Évaluation chez le porcelet de l`effet des probiotiques

Évaluation chez le porcelet de l’effet des probiotiques
Pediococcus acidilactici et Saccharomyces cerevisiae
ssp. boulardii sur le microbiote intestinal et sur les
réponses innées et acquises lors d’une infection à
Salmonella Typhimurium DT104
Mémoire
Jean-Philippe Brousseau
Maîtrise en Microbiologie agroalimentaire
Maître ès sciences (M. Sc.)
Québec, Canada
© Jean-Philippe Brousseau, 2013
Résumé
Les suppléments antibiotiques dans l'alimentation animale sont sévèrement critiqués. Les
probiotiques sont une alternative prometteuse, mais la caractérisation de leurs effets
demeure nécessaire. Ce mémoire décrit l'influence de Pediococcus acidilactici (PA) et
Saccharomyces cerevisiae ssp. boulardii (SCB) sur 1) le microbiote intestinal avant et
après le sevrage et, 2) l'immunité et la colonisation intestinale lors d'une infection à
Salmonella Typhimurium DT104. Nos résultats montrent que suite au sevrage PA module
le microbiote iléal de façon similaire aux antibiotiques tandis que SCB influence le
microbiote colique. De plus, SCB seul ou avec PA module certaines populations de cellules
immunitaires du sang avant et après l'infection à S. Typhimurium. Cependant, aucun effet
n'a été observé sur les autres paramètres évalués. Même si nous approfondissons la
compréhension entourant les effets de PA et SCB sur l'hôte, d'autres études sont nécessaires
pour optimiser l'utilisation des probiotiques comme alternative aux suppléments
d'antibiotiques dans l'élevage.
iii
Abstract
Antibiotics as growth promoters in pig feed are severely criticized. Probiotics are a
promising alternative, but characterization of their effects on the intestinal microbiota and
immunity is still necessary. In this study, the influences of Pediococcus acidilactici (PA)
and Saccharomyces cerevisiae ssp. boulardii (SCB) on 1) intestinal microbiota before and
after weaning and, on 2) immunity and intestinal colonization during a Salmonella
Typhimurium DT104 infection were evaluated. Our results show that following weaning
PA modulated ileal microbiota similarly to in-feed antibiotic while SCB influenced the
colonic microbiota. Moreover, SCB alone or with PA modulate some immune blood cell
populations before and after the S. Typhimurium infection. However, no effects were
observed on the other parameters assessed. Although we deepened the understanding
surrounding the effects of PA and SCB on the host, further studies are needed to fully
optimize the use of probiotics as alternatives to antibiotic supplements in animal husbandry.
v
Table des matières
Résumé ..............................................................................................................................................................iii
Abstract ............................................................................................................................................................... v
Table des matières ............................................................................................................................................ vii
Liste des tableaux .............................................................................................................................................. xi
Liste des figures ...............................................................................................................................................xiii
Liste des abréviations........................................................................................................................................ xv
Remerciements ................................................................................................................................................ xix
Avant-propos ................................................................................................................................................... xxi
Introduction générale .......................................................................................................................................... 1
Revue de la littérature ......................................................................................................................................... 3
1. Le microbiote intestinal du porcelet........................................................................................................... 3
1.1. Établissement et développement du microbiote intestinal porcin ...................................................... 3
1.1.1. La colonisation primaire .................................................................................................................. 3
1.1.2. De la fin de la 1ere semaine au sevrage ............................................................................................ 4
1.1.3. Le sevrage et l’adaptation à l’alimentation solide ........................................................................... 4
1.1.3.1. Le sevrage commercial des porcelets ........................................................................................... 4
1.1.3.2. L’utilisation d’antibiotiques comme facteurs de croissance ......................................................... 5
1.1.4. Perturbation puis stabilisation du microbiote suite au sevrage ........................................................ 6
1.2. Effets bénéfiques du microbiote sur l’hôte ......................................................................................... 8
2. Le système immunitaire intestinal ............................................................................................................ 10
2.1. Développement du système immunitaire intestinal du porcelet ....................................................... 10
2.2. Voies d’entrées et reconnaissance des antigènes intestinaux ........................................................... 11
2.3. Présentation des antigènes et activation des lymphocytes ................................................................ 15
2.3.1. Les lymphocytes T CD4+ et la réponse immunitaire intestinale ................................................... 15
3. Salmonella................................................................................................................................................ 20
3.1. Classification du genre Salmonella .................................................................................................. 20
3.2. Caractéristiques générales des salmonelles ...................................................................................... 20
3.2.1. Salmonella enterica sous-espèce enterica serovar Typhimurium ................................................. 22
3.3. Facteurs de virulence et pathogenèse moléculaire de Salmonella enterica ...................................... 22
3.3.1. Mode d’infection ........................................................................................................................... 22
3.3.2. Facteurs de virulence ..................................................................................................................... 24
3.3.2.1. Système de sécrétion de type III ................................................................................................. 24
3.4. Réponse immunitaire contre Salmonella enterica ............................................................................ 25
3.5. Moyens utilisés pour prévenir les infections à la Salmonella chez le porcelet ................................. 27
3.5.1. Les antibiotiques ........................................................................................................................... 27
3.5.2. La vaccination ............................................................................................................................... 27
3.5.3. Les probiotiques ............................................................................................................................ 28
4. Les probiotiques ....................................................................................................................................... 29
4.1. Définitions et caractéristiques des probiotiques ............................................................................... 29
4.2. Propriétés bénéfiques des probiotiques chez le porc ........................................................................ 29
4.2.1. Effets positifs sur la performance des porcelets ............................................................................ 31
4.2.2. Effets directs sur les microorganismes pathogènes et commensaux ............................................. 31
vii
4.2.2.1. Techniques moléculaires employées pour évaluer l’effet des probiotiques sur le microbiote
intestinal .................................................................................................................................................. 32
4.2.2.1.1. Contraintes des techniques de culture des microorganismes ................................................... 32
4.2.2.1.2. Méthodes moléculaires d’analyse des écosystèmes bactériens ................................................ 33
4.2.2.1.2.1. Le clonage et le séquençage ................................................................................................. 33
4.2.2.1.2.2. L’électrophorèse sur gel en gradient dénaturant ou DGGE .................................................. 34
4.2.2.1.2.3. Le polymorphisme de longueur des fragments terminaux ou T-RFLP ................................. 34
4.2.3. Effets sur la muqueuse et l’épithélium intestinal ........................................................................... 35
4.2.3.1. Effets sur les jonctions serrées et sur la morphologie de la muqueuse ....................................... 35
4.2.3.1.1. Effets sur la perméabilité ......................................................................................................... 35
4.2.3.1.2. Effets sur la morphologie de l’intestin ..................................................................................... 36
4.2.3.2. Effets sur la production de mucines et de défensines ................................................................. 36
4.2.3.3. Effets sur la translocation bactérienne ........................................................................................ 37
4.2.4. Effets sur l’immunité ..................................................................................................................... 39
4.2.4.1. Effet sur l’immunité innée .......................................................................................................... 39
4.2.4.2. Effet sur l’immunité adaptative .................................................................................................. 40
4.3. Pediococcus acidilactici ................................................................................................................... 40
4.4. Saccharomyces cerevisiae ssp. boulardii ......................................................................................... 41
5. Le but, les hypothèses et les objectifs du projet de recherche .................................................................. 42
5.1. But .................................................................................................................................................... 42
5.2. Hypothèses ....................................................................................................................................... 42
5.3. Objectifs ........................................................................................................................................... 42
Chapitre 1 : Analyse par T-RFLP des effets chez le porcelet de Pediococcus acidilactici et
Saccharomyces cerevisiae ssp. boulardii sur le microbiote fécal lors de la lactation et sur le
microbiote fécal, iléal et du côlon suite au sevrage ........................................................................................... 45
Résumé ......................................................................................................................................................... 45
Abstract ........................................................................................................................................................ 47
Introduction .................................................................................................................................................. 47
Materials & methods .................................................................................................................................... 49
Animals and treatments ........................................................................................................................... 49
Sampling of fecal, ileal and colonic samples ........................................................................................... 51
Microbiological analysis of feces and intestinal contents ........................................................................ 51
DNA extraction and PCR conditions ....................................................................................................... 52
T-RFLP .................................................................................................................................................... 53
Data analysis of T-RFLP profiles ............................................................................................................ 53
Clone library construction ....................................................................................................................... 55
DNA sequencing ..................................................................................................................................... 56
Results & discussion..................................................................................................................................... 57
Probiotic effects on fecal microbiota during lactation ............................................................................. 60
Probiotic effects on fecal microbiota one week post-weaning ................................................................ 64
Probiotic effects on ileal microbiota two weeks post-weaning................................................................ 71
Probiotic effects on colonic microbiota two weeks post-weaning ........................................................... 73
Acknowledgments ......................................................................................................................................... 76
Chapitre 2 : Effets de Pediococcus acidilactici et Saccharomyces cerevisiae ssp. boulardii sur
l’immunité intestinale et systémique du porc suite à une infection expérimentale à Salmonella
Typhimurium DT104 ........................................................................................................................................ 77
Résumé ......................................................................................................................................................... 77
Abstract ........................................................................................................................................................ 79
viii
Introduction.................................................................................................................................................. 80
Materials & methods .................................................................................................................................... 81
Animals and treatments ........................................................................................................................... 81
Salmonella Typhimurium strain and experimental challenge ................................................................. 83
Microbiological analysis of intestinal contents and MLN ....................................................................... 83
Measurement of secretory IgA in ileal mucosa ....................................................................................... 84
Isolation of leukocytes from blood and MLN ......................................................................................... 84
Flow Cytometry Analysis ........................................................................................................................ 85
RNA extraction and cDNA synthesis ...................................................................................................... 86
Quantification of cytokine gene expression by real-time PCR................................................................ 87
Statistical analysis ................................................................................................................................... 89
Results .......................................................................................................................................................... 89
Probiotic counts and clinical signs .......................................................................................................... 89
Effect on leukocyte populations .............................................................................................................. 90
Gene expression of cytokines .................................................................................................................. 93
Discussion .................................................................................................................................................... 94
Acknowledgements ..................................................................................................................................... 103
Chapitre 3 : Discussion, perspectives et conclusions ...................................................................................... 105
Références....................................................................................................................................................... 113
ix
Liste des tableaux
Tableau 1. Types bactériens cultivables provenant du tractus gastro-intestinal porcin. ..................................... 7
Tableau 2. Principales lignées phylogénétiques associées aux phylotypes identifiés dans le
tractus gastro-intestinal du porc. ......................................................................................................................... 7
Tableau 3. Caractéristiques des animaux axéniques lorsque comparés aux animaux de la même
espèce possédants un microbiote intestinal typique. ........................................................................................... 9
Tableau 4. Stades de développement du système immunitaire mucosal du porcelet nouveau-né..................... 11
Tableau 5. Ligands des différents récepteurs de type Toll (TLR) présents dans l’intestin. .............................. 14
Tableau 6. Exemples de sérovars de Salmonella enterica; leurs hôtes et leur maladie. ................................... 21
Chapitre 1 : Analyse par T-RFLP des effets chez le porcelet de Pediococcus acidilactici et
Saccharomyces cerevisiae ssp. boulardii sur le microbiote fécal lors de la lactation et sur le
microbiote fécal, iléal et du côlon suite au sevrage
Table 1. Nutrient composition of the weaning diet (d21 to d37). ..................................................................... 51
Table 2. Influence of probiotic treatments on microbial diversity indices in feces of piglets at
day 10 of lactation and one week post weaning (d28) and in the ileum and colon digesta of two
week weaned piglets (d37)1. ............................................................................................................................. 61
Table 3. Relative percentage of each bacterial Phylum identified from T-RFLP fingerprints of
piglets feces during lactation (d10) and one week post-weaning (d28), and of the ileum and
colon contents two weeks post-weaning (d37)1. ............................................................................................... 63
Table 4. Multi-response permutation procedure (MRPP) testing for differences in the
composition of the microbial communities of feces collected during lactation (d10) and one
week post-weaning (d28), and of the ileum and colon contents two weeks post-weaning (d37)1. ................... 68
Table 5. Indicator species analysis (ISA) and phylogenic identification of modulated phylotypes
obtained from T-RFLP fingerprints in piglets feces during lactation (d10) and one week postweaning (d28), and in the ileum and colon digesta two weeks post-weaning (d37)1........................................ 70
Chapitre 2 : Effets de Pediococcus acidilactici et Saccharomyces cerevisiae ssp. boulardii sur
l’immunité intestinale et systémique du porc suite à une infection expérimentale à Salmonella
Typhimurium DT104
Table 1. Nutrient composition of the weaning diet (d21 to d44) ...................................................................... 82
Table 2. Swine-specific antibodies used to characterize different populations of leukocytes
isolated from blood and mesenteric lymph nodes. ............................................................................................ 86
Table 3. List of genes and sequences of the primers used for real-time PCR*. ................................................ 88
Table 4. Influence of probiotic and antibiotic treatments on S. Typhimurium DT104 counts in
intestinal contents and MLN and concentration of IgA in ileal mucosa of pigs1. ............................................. 90
Table 5. Proportion (%) of blood leukocyte populations before (d39) and after S. Typhimurium
challenge (d44) in pigs fed a basal diet (CTRL) or a basal diet supplemented with either
antibiotics (ATB), Pediococcus acidilactici (PA), Saccharomyces cerevisiae subsp. boulardii
(SCB), or PA and SCB (PA+SCB)1. ................................................................................................................. 91
xi
Table 6. Proportion (%) of leukocyte populations in mesenteric lymph nodes after
S. Typhimurium DT104 challenge in pigs fed a basal diet (CTRL) or a basal diet supplemented
with either antibiotics (ATB), Pediococcus acidilactici (PA), Saccharomyces cerevisiae subsp.
boulardii (SCB), or PA and SCB (PA+SCB)1. ................................................................................................. 92
Table 7. Ileum cytokine mRNA relative levels normalized to ACTB in 24 hpc S. Typhimurium
DT104 pigs treated with probiotics or antibiotics1. ........................................................................................... 93
Table 8. Mesenteric lymph node (MLN) cytokine mRNA levels normalized to ACTB in 24 hpc
S. Typhimurium DT104 pigs treated with probiotics or antibiotics1. ................................................................ 94
xii
Liste des figures
Figure 1. Schéma de l’impact du sevrage sur la santé intestinale du porcelet. ................................................... 5
Figure 2. Densité microbienne retrouvée selon les différents compartiments du tractus gastrointestinal porcin exprimée en unité formatrice de colonies par gramme de contenu (UFC/g). ........................... 8
Figure 3. Principales voies d’entrée des antigènes dans le tissu intestinal. ....................................................... 12
Figure 4. Différenciation des cellules T effectrices. ......................................................................................... 16
Figure 5. Réponses immunitaires mucosales typiques engendrées par les pathogènes entériques. .................. 18
Figure 6. Infection par voie orale par les salmonelles....................................................................................... 23
Figure 7. Schéma illustrant les mécanismes potentiels et connus par lesquels les bactéries
probiotiques influencent le microbiote et la santé intestinale en général. ......................................................... 30
Figure 8. Réponses immunitaires mucosales induites par les bactéries probiotiques et
commensales. .................................................................................................................................................... 38
Chapitre 1 : Analyse par T-RFLP des effets chez le porcelet de Pediococcus acidilactici et
Saccharomyces cerevisiae ssp. boulardii sur le microbiote fécal lors de la lactation et sur le
microbiote fécal, iléal et du côlon suite au sevrage
Figure 1. Influence of dietary treatments on densities (Log10 cfu/g sample) of selected bacterial
groups in (a) feces of piglets at day 10 of lactation, (b) in feces one week (d28) post-weaning,
(c) in the ileum and (d) colon contents two weeks post-weaning (d37). ........................................................... 58
Figure 2. NMS triplot representation of T-RFLP fingerprints from the 16S rDNA of the bacterial
community in (a) feces on d10, (b) feces on d28, (c) ileal contents and (d) colon contents from
d37. ................................................................................................................................................................... 65
xiii
Liste des abréviations
ACTB = Beta-actin gene;
ADN = Acide désoxyribonucléique;
ANOVA = Analysis of variance;
ARNr = Acide ribonucléique ribosomal;
ATB = Groupe recevant des antibiotiques dans leur alimentation (groupe de référence), Reference group in
which antibiotics were added to weanling feed;
BAMP = Motif moléculaire associé aux bactéries;
bp = Base pairs;
BSA = Bovine serum albumin;
CARD = Domaine de recrutement et d’activation de caspase, Caspase activation and recruitment domain;
CCAC = Conseil Canadian de protection des animaux, Canadian council on animal care;
CD = Cellules dendritiques;
cDNA = Complementary DNA;
cfu = Colony forming unit;
Ch = Challenge;
CMH = Complexe majeur d'histocompatibilité;
CPA = Cellules présentatrices d’antigène;
CpG = Cytosine polyguanine;
Cq = Quantification cycle;
CT = Threshold cycle;
CTRL = Groupe contrôle, Control group;
DGGE = Électrophorèse sur gel en gradient dénaturant;
DNA = Deoxyribonucleic acid;
DSS = Dioctylsulfosuccinate de sodium;
DT = Type définitif, Definitive type;
ELISA = Enzyme-linked immunosorbent assay;
ETEC = Escherichia coli entérotoxigénique, Enterotoxigenic Escherichia coli;
FAM = Carboxyfluorescein;
FITC = Fluoreccein;
GALT = Tissue lymphoïde associé à l’intestin, Gut-associated lymphoid tissue;
GAPDH = Glyceraldehyde-3-phosphate dehydrogenase gene;
GM = Ganglions mésentériques;
HACCP = Système d'analyse des dangers - points critiques, Hazard Analysis Critical Control Point;
HBSS = Hank’s basal salt solution;
hpc = Hour post-challenge;
IFN-γ = Interféron gamma, Interferon-gamma;
Ig = Immunoglobuline;
IL = Interleukine;
ISA = Indicator species analysis;
IV = Indicator value;
xv
LAMVAB = Lactobacillus Anaerobic MRS with Vancomycin and Bromocresol green;
LB = Luria-Bertani;
LPS = Lipopolysaccharide;
MANOVA = Multivariate analysis of variance;
MiCA = Microbial Community Analysis;
MLN = Mesenteric lymph nodes;
mRNA = Messenger RNA;
MRPP = Multi-Response Permutation Procedure;
NK = Natural killer cell;
NMS = Non-metric Multidimensional Scaling;
NOD = Domaine d’oligomérisation et de liaison des nucléotides, Nucleotide-binding oligomerization domain;
OMS = Organisation mondiale de la santé;
OTU = Operational taxonic units;
PA = Pediococcus acidilactici MA18/5 M;
PAMP = Motif moléculaire associé aux bactéries pathogènes, Pathogen associated molecular pattern;
PBMC = Peripheral blood mononuclear cell;
PBS = Phosphate buffered saline;
PCR = Réaction en chaîne par polymérase, Polymerase chain reaction;
PE = Phycoerythrin;
PMN = Leucocytes polymorphonucléaires;
PPIA = Cyclophilin A gene;
RDML = Real-time PCR data markup language;
rDNA = Ribosomal DNA;
RDP = Ribosomal database project;
RFLP = Restriction fragment length polymorphism;
rfu = Relative fluorescent units;
SCB = Saccharomyces cerevisiae ssp. boulardii CNCM I-1079;
SCV = Vacuole contenant Salmonella, Salmonella containing vacuole;
SEM = Pooled standard error of the mean;
sIgA = Secretory Immunoglobulin A;
SPI = Îlots de pathogénicité Salmonella;
spp = Espèces, species;
ssp = Sous-espèces;
subsp = Sub-species;
SST3 = Système de sécrétion de type III;
ST = Salmonella Typhimurium Dt104;
Tfh = Cellule T effectrice folliculaire;
TG = Target gene;
TGF-β = Facteur de croissance transformant bêta, Transforming growth factor-beta;
Th = Cellule T effectrice;
TLR = Récepteur de type Toll, Toll-like receptor;
TNF-α = Facteur de nécrose tumorale alpha, Tumor necrosis factor-alpha;
xvi
TP = Type phagique;
Treg = Cellule T régulatrice;
T-RF = Terminal restriction fragment;
T-RFLP = Polymorphisme de longueur des fragments terminaux, Terminal restriction fragment length
polymorphism;
TRT = Treatment;
UFC = Unité formatrice de colonies;
USP = United States Pharmacopeia unit;
ZO = Zona occludens;
xvii
Remerciements
Franchir des étapes importantes de notre vie ne s’effectue pas seul, mais nécessite des gens
qui nous aident à passer au travers pour accomplir nos objectifs. J’aimerais remercier les
personnes suivantes et bien d’autres encore :
Pour avoir accepté de me prendre sous sa tutelle, pour ses commentaires éclairants et son
esprit critique, mon directeur de recherche, le Dr Denis Roy;
Pour m’avoir accepté et accompagné pendant toutes ces années, pour son indéfectible
disponibilité, son encadrement et sa confiance, mon codirecteur, le Dr Martin Lessard;
Pour leurs encouragements, leurs grands professionnalismes et leurs toujours judicieux
conseils, mes collègues et amis, Karoline Lauzon et Frédéric Beaudoin;
Pour leur indispensable aide tout au long des analyses, Steve Methot et la Dre Guylaine
Talbot;
Pour leurs travaux acharnés, mes stagiaires, Guillaume Huftier, Guillaume St-Pierre,
David Roy… et les autres qui n’ont été que de passage;
Pour toute l’aide reçu lors des différentes étapes des projets, les indispensables travailleurs
du complexe porcin du CRDBLP et plus particulièrement, Justin, Mélanie, Dominique et
France;
Pour les belles valeurs qu'ils m'ont transmises, leur inconditionnel soutien et leurs
encouragements, mes parents, Louise et Jean;
Et parce que, sans son constant support et son amour ce mémoire aurait été insurmontable,
un merci particulier à ma conjointe Dominic.
xix
Avant-propos
Ce mémoire est présenté sous forme d’articles scientifiques pour soumission à des revues
avec comité de lecture. Afin de respecter les normes de la Faculté des études supérieures,
les sections rédigées en anglais sont précédées d’un résumé en français et les références
bibliographiques des sections sont présentées à la fin du document pour éviter la
redondance. Les tableaux présentés dans les articles sont désignés par l’appellation
« T a b l e » et sont insérés dans le texte tout comme les figures (lorsque présente), pour
faciliter la fluidité de la lecture et la compréhension par le lecteur.
Le manuscrit débute par une courte introduction qui est suivie d’une section, intitulée
« Revue de la littérature ». Cette première section donne une vue d'ensemble des
connaissances actuelles sur le microbiote et le système immunitaire du porcelet; sur
l’importance des infections entériques causées par Salmonella Typhimurium DT104 chez le
porcelet; et, finalement, sur les connaissances entourant les mécanismes d’actions des
probiotiques sur l’hôte. Subséquemment, le but, les hypothèses et les objectifs de recherche
sont posés. Le manuscrit est par la suite divisé en trois chapitres.
Le premier chapitre, intitulé « Analyse par T-RFLP des effets chez le porcelet de
Pediococcus acidilactici et Saccharomyces cerevisiae ssp. boulardii sur le microbiote fécal
lors de la lactation et sur le microbiote fécal, iléal et du côlon suite au sevrage », évalue par
T-RFLP la composition bactérienne du microbiote intestinal de porcelets recevant des
probiotiques, des antibiotiques ou aucun supplément. Les résultats de ce travail seront
soumis au journal Applied and Environmental Microbiology. Pour la réalisation de cet
article scientifique, j’ai mis au point et validé la technique T-RFLP, j’ai participé aux
différents aspects des phases animales, et à la collecte des échantillons. J’ai réalisé presque
entièrement
l’analyse
des
échantillons
et
l’interprété
des
résultats
des
tests
microbiologiques et de T-RFLP. Assisté de David Roy, un stagiaire COOP de l’Université
de Sherbrooke, j’ai mis sur pied une banque de clones du gène de l’ARN ribosomal 16S et
effectué l’analyse et la compilation des résultats de séquençage. Finalement, j’ai conçu les
figures et tableaux, et rédigé le manuscrit. Frédéric Beaudoin a supervisé les phases
animales, participé aux différentes collectes d’échantillon, à la mise au point de la
technique T-RFLP et de la banque de clones, et à l’interprétation des résultats. Karoline
xxi
Lauzon a activement participé aux phases animales, à la collecte d’échantillon, aux
analyses microbiologiques et à la compilation de données. J’ai aussi bénéficié de l’aide
précieuse et des judicieux conseils du Dr Guylaine Talbot pour le traitement et
l’interprétation des résultats obtenus par T-RFLP. Finalement, le Dr Denis Roy a participé à
la conceptualisation du projet de recherche et à l’interprétation des résultats. Toutes ces
personnes ont de plus révisé le manuscrit dont ils sont coauteurs.
Le second chapitre, intitulé « Effets de Pediococcus acidilactici et Saccharomyces
cerevisiae ssp. boulardii sur l’immunité intestinale et systémique du porc suite à une
infection expérimentale à Salmonella Typhimurium DT104 », détermine chez le porc
l’efficacité de traitements probiotiques à prévenir la colonisation de l’intestin par
Salmonella Typhimurium DT104. De plus, cette section caractérise par PCR en temps réel
l’influence des différents traitements probiotiques sur l’expression de gènes du système
immunitaire, et par cytométrie de flux la concentration des différentes populations de
cellules immunes retrouvées dans différents tissus avant et 24 h après l’infection. Les
résultats de ce travail seront soumis au Journal of Animal Science. Pour la réalisation de cet
article scientifique, j’ai participé aux différents aspects des phases animales, à la collecte
des échantillons. J’ai effectué les analyses de cytométrie de flux, la quantification des
anticorps et j’ai assisté Guillaume St-Pierre, stagiaire COOP de l’Université de Sherbrooke,
lors des analyses de PCR en temps réel. Finalement, j’ai fait l’interprétation des résultats,
conçu les figures et tableaux, et rédigé le manuscrit. Frédéric Beaudoin a supervisé les
phases animales, participé aux différentes collectes d’échantillon, à l’analyse de ces
derniers par PCR en temps réel et par cytométrie de flux et, finalement, à la compilation et
à l’interprétation des résultats. Karoline Lauzon a activement participé aux phases
animales, à la collecte d’échantillon, aux analyses par PCR en temps réel et par cytométrie
de flux, et à la compilation des données. Le Dr Ann Lettelier a participé à la
conceptualisation du projet de recherche et aux activités entourant les infections
expérimentales des porcs. Finalement, le Dr Denis Roy a participé à la supervision du
projet de recherche. Les personnes ici mentionnées ont aussi révisé le manuscrit dont ils
sont coauteurs.
Pour ces deux chapitres, le Dr Martin Lessard a supervisé de façon attentive et a participé
activement aux phases animales, aux collectes et aux traitements des échantillons. Il est à
xxii
l’origine de la conceptualisation des projets de recherche et il a contribué à encadrer
l’analyse et l’interprétation des résultats. Il a de surcroît orienté et révisé les manuscrits afin
d’en augmenter la fluidité et la valeur scientifique.
Finalement, le troisième chapitre présente une discussion des résultats les plus importants
de cette étude, les perspectives pour des travaux futurs et une conclusion générale.
xxiii
Introduction générale
La production porcine constitue un levier économique important pour différentes régions
du Québec. Fortement intégrée au milieu rural, elle est aussi, de par son rôle et son
importance, un élément stabilisateur de l’économie régionale. Elle façonne en fait une
chaîne d’activités reliant les consommateurs, les commerçants, les transformateurs et les
producteurs. En 2002, selon le ministère de l’Agriculture, des Pêcheries et de
l’Alimentation du Québec, les recettes de l’industrie porcine, tous secteurs confondus,
étaient de 3,4 milliards de dollars et fournissaient près de 29 000 emplois directs et
indirects. En 2003, l’élevage porcin était la deuxième plus grande industrie bioalimentaire
du Québec après l’élevage laitier.
Chez les éleveurs de porcs, il est reconnu que la période de sevrage (passage de la lactation
(alimentation liquide) à une alimentation solide) est une période très critique pour les
porcelets puisqu’ils sont soumis à plusieurs stress tels, la séparation brusque de leur mère et
du reste de la portée, un changement d’environnement et une modification drastique de
l’alimentation. Cela entraîne un ralentissement de la croissance, une plus grande
susceptibilité aux maladies et une plus grande morbidité (92, 166).
Au Canada, les éleveurs ont recours aux aliments médicamentés contenant des
antibiotiques afin d’améliorer les performances de croissance des porcelets et diminuer les
effets néfastes du sevrage. Cependant, cet usage des antimicrobiens est sévèrement critiqué
dû à la possible acquisition de résistances par les microorganismes pathogènes et par les
bactéries composant la flore commensale (microbiote). Le développement de résistances
aux antimicrobiens constitue un phénomène inquiétant et lourd de conséquences pour le
traitement et la prévention des maladies infectieuses tant chez l’animal que chez l’humain.
Pour empêcher que les producteurs subissent une augmentation du coût de production
causée par une abolition des antibiotiques comme facteurs de croissance, de nouvelles
alternatives plus naturelles doivent être adoptées. Les additifs et les ingrédients susceptibles
de remplacer les antibiotiques sont nombreux, mais pour plusieurs leur efficacité reste à
démontrer.
1
Parmi ces produits, les probiotiques suscitent beaucoup d’intérêt. Le terme « probiotique »
est utilisé pour définir les préparations de microorganismes vivants qui sont ajoutées aux
aliments pour améliorer la santé intestinale de l’hôte en agissant positivement sur la balance
microbienne du tractus gastro-intestinal (273). Bien que plusieurs études suggèrent que les
probiotiques améliorent les performances des porcelets après le sevrage (1, 132, 291), les
mécanismes d’action sont toujours inconnus. Un certain nombre de mécanismes
biologiques plausibles ont été suggérés pour expliquer les effets bénéfiques sur la santé,
cependant les données scientifiques disponibles ne sont pas toujours suffisantes pour les
supporter. Malgré tout, plusieurs études ont démontré que l’ingestion de probiotiques
durant la période néonatale et de sevrage aurait comme effet de promouvoir un meilleur
développement, d’influencer l’activité du microbiote et de stimuler la réponse immunitaire
(1, 56, 132, 172, 176, 278, 281, 291). Plusieurs travaux ont aussi été effectués dans le but
de comprendre et d’expliquer comment les probiotiques influencent le microbiote du
tractus gastro-intestinal (3, 25, 36, 94). Par contre, très peu d’études ont porté leur attention
sur l’impact des probiotiques, premièrement, au niveau de l’établissement du microbiote
intestinal du porcelet, deuxièmement, au niveau de la modulation de cette flore à la suite du
sevrage et troisièmement, au niveau des effets modulatoires des probiotiques sur le système
immunitaire inné et acquis lors d’une infection entérique chez le porcelet sevré.
Le projet vise à évaluer, l’influence d’administrer seul ou en combinaison, deux
probiotiques disponibles commercialement, Pediococcus acidilactici MA18/5 M (PA) et
Saccharomyces cerevisiae ssp. boulardii CNCM I-1079 (SCB), à des truies (fin de gestion
et lactation) et aux porcelets dès la naissance. Le but étant d’améliorer la santé intestinale
des porcelets dès la naissance et d’augmenter leur résistance aux infections en modulant le
microbiote et le système immunitaire des porcelets.
2
Revue de la littérature
1. Le microbiote intestinal du porcelet
1.1. Établissement et développement du microbiote intestinal porcin
L’établissement du microbiote intestinal chez le porcelet est un évènement complexe qui
implique une succession de phases où divers groupes bactériens s’implantent dans le tractus
gastro-intestinal, pour éventuellement devenir à l’âge adulte un écosystème dynamique et
unique à chaque individu (149).
Dans une étude pionnière, Swords et ses collègues (302) ont étudié l’évolution du
microbiote fécal porcin lors des quatre premiers mois de vie. Ils ont conclu que
l’établissement de la flore fécale adulte est un processus complexe qui peut-être divisé en
trois phases marquées par la dominance de différents groupes bactériens. La première phase
correspond à la première semaine de vie, la deuxième correspond aux jours restant de
lactation et la troisième, du sevrage jusqu’à l’adaptation à l’alimentation solide.
1.1.1. La colonisation primaire
À la naissance, le porcelet entre dans un nouveau monde en passant d’un milieu stérile à un
environnement extrêmement contaminé. Le contact avec le vagin, les fèces ainsi que la
peau de la mère débutent la colonisation du tractus gastro-intestinal du porcelet (48). En
fait, ce sont principalement les fèces de cette dernière qui jouent un rôle clé dans
l’établissement et le développement futur du microbiote avec une consommation par les
porcelets allant jusqu’à 85 g par jour selon l’estimation effectuée par Sansom et Gleed
(276).
Les premiers genres bactériens détectés dans le tube digestif des porcelets, trois heures à la
suite de leur naissance, sont à 80% des bactéries aérobies et anaérobies facultatives
provenant de la truie (302). Ces premiers colonisateurs utiliseront l’oxygène rendant ainsi
l’environnement intestinal favorable à la colonisation par les bactéries anaérobies. Un autre
élément qui influence grandement les antigènes qui entrent dans le tube digestif provient du
colostrum ingurgité par les porcelets, qui est riche en immunoglobulines (28).
3
Graduellement, les bactéries aérobies et anaérobies facultatives sont remplacées par des
bactéries anaérobies strictes (302).
À la fin de la première semaine de vie des porcelets, les genres microbiens les plus adaptés
aux nutriments contenus dans le lait, principalement des lactobacilles et des streptocoques,
deviennent les groupes bactériens dominants et le resteront durant toute la durée de la
lactation avec des dénombrements allant de 107-109 unité formatrice de colonies par
gramme (UFC/g) de matière fécale (81, 302).
1.1.2. De la fin de la 1ere semaine au sevrage
Durant la seconde phase, les bactéries anaérobies se diversifient (135) éliminant presque
totalement les bactéries aérotolérantes (302). Habituellement, dans cette phase, des
bactéries des genres Clostridium, Bacteroides, Bifidobacterium, et en plus faible quantité,
Eubacterium, Fusobacterium, Propionibacterium et Streptococcus sont isolées (253, 302).
Ce microbiote, instauré pendant la lactation, demeure relativement stable quant à sa
composition en espèce, et ce, tant que le porcelet se nourrit du lait maternel (325).
1.1.3. Le sevrage et l’adaptation à l’alimentation solide
En Amérique du Nord, les producteurs de porcs effectuent le sevrage des porcelets tôt dans
leur vie, soit habituellement entre deux et trois semaines d’âge, et de façon très brusque. Le
changement d’alimentation provoque d’importantes perturbations au niveau du microbiote
intestinal en diminuant la diversité microbienne (333) avec des changements quantitatifs et
qualitatifs majeurs observés immédiatement à la suite du sevrage (141, 187). Les glucides
devenant la principale source énergétique au lieu des lipides, il est logique que le
microbiote soit grandement affecté.
1.1.3.1. Le sevrage commercial des porcelets
Cette étape dans la vie du porcelet engendre des stress de nature physiologique et
psychologique qui provoquent une diminution de la prise alimentaire (166), d’importantes
modifications structurelles et fonctionnelles au niveau intestinal (122), une perturbation du
microbiote (135) et finalement, une plus grande morbidité et une plus grande susceptibilité
aux infections (92). L’immunité passive due aux anticorps du lait n’étant plus disponible et
4
leur système immunitaire n’étant pas encore mature (11), les porcelets deviennent
effectivement plus vulnérables aux infections entériques. Ces changements au sein de
l’intestin sont aussi responsables de réactions inflammatoires intestinales caractérisées par
une augmentation de l’expression de cytokines pro-inflammatoires (248). Concrètement, le
sevrage provoque un ralentissement de la croissance des porcelets (Figure 1) (191, 192).
Dans l’industrie porcine Nord Américaine, pour atténuer les effets néfastes du sevrage, il
est coutume de supplémenter la moulée avec de faibles doses d’antibiotiques.
Figure 1. Schéma de l’impact du sevrage sur la santé intestinale du porcelet. (Modifié
de Castillo-Gomez, (36))
1.1.3.2. L’utilisation d’antibiotiques comme facteurs de croissance
L’incorporation de faible dose d’antibiotiques dans l’alimentation a démontré, depuis plus
de 50 ans, qu’elle favorise le gain de poids des animaux sevrés et qu’elle vient prévenir,
quoique très faiblement, le développement de bactéries pathogènes (49, 50). Globalement,
5
beaucoup d’arguments étayent l’hypothèse que le microbiote intestinal est impliqué dans
les effets observés (88, 90). Les antibiotiques réduiraient certains effets nutritionnels
négatifs du microbiote sur l’animal tels que la compétition avec l’hôte pour les nutriments
et la production de métabolites microbiens affectant la croissance (259, 275, 331), ce qui
augmente la disponibilité des nutriments et donc l’énergie disponible pour le
développement de l’animal (328). Cet effet d’épargne est particulièrement net pour les
acides aminés, et se traduit par une amélioration de la rétention d’azote (65, 89, 205, 259).
Cependant, l’utilisation souvent injustifiée de certains antibiotiques, pour le traitement des
maladies humaines et animales ou encore en prophylaxie, serait selon la communauté
scientifique, la cause du développement de résistances chez les bactéries. L’utilisation
d’antibiotiques comme facteur de croissance pour les animaux d’élevage est aussi
sévèrement critiquée (295).
1.1.4. Perturbation puis stabilisation du microbiote suite au sevrage
La troisième phase de colonisation du tractus gastro-intestinal du porcelet est directement
liée au sevrage et est caractérisée par une diminution des bactéries anaérobies à Gram
positif au profit d’espèces à Gram négatif du genre Bacteroides (140, 302). Une diminution
des lactobacilles en parallèle avec une augmentation des entérobactéries a aussi été
observée (91, 140, 187, 302). En fait, le sevrage commercial a été associé avec une
diminution d’un facteur 100 du nombre de lactobacilles dans l’intestin et une augmentation
de 50 fois du nombre d’Escherichia coli (133).
Deux à trois semaines à la suite du sevrage, chez les individus en santé, le microbiote se
stabilise et devient caractéristique de chacun (293). Les différents genres et espèces
microbiens cultivables sont présentés dans le tableau 1 (300), tandis que les principales
lignées phylogénétiques, identifiées en séquençant le gène de l’acide ribonucléique
ribosomal (ARNr) 16S, sont présentées dans le tableau 2 (169). Selon l’étude effectuée par
Leser et ses collègues en 2002, 83% des séquences amplifiées correspondent à des genres
ou espèces bactériens inconnus, ces séquences ayant une homologie plus petite que 97%
avec toutes les séquences de microorganismes qui étaient connues à ce jour. Globalement,
deux Phyla prédominent; les Firmicutes et les Bacteroidetes
approximativement 80% des phylotypes identifiés (74, 169, 175)
6
qui regroupent
Tableau 1. Types bactériens cultivables provenant du tractus gastro-intestinal
porcin. (Adapté de Stewart et al. (300))
Bactéries
Tableau 2. Principales lignées phylogénétiques associées aux phylotypes identifiés
dans le tractus gastro-intestinal du porc. (Adapté de Leser et al. (169))
Groupes phylogénétiques a
a
b
Nbr de phylotypes
Homologie (%)b
Groupe phylogénétique selon le Ribosomal Database Project
Homologie moyenne des phylotypes associés au groupe phylogénétique
7
Le long du tube digestif d’un animal adulte, la densité bactérienne augmente pour atteindre
au niveau du côlon une concentration d’environ 1011-1012 UFC/g (Figure 2) (81). On
retrouve plus de 500 différentes espèces bactériennes indigènes dans la portion terminale du
tractus gastro-intestinal d’un porc adulte (326), avec au total approximativement 1014
bactéries, ce qui est dix fois plus élevées que le nombre total de cellules formant l’hôte
(179).
Figure 2. Densité microbienne retrouvée selon les différents compartiments du tractus
gastro-intestinal porcin exprimée en unité formatrice de colonies par gramme de
contenu (UFC/g). (Modifié de Kamel et Gasa (147))
1.2. Effets bénéfiques du microbiote sur l’hôte
L’écosystème du tube digestif des mammifères joue un rôle important pour l’hôte en lui
fournissant des produits essentiels (digestion de nutriments) (346), en diminuant la
susceptibilité aux infections entériques (282), en agissant sur le développement de la paroi
intestinale (43) et du système immunitaire (241) et même en modulant, chez l’hôte,
l’expression de certains gènes (131). Le tractus gastro-intestinal offre des niches stables
pour les bactéries et, en retour, le microbiote influence la physiologie intestinale de l’hôte.
8
La relation entre l’hôte et le microbiote peut donc être caractérisée comme étant du
mutualisme et non du commensalisme (54). Même que selon O’Hara et Shanahan le
microbiote peut être considéré comme un organe à l’intérieur d’un organe (229).
