Epigene'c mechanisms in colorectal cancer Joaquín Custodio Rojo | Tesi doctoral 2014 Epigenetic mechanisms in colorectal cancer Memòria presentada per Joaquín Custodio Rojo per optar al grau de Doctor en Biologia Cel·lular Tesi realitzada sota la direcció del Dr. Miquel Àngel Peinado Morales a l’Institut de Medicina Prediciva i Personalitzada del Càncer Tesi adscrita al Departament de Biologia Cel·lular, de Fisiologia i d’Immunologia de la Facultat de Medicina Universitat Autònoma de Barcelona Bienni 2013 – 2014 Director Miquel A. Peinado Morales Tutora Rosa Miró Ametller Barcelona, setembre de 2014 Doctorand Joaquín Custodio Rojo “La frase más excitante que se puede oír en ciencia, la que anuncia nuevos descubrimientos, no es ¡Eureka! (¡Lo encontré!) sino 'Es extraño...'.” “La ciencia se construye a partir de aproximaciones que gradualmente se acercan a la verdad.” ―Isaac Asimov― Als meus avis i iaios, Als meus pares i germà i a l’Anna, Gràcies INDEX ABBREVIATIONS INTRODUCTION COLORECTAL CANCER Colorectal cancer features Incidence and mortality Colorectal cancer risk factors Non-­‐modifiable risk factors Environmental risk factors Colorectal cancer as a stepwise progression model Screening and diagnosis Treatments EPIGENETICS DNA methylation, the fifth base DNA demethylation, the sixth, seventh and eighth bases of the genome Histone modifications Histone variants Polycomb and Trithorax complexes RNA epigenetics, brave new world Chromatin conformation, entering in the third-­‐dimension CANCER EPIGENETICS DNA methylation in cancer Histones in cancer 15 17 19 19 20 23 23 25 28 30 32 34 35 39 40 43 44 46 47 49 50 53 ALDOSE KETO REDUCTASES IN CANCER AKR1B1 in human diseases AKR1B10 and AKR1B15 in cancer RETINOIC ACID PATHWAY OBJECTIVES MATERIALS AND METHODS SAMPLES Patients’ samples Human stool samples and associated carcinoma tissues Mice samples Cell lines EXPRESSION VECTORS cDNA Vectors Vector amplification CELL CULTURE DNA transfections Lentiviral infection Dznep treatment All-­‐trans retinal treatment 5-­‐aza-­‐2'-­‐deoxycytidine treatment Luciferase enhancer assays Cell Proliferation Assay XTT Genome editing: CRISPR DNA METHYLATION ANALYSIS 56 56 58 62 67 71 73 73 73 74 74 76 76 77 77 77 78 78 78 78 79 81 82 84 Genomic DNA extraction Bisulfite treatment 84 84 Bisulfite sequencing 85 Infinium 450K methylation arrays 86 RNA EXPRESSION ANALYSIS 86 RNA extraction 86 Reverse transcriptase PCR 87 Quantitative Real-­‐Time PCR 87 CHIP AND CHIP-­‐SEQ EXPERIMENTS 88 PROTEIN ANALYSIS 90 Western blot 90 Immunohistochemistry 90 CHROMOSOME CONFORMATION CAPTURE (3C) 91 BIOINFORMATICS 92 The Cancer Genome Atlas project 92 TCGA: Gene expression 92 TCGA: DNA methylation 93 TCGA: Gene mutation and copy number alterations 94 Other bioinformatic tools 94 RESULTS 97 DNA METHYLATION PROFILE OF AKR1B GENES IN COLORECTAL CANCER 99 DNA methylation of AKR1B1 by bisulfite sequencing 99 DNA methylation of AKR1B10 by bisulfite sequencing 101 DNA methylation of AKR1B15 by bisulfite sequencing 102 AKR1B1 DNA methylation using TCGA data AKR1B10 DNA methylation using TCGA data AKR1B15 DNA methylation using TCGA data AKR1B1 DNA methylation in stools AKR1B1 CpG island methylation in other cancers Akr1b3 DNA methylation in mice mRNA EXPRESSION OF AKR1B GENES IN COLORECTAL CANCER mRNA expression of AKR1B1 in colorectal cancer samples mRNA expression analysis of AKR1B10 and AKR1B15 in colorectal cancer samples mRNA expression of AKR1B family in a second set of samples mRNA expression of AKR1B family in TCGA samples mRNA expression of AKR1B family genes in cancer cell lines Expression of genes near AKR1B locus Coexpression of AKR1B genes Expression of AKR1B family in mouse colon PROTEIN LEVEL OF AKR1B GENE FAMILY IN COLORECTAL CANCER Expression of AKR1B1 and AKR1B10 at the protein level AKR1B10 in colorectal cancer tissue microarrays AKR1B1 in colorectal cancer tissue microarrays EPIGENETIC GENE REACTIVATION THROUGH 5-­‐AZAC TREATMENT AKR1B genes DNA methylation and expression after 5-­‐AzaC treatment Chromatin profile of the AKR1B locus H3K27ac in normal tissues and in 5-­‐AzaC treated HCT116 cancer cell line 104 105 106 107 110 111 114 114 115 116 118 119 120 121 123 125 125 125 128 131 131 132 134 CHROMOSOME CONFORMATION CAPTURE (3C) LUCIFERASE ASSAYS Enhancer luciferase assays Methylation-­‐enhancer luciferase assays CRISPR ASSAYS CRISPRing the TFBS CRISPRing NF-­‐Y and C/EBP-­‐β genes HCT116 DZNEP TREATMENT FUNCTIONAL IMPLICATIONS OF AKR1B10 AND AKR1B15 RE-­‐EXPRESSION IN COLORECTAL CANCER Proliferation assay XTT assay RETINOIC ACID PATHWAY Expression profiling of the retinoic acid pathway in colorectal tissue through The Cancer Genome Atlas and RefExA databases Altered Expression of Genes involved in retinoic acid pathway is directly linked to survival in colorectal cancer patients Promoter DNA methylation profiling of the RA pathway in normal and colorectal tumor tissue Discovery of new genes related with the RA pathway by analysis of DNA methylation co-­‐regulation Demethylation of the retinoic acid pathways partially restored the altered gene expression Genomic profiling of the RA pathway in colorectal cancer DISCUSSION EPIGENETIC REGULATION OF AKR1B1 GENE FAMILY IN COLORECTAL CANCER Epigenetic regulation of AKR1B1 136 138 138 140 141 141 142 143 144 144 144 147 147 148 150 151 152 153 157 159 159 Epigenetic regulation of AKR1B10 and AKR1B15 ENHANCER ACTIVITY OF AKR1B1 CpG ISLAND Chromatin conformation in the AKR1B locus A distant enhancer regulates the expression of AKR1B10 and AKR1B15 H3K27ac and PRC2 dynamics in the activation/silencing of AKR1B10 and AKR1B15 Gene regulation by enhancer hypermethylation in cancer FUNCTION OF AKR1B10 IN CANCER, LOCATION, LOCATION AND LOCATION Consequences of AKR1B10 and AKR1B15 loss of function in colorectal cancer DEREGULATION OF THE RETINOIC ACID PATHWAY IN COLORECTAL CANCER RETINOIC ACID PATHWAY GENES AS DIAGNOSTIC MARKERS AKR1B1 CpG island DNA methylation as a non-­‐invasive biomarker in stools AKR1B10 protein downregulation in colorectal cancer RETINOIC ACID PATHWAY GENES AS PROGNOSTIC MARKERS CONCLUSIONS BIBLIOGRAPHY ANNEX ANNEX I. TRANSFECTION AND INFECTION VECTORS ANNEX II. BISULFITE PRIMERS ANNEX III. EXPRESSION PRIMERS ANNEX IV. LUCIFERASE PRIMERS CONSTRUCTS ANNEX V. CRISPR TARGET SEQUENCE 161 163 163 163 164 167 169 170 173 176 176 178 179 181 185 209 211 212 213 214 215 ANNEX VI. METHYLATION PROBES ANNEX VII. CHIP PRIMERS ANNEX VIII. 3C PRIMERS ANNEX IX. EXPRESSION PROBES ANNEX X. CHIP-­‐SEQ DATA ANNEX XI. P53 TMAS ANNEX XII. ARTICLE 216 217 218 219 220 221 222 3C 5-AzadC 5-FU 5caC 5fC 5hmC 5hmU 5mC AKR ATRA ChIP CNA COAD CpGi CRC CRISPR CTCF DNMT DZNep ecCEBPA EGFR EMT eRNAs FAP FDA FOBT GO HDAC HNPCC IBD ISC Kb KEGG LMR lncRNA miRNA ncRNA bp PRC PTMS RA RAR RARE RXR TCGA TDG TET TF TFBS TMAs TNM TrxG TSS VEL chromosome conformation capture 5-aza-2’-deoxycytidine 5-Fluorouracil 5-carboxylcytosine 5-formylcytosine 5-hydroxymethylcytosine 5-hydroxymethyluracil 5-methylcytosine aldo-Keto reductase all-trans retinoic acid chromatin immunoprecipitation copy number alteration colorectal adenocarcinoma CpG island colorectal cancer clustered regularly interspaced short palindromic repeats CCCTC-binding factor DNA methyltransferase 3-Deazaneplanocin A hydrochloride extra-coding CEBPA ncRNA epidermal growth factor receptor epithelial to mesenchymal transition enhancer RNA familial adenomatous polyposis Food and Drug Administration fecal occult blood test gene ontology histone deacetylase hereditary non-polyposis colorectal cancer inflammatory bowel disease intestinal stem cells Kilobase Kyoto Encyclopedia of Genes and Genomes low-methylated region long non-coding RNA micro-RNA non-coding RNA base pair Polycomb repressive complex post-translational modifications retinoic acid retinoic acid receptors retinoic acid response elements retinoic X receptors The Cancer Genome Atlas thymine DNA glycosylase Ten-eleven translocation transcription factor transcription factor binding site tissue microarrays tumor node metastasis Trithorax group transcription start site variant enhancer loci c eCi a eti c eoea n o r a nf a i di C e d c Cx %tl 1Ci a s c ac i c eCi dd I Ci R en i en C eau ddl x tI aC q%I c C e s I c et i C 1tI c et I ci u t c dsl tl l ni R en e i di c c c C e d eau i Cl i di c i C de C eti c l 0 ce C I c et dds en l u C x a n Cd 1 et F n d CW L8qL% 0 l su 1ei u l c i di C e d c i c en di l tI c l i C 1 c eti c i en eau i CW tc I en u c t l e eti c l en n dllt d di i l ei i dl W i c l et1 eti c W l ei i d tc c ut W C l tc l tp W di l l i 11 ete Wdi l l i R tI ne c i ad dl i tc da c al iC ( i u tetc I x tre c rau W qóó: , C f a p d r nel i e n oes a eoer ma nf l r en a ea r h Wqóóó% 0 ci i u u i c es1 i i di C e d 0 ci ci tl en CW i u 1Ctl tc I C tc i u l i CtI tc e Ci u en i c z u tdt C en l CC e c C tc i u n u i n l m es r n c n ael s s s hr h euh l e oc i R c ci C tc i u tl i CC e i ddi R za1 c eC eu c ei en 1 et c e0 CC e C tc i u l en c eni l i c l i ddi R tc I en x eetc I ei c L8qZ% 0 l c entl en l tl W R tc 1 c u tc i Ctes i i di C e d i c ( c eti c d i C tl 1d s x tI aC L% 0 Ca t d ei t en c i u l e c ei ( i d( u i C C 1t ds ei i CtI tc c tc da u i le 1ten dtau i en tc e l etc 0 C tc i u l i ddi R eR i u tc 1 enR sl Wen i en es1 i en 11Ci ) tu e ds ó: D i en ei e d i c W 1 c tc I i c en u i d ad C de C eti c l n 1Ci 1 C t I c i l c c i c ( c eti c d1 enR s Cl n l c i c z 1ten dt d C tc i t eau i Cl Wl C i u l c dsu 1ni t eau i Cl 0 R tdd C C ei c eds t en s C tc da c i c z u tdt C tc en i di C e d i c ( c eti c di Cen l CC e ci C tc i u W 1 enR s0 qó c eCi a eti c 380 M Bettington et al. Figure 11. Putative pathways to colorectal cancer. f a 2 d f n n u c n s i ne eoea n o r ah c ae f ael nn r ner 2. pPh five features or with 10–20% necrosis are considered fashion; epithelial serrations are typically lost (Figto be equivocal.110 ure 12F). Micropapillary structures are sometimes The second pattern, accounting for 20% of cases, is seen, and lymphatic invasion is common. Serrated r mucinous r adenocarcinoma r l ean o(Figure ni 12D).35,109 Extra- morphology carcinoma cytology remains apparent. cellular mucin constitutes at least 50% of the This pattern is often a minor component of the other i cross-sectional di C e d area, c Cand tl by definition u ri C theyalare poorly i u i Csubtypes, t tes usually c uati the Ce advancing dtes enCiedge aI of nithe aetumour. en differentiated. Serrations can usually be identified, at Serrated morphology carcinomas segregate as a R ileast Cd focally, xR R Rand 0R typical ni 0i CIserrated % 0 i dcarcinoma i C e d cytology c C tl distinct en lmolecular i c usubset, i l e strengthening i u u i c thealassertion i is retained. Cell balls and papillary rods floating in that they represent a reproducible and distinctive 111 KRAS the are R common, are C characteristic subtype of cCRC.en enmucin R i Cd t x and tc pd F i I dofl ethis tc Wqóó/% entCand uBRAF i l emutations i u u ihave c been identified in 45% and 33% of cases, respecpattern (Figure 12E). 