Les effets observés sur l’hôte sont directement liés à la présence de bactéries commensales.
Cette affirmation a été démontrée en comparant des animaux axéniques, animaux accouplés
et gardés dans un environnement stérile, à des animaux de la même espèce élevés de façon
traditionnelle (Tableau 3) (21, 323, 347). Ces effets sont appelés : caractéristiques associées
au microbiote (207). En fait, le microbiote intestinal agit en contribuant au développement
des trois lignes principales de défense; par exemple, les bactéries peuvent entrer en
compétition avec les pathogènes, stimuler la fonction de barrière de l’épithélium et moduler
l’immunité intestinale.
Tableau 3. Caractéristiques des animaux axéniques lorsque comparés aux animaux de
la même espèce possédants un microbiote intestinal typique.
Caractéristiques morphologiques
Augmentation de la taille du ceacum
Diminution de la masse de la paroi intestinale
Diminution de la taille des villi
Diminution de la taille de la lamina propria
Diminution de la taille du foie et du cœur
Caractéristiques physiologiques et biochimiques
Diminution du péristaltisme
Diminution du renouvellement épithéliale
Modification du profil enzymatique de la muqueuse
Augmentation de la concentration en oxygène
Diminution du métabolisme basal
Diminution du volume et du débit sanguin
Diminution de la synthèse de vitamine K et B
Aucune transformation des sels biliaires dans l’intestin
Carence en acide gras à courte chaîne
Caractéristiques immunologiques
Diminution de la taille des ganglions mésentériques et de la rate
Diminution de la taille des plaques de Peyer
Diminution de la concentration d’anticorps dans le sérum
Diminution de la quantité de lymphocytes producteurs d’IgA dans la lamina propria
Diminution de la quantité de lymphocytes T intra épithéliaux
Diminution de la réponse inflammatoire
Retardement de la réponse immunitaire lors d’une infection expérimentale
9
2. Le système immunitaire intestinal
Le but du système immunitaire consiste à reconnaître les molécules et les organismes
étrangers agressifs, d’empêcher leur propagation et finalement de les éliminer. Ce système
est composé de milliards de cellules différentes qui proviennent, à quelques exceptions
près, de la moelle osseuse et qui interagissent pour combattre les infections.
Le système immunitaire intestinal est géré par ce qu’on nomme les tissus lymphoïdes
associés à l’intestin ou GALT (gut-associated lymphoid tissue) qui à son tour fait partie du
système immunitaire mucosal. Ce dernier est en quelque sorte indépendant du système
immunitaire systémique bien que ces deux systèmes utilisent les mêmes acteurs et qu’ils
soient en constante interaction. Cette démarcation vient du fait que le système immunitaire
intestinal a deux fonctions majeures : premièrement, il doit reconnaître et éliminer les
pathogènes et, deuxièmement, il doit établir une tolérance face aux antigènes alimentaires
et aux bactéries commensales. C’est par cette dernière fonction que le GALT se démarque
particulièrement. En tout temps, il doit y avoir un étroit contrôle de la réaction immunitaire
pour prévenir l’inflammation et les allergies alimentaires, sans toutefois empêcher
l’établissement d’une réponse contre les pathogènes et les molécules toxiques. Ce système
est un des plus complexes et des moins bien compris, encore de nos jours, par les
scientifiques.
Les prochaines sections décriront le développement du système immunitaire intestinal chez
le porcelet, les différentes voies d’entrées des antigènes et leur reconnaissance par le
système immunitaire, l’activation des lymphocytes T auxiliaires et B, et finalement les
réponses faces aux pathogènes entériques.
2.1. Développement du système immunitaire intestinal du porcelet
Il y a deux périodes importantes durant lesquelles le jeune animal est exposé à plusieurs
nouveaux antigènes soit; immédiatement après la naissance et suite au sevrage. Lors de ces
deux périodes, les antigènes du contenu intestinal peuvent changer soudainement dû à la
modification de la diète et à l’introduction de nouvelles espèces et souches
bactériennes (12).
10
À la naissance et lors des premières semaines de vie chez les mammifères, le système
immunitaire intestinal est immature. Tel que mentionné précédemment, le porcelet est
immunodéficient durant les 4 à 7 premières semaines de sa vie, mais, lors des deux ou trois
premières semaines, cette déficience est balancée par le colostrum et le lait obtenu de la
mère qui sont riches en plusieurs molécules permettant au nouveau-né de se protéger des
infections (99). On retrouve notamment plusieurs cytokines et immunoglobulines, dont les
IgA et les IgG, ainsi que différents facteurs de croissance qui améliorent le développement
précoce du porcelet. La compétence immunitaire du porcelet se développera
progressivement jusqu’à atteindre sa maturité. Ce processus de développement est séparé
en quatre phases qui furent établies par Bailey et ses collègues (11-13). Ces étapes du
développement sont présentées dans le tableau 4.
Tableau 4. Stades de développement du système immunitaire mucosal du porcelet
nouveau-né.
2.2. Voies d’entrées et reconnaissance des antigènes intestinaux
Les mammifères, au cours de leur évolution, ont développé des portes d’entrée spécifiques
ainsi qu’un mécanisme complexe de reconnaissance des différents antigènes présents dans
la lumière intestinale.
11
Figure 3. Principales voies d’entrée des antigènes dans le tissu intestinal. Les cellules
M captent et transportent activement des antigènes pour les transférer aux cellules
présentatrices d’antigène (CPA), c’est-à-dire aux cellules dendritiques (CD) présentes au
niveau des plaques de Peyer. Les cellules épithéliales peuvent effectuer de l’endocytose,
puis apprêter et présenter les antigènes captés via leurs complexes majeurs
d’histocompatibilité (CMH) de classe I et de classe II aux lymphocytes intraépithéliaux ou
de la lamina propria, ou encore transférer les antigènes apprêtés aux CD de la muqueuse.
Les CD peuvent aussi directement échantillonner les antigènes de la lumière intestinale en
faufilant leurs dendrites entre les cellules épithéliales, et ce, sans perturber l’intégrité de
l’épithélium. (Adapté de Cheroutre et Madakamutil (39))
12
De nos jours, trois routes principales d’entrées des antigènes ont été élucidées. La première
voie d’entrée est formée de cellules spécialisées nommées cellules micropuits ou, de façon
plus courante, cellules M. Ces cellules sont retrouvées au niveau de l’épithélium qui
recouvre les plaques de Peyer et les follicules lymphoïdes. Ces portails stratégiquement
situés permettent un échantillonnage contrôlé des antigènes de la lumière intestinale et une
livraison directe de ces antigènes aux cellules immunitaires localisées dans les plaques de
Peyers, la lamina propria et les organes lymphoïdes sous-jacents (225), ce phénomène est
appelé la transcytose. Les cellules dendritiques (CD), sont des cellules présentatrices
d’antigène (CPA) dites professionnelles, et sont abondantes dans la région basale des
cellules M des plaques de Peyer. Ces CD apprêtent les antigènes captés puis les présentent
aux cellules T pour induire une réponse immune.
Les cellules absorbantes de l’épithélium peuvent aussi participer activement à la réponse
immunitaire (Figure 3). Ces cellules peuvent capter des macromolécules et les présenter,
via le complexe majeur d'histocompatibilité (CMH) de classe I ou de classe II, directement
aux cellules T activées intraépithéliales ou encore transférer l’antigène aux CD immatures
de la lamina propria (39). Ces CPA mobiles vont ensuite passer par une étape de
maturation et migrer vers les ganglions drainants où elles pourront présenter l’antigène aux
cellules T naïves.
Finalement, les CD, équipées de longues dendrites, peuvent échantillonner directement les
antigènes de la lumière intestinale (260). De façon similaire aux cellules absorbantes, les
CD épithéliales produisent des protéines retrouvées au niveau des jonctions serrées qui leur
permettent de former des connexions avec les cellules de l’épithélium conservant ainsi
l’intégrité de la barrière cellulaire de l’épithélium (Figure 3) (260).
Pour reconnaître adéquatement les différents antigènes, deux principales classes de
récepteurs existent chez les mammifères. Les récepteurs de type Toll (TLR) qui sont
principalement retrouvés associés à la membrane cellulaire. Ces récepteurs possèdent un
domaine externe riche en leucine et un domaine intracellulaire qui permet la transduction
du signal d’activation vers l’intérieur de la cellule (304). L’autre type de molécule, nommé,
domaine d’oligomérisation et de liaison des nucléotides ou NOD (nucleotide-binding
oligomerization domain), est retrouvé dans le cytosol des cellules épithéliales et des
13
cellules du système immunitaire. Ces protéines ont aussi un domaine riche en leucine, en
C-terminal, et un domaine CARD (caspase activation and recruitment domain) en Nterminal (134). Récemment, une autre protéine intracellulaire, nommée Ipaf, a été décrite
(86, 204). Cette protéine reconnaît la flagelline cytoplasmique et on la retrouve entre autres
dans les macrophages.
Tableau 5. Ligands des différents récepteurs de type Toll (TLR) présents dans
l’intestin. (Adapté de Uematsu et Akira, (321))
TLR
Ligands
TLR1
Triacyl des lipoprotéines bactériennes
TLR2
Peptidoglycane des bactéries Gram +, lipoprotéines, lipopeptides,
Lipopolysaccharides (LPS) atypiques (bactéries), glycoprotéines virales,
zymosan et phospholipomannane des Fungi
TLR3
ARN double brin d’origine virale ou parasitaire
TLR4
LPS (bactérie), Mannane et glucuronoxylomannane (Fungi),
Glycoinositolphospholipides (protozoaire), glycoprotéines virales
TLR5
Flagelline bactérienne
TLR9
ADN cytosine polyguanine (CpG) non-méthylées
Au niveau de l’intestin, les cellules épithéliales et immunitaires expriment certains TLR
(TLR1, TLR2, TLR3, TLR4, TLR5 et TLR9) et Nod1 et Nod2 (2, 238, 247). Nod1 et Nod2
reconnaissent différents motifs dérivés du peptidoglycane des bactéries (247), ce qui
suggère que ces protéines perçoivent les pathogènes intracellulaires (329). Les TLR, pour
leur part, reconnaissent différentes composantes de bactéries, de virus, de protozoaires et de
champignons (Tableau 5). Lorsqu’un microorganisme pathogène est détecté par les cellules
épithéliales, ces dernières s’activent et libèrent diverses cytokines et chimiokines menant au
recrutement et à l’activation de plusieurs cellules immunitaires, telles que les cellules
dendritiques et les macrophages (265). La liaison d’un motif conservé des bactéries
(BAMP) à un TLR ou Nod engendre une cascade de signalisation qui mène à : la
prolifération des cellules épithéliales, la sécrétion d’IgA, la production de peptides
14
antimicrobiens, la maturation des CD et l’expression de cytokines et de chimiokines,
permettant l’activation des cellules du système immunitaire inné et adaptatif (2, 134, 304).
2.3. Présentation des antigènes et activation des lymphocytes
Les lymphocytes sont les cellules responsables de la réponse immunitaire acquise. Étant
donné qu’il y a deux formes principales de réponse immunitaire, humorale et cellulaire,
deux grands types de cellules lymphocytaires sont requis soit les lymphocytes B et les
lymphocytes T. Les lymphocytes sont principalement retrouvés dans les organes
lymphoïdes, dans le sang et dispersés sous les surfaces mucosales (318).
La production de lymphocytes immatures s’effectue dans la moelle osseuse. Avant de
devenir mature, les lymphocytes doivent franchir plusieurs étapes essentielles qui
s’effectuent principalement dans les tissus lymphoïdes périphériques, tels la rate ou les
ganglions mésentériques, pour les cellules B et dans le thymus pour les cellules T. Ces
étapes de sélection sont essentielles pour empêcher le développement de cellules
autoréactives. Une fois ces étapes effectuées les lymphocytes devront rencontrer leur
antigène spécifique pour devenir des plasmocytes ou des cellules mémoires, dans le cas des
lymphocytes B, et de puissantes cellules T effectrices CD4+ dans le cas des lymphocytes T.
Dans les prochaines sections, les étapes de développement et les diverses propriétés des
lymphocytes T CD4+ ainsi que leurs rôles lors d’une infection entérique seront abordés.
2.3.1. Les lymphocytes T CD4+ et la réponse immunitaire intestinale
Chaque année, les recherches effectuées pour mieux comprendre le système immunitaire
dévoilent des nouvelles sous-populations de cellules et des nouvelles cytokines et
chimiokines. Dans cette section, pour faciliter la compréhension, nous discuterons
seulement les principaux éléments de la réponse immunitaire intestinale.
Au moment où les cellules T CD4+ naïves rencontrent leur antigène spécifique à la surface
d’une CPA, un processus de différenciation s’entame. Selon l’environnement cytokinaire,
les cellules T CD4+ activées peuvent se différencier en différentes sous-classes de cellules
Th (Figure 4). Chaque sous-population possède des fonctions effectrices et migratoires
uniques caractérisées selon : leurs récepteurs de surface pour les chimiokines, les cytokines
15
qu’elles sécrètent et le type de réponse immunitaire qu’elles engendrent (52, 66, 67, 109,
343).
Figure 4. Différenciation des cellules T effectrices. Au moment où les cellules T CD4+
naïves rencontrent leur antigène spécifique, présenté par les cellules présentatrices
d’antigènes professionnels, elles s’activent et se différencient en différentes classes de
cellules T effectrices (Th) (Th1, Th2, Th17, T régulatrice (Treg), Th folliculaire (Tfh))
caractérisées par l’expression de facteurs de transcription spécifiques, leur profil
cytokinaire et leurs fonctions immunorégulatrices. (Adapté de Nurieva et Chung, (228))
En tout temps, les diverses sous-populations de lymphocyte T CD4+ travaillent en étroite
collaboration pour permettre le maintien de l’homéostasie intestinale, mais aussi pour
engendrer une réponse immunitaire adéquate selon le type d’intrus. En temps normal, les
antigènes rencontrés proviennent de l’alimentation ou des bactéries peuplant la lumière
intestinale. En présence de ces antigènes, les lymphocytes T CD4+ se différencient en
cellules Treg qui produisent de l’IL-10 et/ou du TGF-β. Ces deux cytokines sont dites
suppressives ou anti-inflammatoires, car elles génèrent la tolérance face aux bactéries
commensales et aux antigènes alimentaires (85, 244). De plus, ces cytokines provoquent,
chez les lymphocytes B matures, des réarrangements génétiques dans les loci de
16
l’immunoglobuline qui mènent à la production d’IgA (70). Ce type d’anticorps, produit en
grande quantité dans l’intestin, a pour fonction de lier l’antigène avant que celui-ci n’adhère
à la muqueuse intestinale. Un autre type de cellule T régulatrice est principalement retrouvé
au niveau de la lamina propria. Ces cellules sont nommées cellules T γδ et induisent,
lorsqu’injectées à des souris, la tolérance orale face à de nouveaux antigènes (150).
Lorsque des antigènes provenant de bactéries pathogènes sont détectés, une inflammation
locale est induite par les cellules épithéliales et les cellules présentatrices d’antigènes. La
production de cytokines et de chimiokines attire des CPA et d’autres types de cellules
immunitaires au site d’infection (Figure 5). Ces cellules captent les antigènes, se
différencient, puis migrent vers les plaques de Peyer et les ganglions mésentériques. En
fonction du type de pathogènes rencontré et de l’état d’activation des CPA, ces dernières
produiront diverses cytokines (137, 138). Cet environnement influencera les cellules T
CD4+ naïves à se différencier pour ainsi induire une réponse immunitaire efficace contre le
microorganisme envahisseur.
Dans un environnement inflammatoire constitué d’IL-12, de TNF-α et d’IFN-γ, la réponse
immunitaire est de type cellulaire (Th1). Les cellules Th1 sécrètent de l’IFN-γ et de l’IL-2
et s’attaquent principalement aux pathogènes intracellulaires. Par contre, lorsque
l’environnement est principalement constitué d’IL-4 et d’IL-10, la réponse est dirigée vers
la voie Th2. Les cellules de la voie Th2 sécrètent plusieurs cytokines (IL-4, IL-5, IL-6, IL13 et IL-25) qui mènent à l’élimination des pathogènes extracellulaires (85, 213). Cette
réponse induit principalement une immunité de type humorale, caractérisée par la
production d’anticorps de type IgG1/IgE par les plasmocytes (198). Au niveau intestinal, il
est bien connu que l’équilibre entre ces deux voies permet de maintenir l’homéostasie tout
en permettant une réponse appropriée et efficace face aux antigènes étrangers agressifs.
Deux autres sous-populations de cellules T effectrices ont été décrites dans la dernière
décennie, celle des Tfh et des Th17. Les cellules Tfh jouent un rôle majeur dans le
développement des centres germinatifs des organes lymphoïdes secondaires, comme les
plaques de Peyer et les ganglions mésentériques. Ces cellules produisent de l’IL-21 qui
régule directement la prolifération des cellules B ainsi que le réarrangement des gènes
d’immunoglobuline (298). En ce qui concerne les Th17, c’est en présence d’IL-6, cytokine
17
pro-inflammatoire, et le TGF-β, cytokine anti-inflammatoire, qu’elles se différencient (23).
Les cellules Th17 constituent une population distincte de cellules effectrices, avec comme
fonctions principales l'induction de l'inflammation dans les tissus et la protection de l'hôte
contre les pathogènes extracellulaires (24).
Figure 5. Réponses immunitaires mucosales typiques engendrées par les pathogènes
entériques. Lorsque des molécules associées aux bactéries pathogènes (PAMP) sont
détectées par les récepteurs de type Toll (TLR) présents sur les cellules épithéliales et les
macrophages, une inflammation locale est induite. Après avoir capté des antigènes, les
cellules dendritiques (CD) des plaques de Peyer et de la lamina propria vont passer par des
étapes de maturation et de différenciation, puis migrer vers les ganglions mésentériques
(GM) ou les plaque de Peyer. Les CD vont alors produire des cytokines telles que l’IL-12 et
l’IL-4 et interagirent avec les cellules T CD4+ naïves pour les activer et provoquer leur
différenciation en cellules Th1 et Th2. Les principaux récepteurs de chimiokines (CCR6,
CCR7 et CCR9) ainsi que les diverses molécules essentielles à l’activation, la
différenciation et la migration (CD80/CD86, CD40, CD40L, CD28 et CTLA4) sont
représentées dans la figure pour les CD et les cellules CD4+ naïves. (Adapté de Mowat,
(215))
18
En résumé, la conséquence majeure d’une infection intestinale est le développement d’une
réponse inflammatoire. Les cytokines et chimiokines retrouvées lors de cette réponse sont
la clé pour l’induction d’une réponse immunitaire adaptative. Ces protéines stimulent la
différenciation des lymphocytes T CD4+ naïfs qui pourront répondre efficacement à la
menace. Malgré tout, certains pathogènes entériques comme les salmonelles peuvent, grâce
à leurs différents facteurs de virulence, contourner les défenses intestinales et causer une
infection sévère qui peut, dans certains cas, causer la mort de l’hôte.
19
3. Salmonella
Au cours des dernières années, il a été de plus en plus question de la lutte aux salmonelles
dans la filière porcine. Certaines souches de salmonelles peuvent causer des pertes
significatives dans les élevages de porc (retard de croissance, mortalité, etc.). Cependant, la
principale raison pour lutter contre elles tout le long de la filière, vient du fait que les
salmonelles constituent une des principales causes de toxi-infections alimentaires chez
l’humain. Meuniers, producteurs, abattoirs et transformateurs, tous sont concernés par cette
problématique. En fait, elles sont le principal risque biologique associé à la viande de porc,
faisant ainsi l’objet de contrôles dans le cadre du programme gouvernemental d’Analyse
des dangers et maîtrise des points critiques (HACCP, de l’anglais; Hazard Analysis
Critical Control Point).
3.1. Classification du genre Salmonella
Le genre Salmonella est composé de deux espèces, Salmonella bongori et l’espèce type
S. enterica qui est divisée en 6 sous-espèces : enterica (sous-espèce I), arizonae (IIIa),
diarizonae (IIIb), houtenae (IV), indica (VI), et salamae (II) (129, 317). Ces sous-espèces
regroupent plus de 2500 sérovars (113, 115) qui sont sous-divisés selon la structure de leur
flagelle (antigène H), de leurs lipopolysaccharides (LPS) (antigène O) et de leurs
carbohydrates (capsule) (antigène K). En pratique, les différents sérovars sont distingués
selon la variabilité des antigènes O et H.
En plus du sérotypage, d’autres méthodes telles que le lysotypage, le biotypage,
l’antibiorésistance ou l’analyse du profil plasmidique, sont utilisées pour l’identification
des salmonelles lors d’études épidémiologiques (15).
3.2. Caractéristiques générales des salmonelles
Cette bactérie est un bacille Gram négatif anaérobie facultatif appartenant à la famille des
Enterobacteriaceae qui est mobile grâce à ces flagelles péritriches. Elle est intracellulaire
facultative et certains sérovars sont spécifiques à un hôte ou restreints à un petit nombre
d’hôtes (Tableau 6). Parmi celles-ci, certaines peuvent causer des infections autant chez les
animaux que chez l’humain, mais avec des symptômes différents. Par exemple, le sérovar
20
Typhimurium cause une entérocolite chez l’humain et le porc, mais cause une fièvre de
type typhoïdale chez la souris, tandis que le sérovar Choleraesuis cause, lui aussi, une
entérocolite chez l’humain, mais une septicémie chez le porc (17).
Tableau 6. Exemples de sérovars de Salmonella enterica; leurs hôtes et leur maladie.
(Adapté de Haraga et al. (124))
La salmonellose se développe habituellement suite à une ingestion de nourriture ou d’eau
contaminée contenant de 105 à 1010 bactéries avec des symptômes apparaissant
soudainement après environ 6 à 72 heures (55). L’infection se développe principalement au
niveau de l’iléon et plus rarement au niveau du jéjunum, du duodénum et de l’estomac (27,
196). Habituellement, au bout d’environ 4 à 7 jours, les symptômes disparaissent aussi
soudainement qu’ils sont apparus, et ce, sans aucun traitement.
Depuis quelques années, certaines souches de S. enterica sont devenues résistantes aux
antibiotiques traditionnellement utilisés pour traiter la salmonellose. C’est le cas
notamment des souches d’un sérovar qu’on retrouve aux quatre coins du monde :
Salmonella enterica sous-espèce enterica serovar Typhimurium (S. Typhimurium).
21
3.2.1. Salmonella enterica sous-espèce enterica serovar Typhimurium
La salmonellose est considérée comme l’une des plus importantes zoonoses d’origine
alimentaire. S. Typhimurium est parmi les sérovars les plus répandus à travers le monde, ce
qui en fait une préoccupation majeure pour la santé publique et animale. Une souche en
particulier est, depuis plusieurs années, couramment isolée lors d’épisodes de salmonellose
d’origine alimentaire. Il s’agit du type phagique (TP) ou type définitif (DT) 104 de
S. Typhimurium (314). Les souches isolées autant chez le porc que chez l’humain sont
fréquemment résistantes à l’ampicilline, le chloramphénicol, la streptomycine, les
sulfonamides et la tétracycline (249). Cette bactérie peut aussi acquérir d’autres résistances,
comme c’est le cas pour certains isolats qui sont non seulement résistants aux antibiotiques
mentionnés précédemment, mais aussi à la triméthoprime et/ou à la ciprofloxacine et/ou
aux fluoroquinolones (antibiotiques utilisés en première instance pour traiter les
complications intestinales et extra intestinales graves de la salmonellose chez l'Homme)
(315, 316). Il n’est donc pas étonnant que S. Typhimurium DT104 soit une préoccupation
majeure pour la santé publique de plusieurs pays dans le monde, dont le Canada.
3.3. Facteurs de virulence et pathogenèse moléculaire de Salmonella enterica
3.3.1. Mode d’infection
Typiquement, il existe 3 modes de transmission de la salmonelle; par contact direct avec un
humain ou un animal infecté, par contact indirect c’est-à-dire via l’environnement ou la
nourriture contaminée et finalement, par contact avec un vecteur, qui propage l’agent
pathogène d’animal en animal ou de l’animal à l’Homme (301). Le plus couramment, la
contamination s’effectue par voie orale (Figure 6). Bien que le passage dans l’estomac
diminue à ≈1% la quantité ingérée de bactéries vivantes (32), les salmonelles peuvent
s’adapter aux conditions acides de l’estomac et ainsi augmenter leur chance de survie (96).
Une fois cet obstacle franchi, les salmonelles se rendent à l’iléon où elles traversent la
couche de mucus pour atteindre le feuillet de cellules épithéliales, tout en évitant d’être
éliminées par les enzymes digestives, les sels biliaires, les IgA sécrétoires et les peptides
antimicrobiens composant la barrière mucosale (206, 251, 280). Une fois adhéré aux
cellules de la paroi intestinale, grâce à diverses adhésines, les salmonelles ont la capacité
d’induire leur endocytose par les cellules épithéliales. Cette bactérie perturbe la bordure en
22
brosse des entérocytes et provoque un repliement de la membrane cellulaire qui permet
l’engouffrement de la bactérie (18, 305). En fait, les salmonelles pénètrent l’épithélium
préférentiellement via les cellules M qui les transportent directement aux cellules
immunitaires des plaques de Peyer (144).
Figure 6. Infection par voie orale par les salmonelles. Autant chez l’homme que chez le
porc, suite à l’ingestion d’eau ou d’aliments contaminés, les salmonelles qui survivent au
pH acide de l’estomac et qui évitent les multiples défenses du petit intestin vont se diriger
vers l’épithélium. Ce pathogène, pénètre préférentiellement les cellules M qui les
transportent directement vers les cellules immunitaires. Les salmonelles induisent alors une
inflammation locale qui attire au site et dans la lumière intestinale, des PMN (leucocytes
polymorphonucléaires), ce qui engendre une diarrhée. Certaines salmonelles peuvent aussi
survivre à l’intérieur des macrophages et ainsi permettre la propagation de l’infection vers
d’autres organes tels que les ganglions mésentériques (GM), le foie et la rate. (Adapté de
Haraga et al. (124))
23
Ce pathogène peut déstabiliser les jonctions serrées entre les cellules épithéliales (142). De
plus, les bactéries provoquent une réponse inflammatoire localisée qui induit l’infiltration
de leucocytes polymorphonucléaires (PMN) au site d’inflammation et dans la lumière
intestinale (190). Cette perturbation de l’intégrité de l’épithélium et l’état inflammatoire
provoqué par les salmonelles contribuent de façon importante à l’induction de la diarrhée.
3.3.2. Facteurs de virulence
Chez les bactéries, les facteurs de virulence sont définis comme étant des gènes qui leur
permettent de survivre et de se multiplier dans différents micrœnvironnements (hôte) à
mesure que l’infection progresse. Chez S. Typhimurium, au moins 80 gènes de virulence
différents ont été identifiés. La majorité de ces gènes sont regroupés en régions distinctes
sur le chromosome et ces régions sont appelées îlots de pathogénicité Salmonella (SPI).
Jusqu’à présent, cinq SPI ont été identifiés (SPI 1 à SPI 5). Selon toute vraisemblance,
l’acquisition du SPI 1 permet la pénétration de l’épithélium tandis que les SPI 2 à 4
faciliteraient l’invasion et la survie de la bactérie à l’intérieur des macrophages (185). En
plus des SPI, plusieurs plus petits regroupements de gènes de virulence ont été caractérisés
(185).
3.3.2.1. Système de sécrétion de type III
Les salmonelles, une fois fermement adhérées aux cellules M, vont stimuler leur
internalisation en se servant de leur système de sécrétion de type III (SST3). Ce complexe
protéique, dont la forme s’apparente à une aiguille, permet le transfert de protéines de
virulence, communément appelées effecteurs, de la cellule bactérienne au cytoplasme de la
cellule cible (123). Une fois dans la cellule hôte, ces effecteurs perturbent plusieurs
fonctions cellulaires, telles que le cytosquelette, les jonctions serrées, le trafic membranaire,
la transduction des signaux et l’expression de cytokine; dans le but de favoriser la survie et
la colonisation bactérienne (124).
Le SST3 s’apparente au système flagellaire et est retrouvé dans une grande variété de
pathogènes Gram négatif animaux et végétaux. Ce complexe protéique est divisé en deux
parties : 1) une base, constituée de multiples anneaux bien ancrés dans la membrane interne
24
et externe de l’enveloppe bactérienne et 2) une aiguille qui interagira avec l’hôte, le tout lié
par un canal interne (152, 161).
Les salmonelles sont capables d’infecter et de se répliquer dans plusieurs types cellulaires,
mais il semblerait qu’elles affectionnent particulièrement les macrophages (264). Ce type
bactérien réside à l’intérieur des macrophages dans des vacuoles membranaires appelées
vacuoles contenant Salmonella (SCV). Pour empêcher d’être dégradées, les bactéries
inhibent la maturation des phagosomes en phagolysosomes (95).
Le SPI 3 et SPI 4 auraient un rôle à jouer dans la survie des Salmonella dans le macrophage
(185). Cependant, c’est le SPI 2 qui est essentiel pour permettre la croissance intracellulaire
et assurer la survie (77).
Cette faculté de survivre et de se répliquer dans les macrophages permet à S. Typhimurium
d’être transportée des tissus lymphoïdes associés à l’intestin vers les ganglions
mésentériques, le foie et la rate, en demeurant invisible aux yeux du système immunitaire.
Chez la souris, les souches de Salmonella qui ne peuvent survivre dans les macrophages ont
une virulence atténuée et ne sont pas retrouvées dans d’autres organes, démontrant ainsi
l’importance des macrophages dans la dissémination de l’infection (231). De plus, suite à la
migration des macrophages dans d’autres organes du corps, les salmonelles peuvent se
disperser dans les cellules adjacentes (84). Une fois dans les organes, S. Typhimurium peut
s’y établir et persister de quelques mois à plusieurs années. À ce stade de l’infection, l’hôte
devient asymptomatique et est qualifié de porteur sain. Cependant, dans certaines
conditions, les bactéries reviennent à l’intestin pour être excrétées, ce qui permet leur
dissémination dans l’environnement et donc l’opportunité d’infecter un nouvel hôte.
3.4. Réponse immunitaire contre Salmonella enterica
L’invasion initiale des cellules de l’épithélium induit une réponse inflammatoire massive,
caractérisée par une augmentation de l’expression de plusieurs cytokines et chimiokines.
Ces molécules vont permettre le recrutement de neutrophiles, de monocytes, de
macrophages et de cellules dendritiques immatures au site d’infection (120, 272). Ces
cellules vont reconnaître via leurs TLR (TLR4 et TLR5, particulièrement), leurs Nod ou
Ipaf, des motifs associés aux bactéries, tels le LPS et la flagelline (16, 299).
25
Les macrophages étant la cible préférentielle des salmonelles, ce type cellulaire devient le
premier à détecter la présence de bactéries dans l’hôte et à envoyer des signaux cytokinaires
aux cellules de son entourage pouvant contribuer à l’activation des défenses de l’hôte. Les
cellules dendritiques immatures localisées et recrutées au site vont aussi détecter la
présence des salmonelles. Cette reconnaissance du pathogène va engendrer leur activation
et leur maturation, provoquant l’augmentation à leur surface du CMH de classe II et des
molécules de co-stimulation (200), se préparant ainsi à l’activation de lymphocytes T CD4+
naïfs et donc à la montée d’une réponse immunitaire adaptative. Les CD peuvent activer les
lymphocytes T directement au niveau des plaques de Peyer, après environ 3 à 6 heures
d’infection, et/ou migrer vers les GM pour permettre l’activation des cellules T CD4+
spécifiques aux antigènes de Salmonella, et ce, environ 3 heures plus tard qu’au niveau des
plaques de Peyer (199).
Pour que le système immunitaire combatte efficacement les salmonelles, une réponse de
type Th1 doit être préférentiellement activée (209). Mutotiala et Makela ont démontré que
l’IFN-γ est importante dans le contrôle de la prolifération bactérienne lors des premières
phases de l’infection, mais insuffisante pour l’éradication des bactéries (217, 218). Tandis
que l’IL-4, cytokine anti-inflammatoire caractéristique des cellules Th2, favorise le
développement de l’infection (80).
Dans les études d’infection expérimentale avec S. Typhimurium chez la souris, un rôle de
protection contre l’infection a été démontré pour plusieurs cytokines, telles que le TNFα,
l’IFN-γ, l’IL-1, l’IL-12, l’IL-18 et l’IL-15, tandis que la présence d’IL-4 et d’IL-10 favorise
l’infection et aggrave les symptômes de la maladie (76). Les résultats obtenus avec des
lignées cellulaires d’origine porcine ou lors d’infection expérimentale de porcelets avec
S Typhimurium ont confirmé les résultats obtenus avec le modèle murin (7, 45, 203, 297,
320, 324). Fait intéressant, différentes études in vivo et in vitro ont démontré que le profil
d’expression de diverses cytokines lors de l’infection variait dépendamment du site
intestinal évalué (jéjunum, iléon ou côlon) (7, 45). Ces études montrent donc, qu’il existe
une variabilité dans la réponse immunitaire innée contre les pathogènes selon les régions de
l’intestin de l’hôte et que la création au point d’infection d’un environnement cytokinaire
adéquat est indispensable pour permettre à l’hôte de contenir et d’éliminer efficacement le
pathogène.
26
3.5. Moyens utilisés pour prévenir les infections à la Salmonella chez le porcelet
Pour limiter le nombre de porcs infectés, et ainsi diminuer les probabilités de contamination
de la viande à l’abattoir, différentes stratégies sont utilisées et testées lors de l’élevage des
animaux. Certaines approches ciblant directement les pathogènes ou renforçant le
microbiote intestinal ont montré leur potentiel.
3.5.1. Les antibiotiques
Les antibiotiques utilisés en médecine humaine et animale ont été suggérés comme
méthodes potentielles pour réduire les pathogènes, comme la Salmonella. Cependant, cette
pratique est activement déconseillée due aux craintes associées au développement de
résistances aux antibiotiques, spécialement chez les Salmonella spp.
Une des principales causes de persistance de la Salmonella dans les troupeaux porcins est la
présence de porteurs sains qui peuvent excréter de façon intermittente des niveaux élevés
de la bactérie. Lors d’infection aiguë, un porc peut excréter jusqu’à 10 millions de
Salmonella par gramme de fèces. L’utilisation prudente d’antibiotiques approuvés est
prescrite pour les animaux malades ou lors de l’éclosion de l’infection dans un troupeau.
Cependant, il est fortement recommandé d’utiliser les antibiotiques en combinaison avec
des pratiques opérationnelles strictes pour augmenter l’efficacité du traitement (235).
3.5.2. La vaccination
En ce moment, la vaccination porcine contre la salmonelle diminue faiblement l’incidence
de la maladie et semble être efficace seulement en combinaison avec la mise en place de
mesures opérationnelles adéquates dans la ferme. Les vaccins conçus avec des bactéries
vivantes semblent offrir la meilleure protection contre les infections à Salmonella
comparativement aux vaccins contenants des bactéries inactivées (117). Les vaccins
contenant des bactéries vivantes montrent une activation de la réponse cellulaire et une
induction de la production d’IgA spécifique contre le pathogène (127).
L’administration à des porcs par voie orale d’un vaccin atténué composé d’un mutant
métabolique de S. Typhimurium a permis de réduire de façon significative la colonisation
de l’intestin lors d’infection expérimentale avec des souches homologues (269). De plus,
l’administration d’un vaccin atténué contre Salmonella enterica sous-espèce enterica
27
serovar choleraesuis à des porcs, suite au sevrage, permet de diminuer la quantité de
S. Typhimurium dans l’iléon et dans les ganglions mésentériques en plus d’augmenter la
production d’IgA (173, 174).
Bien que la vaccination ne permette pas encore la prévention complète des infections à
Salmonella, un programme d’immunisation devrait être établi et introduit chez les
producteurs de porcs. La vaccination des truies augmente la quantité d’anticorps contre le
pathogène dans le lait maternel ce qui augmente la protection des porcelets contre la
maladie (160). Cette pratique pourrait donc avoir une incidence dans la prévention des
infections à Salmonella, mais des études plus approfondies sont nécessaires.
3.5.3. Les probiotiques
À l’instar des bactéries indigènes utilisées pour l’exclusion compétitive, les probiotiques
sont généralement des espèces uniques ou des cocktails de bactéries lactiques ou de levures
qui ne sont pas nécessairement originaires de l’animal cible (340). Les probiotiques
facilitent la croissance du microbiote normal de l’intestin ce qui aide à l’exclusion sélective
de certains pathogènes tels qu’E. coli, Salmonella, Campylobacter et Listeria (103).
Une étude a montré qu’E. coli Nissle 1917, une bactérie non pathogène, inhibe l’invasion
des cellules épithéliales intestinales INT407 par plusieurs pathogènes entérique dont
Salmonella (5). Dans une autre étude, 11 souches de bactéries lactiques provenant de
l’intestin porcin ont été évaluées in vitro pour leur capacité à inhiber/éliminer
S. Typhimurium. Les bactéries lactiques testées empêchaient la croissance et l’invasion du
pathogène lorsque mises en contact avec des cellules épithéliales intestinales HT-29 (33).
De plus, une autre étude menée par le même groupe de recherche a démontré qu’une
combinaison de cinq souches de probiotiques composés de Lactobacillus et de
Pediococcus, réduisait l’incidence, la sévérité et la durée des diarrhées de porcs infectés
expérimentalement avec S. Typhimurium (34).
28
4. Les probiotiques
4.1. Définitions et caractéristiques des probiotiques
Le terme « probiotique » est utilisé pour définir les préparations de microorganismes
vivants qui sont ajoutés aux aliments pour améliorer la santé intestinale de l’hôte en
agissant positivement sur la balance microbienne du tractus gastro-intestinal (273). En fait,
les probiotiques sont utilisés depuis aussi longtemps que l’Homme consomme des aliments
fermentés. Au début du vingtième siècle, l’immunologiste russe Elie Metchnikoff suggéra
que les lactobacilles ingérés via le yogourt auraient un effet positif sur le microbiote du
tractus gastro-intestinal (202). Selon l’Organisation mondiale de la santé (OMS), les
probiotiques sont des microorganismes vivants qui, lorsqu’ingérés en quantité suffisante,
confèrent des effets bénéfiques chez l’hôte. Des études in vivo et in vitro doivent démontrer
sans aucun doute les effets bénéfiques pour l’hôte. De plus, le microorganisme doit être très
bien caractérisé autant sur le plan phylogénétique que biochimique.
Pour bénéficier pleinement des effets positifs des probiotiques sur la santé, il est important
de les consommer quotidiennement, car, malgré le fait que certaines souches probiotiques
adhèrent et colonisent l’intestin, elles y demeurent de façon transitoire et après une période
variable selon les individus, les probiotiques sont lessivés et ne sont plus détectables dans
les fèces des humains ou des animaux traités (14, 308). Actuellement, plusieurs études
utilisent une dose de 109 bactéries probiotiques viables, administrées oralement et de façon
quotidienne. Les probiotiques sont habituellement ajoutés directement dans l’alimentation
des animaux, principalement sous la forme de pastille, à des concentrations de 108 à 109
UFC/kg d’aliment (291).
4.2. Propriétés bénéfiques des probiotiques chez le porc
Le grand potentiel des probiotiques à remplacer les antibiotiques dans l’alimentation
porcine est bien connu, cependant la caractérisation des modes d’action propre à chaque
souche utilisée et l’applicabilité de cette stratégie doivent être démontrées par des études in
vivo concrètes et précises. En fait, plusieurs études ont déjà démontré l’efficacité de ceux-ci
sur la santé générale des porcelets et chez d’autres espèces animales (53, 168, 311).
29
Cependant, il faut être conscient que les effets bénéfiques sur l’hôte peuvent différer d’une
espèce voire d’une souche bactérienne à une autre et selon la concentration administrée
(283).
Jusqu’à présent, les différentes études ont démontré que les probiotiques ont des effets
positifs sur la croissance et le gain de poids des porcelets, sur le microbiote intestinal, sur
l’exclusion de pathogènes (exclusion compétitive), sur le système immunitaire et sur la
perméabilité de la paroi intestinale. La figure 7 présente les mécanismes potentiels et
connus des probiotiques sur la santé intestinale.
Figure 7. Schéma illustrant les mécanismes potentiels et connus par lesquels les
bactéries probiotiques influencent le microbiote et la santé intestinale en général.