112 in 16%,candteMSI-L pattern trabecular, c TheC final tc en R iisCd WR ten constituting q0LE u tdapproxidti c c R tively, l l MSS t Iinc i50%, l MSI-H tc L887 n l in 30%.110 These figures suggest that serrated pathways mately 7% of cases.35,109 These tumours are poorly differentiated, cellsCgrowing a trabecular and described c l etu with e tumour c tc l i in en tc t c 1b W u 2,otc I a1 above, ei earedoverrepresented. i L0L u tddti c l l t I ci l i di C e d c 1 Cs C el u c c ntI n C tc en tc al eCt dtp R i u c du i l e 9a ddsW c L8 l e Cc aCi 1 en tc t c i ac eCt l x i ae eR i zentC l %x i sd F u i c I en u en ntI n l e tc t c dc W © 2012 Blackwell Publishing Ltd, Histopathology, 62, 367–386. C s L8Z80 c i i aen Cc i di C e d aCi 1 , c c C tl tc tl i c WL88L% W al eC dt W R en di R l e tc t c tc c eCi a eti c t F d c l e Cc Ct c i aenz c eC d l t xnee12MMR R R 0R C 0i CI %x i sd c I u c WL888% 0 otc I 0 0 l c ) u 1d i tc al eCt dtp tc t c c tc 1 Cet ad C i di C e d c L8qZ% 0 c en 1 i 1d I 0 i di C e d c i ac eCt l x i sd F x tI aC Z% 0 tl l 40 to 59 0.94 (1 in 106) 0.75 (1 in 134) C d q%x t I dW c C u i cI C e 60 to 69 1.40 (1 in 71) 0.98 (1 in 102) h1 pz Cdt C l e I l i Fm r 0 c tc u i l ei en tc al eCt dtp ce WL8q8, t I dWL8qZ% a ei l C c tc I 1C et l c en t t c e eC eu c e C I tu c l en0 70 and older 4.19 (1 in 24) 3.80 (1 in 26) r a s n r o n r n au o ael ei o | er m2. . 2h C l tc I tc en c I u c WL888, e e ( td tdtes i u i C c c i c WL88L% 0 c ae o ni vb , e eoea n o a ael 2. . 3 ne 2. . Th cn i di C e du i Ce dtes C e tl C a eti c tc Ctc C l l R ten I x C tl en u i l e C 9a c e i Cu i Cl c i d Cx i sd F Birth to 39 0.08 (1 in 1212) 0.08 (1 in 1236) o p d r r r n n n e l c i l C( en e Cancer Statistics, 2013 U: s Male Female i ac eCsWR 11 C ei n ( Ct( c entl FIGURE 4. Trends in Death Rates Among Males for Selected Cancers, United States, 1930 to 2009. Rates are age adjusted to the 2000 US standard population. Due to changes in International Classification of Diseases (ICD) coding, numerator information has changed over time. Rates for cancers of the lung and bronchus, colorectum, and liver are affected by these changes. Cancer Statistics, 2013 A Cancer Statistics, 2013 Cancer Statistics, 2013 original article Annals of Oncology B FIGURE 5. Trends in Death Rates Among Females for Selected Cancers, United States, 1930 to 2009. FIGURE 4. Trends in Death Rates Among Males for Selected Cancers, United States, 1930 to 2009. arenumerator age adjusted to the 2000 US standard population. Due to changes in International Classification of Diseases (ICD) coding, numerator information Rates are age adjusted to the 2000 US standard population. Due to changes in International Classification of Diseases (ICD) Rates coding, information has changed over time. Rates for cancers of the uterus, ovary, lung and bronchus, and colorectum are affected by these changes. has changed over time. Rates for cancers of the lung and bronchus, colorectum, and liver are affected by these changes. *Uterus includes uterine cervix and uterine corpus. FIGURE 6. Total Number of Cancer Deaths Averted From 1991 to 2009 in Men and From 1992 to 2009 18 in Women. CA: A Cancer Journal for Clinicians The blue line represents the actual number of cancer deaths recorded year, and the red represents the number of cancer FIGURE in6.each Total Number of line Cancer Deaths Averted Fromdeaths 1991that to would 2009have in Men and From 1992 to 2009 in Women. been expected if cancer death rates had remained at their peak. The blue line represents the actual number of cancer deaths recorded in each year, and the red line represents the number of cancer deaths that would have been expected if cancer death rates had remained at their peak. lung, and by more than 40% for prostate cancer. The 40 years, while lung cancer ranks first among men aged years and40% older.forAmong brain decrease in lung cancer death rates—among lung, men and sinceby 40 years, while lung cancer ranks first among men aged more than prostatefemales, cancer.tumors The of40the 1990 and among women since 2002—is due to the and other nervous system are the leading cause of cancer decrease in lung cancer death rates—among men since 40 years and older. Among females, tumors of the brain 20 reduction in tobacco use, while the decrease in death rates death among children and adolescents (aged younger than 1990 and among women since 2002—is due to the and other nervous system are the leading cause of cancer for female breast, colorectal, and prostate cancers largely 20 years), 20breast cancer ranks first