Correspondance des abréviations : T, lymphocyte T; B, lymphocyte B; CD, cellule
dendritique. (Adapté de O’Toole et Cooney (230) ; et de Wealleans et Litten-Brown (336))
30
4.2.1. Effets positifs sur la performance des porcelets
Plusieurs études ont montré que les probiotiques améliorent la croissance et le gain de
poids des porcelets suite au sevrage. Cependant, certains résultats sont contradictoires et les
effets sont variables en fonction de la souche ou de la combinaison de bactéries
probiotiques utilisée. Dans une des premières études à avoir été réalisée, l’administration
quotidienne par voie orale d’une préparation composée de Lactobacillus delbrueckii ssp.
bulgaricus, Lactobacillus casei et Streptococcus thermophilus, a permis d’améliorer la
croissance et la prise alimentaire de porcelets sevrés (170). D’autres études ont aussi obtenu
des effets positifs sur les performances des animaux, en plus de noter une amélioration de
la qualité des carcasses et donc de la viande (4, 34, 38, 162).
Les genres bactériens ayant démontré le plus d’effets significatifs sont : Bacillus (57, 310),
Bifidobacterium (288), Enterococcus (351), Lactobacillus (102, 348), et les levures de
l’espèce Saccharomyces cerevisiae (22). Lorsque les antibiotiques utilisés comme facteur
de croissance sont retirés de l’alimentation, le taux de croissance des porcs chute d’environ
8% (339), cependant ces microorganismes ont montré un fort potentiel à renverser cette
diminution.
Malgré tout, des résultats contradictoires sont parfois obtenus en fonction des conditions
expérimentales utilisées. C’est le cas par exemple avec Enterococcus faecium NCIMB
10415 qui augmente le gain de poids quotidien moyen des porcelets, lorsqu’administré sous
forme d’additif liquide deux fois par jour (351), mais qui n’a aucun effet, lorsqu’administré
en supplément via l’alimentation une fois par jour (309). Il semble donc qu’il y ait une
variation dans les résultats obtenus en fonction du mode d’administration ainsi que de la
fréquence de celle-ci, et ce, malgré l’utilisation d’une souche identique de probiotique.
4.2.2. Effets directs sur les microorganismes pathogènes et commensaux
L’interaction des probiotiques avec l’épithélium intestinal est essentielle pour bloquer
l’adhésion des pathogènes, plusieurs études ayant démontré ce mécanisme d’action sont
décrites dans la littérature. Lactobacillus reuteri (257), Lactobacillus acidophilus (118),
Lactobacillus rhamnossus
GG
(78),
Lactobacillus
delbrueckii
ssp.
bulgaricus,
Saccharomyces cerevisiae ssp. boulardii et certaines espèces d’Enterococcus (240)
possèdent tous la propriété d’adhérer fermement aux cellules de l’épithélium. Cette
31
caractéristique signifie donc que les probiotiques sont en compétition avec les pathogènes
pour les récepteurs d’adhésion disponibles. Par exemple, Collado et al. (46) ont montré que
Bifidobacterium animalis ssp. lactis et L. rhamnosus GG réduisent l’adhésion de
Salmonella, Clostridium et des E. coli pathogènes à du mucus prélevé de différentes
régions de l’intestin de porcs.
Les probiotiques peuvent aussi inhiber la croissance et l’adhésion des pathogènes via la
production de produits possédant une activité antimicrobienne. C’est le cas notamment
pour Lactobacillus crispatus JCM 8779 qui inhibe l’adhésion d’Enterococcus faecalis par
sa sécrétion d’un produit antimicrobien non caractérisé (319) et de Lactobacillus salivarius
UCC118 qui permet l’inhibition d’un large éventail de genres bactériens pathogènes tels
que, Bacillus, Staphylococcus, Enterococcus, Listeria et Salmonella, grâce à la production
de la bactériocine ABP-118 (83).
Des études menées chez le porcelet ont aussi permis de démontrer que les probiotiques
modulent le microbiote intestinal. En guise d’exemple, il fut observé que l’administration
du probiotique Pediococcus acidilactici MA 18/5 M, diminue la diversité microbienne au
niveau du côlon des porcelets en post-sevrage comparativement aux porcelets non traités
(94), tandis qu’une autre étude a établi que l’administration de probiotiques diminuait le
nombre d’E. coli et augmentait les bifidobactéries dans l’intestin de porcelets en lactation
(287).
4.2.2.1. Techniques moléculaires employées pour évaluer l’effet des probiotiques sur le
microbiote intestinal
L’étude microbiologique des écosystèmes a subi un profond changement dans les dernières
décennies avec le développement de nouvelles méthodes permettant l’analyse des
communautés bactériennes. Les microbiologistes sont passés de la culture des
microorganismes sur milieux gélosés à des techniques d’analyse moléculaire.
4.2.2.1.1. Contraintes des techniques de culture des microorganismes
La grande majorité des microorganismes composant un écosystème sont non
cultivables (6). Malgré que la culture des microorganismes sur milieux sélectifs soit
indispensable
32
dans
l’approfondissement
de
nos
connaissances
sur
certains
microorganismes, le problème de l’utilisation de cette technique pour l’analyse des
communautés vient du fait qu’un milieu artificiel permet la croissance d’une petite fraction
de l’ensemble des microorganismes présents. En raison de cette contrainte intrinsèque, la
richesse et la diversité obtenues par culture ne représentent pas avec précision la réalité de
l’écosystème (6, 335).
4.2.2.1.2. Méthodes moléculaires d’analyse des écosystèmes bactériens
Les méthodes moléculaires employées de nos jours utilisent l’ADN pour caractériser une
communauté bactérienne. La cible préférentielle lors d’étude de diversité microbienne est le
gène codant pour l’ARN ribosomal (ARNr) 16S (242). Ce gène est hautement conservé
chez les procaryotes, cependant il contient certaines régions variables. Les régions
conservées de ce gène entre les microorganismes servent de site de liaison à des amorces,
dites amorces universelles, qui elles permettent l’amplification par PCR (Polymerase chain
reaction) des régions variables. Les produits PCR obtenus peuvent alors être clonés et
séquencés ou être soumis à différentes méthodes génétiques de profilage (227, 307) tels
l’électrophorèse sur gel en gradient dénaturant ou DGGE (denaturing gradient gel
electrophoresis) et le polymorphisme de longueur des fragments terminaux ou T-RFLP
(terminal restriction fragment length polymorphism). Ces techniques permettent de
comparer différentes communautés bactériennes entre elles pour évaluer l’effet des
modifications apportées aux paramètres environnementaux étudiés (169, 252, 293).
Ces méthodes passent toutes par une étape d’extraction d’ADN total optimisée selon le type
d’échantillon à analyser (233). L’ADN ainsi extrait est utilisé pour effectuer l’amplification
par PCR de la région ciblée par les amorces universelles. C’est par la suite que les
différentes techniques d’analyse se différencient les unes des autres dépendamment de la
façon dont les produits PCR sont traités et analysés.
4.2.2.1.2.1. Le clonage et le séquençage
Tout d’abord, le clonage des produits PCR est la première étape pour l’identification
subséquente du genre ou de l’espèce bactérienne par séquençage. Les régions variables du
gène de l’ARNr 16S sont utilisées pour la classification des microorganismes selon leur
appartenance phylogénétique (Domaine, Phylum, Ordre, Famille, Genre, ...), c'est-à-dire
33
que plus les régions variables entre les microorganismes sont identiques, plus les
probabilités que ces microorganismes appartiennent au même genre microbien sont fortes
(345). Le séquençage complet du fragment d’ADN cloné permet l’identification
phylogénétique de la bactérie par comparaison avec les séquences de microorganismes
connus disponibles dans les banques de données publiques, par exemple PubMed ou
Ribosomal Database Project II (RDPII). L’analyse de banques de clones par séquençage a
permis d’obtenir une foule de renseignements sur la diversité des procaryotes présents dans
un environnement tel que le tractus gastro-intestinal porcin (169, 252).
4.2.2.1.2.2. L’électrophorèse sur gel en gradient dénaturant ou DGGE
L’analyse des communautés bactériennes par DGGE est basée sur l’électrophorèse des
produits PCR dans un gel de polyacrylamide contenant un gradient linéaire croissant d’un
agent dénaturant (formamide et urée) (219). Les fragments d’ADN amplifiés étant
fréquemment de longueur similaire, la différentiation entre les microorganismes présents
dans l’échantillon s’effectue en fonction des variations dans la séquence d’ADN. Au fur et
à mesure que les brins d’ADN progressent dans le gel, les conditions de dénaturation
deviennent de plus en plus fortes. En fonction de la longueur du fragment, de sa
composition en GC et de sa composition en nucléotides, les conditions provoquent la
séparation des deux brins d’ADN cessant ainsi la migration de celui-ci dans le gel.
Techniquement, plus la stabilité intrinsèque du fragment d’ADN est grande, plus les
conditions dénaturantes doivent être élevées pour provoquer la séparation des deux brins.
Cette technologie a abondamment été employée en microbiologie environnementale pour
étudier la modulation de la diversité et de l’abondance relative des populations bactériennes
présentes dans un écosystème complexe, comme celui du microbiote porcin (157, 293,
294).
4.2.2.1.2.3. Le polymorphisme de longueur des fragments terminaux ou T-RFLP
La technique T-RFLP utilise la puissante technologie du séquençage pour évaluer la
composition en microorganisme d’un environnement complexe. Le gène ciblé est amplifié
par PCR tout comme pour les autres techniques décrites, cependant une molécule
fluorescente est attachée à l’extrémité 5’ d’une des amorces produisant ainsi des produits
PCR marqués (8, 42). Les produits PCR obtenus sont par la suite soumis à une ou des
34
enzymes de restriction. En fonction de la présence ou non des sites de reconnaissances de
l’enzyme de restriction, les fragments obtenus sont de longueur variable selon les différents
microorganismes. Par la suite, les produits de digestions sont séparés dans un gel de
séquençage en acrylamide ou par un séquenceur capillaire. Ainsi seulement les fragments
terminaux marqués sont détectés par un laser pour obtenir un électropherogramme
représentant les populations bactériennes présentent dans l’échantillon. La technique TRFLP a prouvé être une technique de profilage très pratique lors de l’évaluation de la
composition du microbiote du tractus gastro-intestinal (148, 169, 220).
4.2.3. Effets sur la muqueuse et l’épithélium intestinal
Pour se protéger des réactions inflammatoires incontrôlées, l’épithélium intestinal a
développé des mécanismes qui permettent de restreindre la croissance bactérienne, de
limiter les contacts directs avec les bactéries, et ainsi prévenir leur dissémination dans les
tissus sous-jacents. La barrière épithéliale est composée d’une couche de mucus, de
peptides antimicrobiens, d’IgA sécrétoire et des jonctions serrées liant étroitement les
cellules de l’épithélium entre elles (197). La consommation de bactéries probiotiques peut
contribuer à améliorer les fonctions de barrière de l’épithélium.
4.2.3.1. Effets sur les jonctions serrées et sur la morphologie de la muqueuse
Plusieurs études in vitro et in vivo ont fait la démonstration de l’efficacité de certaines
souches probiotiques à interagir avec l’épithélium, à modifier sa perméabilité et même sa
morphologie.
4.2.3.1.1. Effets sur la perméabilité
Il a été observé qu’un prétraitement avec des bactéries probiotiques peut inhiber
l’augmentation de la perméabilité de l’épithélium provoquée par des stress, des infections
ou la présence de cytokines pro-inflammatoires, comme le TNF-α ou l’IFN-γ (25, 60, 224,
232, 262). Il est aussi particulièrement intéressant de constater que les probiotiques peuvent
modifier directement la fonction de barrière de l’épithélium en influençant la structure des
jonctions serrées (25, 234).
35
Une étude a démontré que Streptococcus thermophilus et Lactobacillus acidophilus, de
façon indépendante, augmentent la résistance transépithéliale et diminuent la perméabilité
des cellules HT-29 et Caco-2 (261). De plus, une augmentation de la phosphorylation et
donc de l’activation de certaines protéines formant les jonctions serrées (zona occludens-1
(ZO-1) et occludines) a été observée, sans toutefois modifier de façon significative la
concentration de ces protéines. Une autre étude menée par le même groupe de recherche a
montré que ces deux probiotiques préviennent les effets négatifs provoqués par la présence
de cytokines pro-inflammatoires, en agissant sur les voies de signalisation habituellement
activées par ces cytokines, augmentant ainsi la résistance transépithéliale et la rétention des
ions (262).
Une étude in vivo a fait la démonstration que la colonisation de souris gnotobiotiques avec
le probiotique E. coli Nissle 1917 augmente l’expression de ZO-1, mais pas de ZO-2 (322).
En complément, les auteurs ont observé qu’un prétraitement avec la souche probiotique
diminue de façon significative la perméabilité de la muqueuse du côlon lors d’un traitement
au DSS.
4.2.3.1.2. Effets sur la morphologie de l’intestin
Plusieurs différentes études chez le porcelet ont montré des effets sur la morphologie de la
muqueuse intestinale suite à la consommation de probiotiques. La longueur des villosités
ainsi que la profondeur des cryptes intestinales sont augmentées chez des porcelets sevrés
traités avec Pediococcus acidilactici lorsque comparés aux animaux non traités (64). Une
autre étude utilisant un mélange de trois probiotiques a montré une augmentation de la
taille des villi au niveau du jéjunum chez des porcelets en post-sevrage, après quatre
semaines de traitement (183).
4.2.3.2. Effets sur la production de mucines et de défensines
Le mucus recouvrant le feuillet épithélial est composé de mucine et est une composante
essentielle de la barrière mucosale. Plusieurs espèces probiotiques de Lactobacillus
augmentent la production de certaines mucines lorsque ces souches sont mises en contact
avec des lignées épithéliales intestinales humaines (HT-29 et Caco-2) (180, 188). Par
contre, les études in vivo sont moins cohérentes ne montrant, en fonction des modèles,
36
aucun effet ou, au contraire, des augmentations significatives sur la sécrétion de mucine.
Des souris traitées pendant 14 jours avec la formule de probiotiques VSL#3, n’ont montré
aucune modulation dans l’expression des différents gènes de mucines ni dans l’épaisseur de
la couche de mucus lorsque comparées aux animaux non traités (100). Cependant, des rats
recevant une dose similaire sur une période de 7 jours avaient une expression de MUC2
soixante fois plus élevée que les rats non traités, et des effets sur MUC1 et MUC3 ont aussi
été observé, mais avec des niveaux d’augmentation plus faibles que pour MUC2 (31). Il
semble donc que la production de mucus peut aussi être augmentée in vivo suite à
l’administration de probiotiques, cependant des études plus approfondies utilisant divers
modèles animaux sont nécessaires pour conclure hors de tout doute de l’efficacité de
certaines souches probiotiques à moduler la production de mucus.
Un autre mécanisme d’action connu associé aux probiotiques est la stimulation de la
production de défensines. Les effets associés aux probiotiques sur la production par l’hôte
de ces peptides antimicrobiens ont surtout été démontrés in vitro en utilisant des cellules
épithéliales humaines. Il fut montré que l’expression et/ou la sécrétion de β-défensine 2 est
significativement augmentée dans des cellules Caco-2 lorsque stimulées avec E. coli Nissle
1917, avec différentes espèces de Lactobacillus ou avec la formulation de probiotiques
VSL#3 (211, 279, 337).
4.2.3.3. Effets sur la translocation bactérienne
En diminuant la perméabilité de l’épithélium intestinal et en favorisant la production de
mucus et de défensines, les probiotiques renforcent la barrière mucosale ce qui rend l’accès
direct aux cellules de l’épithélium beaucoup plus difficile pour les bactéries commensales
ou pathogènes, diminuant du même coup la translocation bactérienne vers les ganglions
mésentériques et vers d’autres organes extra-intestinaux.
Une étude utilisant des porcelets sevrés infectés avec une souche d’E. coli
entérotoxigénique (ETEC) a permis de constater cet effet des probiotiques sur la
translocation du pathogène. En fait, une diminution significative du nombre d’E. coli ETEC
a été obtenue pour les porcelets ayant reçu Pediococcus acidilactici ou Saccharomyces
cerevisiae ssp. boulardii ou la combinaison des deux probiotiques lorsque comparés aux
animaux n’ayant reçu aucun traitement (172). D’autres études utilisant d’autres modèles ont
37
aussi démontré que S. cerevisiae et certaines bactéries lactiques, telles que Lactobacillus
plantarum et Bifidobacterium lactis, réduisent la translocation bactérienne (128, 237).
Figure 8. Réponses immunitaires mucosales induites par les bactéries probiotiques et
commensales. Les bactéries commensales et probiotiques de la lumière intestinale sont
captées par les cellules de l’épithélium et/ou par les cellules dendritiques (CD). Les cellules
épithéliales vont alors produire des cytokines telles que l’IL-10 et le TGF-β. Cet
environnement permet la différenciation partielle des CD. Ces dernières vont alors interagir
avec les cellules T CD4+ naïves présentes dans les plaques de Peyer et/ou dans les
ganglions mésentériques (GM). Lors de la présentation de l’antigène, l’absence d’une
stimulation adéquate provoque la différenciation des cellules T CD4+ naïves en cellule
Treg ou en cellule Th3 qui produiront de l’IL-10 et du TGF-β. Ces cytokines stimulent la
tolérance orale et la production d’IgA par les plasmocytes. (Adapté de Mowat, (215))
38
4.2.4. Effets sur l’immunité
Les organismes probiotiques produisent plusieurs composés qui peuvent influencer le
système immunitaire de l’hôte comme des composantes de la paroi, l’ADN et différents
métabolites. Tout comme ceux produits par les bactéries pathogènes, ces produits sont
reconnus par le système immunitaire comme étant nuisibles ce qui engendre une réponse
immune. Cependant, contrairement à la réponse provoquée par les pathogènes, la présence
des probiotiques provoque l’activation de lymphocytes T et B, mais ne cause pas
d’inflammation ou d’infiltration des neutrophiles (146). Des effets sur l’immunité innée et
sur l’immunité adaptative ont été décrits à maintes reprises dans la littérature.
4.2.4.1. Effet sur l’immunité innée
Les bactéries probiotiques peuvent interagir avec les cellules épithéliales et moduler les
voies de signalisation intracellulaires modifiant ainsi la production de cytokines et de
chimiokines (222, 239, 271). Certaines souches probiotiques peuvent engendrer une
réponse anti-inflammatoire et/ou inhiber la voie de signalisation de NF-κB (nuclear factorκB) dans les cellules épithéliales. NF-κB est un facteur de transcription responsable de
l’activation de plusieurs gènes, dont ceux codant pour des cytokines pro-inflammatoires et
des chimiokines. Les probiotiques peuvent agir sur cette voie de signalisation par divers
mécanismes, soit en bloquant la dégradation de l’inhibiteur de κB (223); en inhibant les
fonctions des protéasomes (143); ou en régulant la migration des protéines du cytoplasme
vers le noyau (151).
D’autre part, tel que décrit dans une des sections précédentes, les probiotiques influencent
la production de mucus et de défensines, renforçant ainsi la barrière mucosale et donc
l’immunité innée de l’animal ou de l’individu. Les cellules de l’épithélium expriment à leur
surface des molécules qui présentent les antigènes captés ainsi que diverses molécules de
costimulation. Il fut démontré que ces cellules jouent un rôle important dans l’activation et
l’expansion clonale des lymphocytes Treg (216). Certaines souches de probiotiques ont la
capacité de moduler l’activité des protéasomes (143, 246). Cette découverte permet
d’expliquer en partie les différences observées dans l’activation et la maturation des
cellules T lorsqu’elles sont en présence de probiotiques ou de bactéries pathogènes (182).
39
4.2.4.2. Effet sur l’immunité adaptative
Plusieurs études ont montré que les probiotiques agissent sur la maturation des CD et
conséquemment sur l’activation des cellules T naïves (Figure 8). Les probiotiques peuvent
moduler l’expression des molécules de surface et des cytokines pro-inflammatoires
produites par les cellules dendritiques (41, 68). Tout comme pour les bactéries
commensales, les probiotiques induisent une réponse de tolérance caractérisée par
l’expression de cytokines comme l’IL-10 et le TGF-β. Les cellules T CD4+ naïves vont
interagir avec les CD. L’environnement cytokinaire composé principalement d’IL-10 et la
stimulation plus ou moins forte des CD provoqueront la différenciation des lymphocytes T
naïfs en lymphocyte T régulateur et en lymphocyte Th3. Ces cellules vont produire des
cytokines anti-inflammatoires comme l’IL-10 et le TGF-β induisant ainsi une réponse de
tolérance et la production d’IgA sécrétoire (182, 215, 224). Cependant, ces effets
modulatoires sur le système immunitaire diffèrent d’une espèce ou d’une souche
probiotique à l’autre (136).
4.3. Pediococcus acidilactici
Les pediocoques sont des bactéries lactiques non sporulées à Gram positif. Les souches
probiotiques de cette espèce bactérienne sont principalement utilisées en production porcine
et aviaire. Les Pediococcus spp. sont bien connus pour leur capacité à survivre dans des
conditions très acides et en présence de forte concentration en sels biliaires (79). La plupart
des souches de P. acidilactici produisent une bactériocine, nommée pédiocine PA-1 (40),
qui agit sur plusieurs types de bactéries lactiques et sur certains pathogènes comme Listeria
monocytogenes (267). Une autre caractéristique intéressante est la forte production d’acide
lactique. La grande concentration d’acide lactique produite par ces bactéries diminuerait le
pH de la lumière intestinale ce qui aurait pour conséquence de venir moduler le microbiote
intestinal.
Des études chez le porc ont permis de montrer des effets sur le gain poids, sur la
morphologie intestinale, sur la translocation bactérienne lors d’une infection entérique et
sur le système immunitaire des animaux ayant reçu des probiotiques. Di Giancamillo et ses
collègues ont démontré que l’administration d’une souche de P. acidilactici influençait
positivement le gain de poids et augmentait la longueur des villosités et la profondeur des
40
cryptes intestinales, chez le porcelet sevré (64). Lessard et ses collègues ont observé que le
pourcentage des cellules T CD8+ dans l’iléon des porcelets en lactation traités avec
P. acidilactici MA18/5 M était plus élevé que le groupe témoin et que la translocation
bactérienne était diminuée lors d’une infection expérimentale avec un E. coli ETEC, suite
au sevrage (172).
4.4. Saccharomyces cerevisiae ssp. boulardii
Des souches probiotiques de S. cerevisiae ssp. boulardii sont actuellement utilisées chez
l’humain lors du traitement d’infection nosocomiale lié à Clostridium difficile. Cette levure
est aussi utilisée en production porcine comme supplément alimentaire pour favoriser le
développement et la santé intestinale des porcelets sevrés. Plusieurs mécanismes d’action
ont été décrits au fil des années dans la littérature pour ce type de microorganisme.
Cette levure peut, via les résidus mannoses situés sur sa membrane externe, lier des
bactéries flagellées telles que Salmonella et E. coli, formant ainsi un agrégat qui sera
rapidement éliminé du tractus gastro-intestinal (51, 101). De plus, elle sécrète une protéase
qui hydrolyse la toxine A de Clostridium difficile (35). En complément des effets directs
sur les pathogènes ou leurs métabolites, cette levure peut moduler le système immunitaire
de l’hôte. Elle augmente la sécrétion des IgA chez l’hôte (30) et elle sécrète un facteur antiinflammatoire qui inhibe la dégradation de l’inhibiteur de κB, empêchant ainsi la
translocation de NF-κB dans le noyau (296). Finalement, S. cerevisiae ssp. boulardii aurait
des effets sur l’intégrité de l’épithélium intestinal en renforçant les jonctions serrées (52) et
en affectant positivement la maturation des cellules épithéliales et la survie des cellules de
Goblet (63).
41
5. Le but, les hypothèses et les objectifs du projet de recherche
5.1. But
Parce que pour être défini comme étant une souche potentiellement probiotique des effets
positifs sur l’hôte et sa santé intestinale ou générale doivent être démontrés, déterminer les
effets de l’ingestion des probiotiques Pediococcus acidilactici MA18/5 M (PA) et
Saccharomyces cerevisiae ssp. boulardii CNCM I-1079 (SCB) par des porcelets sur leur
microbiote intestinal et sur leur immunité innée et acquise a été le but général de ce
mémoire. Ainsi, les buts spécifiques à l’atteinte de ce projet ont reposé sur l’identification
des populations bactériennes intestinales avant et après sevrage et l’évaluation de
marqueurs de l’immunité innée et acquise lors d’une infection entérique causée par
Salmonella Typhimurium DT104 afin de permettre une meilleure connaissance des effets
modulatoires des probiotiques utilisés dans cette étude sur ces différents éléments.
5.2. Hypothèses
1) L’ingestion des probiotiques PA et SCB, par les truies gestantes et dès la naissance par
les porcelets influence positivement le microbiote intestinal des porcelets, avant et après
le sevrage.
2) L’ingestion des probiotiques PA et SCB, dès la naissance par les porcelets augmente
leur résistance aux infections causées par Salmonella Typhimurium DT104 et module
leurs réponses immunitaires, à la suite du sevrage.
5.3. Objectifs
Pour vérifier les hypothèses et atteindre les buts de ce projet de recherche, quatre objectifs
ont été fixés :
a. Déterminer l’effet des probiotiques, sur les diverses populations bactériennes
composants le microbiote fécal pendant la lactation et à la suite du sevrage.
b. Déterminer l’effet des probiotiques sur les diverses populations bactériennes
composants le microbiote de l’iléon et du côlon à la suite du sevrage.
42
c. Déterminer l’efficacité des probiotiques à prévenir une infection à Salmonella
Typhimurium DT104.
d. Déterminer l’effet des probiotiques sur l’immunité intestinale spécifique et non
spécifique des porcelets lors d’une infection à Salmonella Typhimurium DT104.
43
Chapitre 1 : Analyse par T-RFLP des effets chez le
porcelet de Pediococcus acidilactici et Saccharomyces
cerevisiae ssp. boulardii sur le microbiote fécal lors de la
lactation et sur le microbiote fécal, iléal et du côlon suite
au sevrage
Résumé
Nous avons évalué lors de la lactation le microbiote fécal de porcelets traités avec ou sans
Pediococcus acidilactici (PA) et/ou Saccharomyces cerevisiae ssp. boulardii (SCB). Postsevrage, nous analysons le microbiote fécal, iléal et du côlon de porcelets nourris avec une
alimentation contrôle ou supplémentée avec PA et/ou SCB ou des antibiotiques. Les
probiotiques ont été administrés quotidiennement par voie orale (lactation) et via
l’alimentation (post-sevrage). À 10 et 28 jours d'âge, des fèces ont été recueillies et à
37 jours les porcelets ont été abattus et le contenu iléal et du colon prélevé. Le microbiote a
été caractérisé sur des milieux sélectifs et par T-RFLP. Nous démontrons que les
probiotiques ont modulé faiblement le microbiote fécal pendant l’allaitement. Post-sevrage
PA a modulé le microbiote iléal de façon similaire aux antibiotiques tandis que SCB a
modulé le microbiote du côlon. Cependant, la coadministration des probiotiques a aboli les
effets individuels observés.
45
Title: Analysis by T-RFLP of effects on piglets of Pediococcus acidilactici
and Saccharomyces cerevisiae subsp. boulardii on fecal microbiota, during
lactation, and on fecal, ileal and colonic microbiota post-weaning
Jean-Philippe Brousseau1,2, Frédécic Beaudoin1, Karoline Lauzon1, Denis Roy2, Guylaine
Talbot1, and Martin Lessard1*
1
Dairy and Swine Research and Development Centre, Agriculture and Agri-Food Canada,
Sherbrooke, Québec, Canada.
2
Université Laval, Québec, Québec, Canada.
Running Title: Probiotic effects on intestinal microbiota before and after weaning
*Corresponding author.
Mailing address: Dairy and Swine Research and Development Centre,
Agriculture and Agri-Food Canada,
2000, rue Collège
Sherbrooke, Québec,
J1M 0C8 Canada
Phone: 819-780-7220
Fax: 819-564-5507
Email: [email protected]
Manuscrit en préparation pour soumission à Applied and Environmental Microbiology.
46
Abstract
In this study, changes in the fecal microbiota of piglets orally treated from birth with or
without Pediococcus acidilactici (PA) and/or Saccharomyces cerevisiae subsp. boulardii
(SCB) was monitored during lactation and after weaning. We also evaluated the changes in
the ileal and colonic microbiota of two week weaned piglets fed a control diet
supplemented with PA and/or SCB or antibiotics. At 10 and 28 days of age, fecal samples
were collected. Piglets were slaughtered two weeks post weaning (day 37), and the ileum
and colon contents were sampled to characterize the microbiota on selective media and by
terminal restriction fragment length polymorphism (T-RFLP). Results showed that
administration of probiotics, slightly modulated the fecal microbiota during lactation, but
after weaning probiotic administration had major effects particularly in the ileum and
colon. Consumption of SCB alone modulated the colonic microbiota and positively
influenced the establishment of the Porphyromonadaceae and Ruminococcaceae bacterial
families. Administration of antibiotics and PA alone reduced ileal microbiota diversity,
promoted the establishment of Firmicutes in part by increasing the amount of Lactobacillus
amylovorus-like bacteria. This suggests that PA can be considered as a good feed additive
to mitigate the prophylactic usage of antibiotics in piglet feed. In conclusion, the probiotics
used in this study greatly influenced in a strain dependent manner the intestinal microbiota
of weaned piglets, but co-administration of these probiotics abolished their individual effect
on the microbiota.
Introduction
The establishment of the intestinal microbiota is a complex event that involves a succession
of phases which leads to the formation of a dynamic ecosystem unique of each individual
(149). At birth, the newborn leaves the germfree intrauterine environment and enters a
highly contaminated world. Contact with the vagina, feces and skin of the mother begins
the colonization of the gastrointestinal tract of piglets (48). In North America and some
other countries, piglets are weaned within the first 3 weeks of life and do not have access to
solid food before weaning. One consequence of this stressful period is the perturbation of
the intestinal microbiota. Therefore, this period is critical for piglets as they are subjected to
47
several stressors that lead to reduced growth performance and increased morbidity and
susceptibility to disease (92, 166). During the past five decades, to prevent negative effects
of weaning, antimicrobial compounds have been added to piglet weaning diet at
subtherapeutic levels. Even if this breeding technique prevents the growth of pathogenic
bacteria and enhances the growth rates of piglets (50), the emergence of antibiotic
resistance in animals and mostly human commensal bacteria has raised concerns about the
impact of antimicrobial compounds for agricultural use (295). Numerous additives and
ingredients have the potential to replace in-feed antibiotics; however their effectiveness
remains to be demonstrated. Among the alternatives, probiotics arouse great interest. Many
different definitions of a probiotic have been proposed, although the most widely used is
that of Fuller, which defined probiotic as a live microbial food supplement that beneficially
affects the host animal by improving its intestinal microbial balance (93). Studies suggest
that probiotics have beneficial effects on health in animals and humans through their action
on microbial populations in the gut and mucosal immunity (60, 312). A few companies
have developed probiotic strains for farm animals. From these, two probiotics developed
for the swine industry, Pediococcus acidilactici MA18/5M (PA) and Saccharomyces
cerevisiae subsp. boulardii CNCM I-1079 (SCB) have been shown to modulate intestinal
microbiota, influence bacterial translocation and are effective in reducing attachment of
Escherichia coli O149:F4 to the ileal mucosa of weaned pigs (56, 94, 172). Therefore,
probiotic administration could be considered as an alternative to reduce the use of
antibiotics in-feed as growth promotors. However, a better understanding of the effect of
probiotics on microbial populations in the gut of piglets before and after weaning is
important to develop a feeding strategy that improves intestinal health, growth performance
and prevents enteric diseases.
Molecular techniques are useful tools to comprehensively determine intestinal microbiota
profiles. The stepwise strategy of these approaches is to isolate total community DNA and
use this DNA as a template for PCR amplification of 16S ribosomal DNA (rDNA) genes
with universal primers. After PCR, amplicon composition is determined by fingerprint
analysis. One method well suited for studying complex bacterial communities is the
analysis of terminal restriction fragment (T-RF) patterns. Terminal restriction fragment
length polymorphism (T-RFLP) analysis is an automated and sensitive fingerprinting
48
method which uses fluorescently labeled primers for PCR, followed by endonuclease
digestion and visualization of T-RF after electrophoretic separation on a DNA sequencing
machine. When the target of PCR is 16S rDNA, the T-RF pattern reflects the taxonomic
diversity of the bacteria in the sample (42, 177). Comparing T-RF patterns is a powerful
method to detect the effects of probiotic administration on piglets’ intestinal microbiota.
In this study, we determined the effects of PA and SCB administration on the fecal
microbiota of piglets during lactation and after weaning. We also highlight two weeks postweaning a strain dependent action of PA and SCB on the ileal and colonic microbiota,
respectively.
Materials & methods
Animals and treatments
The animal use protocol was reviewed and approved by the Dairy and Swine Research and
Development animal care committee and followed the principle established by the
Canadian council on animal care (37). The experimental protocol has been described
previously (56), however a brief description is provided to facilitate understanding.
A total of 40 Yorkshire-Landrace gilts obtained from La Coop fédérée (Montreal, QC,
Canada) and housed at Agriculture and Agri-Food Canada’s Dairy and Swine Research and
Development Centre (Sherbrooke, QC, Canada) were used to carry out the experiment.
Two batches of 20 gilts were constituted and each batch of gilts was used in two successive
parities over a two-year period. Regu-Mate (Intervet Canada Ltd., Whitby, ON, Canada)
was used to synchronize oestrus, and sows were inseminated twice with the same tested
semen provided by the Centre d’insémination porcine du Québec inc. (St-Lambert-deLauzon, QC, Canada). Among a total of 80 expected litters, 40 were used as described
below.
Twenty-eight days before parturition, pregnant sows were allocated to one of the five
treatment groups using a complete randomized block design. Three groups of sows and
their litters were assigned to one of the following treatments: P. acidilactici (strain
MA18/5M, Lallemand Animal Nutrition, Blagnac, France), S. cerevisiae subsp. boulardii
(strain SB-CNCM I-1079, Lallemand Animal Nutrition), or PA in combination with SCB.
49
The other two groups were used as reference and control groups respectively; piglets of the
reference group received at weaning a diet supplemented with chlortetracycline and
tiamulin antibiotics (ATB) and those of the untreated control group (CTRL) were fed
weanling basal diet without ATB or probiotics. For both groups, sows and their litters
remained untreated throughout the gestation and lactation periods. The ATB group was
included as a reference group because antibiotics are commonly added to the weanling feed
of pigs in North America. The sows assigned to the probiotic treatments received daily
2.5 × 109 cfu from day -28 to day -14, 3.5 × 109 cfu from day -14 to day 0 (parturition), and
6 × 109 cfu from day 0 to day 21 (nursing). In the PA+SCB group, both probiotics were
simultaneously given at the indicated concentrations above. The probiotic doses were
mixed with 500 g of feed and given to the sows before the morning meal. The daily feed
ration given to the sows was 2.5 kg from day -28 to day -14, 3.5 kg from day -14 to day 0,
and ad libitum during the lactation period (day 0 to day 21). The groups of sows were
housed in different pens located in different sections of the gestation room to prevent crosscontamination between the treatments. One week before farrowing, the sows were
transferred in the maternity unit into 5 different rooms allocated to the treatments. From
each batch of 20 gilts, 10 gilts and their piglets (two litters per treatment) were randomly
chosen. Within the first 24 h after parturition, litter size was adjusted to 12 piglets and, if
necessary, adoptions were carried out from litters assigned to the same treatment.
Twenty-four hours after birth, the pigs started to receive orally the same probiotic treatment
as their mother by means of disposable pipettes. In the probiotic groups, the daily dose of
each probiotic was 109 cfu diluted in 2 mL peptone water. The pigs in both the control and
reference groups (CTRL and ATB, respectively) received 2 mL peptone water alone. The
probiotics or peptone water were given daily during lactation and after weaning at 21 days
of age until day 28. At weaning, all pigs were transferred to their respective pens to prevent
cross-contamination. Pigs having received probiotics during the lactation were also fed a
basal diet enriched with the same probiotic at 2 × 109 cfu/kg. The pigs in the ATB group
received the same diet supplemented with chlortetracycline (110 ppm active ingredient/kg)
and tiamulin (31.2 ppm active ingredient/kg). The basal diet was provided by La Coop
fédérée (Table 1). Feed and water were available ad libitum to the weaned pigs.
50
Table 1. Nutrient composition of the weaning diet (d21 to d37).
Nutrient
Concentration
Protein, %
21.5
Fat, %
7.52
Fiber, %
2.34
Calcium, %
1.00
Phosphorus, %
0.76
Sodium, %
0.2
Copper, mg/kg
128.17
Zinc, mg/kg
138.41
Vitamin A, IU/kg
11,500
Vitamin D, IU/kg
1,140
Vitamin E, IU/kg
56
Sampling of fecal, ileal and colonic samples
During lactation, at 10 days of age (d10), two piglets from the CTRL and probiotics litters
(16 piglets per group) were used for fecal sampling. One week after weaning, at 28 days of
age (d28), the same piglets sampled during lactation and 2 randomly selected piglets from
the ATB litters were used for the feces collection. Also, at 37 days of age (d37) these
piglets were slaughtered for tissue sampling. Ileal content from each piglet was collected in
the same area at approximately 20 cm from the ceacum, while colonic samples were
collected at 30 cm from the ceacum (mid colon). For each collected fecal, ileal or colonic
sample, one aliquot of fresh matter was kept on ice until microbiological analysis and the
remaining was aliquot and store at -20ºC until DNA extraction.
Microbiological analysis of feces and intestinal contents
Samples were serially diluted in sterile 0.1% (w/v) peptone water for enumeration of
probiotics and some selected microbial populations. Potato dextrose agar (BD Biosciences,
Mississauga, ON, Canada) adjusted to pH 3.5 with sterile tartaric acid (10% solution), to
inhibit bacterial growth, was used for the detection of S. cerevisiae subsp. boulardii. The
51
yeast plates were incubated at 30°C for 48 h. Plates containing LAMVAB agar were used
for the detection of P. acidilactici and for the isolation of Lactobacillus species (125). The
plates were incubated anaerobically for 48 h at 37°C. MacConkey Agar No.2 (Oxoid
Company, Nepean, ON, Canada) plates were incubated at 37°C for 24 h to enumerate
E. coli and total coliforms. For the quantification of clostridia in feces and colonic contents,
Sulphite-Polymixin-Milk agar plates were used (58). Plates were incubated anaerobically at
37°C for 24 h. Finally, Bifidobacterium species were quantified in fecal and colonic matter
using Beerens’ agar plates (20, 290), incubated anaerobically at 37°C for 48 to 72 h.
Results are reported in cfu/ g of feces or intestinal content. Statistical analysis were
performed using the Mixed procedure of SAS software (277). Treatment comparisons were
further evaluated by testing the probiotic treatments (three groups) against the control
(CTRL) and reference groups (ATB; for samples from feces taken on d28 and ileal and
colonic contents from d37) using a Dunnett’s adjustment for multiple testing. A P-value
smaller than 0.05 is considered as a significant difference between groups, whereas a Pvalue smaller than 0.1 represents a tendency.
DNA extraction and PCR conditions
Total genomic DNA from fecal and intestinal samples (0.4 g) was extracted by the bead
beating method and recovered by phenol-chloroform extraction as described by Reilly and
Attwood (258). All extractions were done in triplicate. DNA integrity was assessed using
gel electrophoresis with 1.5% agarose gel. Triplicates showing the same integrity were
pooled and DNA yield was quantified by determining absorption of DNA at 260 nm and
280 nm (A260/280) using a NanoDrop spectrometer (NanoDrop Technologies, Inc.).
PCR was performed in 25-μl reaction volume using a reaction mixture of 1X PCR buffer,
200 μM each deoxynucleoside triphosphate, 1.5 mM MgCl2, each primer at a concentration
of 0.1 μM, and 1 U of Taq DNA polymerase (Qiagen Inc.). The primers used were specific
for conserved bacterial 16S rDNA sequences, F27 (AGAGTTTGATCMTGGCTCAG) and
R788 (GGACTACCAGGGTATCTAA) (126, 313). The forward primer was labeled at the
5' end with 6-carboxyfluorescein (6-FAM). Amplification of DNA was performed in a
GeneAmp PCR system 2700 (Perkin Elmer) by using the following program: an initial
denaturing step at 94°C for 5 min, followed by 25 cycles of denaturation at 94°C for 1 min,
52
annealing at 47°C for 1 min, extension at 72°C for 2 min, and final extension at 72°C for 10
min. PCR 96-well plate was placed in the thermocycler when the block temperature
reached 94°C. Four replicate PCRs were performed for each sample and the products were
verified visually (3 μl) using 1% agarose gel, then pooled.