among women aged deathcancer among children and adolescents (aged younger than reduction in tobacco whileand the lung decrease in death 20 to use, 59 years, cancer causesrates the most reflects improvements in early detection and/or colorectal, and 60 prostate cancers deaths in those aged years and older.largely 20 years), breast cancer ranks first among women aged treatment.17,21,22 Over the past 10 yearsfor offemale data breast, improvements in early detection and/or 20 to 59 years, and lung cancer causes the most cancer (2000-2009), the largest annual declines in deathreflects rates were for chronic myeloid leukemia (8.4%), cancers of the17,21,22 treatment. Over Variations the past in10Cancer years Rates of data deaths in those aged 60 years and older. Regional stomach (3.1%) and colorectum (3.0%), and non-Hodgkin (2000-2009), the largest annual declinescancer in death rates were Tables 8 and 9 depict incidence and death rates lymphoma (3.0%). for selected cancers by state. Lung cancer shows the Figure 1. Colorectalf cancer incidence mortality (adjusted age) among men and women age a P din ,Spain. a r Trends r linean o ni a (adjusted n ea for o age n and rregistry) a iand Fm r r nrates n n aelforpT3B ne >29 years, obtained model. The ,vertical when 2. from . Tm thec change-point n ael om2. pP a r grey r llines eanshow o ni athe n time ea interval eoea n o rthe achange r c inr trend v f occurred. n ea , l er lfor chronic r r myeloid s elleukemia r (8.4%),( cancers 2T i of the a hRegional c nVariations aelin Cancer 1c Rates gw r n m2. p. h geographic(3.0%), variation cancer occurrence by far, stomach (3.1%)largest and colorectum andinnon-Hodgkin 8 and 9 depict cancer incidence and death rates Recorded Number of Deaths From Cancer in 2009 reflecting the large historical and continuing Tables differences lymphoma (3.0%). 20 for selected by state. Lung cancer shows the in smoking prevalence among states. A total of 2,437,163 deaths were recorded in the United For example, lung cancers Table 2. Trends in incidence (1975–2004) and mortality (1975–2007) in Spain among subjects aged >29 years, and identification 23 geographic variation in cancer occurrence by far, States in 2009, 567,628 of these from cancer. Cancer is cancer incidence rates in Kentucky, which has largest historically Recorded Number of Deaths From Cancer in 2009 reflecting 4-foldthe large historical and continuing differences the second leading cause of death, following heart disease, had the highest smoking prevalence, are almost higher than those Utah, which hasUnited the lowest accounting for 23% of all deaths. However, within 20-year in smoking prevalence among states.20 For example, lung A total of 2,437,163 deaths wereinrecorded in the 23 100,000 men). In conprevalence (128 vs 34 cases per age groups, cancer is the leading cause of death among both States in 2009, 567,628 of these from cancer. Cancer is cancer incidence rates in Kentucky, which has historically Change-point Annual percentage change (95% CI) trast, state variations for other cancer sites are smaller in men and women aged 40 to 79 years (Table 6). the second leading cause of death, following heart disease, had the highest smoking prevalence, are almost 4-fold absolute and CI) proportionate terms. For example, Table 7 presents the numbers of deaths for all cancers both P-values Year (95% Overall Below change-point accounting for 23% of all deaths. However, within 20-year higher than those in Utah, which has the lowest smoking combined and for the 5 most common sites for each the breast cancer incidence rate in Connecticut, which prevalence thehighest leadingrate cause(137 of death has is the per among 100,000both women), is only (128 vs 34 cases per 100,000 men). In con20-year age group. Among males, leukemia is age the groups, leading cancer Men cause of cancer death among those aged younger state variations for other cancer sites are smaller in men and women aged 40 to than 79 years 6). 28% higher that(Table in Arizona, which has trast, the lowest than FIGURE 5. Trends in Death Rates Among Females Selected States, to 2009. both absolute and proportionate terms. For example, Table 7forpresents theCancers, numbersUnited of 1997) deaths for1930 all cancers Incidence 1995 (1993, 3.42information (3.25, 3.59) 4.26 (3.92, 4.61) Rates are age adjusted to <0.0001 the 2000 US standard population. Due to changes in International Classification of Diseases (ICD) coding, numerator 20 CA: A Cancer Journal for Clinicians combined for theand5 colorectum most common forchanges. each the breast cancer incidence rate in Connecticut, which has changed over time. Rates for cancers of the uterus, ovary, lungand and bronchus, are affectedsites by these and uterine corpus. 20-year age group. Mortality *Uterus includes uterine cervix <0.0001 1998 (1996, 2000) 1.86 (1.75, 1.97) 2.88 Among males, leukemia is the leading has the highest rate (137 per 100,000 women), is only (2.72, 3.05) Lq of changes in trend. Above change-poin 2.53 (2.17, 2.89) –0.39 (–0.70, –0.08 c eCi a eti c i R ( CWen tc ) i tc t c i ac eCsW i C ) u 1d tc en tc 1 tc x c x h1 pz ce u i l e i en ) nt tel 0 en tc t c aCi 1 c t C c e 1 ee Cc l n l C l 1 c tc I i c en x t I dWL8qZ% WR ntd i ac eCt l %tl l etdd tc C l tc I x tI aC E% WL8q8% 0 CA CANCER J CLIN 2013;63:11–30 A original article Annals of Oncology FIGURE 3. Trends in Incidence Rates for Selected Cancers by Sex, United States, 1975 to 2009. B Rates are age adjusted to the 2000 US standard population and adjusted for delays in reporting. *Liver includes intrahepatic bile duct. According to data from the SEER 13 cancer registries, inciThe lifetime probability of being diagnosed with an dence rates in the most recent 5 years (2005-2009) decreased invasive cancer is higher for men (45%) than for women in males by 0.6% per year and were stable in females (Table (38%) (Table 4). However, because of the earlier median 5). Incidence rates are decreasing for all 4 major cancer sites age at diagnosis for breast cancer compared with other except female breast, for which rates remained relatively major cancers, women have a slightly higher probability of stable from 2005 to 2009 after decreasing by 2% per year developing cancer before age 60 years. These estimates are from 1999 to 2005. Lung cancer incidence rates in women f a R d , a r r r r a n ea o n r a i Fmr r n n n ael pT3B ne began declining in the late 1990s, more than a decade after based2.on. Tm the average ofomthe general c n experience ael 2. pP , population a r r r r a n ea eoea6 n o r a r c r lungrcancer incibegan and may v overf n oreaunderestimate r a individual nai , l erriskl because r r sofel the r decline ( 2T i a inmmen. c n Differences ael 1c ingw n dence patterns between men and women reflect historical 2. exposure p. h differencesmin (eg, smoking history) and/or genetic differences in tobacco use; cigarette smoking prevalence susceptibility. i C i ( CWen C C c i e i c ds t C c l peaked u i cabout I i20 acyears eCt later l W in0women tc t than c in men. c 16 Recent Trends in Cancer Incidence rapid declines in colorectal cancer incidence rates have u i Ce dtes C e l ( Cs i c l t C ds u i c I C t d c enc t I Ci a1l x d L% 0 Figures 2 to 5 depict long-term trends in cancer incidence largely been attributed to increases in screening that can 17-19 andand allow the removal of precancerous polyps.men and death rates for all Trends cancersincombined and for selected Figure 1. Colorectal cancer in Spain. incidence (adjusted for age anddetect registry) mortality rates (adjusted for age) among and women age Although trendthe analysis thatoccurred. the incidence cancerfrom sitesthe by change-point sex. While incidence ratesvertical are declining forshow >29 years, obtained model. The grey lines the time joinpoint interval when changeshows in trend most cancer sites, they are increasing among both men and rate for prostate cancer declined steadily by 1.9% per year women for melanoma of the skin and cancers of the liver from 2000 to 2009, it is important to realize that annual rates fluctuate widely likely variation in andinthyroid (Fig. 3, Table and 5). Table 5 shows incidence Table 2. Trends incidence (1975–2004) mortality (1975–2007) in Spain among subjects aged(Fig. >29 3), years, andreflecting identification of changes in trend. (delay-adjusted) and mortality trends for all cancers com- the prevalence of prostate-specific antigen testing for the binedLL and for selected cancer sites based on joinpoint regres- detection of prostate cancer. For example, in the SEER 13 Change-point Annual percentage change (95% CI) sion analysis. Joinpoint is a tool used to describe and quantify areas, the delay-adjusted prostate cancer incidence rate P-values Year (95% CI) Overall Below change-point Above change-poin trends by fitting observed rates to lines connected at ‘‘join- increased from 154 (per 100,000) to 164 from 2005 to 2006, 13,15 Men Lifetime Probability of Developing Cancer c eCi a eti c White African American Male Female 52.8 65.1 39.2 48.0 Male Female 19.5 29.8 13.6 19.8 Assian American and Pacific islanders American Indian and Alaska native Hispanic 41.4 50.7 46.9 32.1 41.1 33.3 13.1 18.8 15.3 9.6 14.6 10.2 Incidence Mortality o 2d r 2. . Th cn n l r ael r l ean o ni a n om2. pPh tl l tu td Ctet l tc i Fma i di C e d tc t c i ac eCt l i C enc t dI Ci a1l u s ) 1i l aC ei Ctl o r c eeCt ae ei Cl x1i ddaeti c tc en nr ni m r r n n n ael 2. . B ne u i Ce dtes eR tc 1 Ce ei oc i R c c t C c e ei Cl l a n l tCW t eW d i ni d tc e o T % W l l ei ntI nz9a dtes l C c tc I Wetu ds t I c i l tl c en 9a dtes i en eC eu c e0 eoea n o r ( C dCtl o C a a C ei Cl C nea lli t e eR i es1 l i Ctl o c ( tCi c u c e dCtl o ei Cl 2 en o a C c i i di C e d c c i c zu i t t d Ctl o c i di C e d ) u 1d i te0 i C en c ó8D i i di C e d c C l l i C tl c I zC d e WL887% 0 n tc t c Cl i d 1 i 1d en c tc eni l tc t c tl I Ci R tc I tc si ac I 1 i 1d 0 i R eR en q8 u i l e i u u i c ds t I ci l k c i u ei al Cl i c d tl ei Cs i I Ci R en i en i di c ( di 1tc I l su 1ei u et i ( C en ci u c tI c I i : 8 s i di C e d c Cl Ctl c tl C tl d C :8 Cl 0 i R ( CWen 0 W i di C e d c C tc R i u c c i ds1l 2 i ds1l C Wqóó/% 0 n ) eC u ds ntI n, te n l u c i c l 9a c i di c 1ten dtau etl l a x tI aC : % c C tc i u l x tc R C c sl tc en c WL88/% 0 d l ti c l i en aC tc 1 i 1d I si ac I C en c E8 s c L8 c Eó x tCd s cn c c C e tl u