T-RFLP
PCR products (88 μl) were purified with the QIAquick PCR Purification Kit (Qiagen Inc.)
as recommended by the supplier, and eluted with 30 μl elution buffer. The concentration
and the purity of PCR products were determined by measuring absorption of DNA at 260
nm and 280 nm (A260/280) using a NanoDrop spectrometer. Purified PCR products (500 ng)
were digested simultaneously with 10 U of each tetrameric restriction endonucleases HhaI
and MspI (New England Biolabs) in a 20-μl reaction volume. Digestions were performed at
37°C for 4 h, and stopped by enzyme deactivation at 65°C for 1 h. The analysis of terminal
restriction fragments (T-RF) was carried out by the Plate-forme d'Analyses Génomiques
from Laval University (Quebec, Canada; pag.ibis.ulaval.ca/). Briefly, 2 μl of each sample
were mixed with 0.5 μl of GeneScan 1200 Liz internal size standard and 12 μl of
formamide (all reagents obtained from Applied Biosystem). Samples were denatured at
95°C for 5 min, chilled on ice for 5 min and then the fragment size analysis was carried out
with an ABI PRISM 3130xl genetic analyzer (Applied Biosystem). After electrophoresis,
T-RFLP profiles were produced by comparison with internal standards by using the
GeneMapper software (version 3.7; Applied Biosystem).
Data analysis of T-RFLP profiles
Before analyzing T-RFLP profiles, the following conditions were established to determine
fragments to include in the analysis. First, fragments with a peak height ≤25 relative
fluorescent unit (rfu) were excluded from the analysis. Second, fragments that differed by
less than 1 base pair in different profiles were considered identical and clustered together
due to the systematic instrument error in determining fragment size. Third, standardization
of the fingerprint data was performed in order to normalize to identical peak heights, using
the methods described by Dunbar and colleagues (72). To eliminate the other possible
remaining source of background noise or incompletely digested T-RFs, we only kept T-RFs
53
that were present at least in 10% of T-RFLP profiles of fecal samples or intestinal contents
collected. Then normalized data were subjected to statistical analysis.
To evaluate structural diversity between samples, the Shannon-Weaver diversity index (H),
richness (S), and evenness (E), were calculated (284). The Shannon-Weaver diversity index
was calculated as follows: H = ‒∑(pi) (ln pi), where the summation is over all unique
fragments i and pi the relative abundance of fragment i. The abundance of a particular
fragment can be determined by using the peak height intensity in relative fluorescent units.
Evenness was measured as follows: E = H/(ln[S]). Richness (S) was defined as the number
of unique T-RFs or operational taxonomic units (OTU) in a profile. The Shannon diversity
is high when the bacterial community has a lot of phylotypes and an even distribution of
the phylotypes. Eveness is a measure of the equitability of abundance. In other words, an
environmental sample with more even abundance is more diverse than a sample with
predominant and sparse species. In this study, we used T-RFs to describe quantitative
differences among communities although one T-RFLP peak may not be equal to one
bacterial species (71). Statistical analysis were performed by ANOVA using SAS software
(277). Treatment comparisons were further evaluated by testing the probiotic treatments
(three groups) against the control (CTRL) and reference groups (ATB; for samples of feces
taken on d28 and ileal and colonic contents from d37) using a Dunnett’s adjustment for
multiple testing. A P-value smaller than 0.05 is considered as a significant difference
between groups, whereas a P-value smaller than 0.1 represents a tendency.
T-RFLP profiles were compared by Non-metric Multidimensional Scaling (NMS)
ordination plots using Bray–Curtis (i.e. Sørenson) distance measures and PC-ORD software
(194). The fingerprint data were reduced to single points which were projected into a twoor three-dimensional space using the NMS ordination method. Multivariate statistical
analyses such as NMS are useful for summarizing fingerprint data and further identifying
major patterns and putative causal factors that find applications in microbial ecology (255,
307). NMS was performed using 100 iterations with random starting configurations to
ensure that minimum stress was achieved for the final ordination. The NMS plots were
rotated by varimax rotation (193). A Multi-Response Permutation Procedure (MRPP), with
Sørenson distance and using PC-ORD software (194) was used to test for significant
differences in bacterial community composition between treatments for each feces (d10 and
54
d28) and intestinal content (ileum and colon; d37) samples. MRPP is a method for testing
group differences and is similar to analysis of similarity or MANOVA. The MRPP
agreement statistic A describes the within- and between-group relatedness compared with
the random expectation (193). The highest value for A is 1, when all items are identical
within groups. A P-value smaller than 0.05 is considered as a significant difference
between groups, whereas a P-value smaller than 0.1 represents a tendency.
Indicator species analysis (ISA) as described by Dufrêne and Legendre (69) was used to
identify, specific phylotypes that were responsible for bacterial diversity variation between
treatments at each time of feces sampling and each intestinal site of digesta sampling. The
relative abundance and the relative frequency of each phylotype in each fecal or digesta
sample were calculated. Indicator values (IV from 0 to 100; absent to exclusively present,
respectively) of each phylotype and for each sample were obtained by multiplying the
relative abundance data by the relative frequency data described herein. Within each
treatment, the indicator values obtained by ISA were tested for statistical significance with
the Monte Carlo randomization test included in the PC-ORD package to evaluate the effect
of probiotic administration. A P-value smaller than 0.05 is considered as a significant
difference between groups, whereas a P-value smaller than 0.1 represents a tendency.
Clone library construction
Clone libraries were constructed to identify the T-RFLP peaks. Four libraries were made
from pooled DNA extracts obtained at each time of feces sampling (d10 and d28) and each
intestinal digesta (ileum and colon; d37). Amplification of 16S rDNA genes was performed
by PCR using the same conditions as described above for T-RFLP, except that the forward
primer was not labeled, the final reaction volume was 50 μl and 30 amplification cycles
were done instead of 25. Products of the PCR amplification were cloned into the pDrive
Cloning Vector using the QIAgen PCR cloning kit (Qiagen Inc.) and then transformed into
One Shot MAX Efficiency Escherichia coli DH5α competent cells (Invitrogen) following
the manufacturer’s instructions. Individual colonies from each time and sites of sampling
were grown in ten 96-well culture blocks (960 colonies for each time and site of sampling;
except for the ileum digesta where six 96-well culture blocks were used) and screened
using RFLP to reduce but not completely eliminate the number of redundant sequences
55
(164). Amplification of 16S rDNA genes was performed by PCR on each transformant
using the same conditions as described above. Tetrameric restriction endonucleases HhaI
and MspI (New England Biolabs) were used to digest PCR amplification products and a gel
electrophoresis with 1.7% agarose gel was executed to generate RFLP profiles. Clones
exhibiting the same RFLP banding pattern were assumed to contain the same 16S rDNA
gene. After RFLP screening, 135, 122, 85 and 126 transformants were selected from d10
and d28 fecal samples and ileum and colon digesta samples respectively and propagated in
liquid LB-ampicillin-kanamycin medium for an overnight cultivation. Plasmids were
extracted using the QIAprep spin mini prep kit (Qiagen Inc.) for sequencing.
DNA sequencing
Plasmid DNA sequencing reactions were carried out by the Plate-forme d'Analyses
Génomiques from Laval University (Quebec, Canada; pag.ibis.ulaval.ca/). Clones were
sequenced from each ends on an ABI PRISM 3130xl genetic analyzer (Applied Biosystem)
using T7 and SP6 primers. The sequences were submitted to SEQMATCH and
CLASSIFIER program of the Ribosomal Database Project (RDP; http://rdp.cme.msu.edu/)
to obtain a list of closest phylogenetic neighbors (44). Sequences were deposited in
GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html) under accession numbers
HQXXXX – HQXXXX. In silico restriction of each sequence was executed using
NEBcutter (330), to identify the theoretical T-RF obtained with the tetrameric restriction
endonucleases HhaI and MspI. One representative clone for each theoretical T-RF obtained
was analysed with the T-RFLP method described previously. Following this strategy,
between 50 and 55% of all T-RFLP peaks that were analysed from samples obtained at
different times and from different sites were assigned to a bacterial Phylum. The remaining
unidentified T-RFs were attributed to a bacterial Phylum using Virtual Digest from
Microbial Community Analysis (MiCA, http://mica.ibest.uidaho.edu/) (289). For each time
of fecal samplings (d10 and d28) and each intestinal digesta (ileum and colon; d37), T-RFs
were grouped according to their Phylum affiliation. Statistical analysis was performed by
ANOVA using SAS software (277). Treatment comparisons were further evaluated by
testing the probiotic treatments (three groups) against the control (CTRL) and reference
groups (ATB; for samples of feces taken on d 28 and ileal and colonic contents from d 37)
56
using a Dunnett’s adjustment for multiple testing. A P-value smaller than 0.05 is
considered as a significant difference between groups, whereas a P-value smaller than 0.1
represents a tendency.
Results & discussion
Probiotics, as a member of the gut microbiota, may contribute to improve the health of the
host’s gastrointestinal system. Possible mechanisms are that probiotics may increase
desired bacterial populations in the gut, suppress pathogenic bacteria and/or modulate
metabolic activity of the microbiota (256). To be efficient, a probiotic must be viable and in
sufficient amount at their site of action. In our study, the probiotics PA and SCB were
detected in feces and intestinal content of pigs receiving daily doses of PA, SCB or
PA+SCB. Mean concentrations of PA and SCB were respectively around 107 cfu/g and 105
cfu/g of fecal content during lactation (d10) and around 106 cfu/g and 105 cfu/g of fecal or
both intestinal digesta after weaning (d28 and d37).
Molecular methods such as T-RFLP are powerful tools which have greatly contributed to
unravelling microbial diversity in the pig’s gut (130, 169). The T-RFLP analysis technique
has gained in popularity in recent years because it is highly reproducible and yields a
greater number of operational taxonomic units (OTUs) than many other PCR-based
fingerprinting methods (236). More importantly, the comparison of experimentally
determined fragments with the fragments predicted from cognate 16S rRNA gene
sequences from our database or the implementation of automated fragment length
assignment tools (e.g., MiCA (http://mica.ibest.uidaho.edu/)), may allow phylogenetic
assignments of signals or predictions of which organisms might be present in a specific
sample.
This study was undertaken to evaluate the impact of probiotic administration from birth, on
fecal and intestinal microbiota of nursing and weanling piglets. Our results demonstrated
that inclusion of probiotics in the basal diet slightly influenced the fecal microbiota, but
significantly modulated bacterial populations of the ileum and colon in a strain-dependent
manner.
57
Figure 1. Influence of dietary treatments on densities (Log10 cfu/g sample) of selected
bacterial groups in (a) feces of piglets at day 10 of lactation, (b) in feces one week
(d28) post-weaning, (c) in the ileum and (d) colon contents two weeks post-weaning
(d37). Pigs were fed a basal diet (CTRL) or a basal diet supplemented with either
antibiotics (ATB), Pediococcus acidilactici (PA), Saccharomyces cerevisiae subsp.
boulardii (SCB), or PA and SCB (PA+SCB). Data are presented as means ± Pooled
standard error of the mean (SEM). Bifidobacterium spp. and Clostridium spp. were not
mesured in the ileum. Two pigs/litter were used (8 litters/treatment). Asterisks (*) are used
to indicate differences between probiotic treated groups and CTRL and ATB groups
(P ≤ 0.1 and P ≤ 0.05 for one and two asterisks, respectively).
(a)
58
(b)
(c)
59
(d)
Probiotic effects on fecal microbiota during lactation
Feces of the mother appear to play a key role in the establishment and future development
of the microbiota. Indeed, it has been estimated by Sansom and Gleed (276) that piglets can
eat up to 85 g per day of fecal matter. For this reason, 28 days before parturition, pregnant
sows assigned to one of the probiotic treatment received a daily dose of probiotic until
weaning of the piglets. Moreover, in most studies conducted so far with young piglet,
probiotics began to be administered at weaning. At this age, the intestinal microbiota is
already well established and therefore more difficult to modulate. Recent studies suggest
that daily ingestion of probiotics from birth has a greater influence on the composition of
the intestinal bacterial populations than later intakes (139).
However, our analysis of fecal matter ten days after birth showed no effect of our probiotic
treatments on bacterial groups cultivated on selective media when compared to bacterial
counts obtained for CTRL piglets (Figure 1a). At this point it is important to mention that
although culturing methods have been indispensable for increasing our understanding of
specific organisms (243), problems with using these methods for community analysis arise
from the fact that an artificial homogenous medium typically allows growth of only a small
60
fraction of the microorganisms. Culturing fails to reproduce the complete diversity
encountered in complex environments and even when using selective media, targeted
microorganisms may not growth adequately and therefore influence the outcome of the
results. However, in our study we used conventional enumeration on selective media to
compare some major bacterial species of the gut microbiota to pinpoint possible
modulatory effects of our probiotic treatments.
Table 2. Influence of probiotic treatments on microbial diversity indices in feces of
piglets at day 10 of lactation and one week post weaning (d28) and in the ileum and colon
digesta of two week weaned piglets (d37)1.
Site /
day
Feces/
d10
Feces/
d28
Ileum/
d37
Colon/
d37
Treatments (n = 8 litters2/Treatment)
Diversity Index
CTRL
ATB
PA
SCB
PA+SCB
SEM
P-value
Richness
48.38
48.94
46.19
43.06
1.91
0.193
Shannon-Weaver
3.11
3.09
2.85
2.90
0.09
0.212
Eveness
0.80
0.80
0.75
0.77
0.02
0.345
Richness
39.31
39.37
40.75
41.93
36.69
2.35
0.579
Shannon-Weaver
3.02
2.74
3.00
2.97
2.83
0.10
0.230
Eveness
0.83c
0.75d
0.81
0.80
0.79
0.02
0.097
Richness
15.93
11.38
10.07
13.40
14.25
2.11
0.301
c
1.21
d
1.12
d
1.42
1.39
0.13
0.033
0.52
b
0.51
d
0.58
0.55
0.04
0.070
40.13
Shannon-Weaver
1.68
a,c
Eveness
0.64
Richness
34.94
Shannon-Weaver
Eveness
2.46
c
0.70
c
39.54
2.68
0.73
38.75
2.60
0.72
38.75
2.63
0.638
2.93
d
2.71
0.12
0.078
0.75
d
0.80
0.02
0.052
1
Definition of acronyms: CTRL = No probiotic and no antibiotic; ATB = tiamulin and
chlortetracycline; PA = P. acidilactici; SCB = S. cerevisiae subsp. boulardii; PA+SCB = a
mixture of the two probiotics. Data are presented as means ± Pooled standard error of the
mean (SEM).
2
Two pigs/litter were used (8 litters/treatment).
a, b
Means within rows for a same site/day tend to be different (P ≤ 0.10).
c, d
Means within rows are significantly different (P ≤ 0.05).
61
Neither the diversity indices calculated from T-RFLP profiles (Table 2) nor the relative
percentage of the different Phyla (Table 3) identified with our clone library or with MiCA
were affected by the daily administration of PA, SCB or both. On the other hand, MRPP
testing performed on NMS triplot representation of bacterial community in feces (Figure
2a), based on 16S rDNA T-RFLP fingerprints, highlighted weak differences in the
composition of the fecal microbiota of piglets receiving PA and PA+SCB compared to
animals from the CTRL group (respectively, P = 0.075 and P = 0.096; Table 4). Altogether,
these results indicated that the probiotics used in this study slightly influenced the global
fecal microbiota of piglets during lactation.
Diet has a crucial influence on bacterial populations and their metabolism. During lactation,
microorganisms which are best suited for the nutrient from the milk become the dominant
bacterial groups and will remain for the duration of lactation (81, 302). Beyond its nutrient
composition, milk contains humoral and cellular immunologic factors which has an
important influence on the establishment of pathogenic and commensal bacteria (274).
Considering these facts and our results it seems that the consumption of milk by piglets is
the main factor influencing the overall fecal microbiota balance.
Nonetheless, further analysis using ISA (Table 5) showed that piglets from the PA
treatment had six indicator phylotypes differentiating their fecal microbiota. All of them
belong to the Phylum Firmicutes which includes several bacterial families, such as the
Eubacteriaceae
(131-bp),
the
Clostridal
Incertae
Sedis
XIII
(163-bp),
the
Peptostreptococcaceae (190-bp) and the Ruminococcaceae (225- and 292-bp). From these,
the 131-, 163- and 292-bp phylotypes showed a mean relative abundance over five percent
and thus were considered as major indicator phylotypes. Piglets from the PA+SCB group
were
characterized
by two
phylotypes;
the
129-bp
T-RF
belonging
to
the
Bifidobacteriaceae family and the 177-bp, a major phylotype with a mean abundance over
ten percent associated with the Lactobacillaceae family. Finally, the 85-bp phylotype
identified as a member of the Bacteroidetes was characteristic of the fecal microbiota of
piglets from the SCB group with a mean abundance of 5.14%.
62
Table 3. Relative percentage of each bacterial Phylum identified from T-RFLP
fingerprints of piglets feces during lactation (d10) and one week post-weaning (d28), and
of the ileum and colon contents two weeks post-weaning (d37)1.
Site /
day
Bacterial
Phyla
PA+SCB
75.77
80.21
75.31
80.08
2.58
0.446
Bacteroidetes
8.36
7.23
9.21
4.69
1.69
0.268
Actinobacteria
5.38
4.37
4.28
5.36
0.97
0.678
Proteobacteria
3.60
2.20
4.71
3.05
0.84
0.243
Fusobacteria
0.89
0.35
2.30
0.52
1.56
0.458
Feces/
d28
Bacteroidetes
84.70
81.16
79.40
80.56
2.81
0.721
6.99
6.42
6.73
8.25
9.28
2.02
0.821
1.71
0.97
a
1.59
2.72
b
1.45
0.40
0.035
Proteobacteria
3.27
2.07c
3.49
5.07d
3.52
0.94
0.265
88.52c
96.48d
96.36d
97.18d
94.25
2.08
0.026
Actinobacteria
8.42
c
6.78
d
2.63
3.93
2.46
0.087
Proteobacteria
3.35
3.76
2.31
2.30
2.76
1.06
0.766
87.72
88.3
88.77
88.14
89.76
2.55
0.982
4.44
3.46
5.63
6.46
3.85
1.08
0.220
c
c
d
1.25
1.61
0.35
0.049
2.15
1.90
1.75
0.43
0.887
Firmicutes
Colon/
d37
81.61
Actinobacteria
Firmicutes
Ileum/
d37
ATB
P-value
SCB
Firmicutes
CTRL
SEM
PA
Firmicutes
Feces/
d10
Treatments (n = 8 litters2/Treatment)
Bacteroidetes
Actinobacteria
1.03
Proteobacteria
2.07
1.21
2.32
1.72
2.30
1
Definition of acronyms: CTRL = No probiotic and no antibiotic; ATB = tiamulin and
chlortetracycline; PA = P. acidilactici; SCB = S. cerevisiae subsp. boulardii; PA+SCB = a
mixture of the two probiotics. Data are presented as means ± Pooled standard error of the
mean (SEM).
2
Two pig/litter were used (8 litters/treatment).
a, b
Means within rows for a same site/day tend to be different (P ≤ 0.10).
c, d
Means within rows are significantly different (P ≤ 0.05).
These results show that probiotic administration influenced the establishment of specific
bacterial families during lactation, which are considered for most as an important
constituent of the fecal microbiota. Consumption of PA influenced bacterial families from
the Phylum Firmicutes while SCB consumption was characterized by the modulation of
bacterial population belonging to the Bacteroidetes. Interestingly, the combined
63
administration of both probiotics did not reflect the individual effects of PA and SCB on
the fecal microbiota. To fully understand the impact of these specific modulations during
lactation, additional studies are needed to identify and functionally characterize these
microbial populations and to further evaluate the health beneficial impact of these specific
modulations on the intestinal and immune development of the young piglets.
Probiotic effects on fecal microbiota one week post-weaning
In North America, piglets are weaned early in life, usually between two and three weeks of
age. This step in the life of the piglet creates physiological and psychological stresses
which cause a decrease in food intake (166), important structural and functional changes in
the intestine (122), disruption of the microbiota (135) and finally, greater morbidity and
increased susceptibility to infections (92). The change in diet causes significant
disturbances in the intestinal microbiota by reducing the microbial diversity (333) with
major quantitative and qualitative changes observed immediately after weaning (140, 187).
In the North American swine industry, to mitigate the adverse effects of weaning, it is
customary to supplement the feed with low-dose of antibiotics. The addition of antibiotics
in the diet promotes weight gain of weaned animals and weakly prevent the growth of
pathogenic bacteria (49, 50). To be more consistent with the reality of the pig industry, at
weaning, we introduced a group of piglets receiving the same diet as CTRL group but
supplemented with chlortetracycline and tiamulin (ATB group). The antibiotics used in this
study are commonly employed by pig producers in North America in weanling feed to
improve performance and to prevent enteric and respiratory diseases. Therefore, the ATB
group was considered as a reference group.
Seven days after weaning (d28), bacterial counts on selective media showed that
administration of PA alone improved the quantity of cultivable bifidobacteria species
compared to CTRL piglets (P = 0.015; Figure 1b), and tended to decrease the amount of
Lactobacillus species in the feces of piglets when compared to animals receiving in-feed
antibiotics since weaning (ATB group; P = 0.100; Figure 1b). Moreover, our results
showed that co-administration of PA and SCB tended to increase the quantity of E. coli
compared to piglets from the ATB group (P = 0.098). Habitually, a pronounced domination
of bifidobacteria is observed over the entire breastfeeding period (181). Following weaning,
64
a decrease of anaerobic Gram-positive species, such as bifidobacteria, is observed in favor
of Gram-negative Bacteroides genus (140, 302). A decrease of lactobacilli in parallel with
an increase in enterobacteria was also described (91, 140, 187).
Figure 2. NMS triplot representation of T-RFLP fingerprints from the 16S rDNA of
the bacterial community in (a) feces on d10, (b) feces on d28, (c) ileal contents and (d)
colon contents from d37. Pigs were fed a basal diet (CTRL;
) or a basal diet
supplemented with either antibiotics (ATB;
), Pediococcus acidilactici (PA;
),
Saccharomyces cerevisiae subsp. boulardii (SCB;
), or PA and SCB (PA+SCB;
).
(a)
65
(b)
(c)
66
(d)
Trends obtained for lactobacilli and E. coli counts are difficult to explain since the bacterial
populations are still adapting to the introduction of the solid diet. The modulation of the
amount of some bacterial type by our probiotic treatments in comparison to the ATB group,
may be explained by the fact that, in healthy individuals, the microbiota stabilizes and
becomes characteristic of each, about two to three weeks after weaning (293). However, we
show that administration of PA alone kept the amount of bifidobacteria higher in the fecal
matter of piglets one week post-weaning. Bifidobacteria are considered as beneficial
bacteria and their presence is indicative of a healthy gut environment (153). P. acidilactici
is a high lactic acid producer. This feature may partly explain the result obtained; the high
production of lactic acid may lower the local pH thus promoting the development of other
bacteria or decrease the proportion of certain bacterial population more likely to favor other
bacterial types such as bifidobacteria.
Following T-RFLP analysis, results showed that probiotic treatments had no modulatory
effects on Eveness and Shannon-Weaver microbial diversity indices (Table 2), but
administration of a diet supplemented with chlortetracycline and tiamulin antibiotics
67
significantly decreased Eveness index compared to piglets receiving a basal diet (CTRL
group; P = 0.032). Surprisingly, the relative percentage of the different Phyla identified
with our clone library or with MiCA was not affected by the daily administration of our
treatments compared to CTRL piglets. Nonetheless piglets receiving SCB had a higher
proportion of Actinobacteria and Proteobacteria than piglets of the ATB group
(respectively, P = 0.008 and P = 0.079; Table 3). Following NMS triplot representation of
T-RFLP fingerprints obtained from d28 feces (Figure 2b), MRPP analysis indicated that
bacterial communities were significantly different in ATB piglets compared to CTRL group
(P = 0.025; Table 4), whereas animals receiving PA had slight differences in their fecal
microbiota composition compared to piglets from the CTRL group (P = 0.085).
Table 4. Multi-response permutation procedure (MRPP) testing for
differences in the composition of the microbial communities of feces
collected during lactation (d10) and one week post-weaning (d28), and of the
ileum and colon contents two weeks post-weaning (d37)1.
Agreement statistic A
Treatments1 tested
Feces d10
Feces d28
Ileum d37
Colon d37
PA vs. CTRL
SCB vs. CTRL
PA+SCB vs. CTRL
ATB vs. CTRL
PA vs. ATB
SCB vs. ATB
PA+SCB vs. ATB
0.024*
0.016
0.024*
0.024*
0.021
0.013
0.052**
0.020
-0.002
0.015
0.096**
0.006
0.036**
0.056**
-0.012
0.028*
0.012
-0.023
0.019
-0.007
-0.016
-0.018
0.011
-0.013
1
Definition of acronyms: CTRL = No probiotic and no antibiotic; ATB =
tiamulin and chlortetracycline; PA = P. acidilactici; SCB = S. cerevisiae subsp.
boulardii; PA+SCB = a mixture of the two probiotics. Two pig/litter were used
(8 litters/treatment). Data are presented as means ± pooled standard error of the
mean (SEM). Asterisks (*) denote statistically significant differences between
probiotics groups and CTRL and ATB groups (P ≤ 0.1 and P ≤ 0.05 for one and
two asterisks, respectively).
68
These results showed that, after only one week of consumption, in-feed administration of
antibiotics to piglets strongly influenced the global intestinal microbiota balance compared
with piglets fed a basal diet. Different studies have shown microbiota changes after the use
of several types of antibiotics, including those used in this study (47, 98, 263). The growthpromoting impact of antibiotics was first described in the 1940s. The increased growth and
feed efficiency promoted by in-feed administration of antibiotics may be due to alteration
of the microbiota of the GI tract. Suggested mechanisms of action have included
suppression of subclinical infections, a decrease in the levels of growth-depressing bacterial
metabolites, decreased consumption of nutrients by intestinal microbiota, and improvement
of nutrient uptake due to a thinner intestinal wall (98, 331). In this study, an antibiotic
effect was observed on the fecal micobiota of piglets one week post-weaning. However, we
did not observe any influence of our treatments on the feed consumption or the growth rate
of the piglets (data not shown). In our research facilities, sanitary conditions are excellent
and efficiency of antibiotics and probiotics has been shown to be more efficient on
performance when sanitary conditions are lessened (158, 167). Moreover, a modulation of
global fecal microbiota does not accurately reflect the complex microbiota of each gut
compartment especially that of the small intestine where nutrient uptake occurs and the
region where bacterial activity would therefore have the greatest influence on the animal
growth (98, 263).
The ISA from T-RFLP profiles of feces on d28 (Table 5) showed that the CTRL group was
the treatment with the highest impact on specific phylotypes. These phylotypes were
associated with the Porphyromonadaceae (89-bp), Ruminococcaceae (292-bp) and
Lachnospiraceae (278-bp) families. The 278-bp phylotype was also characteristic of the
ATB group. Finally, the 156-bp phylotype associated to the Clostridal Incertae Sedis XIV
family was representative of the fecal microbiota of piglets receiving SCB, while no
phylotype was found to be representative of the fecal microbiota of piglets receiving PA or
PA+SCB.
Taken together these results indicated that specific bacterial populations were slightly
modulated by our treatments. In fact the CTRL group was the one that had the greatest
impact on specific phylotypes. At this point, it is not clear how those modulations can be
beneficial for the development of the host. However, it seems clear that consumption of
69
antibiotics after weaning has a more important influence on the global fecal microbiota of
piglets than probiotic administration, in terms of diversity and composition. However, it
would be interesting to characterize the ileal and colonic microbiota of piglets at this same
age because even if no major modulatory effects of our probiotic treatment were observed
on the fecal microbiota, it does not mean that there is no effect on the microbial populations
of the different gut segments such as the ileum or the colon.
Table 5. Indicator species analysis (ISA) and phylogenic identification of modulated phylotypes
obtained from T-RFLP fingerprints in piglets feces during lactation (d10) and one week postweaning (d28), and in the ileum and colon digesta two weeks post-weaning (d37)1.
Site/
day
Phylotype*
(bp)
85
129
131
163
177
Feces/
d10
190
225
283
292
300
368
380
89
Feces/
d28
156
278
292
70
Bacterial
Identification
(Phyla; Family)
Bacteroidetes;
Flavobacteriaceae
Actinobacteria;
Bifidobacteriaceae
Firmicutes;
Eubacteriaceae
Firmicutes;
Incertae Sedis XIII
Firmicutes;
Lactobacillaceae
Firmicutes;
Peptostreptococcaceae
Firmicutes;
Ruminococcaceae
Actinobacteria;
Actinomycetaceae
Firmicutes;
Ruminococcaceae
Firmicutes;
Veillonellaceae
Proteobacteria;
Enterobacteriaceae
Firmicutes;
Unknown
Bacteroidetes;
Porphyromonadaceae
Firmicutes;
Incertae Sedis XIV
Firmicutes;
Lachnospiraceae
Firmicutes;
Ruminococcaceae
Indicator Value† (IV)
IVmax‡
PA
SCB
PA+
SCB
P-value
2
3
37
0
0.013
8
2
13
31
0.022
4
33
14
14
0.026
11
41
10
18
0.050
9
5
4
31
0.046
20
29
17
9
0.077
18
29
15
7
0.066
31
18
11
13
0.078
18
31
16
15
0.020
29
14
5
10
0.028
28
4
4
9
0.041
8
30
6
3
0.008
CTRL
ATB
29
2
8
15
3
0.062
4
6
4
34
8
0.003
26
28
4
1
0
0.032
31
17
16
15
16
0.064
Abundance in
group with
maximum IV2
(%)
5.14
[0.00; 14.26]
3.14
[0.00; 8.61]
5.23
[0.38; 25.64]
6.61
[0.00; 29.19]
12.26
[0.00; 44.20]
1.56
[0.00; 5.17]
2.76
[0.00; 7.77]
3.12
[0.51; 9.56]
5.93
[0.00; 16.48]
0.82
[0.00; 1.64]
2.60
[0.00; 9.42]
0.69
[0.00; 1.17]
3.38
[0.00; 13.07]
1.62
[0.00; 4.08]
1.91
[0.00; 6.76]
5.40
[0.00; 24.17]
Ileum/
d37
175
177
24
Colon/
d37
89
129
292
Firmicutes;
Lactobacillaceae
Firmicutes;
Lactobacillaceae
Firmicutes;
Ruminococcaceae
Bacteroidetes;
Porphyromonadaceae
Actinobacteria;
Bifidobacteriaceae
Firmicutes;
Ruminococcaceae
11
3
0
31
25
0.082
14
23
24
16
19
0.023
10
27
13
19
23
0.041
9
12
12
28
18
0.050
6
13
28
3
13
0.054
11
17
15
32
18
0.034
17.95
[0.00; 58.79]
69.23
[44.04; 85.25]
3.55
[0.00; 6.42]
2.79
[0.00; 5.62]
1.99
[0.00; 6.78]
2.45
[0.51; 11.11]
1
Definition of acronyms: CTRL = No probiotic and no antibiotic; ATB = tiamulin and
chlortetracycline; PA = P. acidilactici; SCB = S. cerevisiae subsp. boulardii; PA+SCB = a mixture of
the two probiotics.
*Only the peaks with P-value (< 0.1) are presented.
†
Indicator value (IV) = relative abundance × relative frequency. For each phylotype, the maximum IV
across the treatments is indicated in bold and underlined.
‡
Statistical significance of the maximum IV for a given phylotype across the treatments.
2
Data are presented as the mean abundance in treatment with maximum IV with the range of values
within brackets.
Probiotic effects on ileal microbiota two weeks post-weaning
At day 37, E. coli counts in the ileal digesta of pigs treated with PA+SCB were higher than
those of CTRL animals (P = 0.034; Figure 1c). On the other hand, addition of the
antibiotics in the weanling feed or the administration of either PA or SCB did not modulate
the different bacterial species quantified on selective media when compared to the CTRL
treatment.
Diversity index calculated from T-RFLP profiles showed that pigs from the PA and ATB
groups had lower Eveness and Shannon-Weaver indices than pigs from the CTRL group
(P = 0.041 and P = 0.013 for animals from the PA treatment and P = 0.050 and P = 0.036
for those of the ATB treatment, respectively; Table 2). Following the identification of each
T-RF with our clone library or with MiCA, T-RF grouping by Phylum membership showed
that pigs from the PA, SCB and ATB groups had a higher relative percentage of Firmicutes
than pigs from the CTRL treatment (P = 0.033, P = 0.014 and P = 0.023, respectively;
Table 3). Moreover, animals treated with PA had a lower quantity of Actinobacteria than
CTRL pigs (P = 0.041). The MRRP analysis of NMS triplot representation of T-RFLP
71
fingerprints (Figure 2c) revealed that bacterial communities from the ileum of pigs treated
either with PA, PA+SCB or ATB were significantly different than the ileal bacterial
community of CTRL pigs (P = 0.003, P = 0.048 and P = 0.023, respectively; Table 4),
whereas SCB animals tended to differ from ATB pigs (P = 0.069).
The gastrointestinal tract is the main digestive and absorptive organ in animals. The small
intestine has a huge absorptive surface. The gastrointestinal tract permits the uptake of
dietary substances into systemic circulation and it also excludes pathogenic compounds
simultaneously (97). The ileum microbial community is under different constraints, due in
part to the greater surface-to-volume ratio, the lower bacterial density, the active nature of
the ileal tissue (for example, through excretion of mucus) and the constant pressure from
the intestinal immune system. Probiotic consumption has shown to have direct effects on
other microorganisms or indirect effects by influencing the metabolism of other species and
genera of microbiota (189). Several possible mechanisms have been proposed, including
competition for adhesion to the epithelial lining, steric inhibition and stimulation of the
host’s immune system (46, 285). Our results showed an important influence of our
treatment on the global ileal microbiota. The most interesting fact is that administration of
antibiotics or PA affects in a similar way the global microbiota as observed with the
diversity indices, the Phylum relative abundance and the MRPP test on the NMS triplot
representation of T-RFLP fingerprints. Moreover, indicator species analysis (Table 5) from
ileal content showed that the 177-bp phylotype was characteristic of the PA and ATB
treatments with an important relative percentage around 69%. This phylotype was strongly
associated with the Lactobacillus amylovorus-like species, as suggest by our clone library.
While the 175-bp phylotype belonging to the Lactobacillaceae family was an indicator of
the SCB group and encompass about 18% of the ileal microbiota.
Recently it has been shown that the growth-promoting antibiotic chlortetracycline
modulates ileal microbiota of weaned piglets by decreasing the quantity of Lactobacillus
johnsonii and Turicibacter phylotypes and by increasing the number of L. amylovorus
bacteria (263). This last Lactobacillus species is abundant in the intestine of piglets and
found to possess probiotic properties, such as antimicrobial activity against enteric
pathogens in both in vitro and in vivo trials (155, 156, 270). Moreover, this lactobacilli
species is amylolytic and can therefore contribute to the metabolism of starch present in
72
large amounts in the diet (263) and have a potential impact on weight gain of the animals,
as observed in other studies using PA (64, 165) or chlortetracycline (263).
Altogether, the results showed that administration of antibiotics and PA reduced ileal
microbiota diversity and promoted the establishment of Firmicutes in the ileum of weaned
piglets by increasing the amount of L. amylovorus-like bacteria. However, their influence
on microbite was different based on microbial richness. It is interesting to note that
administration of PA+SCB abolished the effects observed on the ileal microbiota when PA
or SCB were given alone: by increasing E. coli counts, by reducing the relative percentage
of Firmicutes and by increasing Evenness and Shannon indices to values comparable to
those obtained for the CTRL group.
Probiotic effects on colonic microbiota two weeks post-weaning
Counts on selective media showed that administration of PA+SCB increased the quantity of
E. coli in the colon content of pigs two weeks post-weaning (d37) compared to ATB
animals (P = 0. 086; Figure 1d). Diversity indices calculated from T-RFLP profiles
highlighted a strong effect of SCB administration on colonic microbiota following
weaning. In fact, Eveness and Shannon-Weaver index obtained for SCB pigs were
significantly higher than index obtained for the CTRL group (P = 0.014 and P = 0.019,
respectively; Table 2). On the other hand, the relative percentage of the Actinobacteria was
modulated upward by the daily administration of PA when compared to CTRL and ATB
treatments (respectively, P = 0.022 and P = 0.050; Table 3). Despite these results, MRPP
testing for differences in NMS triplot representation (Figure 2d) of T-RFLP fingerprints
from colonic content did not show any modulatory effect of our probiotic treatments or
antibiotic administration compared to CTRL pigs (Figure 2d; Table 4). Finally, ISA
showed that ATB animals were characterised by the 24-bp phylotype identified as bacteria
from the Ruminococcaceae family, whereas PA pigs were differentiated from other
treatments by the 129-bp phylotype (Bifidobacteriaceae family) and SCB pigs by the 89and 292-bp phylotypes which referred to bacteria belonging to the Porphyromonadaceae
and to the Ruminococcaceae family, respectively (Table 5).
Although most ingested nutrients are digested along the small intestine, a small percentage
of food components including dietary fiber, resistant starch, and some proteins, remain
73
undigested. These ingredients are used and fermented by colonic microbiota to derive their
own energy and to produce metabolites that play a key role as well in the host energy
homeostasis. Indeed, the microbiota ferments undigested carbohydrate residues
preferentially in the proximal colon, yielding short-chain fatty acids and the gases hydrogen
and methane. Our results showed that consumption of SCB alone significantly influenced
the colonic microbiota as observed with the diversity indices and influence the
establishment of the Porphyromonadaceae and the Ruminococcaceae bacterial families. In
the colonic microbiota, these two families are among the most metabolically active (111),
moreover Rumicococcaceae have been shown to play an important role in the colonic
fermentation by using the undigested pectin and cellulose fiber present in the digesta to
produce butyrate (266). Butyrate is the main energy source for colonic epithelial cells,
being preferred over circulatory glucose or glutamine, and up to 90% of it is metabolized
by colonocytes (268). There is also evidence indicating that butyrate reinforces the colonic
defense barrier by inducing the secretion of mucins, trefoil factors, and antimicrobial
peptides (341). These effects can be of great interest in concern with the defense against
intestinal pathogen and overall colonic health conditions.
Our results also demonstrated that piglets from the PA group maintained a higher relative
abundance of Actinobacteria which could be in part reflected by the 129-bp phylotype.
According to the results obtained with our clone library this phylotype was associated with
the Bifidobacterium species. Habitually, a high proportion of bifidobacteria is associated
with a healthy intestinal condition (153). However, in our case this phylotype only
represented an average of 1.99% of the total colonic microbiota. With such a low
percentage it is difficult to say if there was a real impact on the health of the host.
Nevertheless, the T-RFLP technique only represents the relative amount of bacteria in an
environment and not the metabolically active microorganisms in this environment (306).
More research is needed to fully understand the impact of such changes on general
intestinal health, whether for the effect of PA on the bifidobacteria or the influence of SCB
on the Ruminococaceae and Porphyromonadaceae families.
As observed previously with the ileal content analyzed, administration of PA+SCB seemed
to abolish the individual effects of each microorganism on the colonic microbiota. In
contrast to what was observed in the ileum, the impact of SCB on the colonic microbiota
74
appeared to be abrogated by the presence of PA. This effect was also observed in one of our
previous studies using the RISA (ribosomal intergenic spacer region analysis) technique to
monitor changes in the colonic microbiota of piglets treated at birth with or without PA
and/or SCB and weaned piglets fed with control diet supplemented with PA and/or SCB or
antibiotic (94). The antagonistic effect between the two microorganisms may be caused by
multiple factors. However, one fact is that S. cerevisiae subsp. boulardii can bind through
the mannose residues located on the outer membrane, bacteria such as E. coli and
Salmonella (51, 101). Therefore, it could be possible that following ingestion, the two
microorganisms bind together in the stomach or in the upper gut to form an aggregate
which would be naturally cleared leaving an insufficient amount of probiotic in the gut.
However, the administration of both probiotics had a modulatory effect on specific colonic
bacterial families before weaning and a higher quantity of E. coli was obtained on selective
medium for all sampling sites after weaning. Post-weaning diarrhea caused by
enterotoxigenic E. coli, is a major health problem in swine that results in significant
financial losses in pig production (82). A high quantity of E. coli in the intestinal
microbiota of piglets after weaning could improve the competitive exclusion against
pathogenic E. coli, therefore, reducing the risk of infection. This possible effect of coadministration of PA and SCB requires further investigations. Nevertheless, an important
fact that comes out from our results is that co-administration of two probiotics will not
necessarily show the positive effect of each one given alone. Further research is therefore
required to demonstrate the positive health effect of probiotic cocktail, just as it is required
for a single strain.
In conclusion, this study demonstrated first that probiotic consumption did not significantly
modulate the global fecal microbiota balance of piglets during lactation, but the
administration of P. acidilactici alone or in combination with S. cerevisiea subsp. boulardii
had an impact on the establishment of specific bacterial populations. Secondly, we showed
that after only one week of consumption, in-feed administration of antibiotics to piglets
strongly influenced the global fecal microbiota balance compared with piglet fed a basal
diet, while SCB alone increased the proportion of Actinobacteria and Proteobacteria. Most
interestingly, we observed after weaning that the probiotics used in this study greatly
influenced in a strain dependent manner the intestinal microbiota of weaned piglets.
75
Administration of SCB alone increased the colonic microbiota diversity and promoted the
establishment of the Porphyromonadaceae and Ruminococcaceae bacterial families. On the
other hand, PA consumption had a major impact on the ileal microbiota, as observed with
the in-feed administration of antibiotics to piglets. These treatments had a important
modulatory effect by decreasing the ileal diversity, while increasing the Firmicutes
proportion and a specific bacterial population associated with the L. amylovorus-like
species. Finally, our study clearly demonstrated that the co-administration of both probiotic
strains do not reflect their individual effect on the fecal, ileal and colonic microbiota, but
has its own influence on the microbiota.
Acknowledgments
This work was supported by the Coopérative Fédérée du Québec, la Fédération des
producteurs de porc du Québec, the Institut Rosell-Lallemand, and Agriculture and AgriFood Canada’s Matching Investment Initiative (MII). The authors would like to thank
Steve Methot, statistician at the Dairy and Swine R&D Centre, for performing the statistical
analyses, David Roy for his involvement in the establishment of the clone library and all
employees who took care of the animals and collected data during the project.
76
Chapitre 2 : Effets de Pediococcus acidilactici et
Saccharomyces cerevisiae ssp. boulardii sur l’immunité
intestinale et systémique du porc suite à une infection
expérimentale à Salmonella Typhimurium DT104
Résumé
Nous avons évalué chez le porcelet l’influence d’administrer une alimentation de base ou
supplémentée avec PA et/ou SCB ou des antibiotiques sur l’immunité intestinale et la
résistance lors d’une infection expérimentale avec Salmonella Typhimurium DT104 (ST).
Les probiotiques ont été administrés quotidiennement par voie orale (lactation) et via
l’alimentation (post-sevrage). À 43 jours d'âge, les porcs ont été infectés avec ST. Après 24
heures des échantillons de sang et d’intestins ont été recueillis pour évaluer la colonisation
microbienne, la quantité d’IgA sécrétoire, l’expression de cytokines et les populations de
cellules immunitaires des ganglions mésentériques (GM) et du sang. Les résultats obtenus
ont démontré que l’administration de SCB seul ou avec PA module la concentration de
certaines populations cellulaires du sang avant et suite à l’infection, cependant aucun effet
n’a été observé sur la colonisation du pathogène, la sécrétion d’IgA, les populations
cellulaires des GM ou l’expression des cytokines.
77
Title: Effects of Pediococcus acidilactici and Saccharomyces cerevisiae
subsp. boulardii on systemic and gut immunity in pigs challenged with
Salmonella Typhimurium DT104.
J.-P. Brousseau1,2, A. Lettelier3, F. Beaudoin1, K. Lauzon1, J.-F. Daudelin1, D. Roy2 and
M. Lessard1*
1
Dairy and Swine Research and Development Centre, Agriculture and Agri-Food Canada,
Sherbrooke, Québec, J1M 1Z3 Canada; 2Université Laval, Québec, Québec, G1V 0A6
Canada and 3Université de Montréal, Faculté de Médecine Vétérinaire, St-Hyacinthe,
Québec, J2S 7C6 Canada Lévis, Québec, G6V 9V6 Canada.
*Corresponding author: [email protected]
Short Title: Effects of probiotics following a S. Typhimurium infection
Key Words: probiotic, Pediococcus acidilactici, Saccharomyces cerevisiae subsp.
boulardii, pig, immunity, in-feed antibiotics, Salmonella Typhimurium DT104
Manuscrit en préparation pour soumission à Journal of Animal Science.
78
Abstract
In this study, the influence of the probiotics Pediococcus acidilactici (PA) and
Saccharomyces cerevisiae subsp. boulardii (SCB) on intestinal immune traits and
resistance to Salmonella Typhimurium DT104 infection was evaluated in pigs. At birth,
different litters of pigs were randomly assigned to one of the following treatments:
1) control group without probiotics or antibiotics (CTRL); 2) reference group in which
chlortetracyclin and tiamulin were added to weanling feed (ATB); 3) PA, 4) SCB or
5) PA+SCB. Probiotics were administered daily during lactation (1×10 9 cfu) and after
weaning. At 43 days of age, all pigs were orally challenged with S. Typhimurium DT104
strain, and a necropsy was performed 24 h post-challenge (24 hpc). Intestinal samples were
collected to evaluate microbial colonization, secretory IgA production, mesenteric lymph
nodes (MLN) cell populations and ileal cytokine expressions. Blood samples were
collected before challenge (d39) and 24 hpc to analyze immune cell populations.
On d39, blood cell populations from the PA+SCB group showed a higher percentage of
CD8+ T cells compared to ATB (P=0.045) and a higher percentage of CD8+high cells than
CTRL (P=0.024) and ATB (P=0.016) groups. Moreover, the PA+SCB group had a lower
percentage of macrophages compared to CTRL (P=0.024) and ATB (P=0.019). Finally,
pigs from the SCB group showed a tendency to have more CD4+CD8+ T cells on d39 than
CTRL (P=0.069) and ATB (P=0.072). On d44, the blood CD4+ cells from pigs of the SCB
and PA+SCB groups had a tendency to be lower than the CTRL group (P=0.077 and
P=0.060, respectively). The CD8+ cells tended to be higher in the blood of the ATB and
PA+SCB groups than the CTRL (P=0.071 and P=0.058, respectively). Finally, on d44
piglets had a higher percentage of blood macrophages and CD4+CD8+ T cells than on d39
(P<0.0001 and P=0.008, respectively), while B cells percentage was decreased (P<0.0001).
Neither the pathogen colonisation, IgA production, MLN cell populations nor the cytokine
expressions analyzed in this study were modulated by the probiotic treatments.
Nonetheless, the IL-4 expression in the ileum mucosa was lower in the ATB group
compared to the CTRL (P=0.014).
79
In conclusion, even if the administration of SCB alone or in combinaison with PA are
effective in modulating the concentration of some immune blood cell populations, neither
of the probiotic treatments were able to influence the pathogen colonisation, MLN cell
populations or cytokine expression 24 hpc. However, it does not mean that the probiotic
effects highlighted in this study could not be a effective mechanism in reducing the time of
the Salmonella infection or the duration of the shedding period, but more research is needed
to confirm this hypothesis.
Introduction
In North America, antimicrobials are commonly added to the weaning diet of pigs to
stimulate growth and to control or treat gastrointestinal infection (195). This practice is
severely criticized due to the possible emergence of antimicrobial resistance in the pig’s
microbiota. Among the alternatives, probiotics are considered good candidates because they
have the potential to enhance intestinal barrier properties (234), modulate bacterial
populations in the gut (94), stimulate the immune system (60) and the production of
cytokines by enterocytes and immune cells (56, 296).
Probiotics such as Pediococcus acidilactici (PA) and Saccharomyces cerevisiae subsp.
boulardii (SCB) are currently used in swine production and they have been shown to
improve intestinal defenses against microbial infection and increase performance in
different monogastric animals (105, 114). For instance, Pediococcus can inhibit Salmonella
growth in vivo (145), whereas Saccharomyces has been reported to stimulate intestinal
immunity and has the potential to link flagellated bacteria on its surface (30, 101). Our
laboratory observed a decrease in bacterial translocation to mesenteric lymph nodes (MLN)
in weaned pigs treated with PA, SCB or both, following an enterotoxigenic Escherichia
coli O149:F4 (ETEC F4) challenge (172). We also showed that PA or SCB are effective in
reducing attachment of ETEC F4 to ileal mucosa of weaned pigs but only PA modulated
the expression of intestinal inflammatory cytokines (56). However, the positive effects of
probiotic administration observed in those studies may not be the same with another type of
enteropathogenic bacteria. Therefore, the influence of PA, SCB or both on the intestinal
epithelial barrier and immunity in pigs after a Salmonella infection was evaluated. To do
80
so, we analysed pathogen colonization and translocation, the IgA production, the
expression of intestinal cytokines and immune cell populations in blood and MLN.
Materials & methods
Animals and treatments
The animal use protocol was reviewed and approved by the Dairy and Swine Research and
Development animal care committee and followed the principles established by the
Canadian council on animal care (37). The experimental protocol has been
already
described previously (56), however a brief description is provided to facilitate
understanding.
A total of 40 Yorkshire-Landrace gilts obtained from La Coop fédérée (Montreal, QC,
Canada) and housed at Agriculture and Agri-Food Canada’s Dairy and Swine Research and
Development Centre (Sherbrooke, QC, Canada) were used to carry out the experiment.
Two batches of 20 gilts were constituted and each batch of gilts was used in two successive
parities over a two-year period. Regu-Mate (Intervet Canada Ltd., Whitby, ON, Canada)
was used to synchronize oestrus, and sows were inseminated twice with the same tested
semen provided by the Centre d’insémination porcine du Québec inc. (St-Lambert-deLauzon, QC, Canada). Among an expected total of 80 litters, 40 were used as described
below.
Twenty-eight days before parturition (day -28), pregnant sows were allocated to one of the
five treatment groups using a complete randomized block design. Three groups of sows and
their litters were assigned to one of the following treatments: Pediococcus acidilactici
(strain MA18/5M, Lallemand Animal Nutrition, Blagnac, France), Saccharomyces
cerevisiae subsp. boulardii (strain SB-CNCM I-1079, Lallemand Animal Nutrition), or
P. acidilactici in combination with S. cerevisiae subsp. boulardii. The other two groups
were used as reference and control groups respectively; piglets of the reference group
received at weaning a diet supplemented with chlortetracycline and tiamulin antibiotics
(ATB) and those of the untreated control group (CTRL) were fed weanling basal diet
without ATB or probiotics. For both groups, sows and their litters remained untreated
throughout the gestation and lactation periods. The antibiotics used in this study are
81
commonly used by pig producers in North America in weanling feed to improve
performance and to prevent enteric and respiratory diseases. Therefore, the ATB group was
considered as a reference group. The sows assigned to the probiotic treatments received 2.5
× 109 cfu from day -28 to day -14, 3.5 × 109 cfu from day -14 to day 0 (parturition), and 6 ×
109 cfu from day 0 to day 21. In the P. acidilactici + S. cerevisiae subsp. boulardii group,
both probiotics were simultaneously given at the indicated concentrations above. The
probiotic doses were mixed with 500 g of feed and given to the sows before the morning
meal. The daily feed ration given to the sows was 2.5 kg from day -28 to day -14, 3.5 kg
from day -14 to day 0, and ad libitum during the lactation period (day 0 to day 21). The
groups of sows were housed in different pens located in different sections of the gestation
room to prevent cross-contamination between the treatments. One week before farrowing,
the sows were transferred to rooms allocated to different treatments in the maternity
section. From each batch of 20 gilts, 10 gilts and their piglets (two litters per treatment)
were randomly chosen. Within the first 24 h after parturition, litter size was adjusted to 12
piglets and, if necessary, adoptions were carried out from litters assigned to the same
treatment.
Table 1. Nutrient composition of the weaning diet (d21 to d44)
Nutrient
82
Concentration
Protein, %
21.5
Fat, %
7.52
Fiber, %
2.34
Calcium, %
1.00
Phosphorus, %
0.76
Sodium, %
0.2
Copper, mg/kg
128.17
Zinc, mg/kg
138.41
Vitamin A, IU/kg
11,500
Vitamin D, IU/kg
1,140
Vitamin E, IU/kg
56
Twenty-four hours after birth, the pigs started to receive orally the same probiotic treatment
as their mother by means of disposable pipettes. In the probiotic groups, the daily dose of
each probiotic was 109 cfu diluted in 2 mL peptone water. The pigs in the control and
reference groups (CTRL and ATB, respectively) received 2 mL peptone water alone. The
probiotics suspension or peptone water was given daily during lactation and after weaning
at 21 days of age (d 21) until d 28. At weaning, all pigs were transferred to their respective
pens to prevent cross-contamination. Pigs having received probiotics during the lactation
were also fed a basal diet enriched with the same probiotic at 2 × 109 cfu/kg. The pigs in
the ATB group received the same diet supplemented with chlortetracycline (110 ppm active
ingredient/kg) and tiamulin (31.2 ppm active ingredient/kg). The basal diet was provided
by La Coop fédérée (Table 1). Feed and water were available ad libitum to the weaned pigs.
Salmonella Typhimurium strain and experimental challenge
The Salmonella enterica serovar Typhimurium 4393 DT104 strain used in the challenge
study was kindly provided by Dr. Ann Lettelier from the Faculté de médecine vétérinaire
(Saint-Hyacinthe, QC, Canada) of the Université de Montréal. At 39 days of age, one pig
from each litter was transferred to a level 2 biosecurity containment facility (Canadian
Food Inspection Agency, Saint-Hyacinthe Laboratory, QC, Canada). The pigs were housed
in groups (one pen per treatment group). Four days after transfer (d 43), the pigs were
orally challenged with 5x108 cfu S. Typhimurium DT104 strain in 5 mL Nutritive broth
(Difco Laboratories, Inc., Detroit, MI, USA). Inoculum was administered with a seringue
directly in the throat of the pig. The pigs were evaluated for general appearance, attitude,
dehydration, food and water intake, and presence of diarrhea, in accordance with the
guidelines of the Canadian Council on Animal Care, and were euthanized 24 h postchallenge (hpc), on d44. Necropsies were performed and samples of mesenteric lymph
nodes (MLN), ileal tissue and intestinal contents were collected always at the same location
for all the pigs for further analysis.
Microbiological analysis of intestinal contents and MLN
Following euthanasia, intestinal contents from the ileum and proximal colon were sampled
and serially diluted for enumeration of the probiotics and the S. Typhimurium DT104
challenge strain. Plates containing LAMVAB agar (125) were used for the detection of P.
83
acidilactici. The plates were incubated aerobically for 48 h at 37°C. Potato dextrose agar
(BD Biosciences, Mississauga, ON, Canada) adjusted to pH 3.5 with sterile tartaric acid
(10% solution), to inhibit bacterial growth, was used for the detection of S. cerevisiae
subsp. boulardii. The yeast plates were incubated at 30°C for 48 h. To enumerate the
S. Typhimurium DT104 strain in the intestinal contents, plate containing Hektoen Agar
(Oxoid Company, Nepean, ON, Canada) supplemented with ampicillin at 200 μg/mL
(Sigma-Aldrich Canada Ltd., Oakville, ON, Canada) were used. The plates were incubated
aerobically for 24 h at 37°C.
For the detection of viable S. Typhimurium DT104 in ileocecal MLN, 200-300 mg of
tissue, lightly washed in phosphate-buffered saline (PBS), was homogenized for 5 s using a
Polytron homogenizer (Kinematica Inc., Bohemia, NY, USA) in 2-3 mL sterile PBS. Serial
dilutions were done and then plated on Hektoen Agar supplemented with ampicillin at
200 μg/mL.
Measurement of secretory IgA in ileal mucosa
A 5 cm segment of ileum taken approximately 20 cm from the cecum was used for
quantification of secretory IgA (sIgA). First, the mucosa from the segment was scraped and
homogenized using microscope slide in 5 mL PBS. The sample was centrifuged for 10 min
at 500 x g then passed on 0.2 μm filter and finally frozen at −20°C until analysis. The
secretory IgA in the ileal mucosa was measured using a Pig IgA ELISA Quantitation Kit
(Kit E100–102; Bethyl Laboratories Inc., Montgomery, TX) following manufacturer
instructions.
Isolation of leukocytes from blood and MLN
Twenty-four hpc, jugular blood samples (10 mL) were collected from piglets on d44 using
sodium heparin (143 USP units) Vacutainer® tubes (BD Biosciences, Mississauga,
Ontario, Canada). A blood sample was also collected on d39 before the transfer of pigs for
Salmonella challenge. Peripheral blood mononuclear cells were obtained by layering blood
on Ficoll-Paque PLUS (GE Healthcare, Baie d’Urfe, Quebec, Canada) and processed as
described by Lessard and colleagues (171). For cell labeling, 106 cells suspended in PBS
containing 0.5% BSA were added to the wells of round-bottom 96-well microplates
84
(Corning Life Sciences, New York, NY). The cells were marked as described in the section
Flow Cytometry Analysis.
After blood collection, pigs were anesthetised with ketamine (10 mg/Kg) and xylazine
(Rompun®, 5 mg/Kg) before being euthanized with euthanyl (107 mg/Kg) (CDMV, StHyacinthe, Canada). Gastrointestinal tract was excised and mesenteric lymph nodes were
collected and placed in cold Hank’s basal salt solution (HBSS; Invitrogen Canada Inc.,
Burlington, Ontario, Canada) supplemented with a solution of antibiotic and antimycotic
(10 000 U penicillin, 10 000 ug streptomycin, 25 ug fungizone) (Invitrogen, Burlington,
Ontario, Canada) for transportation. In the laboratory, MLN were minced with scissors in a
Petri dish containing HBSS and pass into a 5-mL syringe. The suspension obtained was
transfered into a 15 ml conical tube and tissue debris were left to settle for 5 min, thereafter,
each cell suspension was carefully layered on Ficoll-Paque PLUS (GE Healthcare, Baie
d’Urfe Quebec). Tubes were centrifuged at 750 × g for 40 min at 20°C, and the cells
collected at the interface were washed 3 times in HBSS. Labelling was done using 106 cells
suspended in PBS containing 0.5% BSA and added to the wells of round-bottom 96-well
microplates (Corning Life Sciences).
Flow Cytometry Analysis
Mononuclear cells from the blood and MLN were labeled for flow cytometry according to
the procedure described by Lessard et al. (171) to characterize CD4+, CD8+, double positive
CD4+CD8+
and γδ-T lymphocyte populations,
B-lymphocytes,
monocytes, and
macrophages. Ice-cold PBS containing 0.5% BSA was used to dilute antibodies. The
different antibodies used and their cell specificity are presented in Table 2. Labeling of
CD4+ T cells and γδ-T lymphocytes were done with mouse monoclonal antibodies,
followed by their respective isotype of goat anti-mouse Ig conjugated to fluorescein (FITC;
Southern Biotechnology Associates Inc., Birmingham, AL). The B lymphocytes were
directly labeled with a goat anti-pig IgG conjugated to FITC (Jackson Immunoresearch
Laboratories Inc., West Grove, PA) and with a mouse monoclonal antibody against swine
CD21 followed by an anti-mouse IgG1 conjugated to phycoerythrin (rPE; Southern
Biotechnology Associates Inc., Birmingham, AL). Labeling of CD8+ lymphocytes and
monocytes/macrophages population were done with mouse monoclonal antibodies, the
85
second step of the staining was done with their respective isotype of goat anti-mouse Ig
conjugated rPE. Double-labeling was used for CD4 and CD8 by incubating them with antiCD4-FITC and anti-CD8-PE simultaneously. Finally, NK cells were labeled with a biotin
conjugated anti-CD16 mouse monoclonal antibodies, followed by streptavidin PE-Cy™5
conjugate (BD Biosciences, Mississauga, Ontario, Canada). The cells were resuspended in
PBS containing 1% formaldehyde and transferred to tubes. They were analyzed with an
Epics XL-MCL flow cytometer using the Expo 32 Software (Beckman-Coulter,
Mississauga, Ontario, Canada).
Table 2. Swine-specific antibodies used to characterize different populations of
leukocytes isolated from blood and mesenteric lymph nodes.
Clone name
Source
Type of cells
identified
Isotype
CD4
74-12-4
VMRD
T cells
IgG2b
CD8
PT36B
VMRD
T cells
IgG1
Jackson Immun. Lab.
B cells
Specificity
IgG (H+L chain)
CD21
BB6-11C9
VMRD
B cells
IgG1
SWC3
74-22-15A
VMRD
Monocytes and
macrophages
IgG2b
CD16
FcG7
BD Biosciences
NK cells
Biotinated
PGBL22A
VMRD
T cells
IgG1
γδ T cells
RNA extraction and cDNA synthesis
At necropsy, pieces from MLN and ileal slices taken approximatly 20 cm from the
ileocecal junction were immediately frozen in liquid nitrogen and stored at -80°C until
RNA extraction. Total RNA was extracted from MLN samples and ileal slices using a
tissue RNA extraction kit (RNeasy Plus kit from QIAGEN Inc., Toronto, ON, Canada).
Briefly, 60-100 mg of MLN or a ileal slice beetween 200-300 mg was homogenized 5 s in
RLT buffer containing 2-Mercaptoethanol (Sigma-Aldrich Canada) using a Polytron
86
homogenizer (Kinematica). Then an aliquot corresponding to 20 mg of tissue was used for
total RNA extraction following the manufacturer’s recommendations. The RNA was eluted
in 50 μL ultrapure water provided in the kit supplemented with SUPERase•In at 1 U/μL
(Applied Biosystems Inc., Foster City, CA, USA). Total RNA was quantified using a
NanoDrop spectrometer (NanoDrop Technologies, Inc., Wilmington, DE, USA) at a
wavelength of 260 nm. The RNA integrity was confirmed by examination of the presence
of the 18S and 28S ribosomal bands on agarose gels stained with ethidium bromide before
proceeding to gene expression analysis. To eliminate possible contamination by genomic
DNA, aliquots of 8 μg were treated with DNase I (Applied Biosystems/Ambion, Austin,
TX, USA) following instructions. Total RNA was quantified again with a NanoDrop
spectrometer (NanoDrop Technologies) and purity was assessed by determining the ratio of
absorbance at 260 and 280 nm (A260/A280). All samples had a ratio between 1.8 and 2.0. A 1
μg aliquot of total RNA was reverse-transcribed with Superscript II reverse transcriptase
(Invitrogen Canada) using oligo (dT)12-18 primer (Invitrogen Canada) in a final volume of
20 μL, according to the supplier’s instructions. The cDNA samples were diluted 1:15 in
nuclease-free water and aliquots were stored at -20°C prior to real-time PCR analysis.
Quantification of cytokine gene expression by real-time PCR
Real-time PCR was performed with a 7500 Fast Real-Time PCR System (Applied
Biosystems) to evaluate the expression of the cytokines listed in Table 3. The PCR mixture
was composed of the following: 5 μL Power SYBR Green Master Mix (Applied
Biosystems), 0.1 μL AmpErase uracil-N-glycosylase (Applied Biosystems), each set of
gene specific primers (Applied Biosystems) at the indicated concentrations (Table 3), 3 μL
of diluted 1:15 cDNA and completed to a final volume of 10 μL with molecular grade
water (Invitrogen Canada). The primers were designed using the IDT SciTools
PrimerQuest
software
(IDT
SciTools
PrimerQuest
Software,
Integrated
DNA
Technologies, Inc.) and selected using the following criteria, when possible: (1) both
forward and reverse primers encompass two consecutive exons; and (2) no more than two
guanines or cytosines within the last five nucleotides in the 3’ termini. Moreover, the
primer pairs used were optimised to have an efficiency variation lower than 10% between
87
them. With the primers used, the measured efficiency was between 81% and 91%. The
PCR cycling conditions used were in accordance with the manufacturer’s protocol.
All the cDNA samples in this experiment were analyzed for the expression of three
different reference genes: beta-actin (ACTB), glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) and cyclophilin A (PPIA). These three reference genes are commonly used in in
vivo experiments similar to that of our study (26, 45, 73). Statistical analyses were
performed and results indicated that ACTB was the most stable reference gene for use in
our experiment, as its expression was not altered by the treatments administered to pigs in
contrast to the two other reference genes tested (data not shown).
Table 3. List of genes and sequences of the primers used for real-time PCR*.
mRNA
target1
IL-4
IL-6
IL-10
IFN-γ
TNF-α
ACTB
Oligonucleotides (5' → 3')2
F:GGTCTGCTTACTGGCATGTACC
R:CTCCATGCACGAGTTCTTTCTC
F:GGAAATGTCGAGGCTGTGCAGATT
R:GGTGGTGGCTTTGTCTGGATTCTT
F:GATATCAAGGAGCACGTGAACTC
R:GAGCTTGCTAAAGGCACTCTTC
F:AGGTTCCTAAATGGTAGCTCTGGG
R:AGTTCACTGATGGCTTTGCGCT
F:CACTGACCACCACCAAGAATTGGA
R:CATTCCAGATGTCCCAGGTTGCAT
F:CTCTTCCAGCCCTCCTTCCT
R:GCGTAGAGGTCCTTCCTGATGT
Product size
(bp)
117
87
137
101
94
104
Final
concentration
(nM)3
150
150
300
300
300
300
300
300
300
300
300
300
*From Daudelin et al. (56).
1
Definition of acronyms : IL = interleukin; IFN = interferon; TNF = tumor necrosis factor;
ACTB = β-actin.
2
F and R indicate forward and reverse primers, respectively.
3
Final concentration of forward (F) and reverse (R) primers.
The relative gene expression was assessed by the 2-ΔΔCT method (178), in which the PCR
cycle used for quantification (CT, threshold cycle) has been replaced by the term Cq
(quantification cycle), according to the recommendations of the RDML (real-time PCR
88
Data Markup Language; http://www.rdml.org) data standard. ΔΔCq values were calculated
according to the formula ΔΔCq = (Cq,TGCTRL – Cq,ACTBCTRL) – (Cq,TGTRT –
Cq,ACTBTRT), in which Cq,TG correspond to the quantification cycle of the target gene
and Cq,ACTB correspond to the quantification cycle of the ACTB gene for the animal of
the CTRL group and the other treatment (TRT) groups.
In order to confirm the specificity of the measured amplicons (i.e. the presence of one
amplicon), the melting curve was systematically analyzed for all samples. Each run
included a no-template control to detect DNA contamination of the reagents and each
reaction was performed in triplicate.
Statistical analysis
Data were analyzed as a randomized complete block design with the litter as the
experimental unit. The MIXED procedure of SAS (SAS Institute Inc., Cary, NC, USA) was
used to perform statistical analyses on the measured variables with a model including the
fixed treatment effect (five groups) and the challenge effect as the random blocking factor.
Treatment comparisons were further evaluated by testing the probiotic treatments (three
groups) against the control and reference groups (CTRL and ATB) using a Dunnett’s
adjustement for multiple testing.
Results
Probiotic counts and clinical signs
All pigs used for the challenge were in good health and their growth rate was comparable
between all treatments (data not shown). The probiotics P. acidilactici and S. cerevisiea
subsp. boulardii were only detected in intestinal content of pigs receiving daily dose of PA,
SCB or PA+SCB. Mean concentrations of P. acidilactici and S. cerevisiea subsp. boulardii
were respectively around 104 cfu/g of ileum content and 105 cfu/g of colon content in pigs
treated with PA, SCB or both.
Clinical signs of salmonellosis were evident at slaughtering as all pigs showed moderate to
very liquid feces. This observation was supported by the presence of viable
S. Typhimurium bacteria in the ileal and colon contents as well as in the MLN of all
89
challenged pigs (Table 4). However, Salmonella counts were not affected by probiotic or
antibiotic treatments. In the same way, IgA concentration in the ileum mucosa did not
differ between treatments 24 hpc (Table 4).
Table 4. Influence of probiotic and antibiotic treatments on S. Typhimurium DT104 counts
in intestinal contents and MLN and concentration of IgA in ileal mucosa of pigs1.
Treatments (Tr; n = 8 litters2/Tr)
P-value
CTRL
ATB
PA
SCB
PA+SCB
SEM
Trt
Ileum content3
4.79
4.49
4.46
4.82
5.03
0.39
0.663
Colon content3
5.00
4.41
4.98
5.19
5.22
0.47
0.677
MLN3
4.41
4.61
4.19
4.03
4.29
0.20
0.287
Ileal mucosa
sIgA4
56.53
58.99
55.49
48.77
44.96
7.35
0.493
1
Definition of acronyms: CTRL = No probiotic and no antibiotic; ATB = tiamulin and
chlortetracycline; PA = P. acidilactici; SCB = S. cerevisiae subsp. boulardii;
PA+SCB = a mixture of the two probiotics; SEM = Pooled standard error of the mean; Trt =
P-value for the Treatment effect.
2
One pig/litter was used.
3
Results are expressed as Log10 cfu of S. Typhimurium DT104 /g of content or tissue.
4
A 5 cm segment of ileum was scraped and homogenized using microscope slide in 5 mL PBS
solution. Results are expressed as μg of sIgA /mL of PBS solution.
Effect on leukocyte populations
Leukocyte populations in the blood of pigs before and after Salmonella challenge are
reported in Table 5. Before challenge (d39), pigs of the PA+SCB group showed a higher
percentage of CD4‾CD8+ lymphocytes than the ATB group (P = 0.045) and a higher
percentage of CD4‾CD8+high cells than pigs of the CTRL and ATB groups (P = 0.024 and P
= 0.016, respectively). Moreover, the percentage of macrophages was reduced in pigs from
the PA+SCB group on d39 compared to CTRL and ATB groups (P = 0.024 and P = 0.019,
90
respectively). Finally, pigs from the SCB group tended to have more CD4+CD8+
lymphocytes before challenge than pigs from the CTRL and ATB groups (P = 0.069 and
P = 0.072, respectively).
Table 5. Proportion (%) of blood leukocyte populations before (d39) and after
S. Typhimurium DT104 challenge (d44) in pigs fed a basal diet (CTRL) or a basal diet
supplemented with either antibiotics (ATB), Pediococcus acidilactici (PA), Saccharomyces
cerevisiae subsp. boulardii (SCB), or PA and SCB (PA+SCB)1.
Treatments (Trt; n = 8 litters2/Tr)
Populations
P-value
d
CTRL
ATB
PA
SCB
PA+SCB SEM
Trt
39
14.02
14.82
11.93
14.57
11.78
1.80
0.434
44
17.75c
15.77
15.00 12.56d
12.21d
2.18
0.090
39
28.39
25.71a 32.45
32.30
36.23b
3.13
0.111
44
25.12
c
32.60
d
3.78
0.112
39
a
b
Challenge Trt x
(Ch)
Ch
T cells
CD4+
CD8+
CD8+high
CD8+low
d
37.31
32.54
37.78
7.37
7.06
a
8.55
10.15
12.69
1.83
0.027
44
8.29
11.95
8.89
9.49
12.47
2.18
0.442
39
20.10
18.17
23.51
21.62
23.30
2.95
0.488
44
16.60
25.19
23.19
22.55
39
6.26
c
6.28
c
44
8.09
39
25.10
3.20
0.211
7.38
9.15
d
8.26
1.34
0.088
7.67
9.98
12.75
9.43
2.05
0.357
34.24
34.22
38.86
34.53
42.26
3.87
0.123
44
32.38
34.57
34.48
37.76
39.10
4.66
0.569
39
17.75
13.76
14.80
13.28
15.25
1.73
0.415
44
12.31
8.93
10.67
11.25
11.78
2.23
0.758
Macrophages 39
44
15.80a
16.04a 17.09
13.37
9.53b
1.76
0.013
26.13
26.21
36.21
31.00
7.59
0.523
CD4+CD8+
γδ
B cells
27.81
0.091
0.221
0.336
0.193
0.275
0.421
0.521
0.420
0.008
0.838
0.366
0.362
< 0.0001
0.745
< 0.0001
0.627
1
Definition of acronyms: d = day; SEM = Pooled standard error of the mean; Trt = P-value
for the Treatment effect.
2
One pig/litter was used.
a, b
Means within rows are significantly different (P ≤ 0.05).
c, d
Means within rows tend to be different (P ≤ 0.10).
91
The double positive CD4+CD8+, B lymphocytes and macrophages was markedly increased
(P = 0.008; P = < 0.0001 and P = < 0.0001, respectively) in the blood after challenge (d44)
compared to before the challenge (d39) regardless of the treatments (Table 5). Moreover,
CD4+CD8‾ lymphocytes had a tendancy (P = 0.091) to increase in the blood of all groups
24 hpc except for the SCB group where the percentage of CD4+CD8‾ cells was lower on
d44 than on d39 (Table 5).
After challenge, the percentage of blood CD4+CD8‾ lymphocytes tended to be lower in pigs
of the SCB and PA+SCB groups than in the CTRL group (P = 0.077 and P = 0.060,
respectively). A tendancy was also observed for the CD4‾CD8+ lymphocytes, but the
percentage of these cells was slightly increased in the ATB and PA+SCB groups compared
with the CTRL group (Table 5; P = 0.071 and P = 0.058, respectively).
Finally, leukocyte populations in MLN of Salmonella infected pigs were not affected by
probiotic or antibiotic treatments (Table 6).
Table 6. Proportion (%) of leukocyte populations in mesenteric lymph nodes after
S. Typhimurium DT104 challenge in pigs fed a basal diet (CTRL) or a basal diet
supplemented with either antibiotics (ATB), Pediococcus acidilactici (PA),
Saccharomyces cerevisiae subsp. boulardii (SCB), or PA and SCB (PA+SCB)1.
Treatments (Tr; n = 8 litters2/Tr)
Populations
P-value
CTRL
ATB
PA
SCB
PA+SCB
SEM
Trt
CD4+
32.17
32.49
29.07
19.71
21.01
6.10
0.113
CD8+
22.28
22.76
23.03
20.84
25.81
4.29
0.805
CD8+high
12.79
12.42
10.44
10.93
11.14
1.92
0.787
CD8+low
9.88
10.75
13.25
10.87
14.64
3.98
0.547
CD4+CD8+
8.93
9.88
8.39
10.77
7.41
1.60
0.600
γδ
48.79
54.60
54.91
53.81
55.45
3.79
0.372
B cells
19.25
23.49
23.67
18.88
17.07
3.35
0.365
Macrophages
7.28
7.65
8.74
10.50
8.73
1.77
0.618
T cells
1
Definition of acronyms: SEM = Pooled standard error of the mean; Trt = P-value for the
Treatment effect
2
One pig/litter was used.
92
Gene expression of cytokines
The gene expression levels of analysed cytokines in the ileum and MLN are summarized in
Tables 7 and 8, respectively. Only the expression of IL-4 was modulated in the ileal
mucosa samples excised 24 hpc. Results indicated that its expression was reduced in the
ATB group compared to the CTRL group (P = 0.014). As regards to the influence of
probiotic treatments on the expression of different measured cytokines in the ileum or MLN
24 hpc, there was no difference compared to CTRL and ATB groups.
Table 7. Ileum cytokine mRNA relative levels normalized to ACTB in 24 hpc
S. Typhimurium DT104 pigs treated with probiotics or antibiotics1.
Gene
CTRL
IFN-γ
TNF-α
IL-6
IL-43
IL-10
Mean cytokine mRNA level in the ileum2
ATB
PA
SCB
PA+SCB
1.05
0.68
0.70
0.57
0.75
[0.65-1.53]
[0.37-0.68]
[0.39-1.10]
[0.29-0.94]
[0.43-0.75]
0.72
0.86
0.61
0.58
0.71
[0.4-1.14]
[0.50-0.86]
[0.32-1.00]
[0.30-0.96]
[0.39-1.12]
1.12
1.38
0.69
0.77
0.86
[0.56-1.85]
[0.75-2.19]
[0.28-1.30]
[0.32-1.39]
[0.38-1.51]
0.55
0.11
0.34
0.24
0.36
[0.29-0.90]
[0.02-0.29]
[0.15-0.62]
[0.08-0.48]
[0.16-0.65]
1.21
1.18
0.88
0.94
1.23
[0.92-1.54]
[0.90-1.50]
[0.64-1.16]
[0.69-1.22]
[0.94-1.56]
P-value
Trt
0.401
0.832
0.417
0.052
0.255
1
Definition of acronyms: CTRL = No probiotic and no antibiotic; ATB = tiamulin and
chlortetracycline; PA = P. acidilactici; SCB = S. cerevisiae subsp. boulardii; PA+SCB = a
mixture of the two probiotics; ACTB = β-actin; IL = interleukin; IFN = interferon; TNF =
tumor necrosis factor; Trt = P-value for the Treatment effect (n = 8 litters/treatment; one
pig/litter was used).
2
Data are presented as the mean of target gene normalized to ACTB gene with the range of
values for a 95% confidence interval within brackets.
3
IL-4 : ATB vs CTRL, P = 0.014.
93
Table 8. Mesenteric lymph node (MLN) cytokine mRNA levels normalized to ACTB
in 24 hpc S. Typhimurium DT104 pigs treated with probiotics or antibiotics1.
Gene
Mean cytokine mRNA expression level in the MLN2
CTRL
IFN-γ
TNF-α
IL-6
IL-4
IL-10
ATB
1.11
1.06
[0.42-2.12]
[0.39-2.05]
PA
0.67
SCB
PA+SCB
[0.17-1.49]
0.73
1.01
[0.20-1.57]
[0.37-1.99]
2.42
2.82
2.10
1.97
2.12
[1.57-3.45]
[1.90-3.93]
[1.32-3.07]
[1.22-2.91]
[1.33-3.09]
0.78
0.85
0.51
0.57
0.59
[0.29-1.50]
[0.33-1.59]
[0.14-1.11]
[0.17-1.20]
[0.18-1.24]
1.50
0.81
1.47
1.10
1.24
[0.72-2.57]
[0.28-1.63]
[0.70-2.53]
[0.45-2.02]
[0.54-2.21]
2.31
2.21
1.93
1.62
1.45
[1.58-3.18]
[1.50-3.06]
[1.27-2.73]
[1.02-2.35]
[0.89-2.16]
P-value
Trt
0.921
0.455
0.896
0.884
0.572
1
Definition of acronyms: CTRL = No probiotic and no antibiotic; ATB = tiamulin and
chlortetracycline; PA = P. acidilactici; SCB = S. cerevisiae subsp. boulardii; PA + SCB = a
mixture of the two probiotics; ACTB = β-actin; IL = interleukin; IFN = interferon; TNF =
tumor necrosis factor; Trt = P-value for the Treatment effect (n = 8 litters/treatment; one
pig/litter was used).
2
Data are presented as the mean of target gene /ACTB gene with the range of values for a
95% confidence interval within brackets.
Discussion
In the pursuit to seek for efficient alternatives to in-feed antibiotics for growth promotion in
farm animal production, a greater understanding of how probiotics may modify the
gastrointestinal environment and help protect the host against infection is required. The aim
of the study was to evaluate the influence of administrating the probiotics Pediococcus
acidilactici, Saccharomyces cerevisiae subsp. boulardii or both on the intestinal barrier and
immunity following a 24 h challenge with Salmonella enterica Typhimurium DT104,
including intestinal colonization, IgA production, expression of intestinal cytokines and cell
populations involved in the activation and regulation of the immune response. Salmonella
was chosen as a prototypic invasive pathogen because of its economic importance as a
swine enteropathogen. Salmonella Typhimurium, especially phage type DT104, is the
Salmonella serotype most frequently isolated from pork (250), and it is of particular
concern because of its acquisition of multiple antibiotic resistance (10, 314).
94
In the present study, none of the probiotic treatments compared to the control or antibiotic
group were able to modulate the production of secretory IgA in the intestinal mucosa of
pigs or decrease the quantity of Salmonella in the intestinal contents or in the MLN 24 hpc.
To colonize the intestine of the host, Salmonella has first to penetrate the epithelial barrier,
which includes competition with indogenous bacteria for adhesion sites and avoiding
neutralization by antibodies and other immune defenses. Many studies carried out with
different animal models, including pigs, have demonstrated the potential of probiotics to
improve intestinal barrier function and reduce intestinal bacterial translocation (172, 350).
Competitive exclusion is a well described mechanism for many probiotic strains. Some
probiotics facilitate the growth of the normal intestinal microbiota which promotes the
selective exclusion of certain pathogens such as E. coli, Salmonella, Campylobacter and
Listeria (103). Moreover, some strains of S. cerevisiae subsp. boulardii can bind on its
outer membrane flagellated bacteria such as Salmonella and E. coli forming an aggregate
that is rapidly cleared from the gastrointestinal tract (51, 101). In addition, this yeast can
increase the secretion of intestinal IgA directed against common pathogenic
microorganisms such as Salmonella and Yersinia colonizing the bowel tract of growing
rats (29).