i C en c : 8 etu l ntI n Ctc /8 ei Uó s u i c I en ei Cl nea y tddc l l i Ci d Cx t l C0 n C ei Cl 0 er wl e k I 2 R ten en tc t c C tl I i C 1C aCl i C dt etu c l aI I l e Ctl o i en e c i u l C i ac tc u i C en c E8D i en tc t( t a dl Cl x dt el ei l F Ci u en l i ado l WL88/% 0 ci u l x II C F Cds ó: D i l 1i C t i al n sWL88ó% 0 n LZ c eCi a eti c eC eu c e i c l tl el tc en C u i ( d i en 1i ds1l WR nt n C a l en Ctl o i ( di 1tc I i di C e d C tc i u l x tc R C Wqóó/% 0 A B v , f a B dv , l o a l n m neoe o r l ae ec a c a r n n er e r o eoea n o c eoi c h r el nef c eoi c e eoer c n r nh c n ael s s s hs C c hea 0 k c n Cte I c et Ctl oW u tdt d n C te Cs c i c z1i ds1i l tl i di C e d c c i u ei al 1i ds1i l tl x C x i c teti c tc R nt n c au Ci al 1i ds1l C i Cu tc e l etc x tI aC : % 0 x Ct d WL88q, ( di 1u c e i u adet1d LE tl al ddtl % 2 tc en tl % c c tc n Cte 1ten dtau i en d CI s u ae eti c l tc en eau i C l a11C l l i C I c Wqóóó% 0 c i u ei al 1i ds1l Wte n l tl n C e Ctp c tc t c s en e tCen i Introduction about 1/8,300 and it manifests equally in both sexes. FAP just accounts for less than 1% of colorectal cancer cases (Galiatsatos & Foulkes, 2006). Most of the colorectal cancer patients (~70%) have a family history of colorectal polyps and cancer. Generally cancer starts to develop a decade after the appearance of the polyp, they normally are asymptomatic until the large number of them cause rectal bleeding or other complications. Without treatment, FAP individuals carry 100% of possibilities of developing colorectal cancer. Hereditary non-­‐polyposis colorectal cancer (HNPCC) or Lynch syndrome is another inherited disease caused by mutations on DNA mismatch repair genes, mainly MLH1 and MSH2. In addition to colorectal cancer, HNPCC patients show an increased relative risk in other cancers such as uterus, stomach, small bowel, pancreas, kidney and ureter. In contrast to FAP patients, HNPCC individuals develop few adenomas. Without treatment individuals affected with HNPCC have an approximate 80% lifetime risk of developing colon cancer (Lynch et al., 2009; Weissman et al., 2011). · Inflammatory bowel disease (IBD): IBD includes two diseases: ulcerative colitis and Crohn disease. Ulcerative colitis causes inflammation of the mucosa of the colon and rectum. Crohn disease causes inflammation of the full thickness of the bowel wall and may involve any part of the digestive tract from the mouth to the anus. These inflammatory conditions are known to increase the risk of developing colorectal cancer (Triantafillidis et al., 2009). In patients with inflammatory bowel disease the relative risk of developing colorectal cancer has been estimated to be increased 4 to 20 fold (Haggar & Boushey, 2009). Environmental risk factors: · Dietary and nutritional practices: Evidences from epidemiological studies highlight the strong influence of the diet in the risk of developing colorectal cancer (Boyle & Langman, 2000). It is believed that changing food habits might reduce up to 70% the possibilities of suffering colorectal cancer (Johnson & Lund, 2007). Diets enriched in animal fat are a major risk factor for colorectal cancer. The specific mechanisms that underlie the association between red meat and colorectal cancer are unclear. It has been proposed that red meat might stimulate secretion of endogenous insulin, which is a natural mitogen and 25 Introduction perhaps enhances the uncontrolled cellular growth (Chan & Giovannucci, 2010). Other relevant hypothesis propose red meat as a source of heme iron, which catalyzes the oxidation of polyunsaturated fats to some compounds that are known risk factors for several human diseases, such as Malondialdehyde or 4-­‐ Hydroxynonenal (Bastide et al., 2011). Fiber intake has also been linked with colorectal cancer where a reduced impact was observed in some African populations with high-­‐fiber diet more than 4 decades ago (O’Keefe et al., 1999). Since then, many studies have been testing this hypothesis, some of them successfully and others not (Chan & Giovannucci, 2010; Huxley et al., 2012). Anyway, it has been proposed that fiber could dilute or adsorb fecal carcinogens, modulate colonic transit time, alter bile acid metabolism, reduce colonic pH, or increase the production of short-­‐chain fatty acids (Huxley et al., 2012). It is well known that the composition of the individual’s flora can fluctuate under some circumstances and is deeply affected by dietary habits (Grölund et al., 1999; Smith, 1965). The human gut is the natural habitat for a large and dynamic bacterial community but a substantial part of these bacterial populations are still to be described. Out of curiosity, in the large intestine we can find bacterial concentrations up to 1011 or 1012 cells/g of luminal contents (Guarner & Malagelada, 2003), these concentrations are similar to those found in colonies growing under optimum conditions over the surface of a laboratory plate. Intestinal bacteria could play a role in initiation of colon cancer through production of carcinogens, co-­‐carcinogens or pro-­‐carcinogens. Furthermore, some intestinal microorganisms strongly increase damage to DNA in colon cells induced by heterocyclic amines, whereas other intestinal bacteria can uptake and detoxify such compounds (Wollowski et al., 2001). · Physical Activity and Obesity: Evidences from epidemiologic studies demonstrate that people with high occupational or recreational physical activity appear to be at a lower risk of developing colon cancer (Brown et al., 2012). Physical activity at a level equivalent to walking 4 h per week was associated with a decreased risk of colon cancer among women when compared to the sedentary group. 26 Introduction Obesity (commonly accompanied by diabetes type II) is also a cancer risk factor, although the molecular mechanisms are not well understood. There are some evidences that obese people have more of the mitogenic factor insulin-­‐like growth factor 1 in their bloodstream (Renehan et al., 2003), what could predispose cells to uncontrolled cellular growth. Adipose tissue is a complex, essential, highly active metabolic and endocrine organ (Kershaw & Flier, 2004). Polypeptide hormones derived from adipocytes are known as adipokines, among them, leptin and adiponectin are linked to cancer. Leptin concentration is directly correlated with the amount of body fat and is regulated by insulin. Leptin is adipogenic, antiapoptotic and mitogenic for various cell types, including hematopoietic progenitor cells, normal and transformed epithelial cells, and vascular endothelial cells (Bray, 2002; Rose et al., 2004; Vona-­‐Davis & Rose, 2007). Adiponectin is the most abundant of adipokines, it is an insulin-­‐sensing hormone and unlike leptin, its correlation is inverse with body mass index and appears in low levels in cancer patients (Roberts et al., 2010). · Alcohol intake: The risk factor that alcohol represents to some cancers like gastric or liver is clearly demonstrated, whereas in the case of colorectal cancer is not so well understood. Some studies point out that moderate and heavy drinking alcohol was associated with a 21% and 52% increased risk for colorectal cancer, respectively (Fedirko et al., 2011). The results for alcohol drinking and colorectal cancer risk appeared to be similar between men and women. · Cigarette Smoking: Colorectal cancer has not historically been linked to cigarette smoking although nowadays it is known that heavy cigarette smokers have a 2-­‐3 fold elevated risk of developing colorectal adenomas (Giovannucci, 2001). Overall, cumulated evidences within the past decade support the addition of colorectal cancer to the list of tobacco-­‐associated malignancies. It is known that tobacco’s carcinogens could reach the colorectal mucosa and produce cellular damage that could trigger the cancerous process (Fu et al., 2013; Wei et al., 2009). 27 c eCi a eti c eoea n o r a i di C e d c s Cl ei n c s c ae a er l e C tl di c I etu ( di 1W( c dd0 aCtc I entl etu 1Ci a Ci c F l en n ddu Col i c n c c i l Wen u ri Ctes i eau i Cl e o l i ad 1 l l ei c i Cu d ddl u al e eau i C x oc i R c u adetl e 1 tl Ce tc o ( di 1 9atC c C tc i u Ci al i I dl e tc Wqóó8% 0 n l c c tc L888 C c CI x R C 1i l ead e c n c F tc aeni Cl x tI aC /%x en l l l en e c i Cu d ddl ni ad i ( C1 l l ei Ci al eaC l s tc C ( tl CI WL8qq% 0 n s tc tc i u u dtI c c e0 Figure 3. Emerging Hallmarks an Characteristics B n l n ddu Col i C Ci Ci u An increasing body of research sugg additional hallmarks of cancer are in pathogenesis of some and perhaps One involves the capability to mod gram, cellular metabolism in order to tively support neoplastic proliferation allows cancer cells to evade im destruction, in particular by T and B l macrophages, and natural killer ce neither capability is yet generalized a dated, they are labeled as emergin Additionally, two consequential char neoplasia facilitate acquisition of bo emerging hallmarks. Genomic instab mutability endow cancer cells with g ations that drive tumor progression. by innate immune cells designed to fi and heal wounds can instead result vertent support of multiple hallmark thereby manifesting the now widely tumor-promoting consequences of responses. surface, rendering such cells hyperresponsive to otherwise-limiting amounts of growth factor ligand; the same outcome can result from structural alterations in the receptor molecules that facilitate ligand-independent firing. Growth factor independence may also derive from the constitutive activation of components of signaling pathways operating downstream of these receptors, obviating the need to stimulate these pathways by ligand-mediated receptor activation. Given that a number of distinct downstream signaling pathways radiateefrom a ligand-stimulated distinct receptor, cancer cells have been ability of genome maintenance s ool aC rYet other ah be r functionally n attributes o important ntheofi activaa thecdevelopment ae of detect fThe extraordinary and resolve defects in the DNA ensures th tion of one or anotherproposed of theseto downstream pathways, for for r n the oone ni responding rcancerl and fton n er ue rto the list l ofl core f rhallmarks naf n er mutation are usually very low during might therefore be added spontaneous example, the Rasm signal transducer, al., the Luo et al., instructions may only subset r recapitulate nn a f ra(Negrini a