Our results revealed that neither the antibiotics nor the probiotics used in the present study
seemed to affect counts of S. Typhimurium bacteria in ileum and colon or its ability to
penetrate the mucosal barrier and colonize the MLN. Related studies using different animal
models, probiotic strains and various pathogens have shown either a similar or a decreased
intestinal colonization in the probiotic group compared to a control group (56, 245, 352). In
contrast, another study revealed that the amount of S. Typhimurium DT104 excreted in
feces of pigs on several days post-infection was significantly larger for the group receiving
a probiotic strain of Enterococcus faecium (303). However, the differences between our
results and these studies may be partly explained by the experimental conditions used and
the sampling time post-challenge. Our probiotic treatments have been ineffective in
reducing the intestinal pathogen colonization 24 hpc, however we can not conclude on their
effects past this time and we can not exclude that our treatments could have positive effects
by decreasing the length of the shedding period, as observed by Casey et al. (34). In that
study, weaned piglets were fed a mixture of five probiotic strains (one Pediococcus strain
95
and four Lactobacillus strains) and challenged with S. Typhimurium. The microbiological
composition of their feces was monitored for 23 d post-infection. At 15 d post-infection,
the mean fecal numbers of Salmonella were significantly reduced in probiotic-treated
animals (34). Salmonellae have the ability to invade entorocytes of the intestinal epithelium
by multiple mechanisms. Once adhered to an intestinal epithelial cell, the bacteria can
provoke their endocytosis (87, 144). They disrupt the epithelial brush border and induce
membrane ruffles that engulf the organisms (18, 305). Alternatively, they can translocate
through the intestinal epithelia after uptake by CD18-expressing phagocytes (327). Finally,
it was shown, in vitro, that salmonellae are able to disrupt tight junctions, which seal the
epithelial cell layer and restrict the paracellular passage of ions, water and immune cells
(142). All these mechanisms, allowing the penetration of the intestinal barrier, indicates the
importance of this strategy to the lifestyle of salmonellae and may partly explain why our
treatments had no effect on the MLN pathogen colonization. Further investigation is needed
to demonstrate the effectiveness of our probiotic treatments in decreasing the length of
Salmonella shedding period in infected animals and improving intestinal barrier function.
Colonization of S. Typhimurium and its attachment to the ileal mucosa are implicated in the
stimulation of the host’s innate and adaptive immune response (124, 163). Cytokines are
key communication molecules between host cells in the defense against enteric pathogens.
Infection with Salmonella induces expression of multiple chemokines and proinflammatory cytokines in cultured intestinal epithelial cells and macrophages. In animal
models, protective roles have been shown for TNF-α, IFN-γ and IL-6, whereas IL-4 and IL10 inhibit host defenses against Salmonella (76, 163). TNF-α, a cytokine expressed by a
wide range of cells and involved in multiple functions associated with host inflammatory
responses, is increased during a Salmonella infection in all organs that have been studied to
date (75, 154). Another important cytokine involved in macrophage activation and essential
for the clearance of the Salmonella bacteria, is IFN-γ (163). IFN-γ is induced during the
initial step of infection, since elevated levels of IFN-γ mRNA are found very early in the
gut-associated lymphoid tissue of various animal models, including pig, orally challenged
with S. Typhimurium (76, 254, 324). Neutralization of TNF-α or IFN-γ by genetic or
pharmacological approaches increases the severity of Salmonella infection and decreases
survival of the host (116, 212, 221). IL-6, another component of the inflammatory
96
response, has been shown to play an important role in the regulation of intestinal immune
response, barrier fortification, activation of neutrophils and B cell IgA isotype switching,
important components in the defence against enteric infections (110).
In the present study, the probiotic treatments have shown no modulatory effect on the
expression of IFN-γ, TNF-α, IL-6, IL-10 and IL-4; neither in the ileal mucosa or the MLN
of pigs, 24 h post-infection. The discrepancy between our results and those from other
studies can be due to our experimental conditions, the probiotic strains or differences
between the infection model of the pathogen used. For instance, S. cerevisiae has been
shown to decrease inflammatory TNF-α and IL-6 cytokines induced by F4+
enterotoxigenic Escherichia coli in porcine intestinal epithelial cells, while S. cerevisiae
subsp. boulardii decreases inflammatory responses induced by S. Typhimurium in porcine
intestinal epithelial and dendritic cells (9, 349). Other in vitro studies using lactobacilli
showed an increase in pro-inflammatory cytokines, such as IFN-γ, by epithelial cells when
co-cultured with human PBMC (121, 208). We have recently shown, using the same
experimental conditions than those used in this study, that administration of P. acidilactici
alone or in combination with S. cerevisiae subsp. boulardii increased the expression of IL-6
in the ileum of F4+ enterotoxigenic Escherichia coli challenged pigs (56). In the present
study, we wanted to assess if the administration of P. acidilactici, S. cerevisiae subsp.
boulardii or both could modulate the expression of some cytokines involved in innate
immune defence against S. Typhimurium DT104.
Moreover another factor that can greatly influence the outcome of the results obtained is the
methodology used and the sampling time of tissue following the infection to determine
mRNA expression. For example, a study in mice demonstrates that the mRNA expression
of IFN-γ is increased in Peyer’s patch and in the spleen of infected animals 8 h postinfection with a Salmonella strain (292). Moreover, it was demonstrated that expression of
IL-6 and TNF-α mRNA is increased in the intestine of mice 3 h post-infection with S.
Typhimurium (154). A study using chickens as model showed that administration of
probiotics decreases IFN-γ expression in cecal tonsils 5 d post-challenge with S.
Typhimurium, but has no effects after 1 d and 3 d of infection (119). In that same study,
probiotic treatments do not affect also the IL-6 mRNA expression, 1 d or 5 d after
infection. These studies not only show that cytokine mRNA expression profiles are
97
different for each cytokine but also that cytokine gene expression at different times
following an infection can be modulated by probiotics. This important fact can partially
explain why our probiotic treatments had no effect on the cytokine mRNA expression in
the ileum or the MLN of infected animals at 24 hpc with the S. Typhimurium strain. Based
on our results, it is unlikely that the probiotic treatments conferred any early immunomodulatory benefits to the pigs during the Salmonella infection either via
exacerbation of the immune response to improve rapid pathogen clearance or by
lowering the overall amplitude of the response. Nevertheless, earlier (3 h or 6 h) or
further (3 d or 5 d) tissue samplings following the infection could reveal a probiotic
modulatory effect on cytokine expression but more research is needed.
Surprisingly, in the ileum of pigs receiving diet supplemented with antibiotics, IL-4 mRNA
expression was significantly lower than the control pigs. The sub-therapeutic use of
antibiotics has been shown to be an effective mean of reducing fecal Salmonella
shedding as well as clinical signs of infection in swine, calves, and chickens (108).
A recent review summarizing the association between sub-therapeutic use of
antibiotics and S. Typhimurium in pigs, reported that the most commonly used
antibiotic in-feed as supplement belongs to the tetracycline group (61). Antibiotics
from this group inhibit protein synthesis and therefore are effective against both
Gram positive and negative bacteria (59). Besides direct effect of antibiotics on
bacteria, aureomycin, also known as chlortetracycline, have been shown to reduce
the level of host proteins related to energy metabolism, protein synthesis, cell
structure, motility, and immunity (334). However, from our knowledge, no study has
been performed to evaluate the modulatory effect of chlortetracycline and tiamulin
on cytokine mRNA expression in the ileal tissue following a 24 h infection with S.
Typhimurium. A lower IL-4 expression in the ileum of infected pigs could be
beneficial because, as mentioned earlier, IL-4 expression has been reported to be
associated with impaired control of Salmonella infection. This cytokine directs the
immune response towards humoral immunity, which is antagonistic to the
inflammatory response needed to clear a salmonellae infection (76, 163).
Consequently a low IL-4 expression in the ileum could be an indicator that inflammatory
response is taking place despite the fact that 24 hpc there was no difference on the
98
expression of the tested pro-inflammatory cytokines between infected and non-infected
animals and on Salmonella counts in the intestinal contents and the MLN. Therefore it is
difficult to explain how this low IL-4 expression influences the intestinal immune response
against salmonellae and what are the outcome of this modulation on the development of the
infection and the clearance of the pathogen. More research are needed to understand how
sub-therapeutic administration of antibiotics influence ileal IL-4 mRNA expression levels
and, using different time scale approaches, determine if this immuno-modulatory effect
influences the outcome of the infection.
It is known that commensal bacteria play an important role in the development of immune
functions. However the precise mechanisms by which these bacteria regulate systemic and
intestinal immune functions are largely unknown. One objective of this study was to
evaluate the influence of probiotics administration on the establishment of immune cells
that play an important role in the development and regulation of innate and specific
immune responses during a Salmonella infection.
The mechanisms by which microbial products including probiotics modulate the
establishment of systemic immunocompetent cells are still under investigation. However,
there is growing evidence that environmental factors including microbial colonization and
exposure to a variety of antigens shape different components of the systemic and the gut
mucosal immune system (13, 286, 338, 344). Results from many studies, including the
current study, indicate that the administration of probiotics has the potential to modulate the
establishment of blood PBMC (106, 107, 184). Before the experimental infection, at 39
days of age, administration of PA alone and in-feed administration of antibiotics did not
affect immune blood cell populations, however we observed an upward trend for
CD4+CD8+ lymphocytes in pigs receiving only SCB. As T lymphocytes progress through
their development they become double-positive T cells (CD4+CD8+), and finally mature to
single-positive (CD4+CD8‾ or CD4‾CD8+). This probiotic effect on the relative percentage
of double-positive lymphocytes is hard to explain, but may indicate that during an infection
the immun system could trigger a massive and quick response against the invader.
However, the paramaters evaluated 24 h post-infection with S. Typhimurium did not
support this hypothesis. Still before the experimental infection, our study also revealed that
pigs from the PA+SCB group had a higher percentage of CD4‾CD8+high and CD4‾CD8+
99
lymphocytes and a lower percentage of macrophages. The CD4‾CD8+ cells have generally
been assigned to the cytotoxic lymphocyte population, responsible for killing of infected or
stressed target cells (39, 342). This kind of lymphocyte includes the natural killer (NK) T
cells and the cytotoxic T cells (62, 159, 342). On the other hand, macrophages are versatile
cells that play many roles. They are specialized phagocytic cells that contribute to protect
the host against attack from foreign substances and infectious microbes through engulfing
and digesting process. Macrophages not only play important functions in non-specific
defense (innate immunity) but also in specific defense mechanisms (adaptive immunity) by
activating different populations of lymphocytes involved in humoral and cell-mediated
immune responses (214). As antigen presenting cells along with dendritic cells, they are
playing a crucial role in initiating an immune response. As secretory cells, monocytes and
macrophages are also involved in the regulation of immune responses and the development
of inflammation; they stimulate lymphocytes and other immune cells to respond to
pathogens. Interestingly, our results showed that only the administration of both probiotics
increased after weaning the amount of blood CD4‾CD8+ T lymphocytes and macrophages,
indicating that there was a synergistic effect between the two probiotics when focusing on
blood lymphocyte subpopulations. However, the consequences of this CD4‾CD8+ T cells
and macrophages modulation in blood on the development of an enteric infection will
required further clarification, because 24 hpc with S. Typhimurium DT104 no positive
effect was observed neither on the colonization parameters evaluated or the cytokines
expression in the ileum or MLN of pigs receiving PA+SCB.
According to our experimental conditions, the infection with the S. Typhimurium DT104
strain significantly increased monocytes/macrophages and CD4+CD8+ T lymphocytes in
blood of animals from all treatment groups, while an upward trend was observed for
CD4+CD8‾ T cells. To help in containing and eventually clear the pathogen from the gut,
immune cells must first reach the infection site. Several cell types such as granulocytes and
macrophages, are scattered throughout the human body. The increased quantity of
macrophages in the blood 24 hpc may indicate an important migration of these cells toward
the gut. Once in circulation, they can migrate to the infection site and create a proper
environment to contain the infection. The increase in blood CD4+CD8+ double positive T
lymphocytes may reflect an increase in memory helper T cells in response to the infection.
100
However, not all porcine CD4+CD8+ T cells are memory helper cells. A subset of
CD4+CD8+ T cells has been shown to possess cytotoxic activity (62). We also observed
that percentage of B lymphocytes was markedly reduced in the blood of all animals 24 hpc.
Since S. Typhimurium is a facultative intracellular bacterium, the requirement of B cells in
the immune response against this pathogen is a longstanding matter of debate. B cells have
been shown to be dispensable for resolving primary Salmonella infection in mice and
chickens (19, 201). However, our results suggest that these cells seemed to be called,
probably by various chemiokines, to the infection site. Some B cells may produce
antibodies directed against conserved bacterial molecular patterns such as adhesion
molecules, lipopolysaccharide O-antigen or flagellin (104, 186). These antibodies would
not only recognize a specific bacteria but a wide range of different microorganisms.
Furthermore, salmonellae have the ability to disrupt tight junctions, which allowed bacteria
from the intestinal lumen to easily pass the intestinal epithelium. At this point, peripheral B
cells may be called to the infection site to reduce the adhesion of bacteria to the mucosa and
further bacterial translocation, by increasing the amount of IgA secreted in the intestinal
lumen. However, more research is needed to confirm this hypothesis.
Finally, none of the probiotic treatments nor the in-feed administration of antibiotics had
modulatory effect on MLN cell populations 24 hpc. On the other hand, we observed weak
modulatory effect on some immune blood cell populations. A downward trend was
observed for CD4+CD8‾ T lymphocytes in blood of salmonellae infected pigs from the
PA+SCB and the SCB groups, while an upward trend was observed for peripheral
CD4‾CD8+ T cells for pigs from the PA+SCB and ATB groups.
There is clear evidence that the MLN are an important site for immune protection during
the course of Salmonella infection. Indeed, mice that have had MLN surgically removed
suffer from elevated bacterial loads and severe immunopathology in liver (332). Mice
without MLN had increased bacterial numbers in systemic tissues after the relapse of
primary Salmonella infection (112). Although the MLN is often considered a potential site
of bacterial persistence (210, 226), it actually provides an important protective function as a
firewall preventing bacterial dissemination in primary and relapsing Salmonella infection.
However, considering our results from MLN mRNA analysis and immune cell populations,
it seems clear that the probiotics used in this study conferred no immunomodulatory
101
benefits to the pigs 24 hpc with S. Typhimurium. However as mentioned above, 24 h
maybe too early to observe probiotic effects on the parameters evaluated from MLN tissue.
The trends observed 24 hpc on the immune blood cell populations should not be ignored,
because there are wide individual variations in the establishment and the migration of these
immune cells following exposure to infectious pathogens. Taken together, these results
indicated that S. cerevisiae subsp. boulardii either alone or in combination with
P. acidilactici had a lower relative percentage of CD4+CD8‾ T lymphocytes in blood of
S. Typhimurium DT104-challenged pigs. Moreover, co-administration of both probiotics
and of antibiotics increased the realtive amount of CD4‾CD8+ T cells in blood of infected
animals.
In conclusion, administration of either SCB alone or in combination with PA has the
potential to modulate systemic immunity of piglets after weaning. The mechanism is still
unclear and in this study it is difficult to conclude that this effect is beneficial to the host,
because no positive effect were observed on intestinal colonization, IgA production or
expression of intestinal cytokines following a 24 h challenge with S. Typhimurium DT104.
However, we also showed 24 hpc that PA+SCB pigs had an increased percentage of blood
CD4‾CD8+ T cells, moreover PA+SCB and SCB pigs had a lower percentage of bood
CD4+CD8‾ compared to CTRL pigs. Even if no possitive effects have been observed on the
other parameters evaluated in this study, we cannot exclude that the probiotic effects on
blood cells populations could be effective in decreasing the length of the shedding period
by promoting a faster rise of the adaptive immune response. Interestingly, in pigs fed
antibiotic enriched diet, mRNA expression of ileal IL-4 was reduced whereas the
percentage of CD4‾CD8+ T cells was increased 24 hpc compared to control treated pigs.
These effects of antibiotics on the gut and the systemic immune system may have an impact
in reducing fecal shedding and clinical signs of enteric infection in pigs. Further
investigation is warranted to increase knowledge of the effect of antibiotics on immunity
and to gain a better understanding of the mechanisms by which the probiotics SCB and PA
affect the development and regulation of immune blood cells in weanling pigs and if these
effects have positive impact on the length and severity of enteric infection.
102
Acknowledgements
This work was supported by the Coopérative Fédérée du Québec, la Fédération des
producteurs de porc du Québec, the Institut Rosell-Lallemand, and Agriculture and AgriFood Canada’s Matching Investment Initiative (MII). The authors would like to thank
Steve Methot, statistician at the Dairy and Swine R&D Centre, for performing the statistical
analyses, Guillaume St-Pierre and Nathalie Bissonnette, from the Dairy and Swine R&D
Centre, and Yvan Boutin, from Transbiotech, for their involvement in the quantification of
cytokine gene expression by real-time PCR and all employees who took care of the animals
and collected data during the project.
103
Chapitre 3 : Discussion, perspectives et conclusions
L’industrie porcine est un rouage important de l’économie québécoise et canadienne. Pour
demeurer compétitifs dans un marché mondial toujours plus imposant, les producteurs ont
recours aux aliments médicamentés contenant des antibiotiques afin d’améliorer les
performances de croissance des porcelets. Cette pratique est cependant sévèrement
critiquée par la population et les scientifiques, dû à la possible acquisition de résistances par
les bactéries pathogènes animales et humaines. Les microorganismes probiotiques nous
apparaissent comme une solution de rechange très prometteuse à l’utilisation des
antibiotiques dans l’alimentation des animaux d’élevage. Par contre, l’approfondissement
des connaissances des mécanismes d’action spécifiques des souches probiotiques est
nécessaire pour optimiser leur utilisation. Les buts de ce projet de recherche étaient
d’évaluer les effets modulatoires de Pediococcus acidilactici MA18/5 M (PA) et
Saccharomyces cerevisiae ssp. boulardii CNCM I-1079 (SCB), premièrement, sur les
populations bactériennes intestinales avant et après sevrage et, deuxièmement, sur des
marqueurs de l’immunité innée et acquise en contexte d’infection entérique causée par
Salmonella Typhimurium DT104.
L’effet de l’administration quotidienne des probiotiques sur le microbiote intestinal a été
évalué une première fois lors de la lactation alors que les porcelets étaient âgés de 10 jours.
Les analyses par T-RFLP effectuées sur les fèces recueillies ont révélé que les traitements
probiotiques influencent peu l’équilibre global du microbiote, évalué par le calcul des
indices de diversité, le pourcentage relatif des principaux Phylum et les analyses MRPP sur
les représentations tridimensionnelles des NMS obtenues à partir des profils T-RFLP. Selon
toute vraisemblance, la consommation du colostrum et du lait qui sont riches en facteurs
immunologiques et en facteurs de croissance, est le principal facteur influençant l’équilibre
global du microbiote fécal à ce stade de développement des porcelets. Cependant, les
analyses par T-RFLP ont aussi démontré que les traitements probiotiques favorisaient
l’implantation de certaines familles bactériennes que nous considérons comme des
populations majeures du microbiote, avec une abondance relative de 5% et plus. En fait,
l’administration de PA était caractérisée par l’implantation de familles bactériennes du
Phylum des Firmicutes, tandis que l’administration de SCB favorisait l’implantation de
105
bactérie de la famille des Flavobacteriaceae (phylotype de 85 pb) qui appartient au Phylum
des Bacteroidetes. Autre fait notoire, la coadministration de PA et SCB ne reflétait pas
leurs effets individuels sur le microbiote fécal, mais possédait ses propres effets
modulatoires, étant caractérisé par la présence d’un phylotype majeur associé à la famille
des Lactobacillaceae (phylotype de 177 pb) et par le phylotype de 129 pb identifié comme
un membre de la famille des Bifidobacteriaceae. Pour bien comprendre l’impact sur l’hôte
des modulations observées sur les familles bactériennes par nos traitements probiotiques
lors de la lactation, des études supplémentaires sont nécessaires pour premièrement, mieux
caractériser ces populations bactériennes et deuxièmement, évaluer si ces modulations ont
des effets positifs sur le développement morphologique et immunitaire des porcelets.
C’est à 28 jours d’âge, soit une semaine post-sevrage, que les effets modulatoires de
l’administration des traitements probiotiques ont de nouveau été évalués au niveau des
fèces des mêmes porcelets échantillonnés lors de la lactation. En complément, pour être
représentatif de la réalité de l’industrie porcine nord-américaine, suite au sevrage, un
groupe d’animaux recevant la même alimentation de base que les animaux du groupe
témoin, mais supplémenté avec de la tiamuline et de la chlortétracycline, a été ajouté et
utilisé comme groupe de référence. Nos dénombrements sur milieux sélectifs ont montré
que l’administration de PA favorisait l’implantation des bifidobactéries comparativement à
une alimentation de base. Il demeure important de noter que la culture de microorganismes
ne parvient pas à reproduire la diversité complète rencontrée dans des environnements
complexes. Malgré l’utilisation de milieux sélectifs, certains microorganismes ciblés ne
peuvent parfois pas se multiplier de manière adéquate, influençant du même coup la
validité des résultats. Il n’en demeure pas moins que cette technique peut être utilisée
comme référence pour visualiser les effets modulatoires des probiotiques sur certaines
populations bactériennes majeures du microbiote intestinal. L’analyse par T-RFLP des
échantillons recueillis a démontré qu’après seulement une semaine de consommation par
les porcelets, les antibiotiques avaient un impact majeur sur la balance globale du
microbiote fécal, tandis que les traitements probiotiques n’influençaient pas de façon
significative les paramètres évalués. Au sevrage, le changement d’alimentation provoque
une importante modulation du microbiote intestinal. Les glucides devenant la principale
source énergétique au lieu des lipides, l’équilibre entre les différentes populations
106
bactériennes est modifié pour se stabiliser de nouveau deux à trois semaines plus tard (293).
Il semble donc que, suite au sevrage, l’incorporation d’antibiotique dans l’alimentation
influencerait davantage le remodelage du microbiote fécal que les microorganismes
probiotiques déjà présents dans l’écosystème intestinal. La consommation de faible dose
d’antibiotiques par les porcelets favoriserait l’établissement de populations bactériennes
bénéfiques pour la santé intestinale de l’hôte limitant du même coup le développement de
bactéries pathogènes opportunistes qui pourraient profiter de l’instabilité du microbiote
provoquée par le sevrage pour coloniser la muqueuse intestinale et causer une infection
entérique. D’autres études sont cependant nécessaires pour valider cette hypothèse et pour
approfondir l’impact de l’effet des antibiotiques observé dans cette étude sur le microbiote.
De plus, il serait intéressant de caractériser le microbiote iléal et colique de porcelets de
même âge, car l’analyse des populations bactériennes fécales n’est pas représentative du
microbiote retrouvé au niveau des différents compartiments composant le système digestif.
Ainsi, l’analyse de ces sites pourrait possiblement révéler des effets des traitements
probiotiques sur le microbiote intestinal des porcelets autant lors de la lactation qu’une
semaine post-sevrage.
L’effet modulatoire des probiotiques sur le microbiote a finalement été évalué, deux
semaines suite au sevrage, au niveau de deux segments majeurs du tube digestif, soit l’iléon
et le côlon. Premièrement, au niveau du microbiote iléal, les analyses T-RFLP ont montré
que l’administration de SCB augmentait l’abondance relative des Firmicutes et favorisait
l’implantation d’un phylotype majeur associé à la famille des Lactobacillaceae (phylotype
de 175 pb). De plus, il s’est avéré que l’administration d’antibiotiques ou de PA seul
influençait de façon similaire l’équilibre global du microbiote. En fait, nos résultats ont
montré que les antibiotiques et PA réduisaient la diversité du microbiote iléal des porcelets
sevrés et favorisaient l’établissement des Firmicutes en avantageant l’implantation d’une
population bactérienne associée à Lactobacillus amylovorus (phylotype de 177 pb). Fait
intéressant à noter, la coadministration de PA et de SCB ne reflète pas les effets individuels
sur le microbiote iléal de PA et SCB lorsqu’administré seul. Il a été montré récemment que
la chlortétracycline utilisée comme facteur de croissance dans l’alimentation des porcelets
sevrés module le microbiote iléal en diminuant les quantités de Lactobacillus johnsonii et
de Turicibacter tout en augmentant la proportion de L. amylovorus (263). Lactobacillus
107
amylovorus est un type bactérien abondant dans l’intestin du porcelet et certaines souches
posséderaient une activité antimicrobienne contre les pathogènes entériques, tel que
démontré in vitro et in vivo dans d’autres études (155, 156, 270). De plus, cette espèce de
lactobacille est amylolytique et peut donc contribuer au métabolisme de l’amidon présent
en grande quantité dans l’alimentation et ainsi avoir un possible impact sur le gain de poids
des animaux, tel qu’observé dans d’autres études utilisant P. acidilacticii comme
probiotique (64, 164) ou encore la chlortétracycline comme facteur de croissance (262).
Bien que notre étude n’ait pas démontré d’effet sur la croissance des animaux, il n’en
demeure pas moins lorsqu’on considère les résultats obtenus au niveau du microbiote iléal
que PA semble être un candidat potentiel pour remplacer les antibiotiques comme
supplément alimentaire. Cependant, d’autres études dans des conditions industrielles sont
nécessaires pour confirmer nos observations et optimiser les conditions d’utilisation.
Finalement, toujours deux semaines post-sevrage, l’effet de nos traitements sur le
microbiote colique a été évalué. Les analyses T-RFLP ont démontré que les porcelets
consommant PA seul possédaient une abondance relative d’Actinobacteria plus élevée que
les porcelets recevant une alimentation de base. Cet effet était aussi appuyé par le
phylotype de 129 pb associé à la famille des Bifidobacteriaceae qui était caractéristique du
microbiote colique des porcelets du traitement PA. Généralement, une proportion élevée de
Bifidobacteriaceae qui regroupe les bactéries du genre Bifidobacterium, est associée à une
bonne santé intestinale (153). Cependant, ce phylotype représentait seulement 2% du
microbiote colique. Avec une si faible proportion, il est difficile de savoir si cet effet
modulatoire de PA a un impact réel sur la santé intestinale de l’hôte. Nos analyses ont aussi
permis de démontrer que l’administration de SCB influençait de façon importante le
microbiote du côlon en augmentant la diversité et en favorisant l’implantation de deux
familles bactériennes, soit les Porphyromonadaceae et les Ruminococcaceae (phylotype de
89 et 292 pb, respectivement). Dans le côlon, ces deux familles sont parmi les plus actives
métaboliquement (111). De plus, il a été démontré que les Ruminococcaceae jouent un rôle
important dans la fermentation colique en utilisant la pectine et la cellulose non digérée
pour produire du butyrate (266). Le butyrate est un élément important au niveau du côlon
puisque plus du trois quart de celui-ci est utilisé par les colonocytes comme source
d’énergie (268). Il a aussi été démontré que le butyrate renforce les barrières de défense
108
épithéliales en induisant la sécrétion de mucines et de peptides antimicrobiens (341). Ces
effets de SCB peuvent donc être d’un grand intérêt dans la défense contre les pathogènes
intestinaux et dans le maintien d’une homéostasie et d’une santé intestinale adéquate.
Malgré tout, il est important de mentionner que la technique T-RFLP permet d’évaluer
l’abondance relative des populations présentes dans un écosystème, mais ne représente pas
les populations métaboliquement actives dans cet écosystème (306). D’autres études sont
donc nécessaires pour premièrement confirmer que les populations bactériennes modulées
par nos traitements probiotiques sont actives métaboliquement et, deuxièmement, évaluer
l'impact de ces modulations sur la santé intestinale de l’hôte, que ce soit pour l'effet de PA
sur les bifidobactéries ou de SCB sur les Ruminococaceae et les Porphyromonadaceae.
Dans ce projet de recherche, l’influence des traitements probiotiques et antibiotiques sur la
barrière
épithéliale
intestinale
et
l’immunité
en
contexte
d’infection
à
S. Typhimurium DT104 a aussi été évaluée chez le porc sevré. Pour ce faire, nous avons
analysé la colonisation intestinale et la translocation du pathogène vers les ganglions
mésentériques (GM), la sécrétion d’IgA, l’expression de certaines cytokines au niveau de
l’iléon et des GM et, finalement, la proportion des populations de cellules immunitaires
dans le sang et les GM. Des porcs âgés de 43 jours ont été infectés oralement avec une
souche de S. Typhimurium DT104 et 24 heures plus tard, les porcs étaient euthanasiés. Lors
de l’euthanasie, des signes d’infection étaient visibles, tous les porcs montrant des fèces de
modérément à très liquide. Cette observation a ensuite été appuyée par l’isolement de
salmonelles viables au niveau des GM et dans les contenus de l’iléon et du côlon chez tous
les porcs. Malgré tout, les comptes de Salmonella sur milieu sélectif n’ont montré aucun
effet des traitements probiotiques ou antibiotiques. De façon similaire, la concentration
d’IgA sécrétoire au niveau de la muqueuse iléale et l’expression des cytokines, IFN-γ,
TNF-α, IL-6, IL-10 et IL-4, que ce soit au niveau de l’iléon ou des GM n’ont pas été affecté
par l’administration des probiotiques. Toujours dans le même ordre d’idée, 24 heures suite
à l’infection, l’analyse des populations cellulaires au niveau des GM n’a montré aucun effet
des probiotiques ou des antibiotiques utilisés. Cependant, que ce soit avant ou après le
challenge expérimental, des effets sur les populations de cellules immunitaires du sang ont
été obtenus. Avant l’infection, à 39 jours d’âge, les porcs recevant seulement SCB
possédaient une quantité supérieure de lymphocytes T CD4+CD8+. Lors de leur
109
développement, les lymphocytes T passent par un stade où ils deviennent double-positifs
(CD4+CD8+) pour éventuellement devenir des cellules simple-positives (CD4+CD8‾ ou
CD4‾CD8+). Cet effet de SCB sur le pourcentage relatif des lymphocytes T double-positifs
est difficilement explicable. Cependant, il est possible de croire qu’en cas d’infection un
animal ayant une quantité plus importante de lymphocytes double-positifs aura une réponse
immune plus rapide contre le microorganisme pathogène qu’un animal où le nombre de
cellules immunitaires en développement est moindre. Toutefois, suite à l’infection
expérimentale avec S. Typhimurium, les paramètres évalués n’ont pas appuyé cette
hypothèse. Toujours à 39 jours d’âge, notre étude a démontré que les porcelets du groupe
PA+SCB avaient dans leur sang une quantité supérieure de lymphocytes T CD4‾CD8+ et de
CD4‾CD8+high. De plus, le pourcentage relatif des monocytes/macrophages était moins
élevé chez les porcelets recevant PA+SCB. Les lymphocytes CD4‾CD8+ sont généralement
considérés comme étant des cellules cytotoxiques, responsables de l’élimination des
cellules infectées par des virus ou des bactéries pathogènes intracellulaires (39, 342). Cette
population de lymphocyte comprend les cellules NK et les lymphocytes T cytotoxique (62,
159, 342). Tandis que les monocytes/macrophages sont des cellules très polyvalentes qui
jouent plusieurs rôles. Ce sont des cellules phagocytaires spécialisées qui contribuent à
protéger l’hôte contre les substances étrangères néfastes et les microorganismes infectieux.
Les macrophages n’ont pas seulement un rôle important au niveau de l’immunité innée,
mais sont aussi indispensables pour l’activation de diverses populations de lymphocytes
indispensable à l’établissement d’une réponse immunitaire spécifique contre le type de
pathogène rencontré (immunité adaptative) (214). Les macrophages comme les cellules
dendritiques, sont des cellules présentatrices d’antigène qui jouent un rôle majeur dans
l’initiation d’une réponse immunitaire. Les monocytes et les macrophages sont également
des cellules sécrétoires impliquées dans le développement d’une réponse inflammatoire qui
stimule les lymphocytes et les autres cellules immunitaires à répondre adéquatement à
l’agent pathogène envahisseur. Fait intéressant, nos résultats ont montré que la présence à
la fois de PA et de SCB est requise pour influencer la quantité de lymphocyte T CD4‾CD8+
et de monocyte/macrophage dans le sang, ce qui indique qu’il y a un effet synergique entre
les deux probiotiques. Cette étude suggère aussi que l’administration de SCB seule ou en
combinaison avec PA, a le potentiel de moduler l’immunité systémique des porcelets suite
110
au sevrage. Le mécanisme d’action n’est pas clair et il est difficile de conclure que ces
effets sur l’immunité sont bénéfiques pour l’hôte puisqu’aucun effet positif n’a été obtenu
sur la colonisation intestinale du pathogène, la production d’IgA sécrétoire ou l’expression
des cytokines évaluées dans cette étude, suite à une infection de 24 heures avec
S. Typhimurium.
Cette étude a aussi permis de démontrer qu’une infection entérique de 24 heures causée par
S. Typhimurium DT104 chez le porc, tous traitements confondus, provoquait une hausse
dans le sang des lymphocytes T double-positif (CD4+CD8+), des lymphocytes T auxiliaires
(CD4+CD8‾) et des monocytes/macrophages, mais diminuait la proportion de cellules
productrices d’anticorps, soit les lymphocytes B. Finalement, toujours dans le sang 24 h
suite à l’infection, les porcs des groupes PA+SCB et ATB montraient une tendance à
posséder un pourcentage relatif de lymphocyte T cytotoxique (CD4‾CD8+) plus élevé.
Tandis que l’administration de SCB seul ou en combinaison avec PA diminuait la quantité
de cellules T auxiliaires (CD4+CD8‾). Malgré le fait qu’aucun effet positif des traitements
probiotiques n’ait été obtenu pour les autres paramètres évalués, il n’est pas possible
d’exclure que les effets modulatoires observés sur les populations de cellules immunitaires
du sang aient une influence sur la durée de la période d’excrétion du pathogène en
favorisant la montée plus rapide et plus efficace d’une réponse immunitaire adaptative. Il
est aussi important de mentionner que les analyses ont été effectuées à un temps bien précis
suite à l’infection et que la réponse immunitaire est variable dans le temps principalement
au niveau de l’expression des cytokines que ce soit dans les GM ou au niveau de la
muqueuse iléale. D’autres études sont donc nécessaires pour évaluer premièrement à
différents temps l’effet des probiotiques sur le profil d’expression des cytokines et,
deuxièmement, étudier l’impact de PA et SCB sur la durée et la sévérité d’une infection à
Salmonella.
En conclusion, cette étude a permis d’établir que PA et SCB ont des effets modulatoires
modérés sur le microbiote fécal global des porcelets que ce soit lors de la lactation ou à une
semaine post-sevrage. Par contre, des impacts majeurs sur le microbiote sont observés au
niveau des compartiments internes de l’intestin. L’administration de PA ayant un impact
important au niveau du microbiote iléal, et ce, de façon similaire à l’ajout d’antibiotiques
dans l’alimentation, tandis que SCB influence le microbiote du côlon. Fait intéressant,
111
autant au niveau du microbiote fécal suite au sevrage qu’au niveau de l’iléon et du côlon, la
coadministration de PA et SCB semble abolir les effets individuels de ces deux
microorganismes lorsqu’administré seul. Ce projet a aussi permis de mettre à jour les effets
modulatoires de SCB seul ou en combinaison avec PA sur l’immunité systémique suite au
sevrage et ce, autant en condition normale que lors d’une infection entérique causée pas
S. Typhimurium. Bien que cette étude ait permis d’améliorer les connaissances entourant
les mécanismes d’action des probiotiques sur le microbiote intestinal et le système
immunitaire, des projets de recherche doivent encore être conduits pour poursuivre
l’approfondissement des connaissances visant à évaluer les impacts des probiotiques sur la
santé intestinale et générale de l’hôte, et pour optimiser l'utilisation des probiotiques
comme alternative aux suppléments d'antibiotiques dans l'élevage.
112
Références
1.
Abe, F., N. Ishibashi, and S. Shimamura. 1995. Effect of administration of bifidobacteria and
lactic acid bacteria to newborn calves and piglets. Journal of Dairy Science 78:2838-2846.
2.
Abreu, M. T. 2010. Toll-like receptor signalling in the intestinal epithelium: how bacterial
recognition shapes intestinal function. Nature Reviews Immunology 10:131-144.
3.
Akil, I., O. Yilmaz, S. Kurutepe, K. Degerli, and S. Kavukcu. 2006. Influence of oral intake of
Saccharomyces boulardii on Escherichia coli in enteric flora. Pediatric Nephrology 21:807-810.
4.
Alexopoulos, C., I. E. Georgoulakis, A. Tzivara, S. K. Kritas, A. Siochu, and S. C. Kyriakis.
2004. Field evaluation of the efficacy of a probiotic containing Bacillus licheniformis and Bacillus
subtilis spores, on the health status and performance of sows and their litters. Journal of Animal
Physiology and Animal Nutrition 88:381-392.
5.
Altenhoefer, A., S. Oswald, U. Sonnenborn, C. Enders, J. Schulze, J. Hacker, and T. A.
Oelschlaeger. 2004. The probiotic Escherichia coli strain Nissle 1917 interferes with invasion of
human intestinal epithelial cells by different enteroinvasive bacterial pathogens. FEMS Immunology
and Medical Microbiology 40:223-229.
6.
Amann, R. I., W. Ludwig, and K. H. Schleifer. 1995. Phylogenetic identification and in situ
detection of individual microbial cells without cultivation. Microbiological Reviews 59:143-169.
7.
Arce, C., M. Ramírez-Boo, C. Lucena, and J. J. Garrido. 2010. Innate immune activation of
swine intestinal epithelial cell lines (IPEC-J2 and IPI-2I) in response to LPS from Salmonella
typhimurium. Comparative Immunology, Microbiology and Infectious Diseases 33:161-174.
8.
Avaniss-Aghajani, E., K. Jones, D. Chapman, and C. Brunk. 1994. A molecular technique for
identification of bacteria using small subunit ribosomal RNA sequences. Bio Techniques. 17:144146, 148-149.
9.
Badia, R., M. T. Brufau, A. M. Guerrero-Zamora, R. Lizardo, I. Dobrescu, R. MartinVenegas, R. Ferrer, H. Salmon, P. Martínez, and J. Brufau. 2012. β-galactomannan and
Saccharomyces cerevisiae var. Boulardii modulate immune response against Salmonella enterica
ser. Typhimurium in porcine intestinal epithelial and dendritic cells. Clinical and Vaccine
Immunology 19:368-376.
10.
Baggesen, D. L., and F. M. Aarestrup. 1998. Characterisation of recently emerged multiple
antibiotic-resistant Salmonella enterica serovar typhimurium DT104 and other multiresistant phage
types from Danish pig herds. The Veterinary Record 143:95-97.
11.
Bailey, M., and K. Haverson. 2006. The postnatal development of the mucosal immune system and
mucosal tolerance in domestic animals. Veterinary Research 37:443-453.
12.
Bailey, M., K. Haverson, C. Inman, C. Harris, P. Jones, G. Corfield, B. Miller, and C. Stokes.
2005. The development of the mucosal immune system pre- and post-weaning: balancing regulatory
and effector function. Proceedings of the Nutrition Society 64:451-457.
13.
Bailey, M., K. Haverson, C. Inman, C. Harris, P. Jones, G. Corfield, B. Miller, and C. Stokes.
2005. The influence of environment on development of the mucosal immune system. Veterinary
Immunology and Immunopathology 108:189-198.
113
14.
Barc, M. C., C. Charrin-Sarnel, V. Rochet, F. Bourlioux, C. Sandré, H. Boureau, J. Doré, and
A. Collignon. 2008. Molecular analysis of the digestive microbiota in a gnotobiotic mouse model
during antibiotic treatment: Influence of Saccharomyces boulardii. Anaerobe 14:229-233.
15.
Barker, R. M., and D. C. Old. 1989. The usefulness of biotyping in studying the epidemiology and
phylogeny of salmonellae. Journal of Medical Microbiology 29:81-88.
16.
Barton, G. M., and R. Medzhitov. 2002. Toll-like receptors and their ligands, p. 81-92. In B.
Beutler and H. Wagner (ed.), Toll-Like Receptor Family Members and Their Ligands, vol. 270.
Section of Immunobiology, Howard Hughes Medical Institute, Yale University School of Medicine,
New Haven.
17.
Bäumler, A. J., R. M. Tsolis, T. A. Ficht, and L. G. Adams. 1998. Evolution of host adaptation in
Salmonella enterica. Infection and Immunity 66:4579-4587.
18.
Bäumler, A. J., R. M. Tsolis, and F. Heffron. 1996. Contribution of fimbrial operons to attachment
to and invasion of epithelial cell lines by Salmonella typhimurium. Infection and Immunity 64:18621865.
19.
Beal, R. K., and A. L. Smith. 2007. Antibody response to Salmonella: its induction and role in
protection against avian enteric salmonellosis. Expert Review of Anti-infective Therapy 5:873-881.
20.
Beerens, H. 1990. An elective and selective isolation medium for Bifidobacterium spp. Letters in
Applied Microbiology 11:155-157.
21.
Berg, R. D. 1996. The indigenous gastrointestinal microflora. Trends in Microbiology 4:430-435.
22.
Bertin, G., M. Brault, M. M. Baud, M. Mercier, and J. Tournut. 1997. Presented at the
Proceedings of the VII international symposium on digestive physiology in pigs, St. Malo, France.
23.
Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K.
Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17
and regulatory T cells. Nature 441:235-238.
24.
Bettelli, E., T. Korn, M. Oukka, and V. K. Kuchroo. 2008. Induction and effector functions of
TH17 cells. Nature 453:1051-1057.
25.
Boirivant, M., and W. Strober. 2007. The mechanism of action of probiotics. Current Opinion in
Gastroenterology 23:679-692.
26.
Bosi, P., L. Casini, A. Finamore, C. Cremokolini, G. Merialdi, P. Trevisi, F. Nobili, and E.
Mengheri. 2004. Spray-dried plasma improves growth performance and reduces inflammatory status
of weaned pigs challenged with enterotoxigenic Escherichia coli K88. Journal of Animal Science
82:1764-1772.
27.
Boyd, J. F. 1985. Pathology of the alimentary tract in Salmonella typhimurium food poisoning. Gut
26:935-944.
28.
Brandtzaeg, P. E. R. 2002. Current understanding of gastrointestinal immunoregulation and its
relation to food allergy. Annals of the New York Academy of Sciences 964:13-45.
29.
Buts, J.-P., P. Bernasconi, J.-P. Vaerman, and C. Dive. 1990. Stimulation of secretory IgA and
secretory component of immunoglobulins in small intestine of rats treated with Saccharomyces
boulardii. Digestive Diseases and Sciences 35:251-256.
114
30.
Buts, J.-P., and N. De Keyser. 2006. Effects of Saccharomyces boulardii on intestinal mucosa.
Digestive Diseases and Sciences 51:1485-1492.
31.
Caballero-Franco, C., K. Keller, C. De Simone, and K. Chadee. 2007. The VSL#3 probiotic
formula induces mucin gene expression and secretion in colonic epithelial cells. American Journal of
Physiology - Gastrointestinal and Liver Physiology 292:G315-G322.
32.
Carter, P. B., and F. M. Collins. 1974. The route of enteric infection in normal mice. Journal of
Experimental Medicine 139:1189-1203.
33.
Casey, P. G., G. D. Casey, G. E. Gardiner, M. Tangney, C. Stanton, R. P. Ross, C. Hill, and G.
F. Fitzgerald. 2004. Isolation and characterization of anti-Salmonella lactic acid bacteria from the
porcine gastrointestinal tract. Letters in Applied Microbiology 39:431-438.
34.
Casey, P. G., G. E. Gardiner, G. Casey, B. Bradshaw, P. G. Lawlor, P. B. Lynch, F. C.
Leonard, C. Stanton, R. P. Ross, G. F. Fitzgerald, and C. Hill. 2007. A five-strain probiotic
combination reduces pathogen shedding and alleviates disease signs in pigs challenged with
Salmonella enterica serovar Typhimurium. Applied and Environmental Microbiology 73:1858-1863.
35.
Castagliuolo, I., M. F. Riegler, L. Valenick, J. T. LaMont, and C. Pothoulakis. 1999.
Saccharomyces boulardii protease inhibits the effects of Clostridium difficile toxins A and B in
human colonic mucosa. Infection and Immunity 67:302-307.
36.
Castillo-Gomez, M. S. 2006. Development of gut microbiota in the pig : modulation of bacterial
communities by different feeding strategies. Faculté Vétérinaire, Barcelone.
37.
CCAC. 2009. Guidelines on the care and use of farm animal in research, teaching and testing.
Canadian Council on Animal Care, Ottawa, ON, Canada.
38.
Ceslovas, J., J. Vigilijus, and S. Almantas. 2005. The effect of probiotics and phytobiotics on meat
properties and quality in pigs. Veterinarija ir Zootechnika 29:1392-2130.
39.
Cheroutre, H., and L. Madakamutil. 2004. Acquired and natural memory T cells join forces at the
mucosal front line. Nature Reviews Immunology 4:290-300.
40.
Chikindas, M. L., M. J. Garcia-Garcera, A. J. M. Driessen, A. M. Ledeboer, J. Nissen- Meyer,
I. F. Nes, T. Abee, W. N. Konings, and G. Venema. 1993. Pediocin PA-1, a bacteriocin from
Pediococcus acidilactici PAC1.0, forms hydrophilic pores in the cytoplasmic membrane of target
cells. Applied and Environmental Microbiology 59:3577-3584.
41.
Christensen, H. R., H. Frøkiær, and J. J. Pestka. 2002. Lactobacilli differentially modulate
expression of cytokines and maturation surface markers in murine dendritic cells. Journal of
Immunology 168:171-178.
42.
Clement, B. G., L. E. Kehl, K. L. DeBord, and C. L. Kitts. 1998. Terminal restriction fragment
patterns (TRFPs), a rapid, PCR-based method for the comparison of complex bacterial communities.
Journal of Microbiological Methods 31:135-142.
43.
Coates, M. E., R. Fuller, G. F. Harrison, M. Lev, and S. F. Suffolk. 1963. A comparison of the
growth of xhicks in the Fustafsson germ-free apparatus and in a conventional environment, with and
without dietary supplements of penicillin. British Journal of Nutrition 17:141-151.
44.
Cole, J. R., Q. Wang, E. Cardenas, J. Fish, B. Chai, R. J. Farris, A. S. Kulam-Syed-Mohideen,
D. M. McGarrell, T. Marsh, G. M. Garrity, and J. M. Tiedje. 2009. The Ribosomal Database
115
Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Research 37:D141D145.
45.
Collado-Romero, M., C. Arce, M. Ramírez-Boo, A. Carvajal, and J. J. Garrido. 2010.
Quantitative analysis of the immune response upon Salmonella typhimurium infection along the
porcine intestinal gut. Veterinary Research 41:23.
46.
Collado, M. C., Ł. Grześkowiak, and S. Salminen. 2007. Probiotic strains and their combination
inhibit in vitro adhesion of pathogens to pig intestinal mucosa. Current Microbiology 55:260-265.
47.
Collier, C. T., M. R. Smiricky-Tjardes, D. M. Albin, J. E. Wubben, V. M. Gabert, B.
Deplancke, D. Bane, D. B. Anderson, and H. R. Gaskins. 2003. Molecular ecological analysis of
porcine ileal microbiota responses to antimicrobial growth promoters. Journal of Animal Science
81:3035-3045.
48.
Conway, P. L. 1997. Development of intestinal microbiota. Gastrointestinal microbes and host
interactions. In R. I. Mackie, B. A. Whyte, and R. E. Isaacson (ed.), Gastrointestinal Microbiology,
vol. 2. Chapman and Hall, London.
49.
Corpet, D. E. 2000. Mécanismes de la promotion de croissance des animaux par les additifs
alimentaires antibiotiques. Revue de Medecine Veterinaire 151:99-104.
50.
Cromwell, G. L. 2002. Why and how antibiotics are used in swine production. Animal
Biotechnology 13:7-27.
51.
Czerucka, D., T. Piche, and P. Rampal. 2007. Review article: yeast as probiotics –Saccharomyces
boulardii. Alimentary Pharmacology & Therapeutics 26:767-778.
52.
Czerucka, D., and P. Rampal. 1999. Effect of Saccharomyces boulardii on cAMP- and Ca2+dependent Cl- secretion in T84 cells. Digestive Diseases and Sciences 44:2359-2368.
53.
Dalloul, R. A., H. S. Lillehoj, T. A. Shellem, and J. A. Doerr. 2003. Enhanced mucosal immunity
against Eimeria acervulina in broilers fed a Lactobacillus-based probiotic. Poultry Science 82:62-66.
54.
Darveau, R. P., M. McFall-Ngai, E. Ruby, S. Miller, and D. F. Mangan. 2003. Host tissues may
actively respond to beneficial microbes. ASM News 69:186-191.
55.
Darwin, K. H., and V. L. Miller. 1999. Molecular basis of the interaction of Salmonella with the
intestinal mucosa. Clinical Microbiology Reviews 12:405-428.
56.
Daudelin, J. F., M. Lessard, F. Beaudoin, E. Nadeau, N. Bissonnette, Y. Boutin, J. P.
Brousseau, K. Lauzon, and J. M. Fairbrother. 2011. Administration of probiotics influences F4
(K88)-positive enterotoxigenic Escherichia coli attachment and intestinal cytokine expression in
weaned pigs. Veterinary Research 42:69.
57.
Davis, M. E., T. Parrott, D. C. Brown, B. Z. De Rodas, Z. B. Johnson, C. V. Maxwell, and T.
Rehberger. 2008. Effect of a Bacillus-based direct-fed microbial feed supplement on growth
performance and pen cleaning characteristics of growing-finishing pigs. Journal of Animal Science
86:1459-1467.
58.
de Vos, N., E. Mevissen-Verhage, W. H. van Amerongen, and J. Marcelis. 1982. A new selective
medium for the culture of clostridia from human faeces. European Journal of Clinical Microbiology
& Infectious Diseases 1:267-271.
116
59.
del Castillo, J. R. E., J. Elsener, and G. P. Martineau. 1998. Pharmacokinetic modelling of infeed tetracyclines in pigs using meta-analytic compartmental approach. Swine Health and Production
6:189-202.
60.
Delcenserie, V., D. Martel, M. Lamoureux, J. Amiot, B. Y., and D. Roy. 2008.
Immunomodulatory effects of probiotics in the intestinal tract. Current Issues of Molecular Biology
10:37-54.
61.
Denagamage, T., A. O’Connor, J. Sargeant, and J. McKean. 2010. The association between subtherapeutic antibiotics and Salmonella typhimurium in market-weight Swine: a systematic review
and summation of evidence from 1950 to 2007. Zoonoses and Public Health 57:e14-e22.
62.
Denyer, M. S., T. E. Wileman, C. M. A. Stirling, B. Zuber, and H.-H. Takamatsu. 2006.
Perforin expression can define CD8 positive lymphocyte subsets in pigs allowing phenotypic and
functional analysis of Natural Killer, Cytotoxic T, Natural Killer T and MHC un-restricted cytotoxic
T-cells. Veterinary Immunology and Immunopathology 110:279-292.
63.
Di Giancamillo, A., V. Bontempo, G. Savoini, R. Paratte, E. Chevaux, V. Dell’Orto, and C.
Domeneghini. 2003. Presented at the 9th International Symposium on Digestive hysiology in Pigs,
Banff, Alberta, Canada.
64.
Di Giancamillo, A., F. Vitari, G. Savoini, V. Bontempo, C. Bersani, V. Dell'Orto, and C.
Domeneghini. 2008. Effects of orally administered probiotic Pediococcus acidilactici on the small
and large intestine of weaning piglets. A qualitative and quantitative micro-anatomical study.
Histology and histopathology 23:651-664.
65.
Dierick, N. A., I. J. Vervaeke, J. A. Decuypere, and H. K. Henderickx. 1978. Presented at the
Proc III World congress Animal Feeding, Madrid.
66.
Dong, C. 2008. TH17 cells in development: An updated view of their molecular identity and genetic
programming. Nature Reviews Immunology 8:337-348.
67.
Dong, C., and R. A. Flavell. 2001. Th1 and Th2 cells. Current Opinion in Hematology 8:47-51.
68.
Drakes, M., T. Blanchard, and S. Czinn. 2004. Bacterial probiotic modulation of dendritic cells.
Infection and Immunity 72:3299-3309.
69.
Dufr ne, M., and P. Legendre. 1997. Species assemblages and indicator species: the need for a
flexible asymetrical approach. Ecological Monographs 67:345–366.
70.
Dullaers, M., D. Li, Y. Xue, L. Ni, I. Gayet, R. Morita, H. Ueno, K. A. Palucka, J. Banchereau,
and S. Oh. 2009. A T cell-dependent mechanism for the induction of Human mucosal homing
immunoglobulin A-secreting plasmablasts. Immunity 30:120-129.
71.
Dunbar, J., L. O. Ticknor, and C. R. Kuske. 2000. Assessment of microbial diversity in four
southwestern United States soils by 16S rRNA gene terminal restriction fragment analysis. Applied
and Environmental Microbiology 66:2943-2950.
72.
Dunbar, J., L. O. Ticknor, and C. R. Kuske. 2001. Phylogenetic specificity and reproducibility
and new method for analysis of terminal restriction fragment profiles of 16S rRNA genes from
bacterial communities. Applied and Environmental Microbiology 67:190-197.
73.
Duncker, S. C., A. Lorentz, B. Schroeder, G. Breves, and S. C. Bischoff. 2006. Effect of orally
administered probiotic E. coli strain Nissle 1917 on intestinal mucosal immune cells of healthy
young pigs. Veterinary Immunology and Immunopathology 111:239-250.
117
74.
Eckburg, P. B., E. M. Bik, C. N. Bernstein, E. Purdom, L. Dethlefsen, M. Sargent, S. R. Gill, K.
E. Nelson, and D. A. Relman. 2005. Diversity of the Human intestinal microbial flora. Science
308:1635-1638.
75.
Eckmann, L., J. Fierer, and M. Kagnoff. 1996. Genetically resistant (Ityr) and susceptible (Itys)
congenic mouse strains show similar cytokine responses following infection with Salmonella dublin.
The Journal of Immunology 156:2894-2900.
76.
Eckmann, L., and M. F. Kagnoff. 2001. Cytokines in host defense against Salmonella. Microbes
and Infection 3:1191-1200.
77.
Ellermeier, C., and J. Slauch. 2006. The genus Salmonella, p. 123-158. In M. Dworkin, S. Falkow,
E. Rosenberg, K.-H. Schleifer, and E. Stackebrandt (ed.), The Prokaryotes. Springer New York.
78.
Elo, S., M. Saxelin, and S. Salminen. 1991. Attachment of Lactobacillus casei strain GG to human
colon carcinoma cell line Caco-2: Comparison with other dairy strains. Letters in Applied
Microbiology 13:154-156.
79.
Erkkilä, S., and E. Petäjä. 2000. Screening of commercial meat starter cultures at low pH and in
the presence of bile salts for potential probiotic use. Meat Science 55:297-300.
80.
Everest, P., J. Allen, A. Papakonstantinopoulou, P. Mastroeni, M. Roberts, and G. Dougan.
1997. Salmonella typhimurium infections in mice deficient in interleukin-4 production: Role of IL-4
in infection-associated pathology. Journal of Immunology 159:1820-1827.
81.
Ewing, W. N., and D. J. A. Cole. 1994. The microbiology of the gastrointestinal tract. In W. N.
Ewing and D. J. A. Cole (ed.), The living gut. An introduction to microorganisms in nutrition,
Context, Ireland, UK.
82.
Fairbrother, J. M., É. Nadeau, and C. L. Gyles. 2005. Escherichia coli in postweaning diarrhea in
pigs: an update on bacterial types, pathogenesis, and prevention strategies. Animal Health Research
Reviews 6:17-39.
83.
Flynn, S., D. van Sinderen, G. M. Thornton, H. Holo, I. F. Nes, and J. K. Collins. 2002.
Characterization of the genetic locus responsible for the production of ABP-118, a novel bacteriocin
produced by the probiotic bacterium Lactobacillus salivarius subsp. salivarius UCC118.
Microbiology 148:973-984.
84.
Foley, S. L., and A. M. Lynne. 2008. Food animal-associated Salmonella challenges: pathogenicity
and antimicrobial resistance. Journal of Animal Science 86:E173-187.
85.
Fort, M. M., J. Cheung, D. Yen, J. Li, S. M. Zurawski, S. Lo, S. Menon, T. Clifford, B. Hunte,
R. Lesley, T. Muchamuel, S. D. Hurst, G. Zurawski, M. W. Leach, D. M. Gorman, and D. M.
Rennick. 2001. IL-25 induces IL-4, IL-5, and IL-13 and Th2-associated pathologies in vivo.
Immunity 15:985-995.
86.
Franchi, L., A. Amer, M. Body-Malapel, T.-D. Kanneganti, N. Ozoren, R. Jagirdar, N.
Inohara, P. Vandenabeele, J. Bertin, A. Coyle, E. P. Grant, and G. Nunez. 2006. Cytosolic
flagellin requires Ipaf for activation of caspase-1 and interleukin 1[beta] in Salmonella-infected
macrophages. Nature Immunology 7:576-582.
87.
Francis, C. L., M. N. Starnbach, and S. Falkow. 1992. Morphological and cytoskeletal changes in
epithelial cells occur immediately upon interaction with Salmonella typhimurium grown under lowoxygen conditions. Molecular Microbiology 6:3077-3087.
118
88.
Francois, A. C. 1962. Mode of action of antibiotics on growth. Economie et médecine animales
3:77-103.
89.
François, A. C., M. C. Michel, E. M. Barnes, P. Fredericq, P. Kastli, A. C. Frazer, H. Gounelle,
and J. C. Somogyi. 1968. Antibiotics in agriculture, Cinquieme symposium du groupe europeen de
nutritionnistes, vol. 10. Bibliotheca «Nutritio et Dieta», Jouy-en-Josas, France.
90.
François, A. C., and M. C. Michel. 1968. Mode of action of antibiotics on growth, p. 35-59,
Cinquieme symposium du groupe europeen de nutritionnistes, vol. 10. Bibliotheca «Nutritio et
Dieta», Jouy-en-Josas, France.
91.
Franklin, M. A., A. G. Mathew, J. R. Vickers, and R. A. Clift. 2002. Characterization of
microbial populations and volatile fatty acid concentrations in the jejunum, ileum, and cecum of pigs
weaned at 17 vs 24 days of age. Journal of Animal Science 80:2904-2910.
92.
Fraser, D., B. N. Milligan, E. A. Pajor, P. A. Philips, A. A. Taylor, and W. D. M. 1998.
Behavioural perspectives on weaning in domestic pigs, p. 121-138. In J. Wiseman, M. A. Varley,
and P. Chadwik (ed.), Progress Pig Science. Nottingham University Press, Nottingham, UK.
93.
Fuller, R. 1989. Probiotics in man and animals. Journal of Applied Microbiology 66:365-378.
94.
Gagnon, N., G. Talbot, P. Ward, D. Roy, M. Dupuis, E. Farnworth, T. A. Tompkins, and M.
Lessard. 2007. Evaluation of bacterial diversity in the gut of piglets supplemented with probiotics
using ribosomal intergenic spacer analysis. Canadian Journal of Animal Science 87:207-219.
95.
Garcia-del Portillo, F., and B. Finlay. 1994. Invasion and intracellular proliferation of Salmonella
within non-phagocytic cells. Microbiologia 10:229-238.
96.
Garcia-Del Portillo, F., J. W. Foster, and B. B. Finlay. 1993. Role of acid tolerance response
genes in Salmonella typhimurium virulence. Infection and Immunity 61:4489-4492.
97.
Gaskins, H. R. 1997. Immunological aspects of host / microbiota interactions at the intestinal
epithelium. , p. 537-587. In R. L. Mackie, B. A. White, and R. E. Isaacson (ed.), Gastrointestinal
Microbiology: Volume 2, Gastrointestinal Microbes and Host Interactions. , vol. 2. Chapmann &
Hall,, New York, USA.
98.
Gaskins, H. R., C. T. Collier, and D. B. Anderson. 2002. Antibiotics as growth promotants: mode
of action. Animal Biotechnology 13:29-42.
99.
Gaskins, H. R., and K. W. Kelley. 1995. Immunology and neonatal mortality. In M. A. Varley
(ed.), The neonatal pig: development and survival. CAB International, Wallingford,UK.
100.
Gaudier, E., C. Michel, J. P. Segain, C. Cherbut, and C. Hoebler. 2005. The VSL# 3 probiotic
mixture modifies microflora but does not heal chronic dextran-sodium sulfate-induced colitis or
reinforce the mucus barrier in mice. Journal of Nutrition 135:2753-2761.
101.
Gedek. 1999. Adherence of Escherichia coli serogroup 0 157 and the Salmonella Typhimurium
mutant DT 104 to the surface of Saccharomyces boulardii. Mycoses 42:261-264.
102.
Giang, H. H., T. Q. Viet, B. Ogle, and J. E. Lindberg. 2010. Growth performance, digestibility,
gut environment and health status in weaned piglets fed a diet supplemented with potentially
probiotic complexes of lactic acid bacteria. Livestock Science 129:95-103.
103.
Gibson, G. R., and R. Fuller. 2000. Aspects of in vitro and in vivo research approaches directed
toward identifying probiotics and prebiotics for human use. Journal of Nutrition 130:391S-395S.
119
104.
Gil-Cruz, C., S. Bobat, J. L. Marshall, R. A. Kingsley, E. A. Ross, I. R. Henderson, D. L.
Leyton, R. E. Coughlan, M. Khan, K. T. Jensen, C. D. Buckley, G. Dougan, I. C. M.
MacLennan, C. López-Macías, and A. F. Cunningham. 2009. The porin OmpD from
nontyphoidal Salmonella is a key target for a protective B1b cell antibody response. Proceedings of
the National Academy of Sciences 106:9803-9808.
105.
Gil de los santos, J. R., O. B. Storch, and C. Gil-turnes. 2005. Bacillus cereus var. toyoii and
Saccharomyces boulardii increased feed efficiency in broilers infected with Salmonella enteritidis.
British Poultry Science 46:494-497.
106.
Gill, H. S., K. J. Rutherfurd, and M. L. Cross. 2001. Dietary probiotic supplementation enhances
Natural Killer cell activity in the elderly: an investigation of age-related immunological changes.
Journal of Clinical Immunology 21:264-271.
107.
Gill, H. S., K. J. Rutherfurd, M. L. Cross, and P. K. Gopal. 2001. Enhancement of immunity in
the elderly by dietary supplementation with the probiotic Bifidobacterium lactis HN019. The
American Journal of Clinical Nutrition 74:833-839.
108.
Girard, A. E., A. R. English, D. G. Evangelisti, J. E. Lynch, and I. A. Solomons. 1976. Influence
of subtherapeutic levels of a combination of neomycin and oxytetracycline on Salmonella
typhimurium in swine, calves, and chickens. Antimicrobial Agents and Chemotherapy 10:89-95.
109.
Glimcher, L. H., and K. M. Murphy. 2000. Lineage commitment in the immune system: The T
helper lymphocyte grows up. Genes and Development 14:1693-1711.
110.
Goodrich, M. E., and D. W. McGee. 1999. Effect of intestinal epithelial cell cytokines on mucosal
B-cell IgA secretion: enhancing effect of epithelial-derived IL-6 but not TGF-β on IgA+ B cells.
Immunology Letters 67:11-14.
111.
Gosalbes, M. J., A. Durbán, M. Pignatelli, J. J. Abellan, N. Jiménez-Hernández, A. E. PérezCobas, A. Latorre, and A. Moya. 2011. Metatranscriptomic approach to analyze the functional
human gut microbiota. PLoS ONE 6:e17447.
112.
Griffin, A. J., L.-X. Li, S. Voedisch, O. Pabst, and S. J. McSorley. 2011. Dissemination of
persistent intestinal bacteria via the mesenteric lymph nodes causes typhoid relapse. Infection and
Immunity 79:1479-1488.
113.
Grimont, P. A. D., and F-X. Weill. 2007. Antigenic formulae of the Salmonella serovars, WHO
Collaborating Centre for Reference and Research on Salmonella, 9 ed. Institut Pasteur, Paris, France.
114.
Guerra, N. P., P. F. Bernárdez, J. Méndez, P. Cachaldora, and L. Pastrana Castro. 2007.
Production of four potentially probiotic lactic acid bacteria and their evaluation as feed additives for
weaned piglets. Animal Feed Science and Technology 134:89-107.
115.
Guibourdenche, M., P. Roggentin, M. Mikoleit, P. I. Fields, J. Bockemühl, P. A. D. Grimont,
and F.-X. Weill. 2010. Supplement 2003-2007 (No. 47) to the White-Kauffmann-Le Minor scheme.
Research in Microbiology 161:26-29.
116.
Gulig, P. A., T. J. Doyle, M. J. Clare-Salzler, R. L. Maiese, and H. Matsui. 1997. Systemic
infection of mice by wild-type but not Spv- Salmonella typhimurium is enhanced by neutralization of
gamma interferon and tumor necrosis factor alpha. Infection and Immunity 65:5191-5197.
117.
Haesebrouck, F., F. Pasmans, K. Chiers, D. Maes, R. Ducatelle, and A. Decostere. 2004.
Efficacy of vaccines against bacterial diseases in swine: What can we expect? Veterinary
Microbiology 100:255-268.
120
118.
Hagberg, L., A. W. Bruce, G. Reid, C. Svanborg Eden, K. Lincoln, and G. Lidin-Janson. 1989.
Colonization of the urinary tract with live bacteria from the normal fecal and urethral flora in
patients with recurrent symptomatic urinary tract infections, p. 194-197. In E. H. Kass and C.
Svanborg Eden (ed.), Hostparasite interactions in urinary tract infections. University of Chicago
Press, Chicago, IL, USA.
119.
Haghighi, H. R., M. F. Abdul-Careem, R. A. Dara, J. R. Chambers, and S. Sharif. 2008.
Cytokine gene expression in chicken cecal tonsils following treatment with probiotics and
Salmonella infection. Veterinary Microbiology 126:225-233.
120.
Halle, S., D. Bumann, H. Herbrand, Y. Willer, S. Dähne, R. Förster, and O. Pabst. 2007.
Solitary intestinal lymphoid tissue provides a productive port of entry for Salmonella enterica
serovar Typhimurium. Infection and Immunity 75:1577-1585.
121.
Haller, D., S. Blum, C. Bode, W. P. Hammes, and E. J. Schiffrin. 2000. Activation of human
peripheral blood mononuclear cells by nonpathogenic bacteria in vitro: evidence of NK cells as
primary targets. Infection and Immunity 68:752-759.
122.
Hampson, D. J. 1986. Attempts to modify changes in the piglet small intestine after weaning.
Research in Veterinary Science 40:313-317.
123.
Hansen-Wester, I., and M. Hensel. 2001. Salmonella pathogenicity islands encoding type III
secretion systems. Microbes and Infection 3:549-559.
124.
Haraga, A., M. B. Ohlson, and S. I. Miller. 2008. Salmonellae interplay with host cells. Nature
Reviews Microbiology 6:53-66.
125.
Hartemink, R., V. R. Domenech, and F. M. Rombouts. 1997. LAMVAB—A new selective
medium for the isolation of lactobacilli from faeces. Journal of Microbiological Methods 29:77-84.
126.
Hartmann, M., B. Frey, R. Kölliker, and F. Widmer. 2005. Semi-automated genetic analyses of
soil microbial communities: comparison of T-RFLP and RISA based on descriptive and
discriminative statistical approaches. Journal of Microbiological Methods 61:349-360.
127.
Hayden, J. 2005. Salmonella control in pigs using a live attenuated Salmonella typhimurium
vaccine. The Pig Journal 55:228-229.
128.
Herek, Ö., I. Gökalan Kara, and I. Kaleli. 2004. Effects of antibiotics and Saccharomyces
boulardii on bacterial translocation in burn injury. Surgery Today 34:256-260.
129.
Heyndrickx, M., F. Pasmans, R. Ducatelle, A. Decostere, and F. Haesebrouck. 2005. Recent
changes in Salmonella nomenclature: the need for clarification. Veterinary Journal 170:275-277.
130.
Hogberg, A., J. Lindberg, T. Leser, and P. Wallgren. 2004. Influence of cereal non-starch
polysaccharides on ileo-caecal and rectal microbial populations in growing pigs. Acta Veterinaria
Scandinavica 45:87-98.
131.
Hooper, L. V., and J. I. Gordon. 2001. Commensal host-bacterial relationships in the gut. Science
292:1115-1118.
132.
Huang, C., S. Qiao, L. I. Defa, P. Xiangshu, and R. E. N. Jiping. 2004. Effects of lactobacilli on
the performance, diarrhea incidence, VFA concentration and gastrointestinal microbial flora of
weaning pigs, vol. 17. Asian-Autralasian Association of Animal Production Societies, Seoul, Corée,
République de.
121
133.
Huis in't Veld J. H. J., and R. Havenaar. 1993. Selection criteria for microorganisms for probiotic
use. In J. F. Jensen, M. H. Hinton, and R. W. A. W. Mulder (ed.), Prevention and control of
potentially pathogenic microorganisms in poultry and poultry meat processing. The Netherlands.
134.
Inohara, N., and G. Nunez. 2003. NODs: intracellular proteins involved in inflammation and
apoptosis. Nature Reviews Immunology 3:371-382.
135.
Inoue, R., T. Tsukahara, N. Nakanishi, and K. Ushida. 2005. Development of the intestinal
microbiota in the piglet. Journal of General and Applied Microbiology 51:257-265.
136.
Isolauri, E., Y. Sütas, P. Kankaanpää, H. Arvilommi, and S. Salminen. 2001. Probiotics: effects
on immunity. The American Journal of Clinical Nutrition 73:444S-450S.
137.
Iwasaki, A., and B. L. Kelsall. 1999. Freshly isolated peyer's patch, but not spleen, dendritic cells
produce interleukin 10 and induce the differentiation of T helper type 2 cells. Journal of
Experimental Medicine 190:229-239.
138.
Iwasaki, A., and B. L. Kelsall. 2001. Unique functions of CD11b+, CD8α+, and double-negative
Peyer's patch dendritic cells. Journal of Immunology 166:4884-4890.
139.
Jadamus, A., W. Vahjen, K. SchÄFer, and O. Simon. 2002. Influence of the probiotic strain
Bacillus cereus var. toyoi on the development of enterobacterial growth and on selected parameters
of bacterial metabolism in digesta samples of piglets. Journal of Animal Physiology and Animal
Nutrition 86:42-54.
140.
Jensen, B. B. 1998. The impact of feed additives on the microbial ecology of the gut in young pigs.
Journal of Animal and Feed Sciences 7:45-64.
141.
Jensen, B. B., N. Agergaard, L. L. Hansen, L. L. Mikkelsen, M. T. Jensen, and A. Laue. 1998.
Effect of liquid feed on microbial production of skatole in the hind gut, skatole absorption to portal
vein blood and skatole deposition in back fat. In W. K. Jensen (ed.), Skatole and Boartaint, Danish
Meat Research Institute, Roskilde.
142.
Jepson, M. A., C. B. Collares-Buzato, M. A. Clark, B. H. Hirst, and N. L. Simmons. 1995. Rapid
disruption of epithelial barrier function by Salmonella typhimurium is associated with structural
modification of intercellular junctions. Infection and Immunity 63:356-359.
143.
Jijon, H., J. Backer, H. Diaz, H. Yeung, D. Thiel, C. McKaigney, C. De Simone, and K.
Madsen. 2004. DNA from probiotic bacteria modulates murine and human epithelial and immune
function. Gastroenterology 126:1358-1373.
144.
Jones, B. D., N. Ghori, and S. Falkow. 1994. Salmonella typhimurium initiates murine infection by
penetrating and destroying the specialized epithelial M cells of the Peyer's patches. Journal of
Experimental Medicine 180:15-23.
145.
Juven, B. J., R. J. Meinersmann, and N. J. Stern. 1991. Antagonistic effects of lactobacilli and
pediococci to control intestinal colonization by human enteropathogens in live poultry. Journal of
Applied Microbiology 70:95-103.
146.
Kalliomäki, M., S. Salminen, and E. Isolauri. 2008. Positive interactions with the microbiota:
Probiotics, p. 57-66. In G. B. Huffnagle and M. C. Noverr (ed.), GI Microbiota and Regulation of the
Immune System, vol. 635. Springer New York.
147.
Kamel, C., and J. Gasa. 2007. Three steps in feed protect the piglet's gut., p. 6-9, Pig Internatonal,
vol. 37. Watt Publishing Company.
122
148.
Kaplan, C. W., J. C. Astaire, M. E. Sanders, B. S. Reddy, and C. L. Kitts. 2001. 16S ribosomal
DNA terminal restriction fragment pattern analysis of bacterial communities in feces of rats fed
Lactobacillus acidophilus NCFM. Applied and Environmental Microbiology 67:1935-1939.
149.
Katouli, M., A. Lund, P. Wallgren, I. Kühn, O. Söderlind, and R. Möllby. 1997. Metabolic
fingerprinting and fermentative capacity of the intestinal flora of pigs during pre- and post-weaning
periods. Journal of Applied Microbiology 83:147-154.
150.
Ke, Y., K. Pearce, J. P. Lake, H. K. Ziegler, and J. A. Kapp. 1997. γδ T lymphocytes regulate the
induction and maintenance of oral tolerance. Journal of Immunology 158:3610-3618.
151.
Kelly, D., J. I. Campbell, T. P. King, G. Grant, E. A. Jansson, A. G. P. Coutts, S. Pettersson,
and S. Conway. 2004. Commensal anaerobic gut bacteria attenuate inflammation by regulating
nuclear-cytoplasmic shuttling of PPAR-[gamma] and RelA. Nature Immunology 5:104-112.
152.
Kimbrough, T. G., and S. I. Miller. 2000. Contribution of Salmonella typhimurium type III
secretion components to needle complex formation. Proceedings of the National Academy of
Sciences of the United States of America 97:11008-11013.
153.
Kleerebezem, M., and E. E. Vaughan. 2009. Probiotic and gut lactobacilli and bifidobacteria:
molecular approaches to study diversity and activity. Annual Review of Microbiology 63:269-290.
154.
Klimpel, G. R., M. Asuncion, J. Haithcoat, and D. W. Niesel. 1995. Cholera toxin and Salmonella
typhimurium induce different cytokine profiles in the gastrointestinal tract. Infection and Immunity
63:1134-1137.
155.
Konstantinov, S. R., E. Poznanski, S. Fuentes, A. D. L. Akkermans, H. Smidt, and W. M. de
Vos. 2006. Lactobacillus sobrius sp. nov., abundant in the intestine of weaning piglets. International
Journal of Systematic and Evolutionary Microbiology 56:29-32.
156.
Konstantinov, S. R., H. Smidt, A. D. L. Akkermans, L. Casini, P. Trevisi, M. Mazzoni, S. De
Filippi, P. Bosi, and W. M. De Vos. 2008. Feeding of Lactobacillus sobrius reduces Escherichia
coli F4 levels in the gut and promotes growth of infected piglets. FEMS Microbiology Ecology
66:599-607.
157.
Konstantinov, S. R., W.-Y. Zhu, B. A. Williams, S. Tamminga, W. M. de Vos, and A. D. L.
Akkermans. 2003. Effect of fermentable carbohydrates on piglet faecal bacterial communities as
revealed by denaturing gradient gel electrophoresis analysis of 16S ribosomal DNA. FEMS
Microbiology Ecology 43:225-235.
158.
Kritas, S. K., and R. B. Morrison. 2005. Evaluation of probiotics as a substitute for antibiotics in a
large pig nursery. Veterinary Record 156:447-448.
159.
Krog, J., M. Hokland, S. K. Andersen, and E. Tonnesen. 2003. Phenotypic characterisation of
porcine counterparts of human NK cell populations: implications for pre-clinical studies. Anglais
111:133-139.
160.
Krug, M., D. Hausleithner, R. Taddey, P. Volkers, B. Kobe, and K. Cußler. 2005. Serological
test methods as replacement for infection trials in piglets to test the potency of E. coli vaccines for
sows (dams). Serologische Testmethoden als Ersatz für Infektionsversuche an Ferkeln zur
Wirksamkeitsprüfung von E.coli-Muttertierimpfstoffen 22:111-116.
161.
Kubori, T., Y. Matsushima, D. Nakamura, J. Uralil, M. Lara-Tejero, A. Sukhan, J. E. Galán,
and S. I. Aizawa. 1998. Supramolecular structure of the Salmonella typhimurium type III protein
secretion system. Science 280:602-605.
123
162.
Kyriakis, S. C., I. Georgoulakis, A. Spais, C. Alexopoulos, C. C. Miliotis, and S. K. Kritas.
2003. Evaluation of toyocerin, a probiotic containing Bacillus toyoi spores, on health status and
productivity of weaned, growing and finishing pigs. Asian-Australasian Journal of Animal Sciences
16:1326-1331.
163.
Lalmanach, A.-C., and F. Lantier. 1999. Host cytokine response and resistance to Salmonella
infection. Microbes and Infection 1:719-726.
164.
Larue, R., Z. Yu, V. A. Parisi, A. R. Egan, and M. Morrison. 2005. Novel microbial diversity
adherent to plant biomass in the herbivore gastrointestinal tract, as revealed by ribosomal intergenic
spacer analysis and rrs gene sequencing. Environmental Microbiology 7:530-543.
165.
Le Bon, M., H. E. Davies, C. Glynn, C. Thompson, M. Madden, J. Wiseman, C. E. R. Dodd, L.
Hurdidge, G. Payne, Y. Le Treut, J. Craigon, S. Tötemeyer, and K. H. Mellits. 2010. Influence
of probiotics on gut health in the weaned pig. Livestock Science 133:179-181.
166.
Le Dividich, J., and P. Herpin. 1994. Effects of climatic conditions on the performance,
metabolism and health status of weaned piglets: a review. Livestock Production Science 38:79-90.
167.
Le Floc'h, N., C. Jondreville, J. J. Matte, and B. Seve. 2006. Importance of sanitary environment
for growth performance and plasma nutrient homeostasis during the post-weaning period in piglets.
Archives of Animal Nutrition 60:23-34.
168.
Lee, S. H., H. S. Lillehoj, R. A. Dalloul, D. W. Park, Y. H. Hong, and J. J. Lin. 2007. Influence
of Pediococcus-based probiotic on coccidiosis in broiler chickens. Poultry Science 86:63-66.
169.
Leser, T. D., J. Z. Amenuvor, T. K. Jensen, R. H. Lindecrona, M. Boye, and K. Moøller. 2002.
Culture-independent analysis of gut bacteria: The pig gastrointestinal tract microbiota revisited.
Applied and Environmental Microbiology 68:673-690.
170.
Lessard, M., and G. J. Brisson. 1987. Effect of a Lactobacillus fermentation product on growth,
immune response and fecal enzyme activity in weaned pigs. Canadian Journal of Animal Science
67:509-516.
171.
Lessard, M., M. Dupuis, and C. Farmer. 2005. Effects of prolactin inhibition during late gestation
on the immunity of gilts and foetuses. Canadian Journal of Animal Science 85:335-343.
172.
Lessard, M., M. Dupuis, N. Gagnon, E. Nadeau, J. J. Matte, J. Goulet, and J. M. Fairbrother.
2009. Administration of Pediococcus acidilactici or Saccharomyces cerevisiae boulardii modulates
development of porcine mucosal immunity and reduces intestinal bacterial translocation after
Escherichia coli challenge. Journal of Animal Science 87:922-934.
173.
Letellier, A., S. Messier, L. Lessard, S. Chénier, and S. Quessy. 2001. Host response to various
treatments to reduce Salmonella infections in swine. Canadian Journal of Veterinary Research
65:168-172.
174.
Letellier, A., S. Messier, L. Lessard, and S. Quessy. 1999. Assessment of various treatments to
reduce carriage of Salmonella in swine. Canadian Journal of Veterinary Research 64:21-37.
175.
Ley, R. E., M. Hamady, C. Lozupone, P. J. Turnbaugh, R. R. Ramey, J. S. Bircher, M. L.
Schlegel, T. A. Tucker, M. D. Schrenzel, R. Knight, and J. I. Gordon. 2008. Evolution of
mammals and their gut microbes. Science 320:1647-1651.
124
176.
Li, D. F., J. Y. Jiang, and Y. X. Ma. 2001. Early weaning diets and feed additives, p. 247-274. In
R.-J. Xu and P. Cranwell (ed.), The neonatal pig: gastrointestinal physiology and nutrition.
Nottingham University Press, The Netherlands.
177.
Liu, W. T., T. L. Marsh, H. Cheng, and L. J. Forney. 1997. Characterization of microbial
diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16S
rRNA. Applied and Environmental Microbiology 63:4516-4522.
178.
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time
quantitative PCR and the 2−ΔΔCT method. Methods 25:402-408.
179.
Luckey, T. D. 1972. Introduction to intestinal microecology. American Journal of Clinical Nutrition
25:1292-1294.
180.
Mack, D. R., S. Ahrne, L. Hyde, S. Wei, and M. A. Hollingsworth. 2003. Extracellular MUC3
mucin secretion follows adherence of Lactobacillus strains to intestinal epithelial cells in vitro. Gut
52:827-833.
181.
Mackie, R. I., A. Sghir, and H. R. Gaskins. 1999. Developmental microbial ecology of the
neonatal gastrointestinal tract. The American Journal of Clinical Nutrition 69:1035s-1045s.
182.
Madsen, K. 2006. Probiotics and the immune response. Journal of Clinical Gastroenterology
40:232-234.
183.
Mair, C., C. Plitzner, M. W. Pfaffl, K. Schedle, H. H. D. Meyer, and W. Windisch. 2010. Inulin
and probiotics in newly weaned piglets: Effects on intestinal morphology, mRNA expression levels
of inflammatory marker genes and haematology. Archives of Animal Nutrition 64:304-321.
184.
Mañé, J., E. Pedrosa, V. Lorén, M. A. Gassull, J. Espadaler, J. Cuñé, S. Audivert, M. A.
Bonachera, and E. Cabré. 2011. A mixture of Lactobacillus plantarum CECT 7315 and CECT
7316 enhances systemic immunity in elderly subjects: A dose-response, double-blind, placebocontrolled, randomized pilot trial. Nutrición Hospitalaria 26:228-235.
185.
Marcus, S. L., J. H. Brumell, C. G. Pfeifer, and B. B. Finlay. 2000. Salmonella pathogenicity
islands: Big virulence in small packages. Microbes and Infection 2:145-156.
186.
Mastroeni, P. 2002. Immunity to systemic Salmonella infections. Current Molecular Medicine
2:393-406.
187.
Mathew, A. G., M. A. Franklin, W. G. Upchurch, and S. E. Chattin. 1996. Effect of weaning on
ileal short-chain fatty acid concentrations in pigs. Nutrition Research 16:1689-1698.
188.
Mattar, A. F., D. H. Teitelbaum, R. A. Drongowski, F. Yongyi, C. M. Harmon, and A. G.
Coran. 2002. Probiotics up-regulate MUC-2 mucin gene expression in a Caco-2 cell-culture model.
Pediatric Surgery International 18:586-590.
189.
Maxwell, F. J., and C. S. Stewart. 1995. Microbiology of the gut and the role of probiotics, p. 155186. In M. A. Varley. (ed.), The Neonatal Pig: Development and Survival. CAB International,
Wallingford, UK.
190.
McCormick, B. A., S. I. Miller, D. Carnes, and J. L. Madara. 1995. Transepithelial signaling to
neutrophils by salmonellae: A novel virulence mechanism for gastroenteritis. Infection and
Immunity 63:2302-2309.
125
191.
McCracken, B. A., H. R. Gaskins, P. J. Ruwe-Kaiser, K. C. Klasing, and D. E. Jewell. 1995.
Diet-dependent and diet-independent metabolic responses underlie growth stasis of pigs at weaning.
Journal of Nutrition 125:2838-2845.
192.
McCracken, B. A., M. E. Spurlock, M. A. Roos, F. A. Zuckermann, and H. R. Gaskins. 1999.
Weaning anorexia may contribute to local inflammation in the piglet small intestine. Journal of
Nutrition 129:613-619.
193.
McCune, B., J. B. Grace, and D. L. Urban. 2002. Analysis of Ecological Communities, Gleneden
Beach, OR.
194.
McCune, B., and M. J. Mefford. 1999. PC-ORD for Windows. Multivariate analysis of ecological
data. In M. S. Design (ed.), Oregon, USA.
195.
McEwen, S. A., and P. J. Fedorka-Cray. 2002. Antimicrobial use and resistance in animals.
Clinical Infectious Diseases 34:S93-S106.
196.
McGovern, V. J., and L. J. Slavutin. 1979. Pathology of Salmonella colitis. American Journal of
Surgical Pathology 3:483-490.
197.
McGuckin, M. A., R. Eri, L. A. Simms, T. H. J. Florin, and G. Radford-Smith. 2009. Intestinal
barrier dysfunction in inflammatory bowel diseases. Inflammatory Bowel Diseases 15:100-113.
198.
McHeyzer-Williams, L. J., and M. G. McHeyzer-Williams. 2005. Antigen-specific memory B cell
development. Annual Review of Immunology 23:487-513.
199.
McSorley, S. J., S. Asch, M. Costalonga, R. L. Reinhardt, and M. K. Jenkins. 2002. Tracking
Salmonella-specific CD4 T cells in vivo reveals a local mucosal response to a disseminated
infection. Immunity 16:365-377.
200.
McSorley, S. J., B. D. Ehst, Y. Yu, and A. T. Gewirtz. 2002. Bacterial flagellin is an effective
adjuvant for CD4+ T cells in vivo. Journal of Immunology 169:3914-3919.
201.
McSorley, S. J., and M. K. Jenkins. 2000. Antibody is required for protection against virulent but
not attenuated Salmonella enterica serovar Typhimurium. Infection and Immunity 68:3344-3348.
202.
Metchnikoff, É. 1907. The prolongation of life. Heinemann, London, UK.
203.
Meurens, F., M. Berri, G. Auray, S. Melo, B. Levast, I. Virlogeux-Payant, C. Chevaleyre, V.
Gerdts, and H. Salmon. 2009. Early immune response following Salmonella enterica subspecies
enterica serovar Typhimurium infection in porcine jejunal gut loops. Veterinary Research 40:5.
204.
Miao, E. A., C. M. Alpuche-Aranda, M. Dors, A. E. Clark, M. W. Bader, S. I. Miller, and A.
Aderem. 2006. Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1[beta] via
Ipaf. Nature Immunology 7:569-575.
205.
Michel, M. C., and S. Boche. 1966. Métabolisme de la flore intestinale du porc. Dégradation des
formes L et D des acides aminés. Annales de biologie animale, biochimie, biophysique 6:33-46.
206.
Michetti, P., M. J. Mahan, J. M. Slauch, J. J. Mekalanos, and M. R. Neutra. 1992. Monoclonal
secretory immunoglobulin A protects mice against oral challenge with the invasive pathogen
Salmonella typhimurium. Infection and Immunity 60:1786-1792.
207.
Midvedt, T. 1989. Monitoring the functional state of the microflora. In T. Hattori, Y. Ishida, and et
al. (ed.), Recent Advances in Microbial Ecology. Japan Science Society Press, Tokyo.
126
208.
Miettinen, M., S. Matikainen, J. Vuopio-Varkila, J. Pirhonen, K. Varkila, M. Kurimoto, and I.
Julkunen. 1998. Lactobacilli and streptococci induce interleukin-12 (IL-12), IL-18, and gamma
interferon production in human peripheral blood mononuclear cells. Infection and Immunity
66:6058-6062.
209.
Mizuno, Y., H. Takada, A. Nomura, C. H. Jin, H. Hattori, K. Ihara, T. Aoki, K. Eguchi, and T.
Hara. 2003. Th1 and Th1-inducing cytokines in Salmonella infection. Clinical and Experimental
Immunology 131:111-117.
210.
Monack, D. M., D. M. Bouley, and S. Falkow. 2004. Salmonella typhimurium persists within
macrophages in the mesenteric lymph nodes of chronically infected Nramp1+/+ mice and can be
reactivated by IFNγ neutralization. The Journal of Experimental Medicine 199:231-241.
211.
Mondel, M., B. O. Schroeder, K. Zimmermann, H. Huber, S. Nuding, J. Beisner, K.
Fellermann, E. F. Stange, and J. Wehkamp. 2008. Probiotic E. coli treatment mediates
antimicrobial human [beta]-defensin synthesis and fecal excretion in humans. Mucosal Immunology
2:166-172.
212.
Morrissey, P. J., K. Charrier, and S. N. Vogel. 1995. Exogenous tumor necrosis factor alpha and
interleukin-1 alpha increase resistance to Salmonella typhimurium: efficacy is influenced by the Ity
and Lps loci. Infection and Immunity 63:3196-3198.
213.
Mosmann, T. R., and R. L. Coffman. 1989. TH1 and TH2 cells: Different patterns of lymphokine
secretion lead to different functional properties. Annual Review of Immunology 7:145-173.
214.
Mosser, D. M., and J. P. Edwards. 2008. Exploring the full spectrum of macrophage activation.
Nature Reviews Immunology 8:958-969.
215.
Mowat, A. M. 2003. Anatomical basis of tolerance and immunity to intestinal antigens. Nature
Reviews Immunology 3:331-341.
216.
Mukherjee, P., A. Dani, S. Bhatia, N. Singh, A. Y. Rudensky, A. George, V. Bal, S. Mayor, and
S. Rath. 2001. Efficient presentation of both cytosolic and endogenous transmembrane protein
antigens on MHC class II is dependent on cytoplasmic proteolysis. Journal of Immunology
167:2632-2641.
217.
Muotiala, A., and P. H. Makela. 1993. Role of gamma interferon in late stages of murine
salmonellosis. Infection and Immunity 61:4248-4253.
218.
Muotiala, A., and P. H. Mäkelä. 1990. The role of IFN-[gamma] in murine Salmonella
typhimurium infection. Microbial Pathogenesis 8:135-141.
219.
Muyzer, G., E. C. de Waal, and A. G. Uitterlinden. 1993. Profiling of complex microbial
populations by denaturing gradient gel electrophoresis analysis of polymerase chain reactionamplified genes coding for 16S rRNA. Applied and Environmental Microbiology 59:695-700.
220.
Nagashima, K., T. Hisada, M. Sato, and J. Mochizuki. 2003. Application of new primer-enzyme
combinations to terminal restriction fragment length polymorphism profiling of bacterial populations
in human feces. Applied and Environmental Microbiology 69:1251-1262.
221.
Nauciel, C., and F. Espinasse-Maes. 1992. Role of gamma interferon and tumor necrosis factor
alpha in resistance to Salmonella typhimurium infection. Infection and Immunity 60:450-454.
222.
Neish, A. S. 2004. Bacterial inhibition of eukaryotic pro-inflammatory pathways. Immunologic
Research 29:175-185.
127
223.
Neish, A. S., A. T. Gewirtz, H. Zeng, A. N. Young, M. E. Hobert, V. Karmali, A. S. Rao, and J.
L. Madara. 2000. Prokaryotic regulation of epithelial responses by inhibition of IκB-α
ubiquitination. Science 289:1560-1563.
224.
Ng, S. C., A. L. Hart, M. A. Kamm, A. J. Stagg, and S. C. Knight. 2009. Mechanisms of action of
probiotics: Recent advances. Inflammatory Bowel Diseases 15:300-310.
225.
Nicoletti, C. 2000. Unsolved mysteries of intestinal M cells. Gut 47:735-739.
226.
Nix, R. N., S. E. Altschuler, P. M. Henson, and C. S. Detweiler. 2007. Hemophagocytic
macrophages harbor Salmonella enterica during persistent infection. PLoS Pathogens 3:e193.
227.
Nocker, A., M. Burr, and A. Camper. 2007. Genotypic microbial community profiling: A critical
technical review. Microbial Ecology 54:276-289.
228.
Nurieva, R. I., and Y. Chung. 2010. Understanding the development and function of T follicular
helper cells. Cellular and Molecular Immunology 7:190-197.
229.
O'Hara, A. M., and F. Shanahan. 2006. The gut flora as a forgotten organ. EMBO Reports 7:688693.
230.
O'Toole, P. W., and J. C. Cooney. 2008. Probiotic bacteria influence the composition and function
of the intestinal microbiota. Interdisciplinary Perspectives on Infectious Diseases 2008:175285.
231.
Ochman, H., F. C. Soncini, F. Solomon, and E. A. Groisman. 1996. Identification of a
pathogenicity island required for Salmonella survival in host cells. Proceedings of the National
Academy of Sciences of the United States of America 93:7800-7804.
232.
Oelschlaeger, T. A. 2010. Mechanisms of probiotic actions – A review. International Journal of
Medical Microbiology 300:57-62.
233.
Ogram, A. 1998. Isolation of nucleic acids from environmental samples., p. 273-288. In R. S.
Burlage, R. Atlas, D. Stahl, G. Geesey, and G. Sayler (ed.), Techniques in Microbial Ecology.
Oxford University Press, New York.
234.
Ohland, C. L., and W. K. MacNaughton. 2010. Probiotic bacteria and intestinal epithelial barrier
function. American Journal of Physiology - Gastrointestinal and Liver Physiology 298:G807-G819.
235.
Ojha, S., and M. Kostrzynska. 2007. Approaches for reducing Salmonella in pork production.
Journal of Food Protection 70:2676-2694.
236.
Osborn, A. M., E. R. B. Moore, and K. N. Timmis. 2000. An evaluation of terminal-restriction
fragment length polymorphism (T-RFLP) analysis for the study of microbial community structure
and dynamics. Environmental Microbiology 2:39-50.
237.
Osman, N., D. Adawi, S. Ahrne, B. Jeppsson, and G. Molin. 2004. Modulation of the effect of
dextran sulfate sodium-induced acute colitis by the administration of different probiotic strains of
Lactobacillus and Bifidobacterium. Digestive Diseases and Sciences 49:320-327.
238.
Otte, J.-M., E. Cario, and D. K. Podolsky. 2004. Mechanisms of cross hyporesponsiveness to tolllike receptor bacterial ligands in intestinal epithelial cells. Gastroenterology 126:1054-1070.
239.
Otte, J. M., and D. K. Podolsky. 2004. Functional modulation of enterocytes by gram-positive and
gram-negative microorganisms. American Journal of Physiology - Gastrointestinal and Liver
Physiology 286:G613-G626.
128
240.
Ouwehand, A. C., P. V. Kirjavainen, M. M. Grönlund, E. Isolauri, and S. J. Salminen. 1999.
Adhesion of probiotic micro-organisms to intestinal mucus. International Dairy Journal 9:623-630.
241.
Pabst, R., M. Geist, H. J. Rothkotter, and F. J. Fritz. 1988. Postnatal development and
lymphocyte production of jejunal and ileal Peyer's patches in normal and gnotobiotic pigs.
Immunology 64:539-544.
242.
Pace, N. R., D. A. Stahl, D. J. Lane, and G. J. Olsen. 1986. The analysis of natural microbial
populations by ribosomal RNA sequences. Advances in microbial ecology 9:1-55.
243.
Palleroni, N. J. 1997. Prokaryotic diversity and the importance of culturing. Antonie van
Leeuwenhoek 72:3-19.
244.
Park, H. B., D. J. Paik, E. Jang, S. Hong, and J. Youn. 2004. Acquisition of anergic and
suppressive activities in transforming growth factor-Β-costimulated CD4+ CD25- T cells.
International Immunology 16:1203-1213.
245.
Pascual, M., M. Hugas, J. I. Badiola, J. M. Monfort, and M. Garriga. 1999. Lactobacillus
salivarius CTC2197 prevents Salmonella enteritidis colonization in chickens. Applied and
Environmental Microbiology 65:4981-4986.
246.
Petrof, E. O., K. Kojima, M. J. Ropeleski, M. W. Musch, Y. Tao, C. De Simone, and E. B.
Chang. 2004. Probiotics inhibit nuclear factor-[kappa]B and induce heat shock proteins in colonic
epithelial cells through proteasome inhibition. Gastroenterology 127:1474-1487.
247.
Philpott, D. J., and S. E. Girardin. 2004. The role of Toll-like receptors and Nod proteins in
bacterial infection. Molecular Immunology 41:1099-1108.
248.
Pié, S., J. P. Lallès, F. Blazy, J. Laffitte, B. Sève, and I. P. Oswald. 2004. Weaning is associated
with an upregulation of expression of inflamatory cytokines in the intestine of piglets. Journal of
Nutrition 134:641-647.
249.
Poppe, C., N. Smart, R. Khakhria, W. Johnson, J. Spika, and J. Prescott. 1998. Salmonella
typhimurium DT104: A virulent and drug-resistant pathogen. Canadian Veterinary Journal 39:559565.
250.
Poppe, C., K. Ziebell, L. Martin, and A. K. 2002. Diversity in antimicrobial resistance and other
characteristics among Salmonella typhimurium DT104 isolates. Microbial Drug Resistance 8:107122.
251.
Prouty, A. M., I. E. Brodsky, S. Falkow, and J. S. Gunn. 2004. Bile-salt-mediated induction of
antimicrobial and bile resistance in Salmonella typhimurium. Microbiology 150:775-783.
252.
Pryde, S. E., A. J. Richardson, C. S. Stewart, and H. J. Flint. 1999. Molecular analysis of the
microbial diversity present in the colonic wall, colonic lumen, and cecal lumen of a pig. Applied and
Environmental Microbiology 65:5372-5377.
253.
Radecki, S. V., and M. T. Yokohama. 1991. Intestinal bacteria and their influence on swine
nutrition. In R. Miller, D. E. Ullrey, and A. J. Lewis (ed.), Swine Nutrition, Butterworth Heinemann,
Boston, USA.
254.
Ramarathinam, L., R. A. Shaban, D. W. Niesel, and G. R. Klimpel. 1991. Interferon gamma
(IFN-γ) production by gut-associated lymphoid tissue and spleen following oral Salmonella
typhimurium challenge. Microbial Pathogenesis 11:347-356.
129
255.
Ramette, A. 2007. Multivariate analyses in microbial ecology. FEMS Microbiology Ecology
62:142-160.
256.
Reid, G., and R. Friendship. 2002. Alternatives to antibiotic use: probiotics for the gut. Animal
Biotechnology 13:97-112.
257.
Reid, G., A. L. Servin, A. W. Bruce, and H. J. Busscher. 1993. Adhesion of three Lactobacillus
strains to human urinary and intestinal epithelial cells. Microbios 75:57-65.
258.
Reilly, K., and G. T. Attwood. 1998. Detection of Clostridium proteoclasticum and closely related
strains in the rumen by competitive PCR. Applied and Environmental Microbiology 64:907-913.
259.
Rérat, A., C. Jouandet, J. Lougnon, Y. Daniel, G. Rouzet, F. Houlier, and M. Lecourtier. 1965.
Influence des antibiotiques sur la rétention azotée chez le rat en croissance. Annales de biologie
animale, biochimie, biophysique 5:41-51.
260.
Rescigno, M., M. Urbano, B. Valzasina, M. Francolini, G. Rotta, R. Bonasio, F. Granucci, J. P.
Kraehenbuhl, and P. Ricciardi-Castagnoli. 2001. Dendritic cells express tight junction proteins
and penetrate gut epithelial monolayers to sample bacteria. Nature Immunology 2:361-367.
261.
Resta-Lenert, S., and K. E. Barrett. 2003. Live probiotics protect intestinal epithelial cells from
the effects of infection with enteroinvasive Escherichia coli (EIEC). Gut 52:988-997.
262.
Resta-Lenert, S., and K. E. Barrett. 2006. Probiotics and commensals reverse TNF-[alpha]- and
IFN-[gamma]-induced dysfunction in human intestinal epithelial cells. Gastroenterology 130:731746.
263.
Rettedal, E., S. Vilain, S. Lindblom, K. Lehnert, C. Scofield, S. George, S. Clay, R. S. Kaushik,
A. J. M. Rosa, D. Francis, and V. S. Brözel. 2009. Alteration of the ileal microbiota of weanling
piglets by the growth-promoting antibiotic chlortetracycline. Applied and Environmental
Microbiology 75:5489-5495.
264.
Richter-Dahlfors, A., A. M. J. Buchan, and B. B. Finlay. 1997. Murine salmonellosis studied by
confocal microscopy: Salmonella typhimurium resides intracellularly inside macrophages and exerts
a cytotoxic effect on phagocytes in vivo. Journal of Experimental Medicine 186:569-580.
265.
Rimoldi, M., M. Chieppa, V. Salucci, F. Avogadri, A. Sonzogni, G. M. Sampietro, A. Nespoli,
G. Viale, P. Allavena, and M. Rescigno. 2005. Intestinal immune homeostasis is regulated by the
crosstalk between epithelial cells and dendritic cells. Nature Immunology 6:507-514.
266.
Rode, L. M., B. R. S. Genthner, and M. P. Bryant. 1981. Syntrophic association by cocultures of
the methanol- and CO2-H2-utilizing species Eubacterium limosum and pectin-fermenting
Lachnospira multiparus during growth in a pectin medium. Applied and Environmental
Microbiology 42:20-22.
267.
Rodríguez, J. M., M. I. Martínez, and J. Kok. 2002. Pediocin PA-1, a wide-spectrum bacteriocin
from lactic acid bacteria. Critical Reviews in Food Science and Nutrition 42:91-121.
268.
Roediger, W. E. 1982. Utilization of nutrients by isolated epithelial cells of the rat colon.
Gastroenterology 83:424-429.
269.
Roesler, U., H. Marg, I. Schröder, S. Mauer, T. Arnold, J. Lehmann, U. Truyen, and A. Hensel.
2004. Oral vaccination of pigs with an invasive gyrA-cpxA-rpoB Salmonella Typhimurium mutant.
Vaccine 23:595-603.
130
270.
Roselli, M., A. Finamore, M. S. Britti, S. R. Konstantinov, H. Smidt, W. M. de Vos, and E.
Mengheri. 2007. The novel porcine Lactobacillus sobrius strain protects intestinal cells from
enterotoxigenic Escherichia coli K88 infection and prevents membrane barrier damage. The Journal
of Nutrition 137:2709-2716.
271.
Ruiz, P. A., M. Hoffmann, S. Szcesny, M. Blaut, and D. Haller. 2005. Innate mechanisms for
Bifidobacterium lactis to activate transient pro-inflammatory host responses in intestinal epithelial
cells after the colonization of germ-free rats. Immunology 115:441-450.
272.
Rydström, A., and M. J. Wick. 2007. Monocyte recruitment, activation, and function in the gutassociated lymphoid tissue during oral Salmonella infection. Journal of Immunology 178:5789-5801.
273.
Salminen, S., A. Ouwehand, Y. Benno, and Y. K. Lee. 1999. Probiotics: how should they be
defined? Trends in Food Science & Technology 10:107-110.
274.
Salmon, H., M. Berri, V. Gerdts, and F. Meurens. 2009. Humoral and cellular factors of maternal
immunity in swine. Developmental & Comparative Immunology 33:384-393.
275.
Salter, D. N., M. E. Coates, and D. Hewitt. 1974. The utilization of protein and excretion of uric
acid in germ free and conventional chicks. British Journal of Nutrition 31:307-318.
276.
Sansom, B. F., and P. T. Gleed. 1981. The ingestion of sow's faeces by suckling piglets. British
Journal of Nutrition 46:451-456.
277.
SAS Institute, I. 2002. SAS statistical analysis system. Release 9.1. SAS Institute, Inc., Cary, NC.
278.
Scharek, L., J. Guth, K. Reiter, K. D. Weyrauch, D. Taras, P. Schwerk, P. Schierack, M. F. G.
Schmidt, L. H. Wieler, and K. Tedin. 2005. Influence of a probiotic Enterococcus faecium strain
on development of the immune system of sows and piglets. Veterinary Immunology and
Immunopathology 105:151-161.
279.
Schlee, M., J. Harder, B. Köten, E. F. Stange, J. Wehkamp, and K. Fellermann. 2008. Probiotic
lactobacilli and VSL#3 induce enterocyte β-defensin 2. Clinical and Experimental Immunology
151:528-535.
280.
Selsted, M. E., S. I. Miller, A. H. Henschen, and A. J. Ouellette. 1992. Enteric defensins:
Antibiotic peptide components of intestinal host defense. Journal of Cell Biology 118:929-936.
281.
Servin, A. L. 2004. Antagonistic activities of lactobacilli and bifidobacteria against microbial
pathogens. FEMS Microbiology Reviews 28:405-440.
282.
Shanahan, F. 2002. The host-microbe interface within the gut. Bailliere's Best Practice and
Research in Clinical Gastroenterology 16:915-931.
283.
Shanahan, F. 2003. Probiotics: A perspective on problems and pitfalls. Scandinavian Journal of
Gastroenterology, Supplement 38:34-36.
284.
Shannon, C. E., and W. Weaver. 1963. The mathematical theory of communication. University of
Illinois Press, Urbana, IL.
285.
Sheil, B., J. McCarthy, L. O’Mahony, M. W. Bennett, P. Ryan, J. J. Fitzgibbon, B. Kiely, J. K.
Collins, and F. Shanahan. 2004. Is the mucosal route of administration essential for probiotic
function? Subcutaneous administration is associated with attenuation of murine colitis and arthritis.
Gut 53:694-700.
131
286.
Shi, H. N., and W. A. Walker. 2004. Bacterial colonization and the development of the intestinal
defenses. Canadian Journal of Gastroenterology 18:493-500.
287.
Shim, S. 2005. Effects of prebiotics, probiotics and synbiotics in the diet of young pigs. Wageningen
University, Wageningen.
288.
Shu, Q., F. Qu, and H. S. Gill. 2001. Probiotic treatment using Bifidobacterium lactis HN019
reduces weanling diarrhea associated with rotavirus and Escherichia coli infection in a piglet model.
Journal of Pediatric Gastroenterology and Nutrition 33:171-177.
289.
Shyu, C., T. Soule, S. Bent, J. Foster, and L. Forney. 2007. MiCA: A web-based tool for the
analysis of microbial communities based on terminal-restriction fragment length polymorphisms of
16S and 18S rRNA genes. Microbial Ecology 53:562-570.
290.
Silvi, S., C. J. Rumney, and I. R. Rowland. 1996. An assessment of three selective media for
bifidobacteria in faeces. Journal of Applied Microbiology 81:561-564.
291.
Simon, O., W. Vahjen, and L. Scharek. 2003. Micro-organisms as feed additives - Probiotics, p.
295-318. In R. O. Ball (ed.), Proceeding of the 9th international symposium on digestive physiology
in pigs, vol. 1. University of Alberta, Banff, Canada.
292.
Simon, R., D. M. Heithoff, M. J. Mahan, and C. E. Samuel. 2007. Comparison of tissue-selective
proinflammatory gene induction in mice infected with wild-type, DNA adenine methylase-deficient,
and flagellin-deficient Salmonella enterica. Infection and Immunity 75:5627-5639.
293.
Simpson, J. M., V. J. McCracken, H. R. Gaskins, and R. I. Mackie. 2000. Denaturing gradient
gel electrophoresis analysis of 16S ribosomal DNA amplicons to monitor changes in fecal bacterial
populations of weaning pigs after introduction of Lactobacillus reuteri strain MM53. Applied and
Environmental Microbiology 66:4705-4714.
294.
Simpson, J. M., V. J. McCracken, B. A. White, H. R. Gaskins, and R. I. Mackie. 1999.
Application of denaturant gradient gel electrophoresis for the analysis of the porcine gastrointestinal
microbiota. Journal of Microbiological Methods 36:167-179.
295.
Smith, D. L., A. D. Harris, J. A. Johnson, E. K. Silbergeld, and J. G. Morris. 2002. Animal
antibiotic use has an early but important impact on the emergence of antibiotic resistance in human
commensal bacteria. Proceedings of the National Academy of Sciences of the United States of
America 99:6434-6439.
296.
Sougioultzis, S., S. Simeonidis, K. R. Bhaskar, X. Chen, P. M. Anton, S. Keates, C. Pothoulakis,
and C. P. Kelly. 2006. Saccharomyces boulardii produces a soluble anti-inflammatory factor that
inhibits NF-[kappa]B-mediated IL-8 gene expression. Biochemical and Biophysical Research
Communications 343:69-76.
297.
Ŝplíchal, I., I. Trebichavský, Y. Muneta, and Y. Mori. 2002. Early cytokine response of
gnotobiotic piglets to Salmonella enterica serotype Typhimurium. Veterinary Research 33:291-297.
298.
Spolski, R., and W. J. Leonard. 2008. Interleukin-21: Basic biology and implications for cancer
and autoimmunity. Annual Review of Immunology 26:57-79.
299.
Srinivasan, A., and S. J. McSorley. 2006. Activation of Salmonella-specific immune responses in
the intestinal mucosa. Archivum Immunologiae et Therapiae Experimentalis 54:25-31.
300.
Stewart, C. S. 1999. Microorganisms in hindgut fermentors. In R. I. Mackie and B. A. White (ed.),
Gastrointestinal Microbiol., 2 ed. Chapman and Hall Microbiol. Series, New York.
132
301.
Stirling, J., M. Griffith, J. S. G. Dooley, C. E. Goldsmith, A. Loughrey, C. J. Lowery, R.
McClurg, K. McCorry, D. McDowell, A. McMahon, B. C. Millar, J. Rao, P. J. Rooney, W. J.
Snelling, M. Matsuda, and J. E. Moore. 2008. Zoonoses associated with petting farms and open
zoos. Vector-Borne and Zoonotic Diseases 8:85-92.
302.
Swords, W. E., C. C. WU, F. R. Champlin, and R. K. Buddington. 1993. Postnatal changes in
selected bacterial groups of the pig colonic microflora. Biology of the Neonate 63:191-200.
303.
Szabó, I., L. H. Wieler, K. Tedin, L. Scharek-Tedin, D. Taras, A. Hensel, B. Appel, and K.
Nöckler. 2009. Influence of a probiotic strain of Enterococcus faecium on Salmonella enterica
serovar Typhimurium DT104 infection in a porcine animal infection model. Applied and
Environmental Microbiology 75:2621-2628.
304.
Takeda, K., and S. Akira. 2004. TLR signaling pathways. Seminars in Immunology 16:3-9.
305.
Takeuchi, A. 1967. Electron microscope studies of experimental Salmonella infection. I. Penetration
into the intestinal epithelium by Salmonella typhimurium. American Journal of Pathology 50:109136.
306.
Talbot, G., C. S. Roy, E. Topp, C. Beaulieu, M.-F. Palin, and D. I. Massé. 2009. Multivariate
statistical analyses of rDNA and rRNA fingerprint data to differentiate microbial communities in
swine manure. FEMS Microbiology Ecology 70:540-552.
307.
Talbot, G., E. Topp, M. F. Palin, and D. I. Massé. 2008. Evaluation of molecular methods used for
establishing the interactions and functions of microorganisms in anaerobic bioreactors. Water
Research 42:513-537.
308.
Tannock, G. W., K. Munro, H. J. M. Harmsen, G. W. Welling, J. Smart, and P. K. Gopal.
2000. Analysis of the fecal microflora of human subjects consuming a probiotic product containing
Lactobacillus rhamnosus DR20. Applied and Environmental Microbiology 66:2578-2588.
309.
Taras, D., W. Vahjen, M. Macha, and O. Simon. 2006. Performance, diarrhea incidence, and
occurrence of Escherichia coli virulence genes during long-term administration of a probiotic
Enterococcus faecium strain to sows and piglets. Journal of Animal Science 84:608-617.
310.
Taras, D., W. Vahjen, M. Macha, and O. Simon. 2005. Response of performance characteristics
and fecal consistency to long-lasting dietary supplementation with the probiotic strain Bacillus
cereus var. toyoi to sows and piglets. Archives of Animal Nutrition 59:405-417.
311.
Taras, D., W. Vahjen, and O. Simon. 2007. Probiotics in pigs - modulation of their intestinal
distribution and of their impact on health and performance. Livestock Science 108:229-231.
312.
Teitelbaum, J. E., and W. A. Walker. 2002. Nutritional impact of pre- and probiotics as protective
gastrointestinal organisms. Annual Review of Nutrition 22:107-138.
313.
Therese, K. L., A. R. Anand, and H. N. Madhavan. 1998. Polymerase chain reaction in the
diagnosis of bacterial endophthalmitis. British Journal of Ophthalmology 82:1078-1082.
314.
Threlfall, E. J., J. A. Frost, L. R. Ward, and B. Rowe. 1994. Epidemic in cattle and humans of
Salmonella typhimurium DT 104 with chromosomally integrated multiple drug resistance. Veterinary
Record 134:577.
315.
Threlfall, E. J., J. A. Frost, L. R. Ward, and B. Rowe. 1996. Increasing spectrum of resistance in
multiresistant Salmonella typhimurium. Lancet 347:1053-1054.
133
316.
Threlfall, E. J., L.R. Ward, and B. Rowe. 1997. Increasing incidence of resistance to trimethoprim
and ciprofloxacin in epidemic Salmonella typhimurium DT104 in England and Wales.
Eurosurveillance 2:81-84.
317.
Tindall, B. J., P. A. D. Grimont, G. M. Garrity, and J. P. Euzéby. 2005. Nomenclature and
taxonomy of the genus Salmonella. International Journal of Systematic and Evolutionary
Microbiology 55:521-524.
318.
Tizard, R. I. 2004. Lymphocytes, p. 94, Veterinary Immunology, An introduction, 7 ed. Elsevier,
Saunders.
319.
Todoriki, K., T. Mukai, S. Sato, and T. Toba. 2001. Inhibition of adhesion of food-borne
pathogens to Caco-2 cells by Lactobacillus strains. Journal of Applied Microbiology 91:154-159.
320.
Trebichavský, I., I. Šplíchal, A. Šplíchalová, Y. Muneta, and Y. Mori. 2003. Systemic and local
cytokine response of young piglets to oral infection with Salmonella enterica serotype typhimurium.
Folia Microbiologica 48:403-407.
321.
Uematsu, S., and S. Akira. 2006. Toll-like receptors and innate immunity. Journal of Molecular
Medicine 84:712-725.
322.
Ukena, S. N., A. Singh, U. Dringenberg, R. Engelhardt, U. Seidler, W. Hansen, A. Bleich, D.
Bruder, A. Franzke, G. Rogler, S. Suerbaum, J. Buer, F. Gunzer, and A. M. Westendorf. 2007.
Probiotic Escherichia coli Nissle 1917 inhibits leaky gut by enhancing mucosal integrity. PLoS ONE
2:e1308.
323.
Umesaki, Y., Y. Okada, S. Matsumoto, A. Imaoka, and H. Setoyama. 1995. Segmented
filamentous bacteria are indigenous intestinal bacteria that activate intraepithelial lymphocytes and
induce MHC class II molecules and fucosyl asialo GM1 glycolipids on the small intestinal epithelial
cells in the ex-germ-free mouse. Microbiology and Immunology 39:555-562.
324.
Uthe, J. J., A. Royaee, J. K. Lunney, T. J. Stabel, S. H. Zhao, C. K. Tuggle, and S. M. D.
Bearson. 2007. Porcine differential gene expression in response to Salmonella enterica serovars
Choleraesuis and Typhimurium. Molecular Immunology 44:2900-2914.
325.
Van der Peet-Schwering, C. M. C., A. J. M. Jansman, H. Smidt, and I. Yoon. 2007. Effects of
yeast culture on performance, gut integrity, and blood cell composition in weanling pigs. Journal of
Animal Science 85:3099-3109.
326.
Van Kessel, A., T. W. Shirkey, R. H. Siggers, M. D. Drew, and B. Laarveld. 2004. Commensal
bacteria and intestinal development. Studies using gnotobiotic pigs. In L. A. Tucker and J. A. TaylorPickard (ed.), Interfacing immunity, gut health and performance. Nottingham University Press,
Nottingham, UK.
327.
Vazquez-Torres, A., J. Jones-Carson, A. J. Baumler, S. Falkow, R. Valdivia, W. Brown, M. Le,
R. Berggren, W. T. Parks, and F. C. Fang. 1999. Extraintestinal dissemination of Salmonella by
CD18-expressing phagocytes. Nature 401:804-808.
328.
Vervaeke, I. J., J. A. Decuypere, N. A. Dierick, and H. K. Henderickx. 1979. Quantitative in
vitro evaluation of the energy metabolism influenced by virginiamycin and spiramycin used as
growth promoters in pig nutrition. Journal of Animal Science 49:846-856.
329.
Viala, J., C. Chaput, I. G. Boneca, A. Cardona, S. E. Girardin, A. P. Moran, R. Athman, S.
Mémet, M. R. Huerre, A. J. Coyle, P. S. DiStefano, P. J. Sansonetti, A. Labigne, J. Bertin, D. J.
134
Philpott, and R. L. Ferrero. 2004. Nod1 responds to peptidoglycan delivered by the Helicobacter
pylori cag pathogenicity island. Nature Immunology 5:1166-1174.
330.
Vincze, T., J. Posfai, and R. J. Roberts. 2003. NEBcutter: a program to cleave DNA with
restriction enzymes. Nucleic Acids Research 31:3688-3691.
331.
Visek, W. J. 1978. The mode of growth promotion by antibiotics. Journal of Animal Science
46:1447-1469.
332.
Voedisch, S., C. Koenecke, S. David, H. Herbrand, R. Förster, M. Rhen, and O. Pabst. 2009.
Mesenteric lymph nodes confine dendritic cell-mediated dissemination of Salmonella enterica
serovar Typhimurium and limit systemic disease in mice. Infection and Immunity 77:3170-3180.
333.
Wallgren, P., and L. Melin. 2001. Weaning systems in relation to disease, p. 309-316. In M. A.
Varley and J. Wiseman (ed.). CABI Publishing, Wallingford.
334.
Wang, X., F. Yang, C. Liu, H. Zhou, G. Wu, S. Qiao, D. Li, and J. Wang. 2012. Dietary
supplementation with the probiotic Lactobacillus fermentum I5007 and the antibiotic aureomycin
differentially affects the small intestinal proteomes of weanling piglets. The Journal of Nutrition
142:7-13.
335.
Ward, D. M., R. Weller, and M. M. Bateson. 1990. 16S rRNA sequences reveal numerous
uncultured microorganisms in a natural community. Nature 345:63-65.
336.
Wealleans, A. L., and J. C. Litten-Brown. 2010. The potential of probiotics as in-feed growth
enhancers for swine. Food Science and Technology Bulletin: Functional Foods 7:65-75.
337.
Wehkamp, J., J. Harder, K. Wehkamp, B. Wehkamp-Von Meissner, M. Schlee, C. Enders, U.
Sonnenborn, S. Nuding, S. Bengmark, K. Fellermann, J. M. Schröder, and E. F. Stange. 2004.
NF-κB- and AP-1-mediated induction of human beta defensin-2 in intestinal epithelial cells by
Escherichia coli Nissle 1917: A novel effect of a probiotic bacterium. Infection and Immunity
72:5750-5758.
338.
Wei, B., G. Wingender, D. Fujiwara, D. Y. Chen, M. McPherson, S. Brewer, J. Borneman, M.
Kronenberg, and J. Braun. 2010. Commensal microbiota and CD8+ T cells shape the formation of
invariant NKT cells. The Journal of Immunology 184:1218-1226.
339.
Wenk, C. 2003. Growth promoter alternatives after the ban on antibiotics. Pig News and
Information 24:11N-16N.
340.
Wiemann, M. 2003. How do probiotic feed additives work? International Poulty Production 11:7-9.
341.
Willemsen, L. E. M., M. A. Koetsier, S. J. H. van Deventer, and E. A. F. van Tol. 2003. Short
chain fatty acids stimulate epithelial mucin 2 expression through differential effects on prostaglandin
E1 and E2 production by intestinal myofibroblasts. Gut 52:1442-1447.
342.
Wilson, A. D., C. R. Stokes, and F. J. Bourne. 1986. Morphology and functional characteristics of
isolated porcine intraepithelial lymphocytes. Immunology 59:109-113.
343.
Wing, K., and S. Sakaguchi. 2010. Regulatory T cells exert checks and balances on self tolerance
and autoimmunity. Nature Immunology 11:7-13.
344.
Winkler, P., D. Ghadimi, J. Schrezenmeir, and J.-P. Kraehenbuhl. 2007. Molecular and cellular
basis of microflora-host interactions. The Journal of Nutrition 137:756S-772S.
135
345.
Woese, C. R., O. Kandler, and M. L. Wheelis. 1990. Towards a natural system of organisms:
proposal for the domains Archaea, Bacteria, and Eucarya. Proceedings of the National Academy of
Sciences 87:4576-4579.
346.
Wostmann, B. S. 1996. Germfree and gnotobiotic animal models: background and applications, 1
ed. CRC-Press.
347.
Xu, J., and J. I. Gordon. 2003. Honor the symbionts. Proceedings of the National Academy of
Sciences of the United States of America 100:10452-10459.
348.
Yu, H. F., A. N. Wang, X. J. Li, and S. Y. Qiao. 2008. Effect of viable Lactobacillus fermentum on
the growth performance, nutrient digestibility and immunity of weaned pigs. Journal of Animal and
Feed Sciences 17:61-69.
349.
Zanello, G., F. Meurens, M. Berri, C. Chevaleyre, S. Melo, E. Auclair, and H. Salmon. 2011.
Saccharomyces cerevisiae decreases inflammatory responses induced by F4+ enterotoxigenic
Escherichia coli in porcine intestinal epithelial cells. Veterinary Immunology and Immunopathology
141:133-138.
350.
Zareie, M., K. Johnson-Henry, J. Jury, P.-C. Yang, B.-Y. Ngan, D. M. McKay, J. D.
Soderholm, M. H. Perdue, and P. M. Sherman. 2006. Probiotics prevent bacterial translocation
and improve intestinal barrier function in rats following chronic psychological stress. Gut 55:15531560.
351.
Zeyner, A., and E. Boldt. 2006. Effects of a probiotic Enterococcus faecium strain supplemented
from birth to weaning on diarrhoea patterns and performance of piglets. Journal of Animal
Physiology and Animal Nutrition 90:25-31.
352.
Zhao, T., M. P. Doyle, B. G. Harmon, C. A. Brown, P. O. E. Mueller, and A. H. Parks. 1998.
Reduction of carriage of enterohemorrhagic Escherichia coli O157:H7 in cattle by inoculation with
probiotic bacteria. Journal of Clinical Microbiology 36:641-647.
136