etnof ee2010;regulatory r er2009; Colotta a et al.,af2009). Two o eageneration. nf l eaIn the course of acquiring the roster of mu such attributes are particularly compelling. The first involves needed to orchestrate tumorigenesis, cancer c transmitted by an activated receptor. major reprogramming of cellular energy metabolism in order to increase the rates of mutation (Negrini et al., 2010; r a m 2. . . r 2. pph Somatic Mutations Activate Additional Downstream support continuous cell growth and proliferation, replacing the 2010). This mutability is achieved through increased Pathways metabolic program that operates in most normal tissues and to mutagenic agents, through a breakdown in one High-throughput DNA fuels sequencing analyses of cancer the physiological operations of thecell associated cells. The components of the genomic maintenance machiner genomes have revealed somatic mutations in certain human second involves active evasion by cancer cells from attack and In addition, the accumulation of mutations can be a tumors that predict constitutive signaling circuits eliminationactivation by immuneof cells; this capability highlights the dichot- by compromising the surveillance systems that norma omous roles of anfactor immune system that both antagonizes and genomic integrity and force genetically damaged cells usually triggered by activated growth receptors. Thus, enhances development and contain progression. Both of these senescence or apoptosis (Jackson and Bartek, 200 we now know that !40% of tumor human melanomas capabilities may well of prove to facilitate the development and 2008; Sigal and Rotter, 2000). The role of TP53 is ce activating mutations affecting the structure the B-Raf protein, progression of many forms of human cancer and therefore can leading to its being called the ‘‘guardian of the genom resulting in constitutive signaling through the Raf to mitogenbe considered to be emerging hallmarks of cancer. These 1992). activated protein (MAP)-kinase pathway (Davies and Samuels enabling characteristics and emerging hallmarks, depicted in A diverse array of defects affecting various compon 2010). Similarly, mutations in the catalytic subunit of phosphoiFigure 3, are discussed individually below. DNA-maintenance machinery—often referred to as nositide 3-kinase (PI3-kinase) isoforms are being detected in takers’’ of the genome (Kinzler and Vogelstein, 19 an array of tumor types,Anwhich serve to hyperactivate the PI3Enabling Characteristic: Genome Instability been documented. The catalog of defects in these kinase signaling circuitry, including its key Akt/PKB signal and Mutation genes includes those whose products are involved in Acquisition of the multiple hallmarks enumerated above depends ing DNA damage and activating the repair machinery, transducer (Jiang and Liu, 2009; Yuan and Cantley, 2008). The in large part on a succession of alterations in the genomes of repairing damaged DNA, and (3) inactivating or in advantages to tumor cells of activating upstream (receptor) neoplastic signaling cells. Simply depicted, certain versus downstream (transducer) remain obscure, as mutant genotypes mutagenic molecules before they have damaged conferofselective advantage on subclones of cells, enabling their (Negrini et al., 2010; Ciccia and Elledge, 2010; Ja does the functional impact crosstalk between the multiple outgrowth and eventual dominance in a local tissue environment. Bartek, 2009; Kastan, 2008; Harper and Elledge, 2007 pathways radiating from growth factor receptors. Accordingly, multistep tumor progression can be portrayed as et al., 2006). From a genetic perspective, these caret Disruptions of Negative-Feedback Mechanisms that a succession of clonal expansions, each of which is triggered behave much like tumor suppressor genes, in that the Attenuate Proliferative by Signaling the chance acquisition of an enabling mutant genotype. can be lost during the course of tumor progression, Recent results have highlighted the importance of negativeBecause heritable phenotypes, e.g., inactivation of tumor losses being achieved either through inactivating m feedback loops that normally operate to dampen typesthrough epigenetic via epigenetic repression. Mutant copies of many of t suppressor genes, can alsovarious be acquired of signaling and thereby ensure homeostatic the mechanisms such as DNAregulation methylationof and histone modifications taker genes have been introduced into the mouse ge andintracellular Esteller, 2010; Esteller, 2007; Jones and Baylin, result, predictably, in increased cancer incidence, flux of signals coursing (Berdasco through the circuitry (Wertz 2007), some clonal expansions may well and Dixit, 2010; Cabrita and Christofori, 2008; Amit et be al.,triggered by nonmu- their potential involvement in human cancer de tationalDefects changesin affecting the regulation of gene expression. (Barnes and Lindahl, 2004). 2007; Mosesson et al., 2008). these feedback mechanisms are capable of enhancing proliferative signaling. The prototype of this type of 658 regulation involves the Rasª2011 oncoprotein: Cell 144, March 4, 2011 Elsevier Inc. the oncogenic effects of Ras do not result from a hyperactivation of its signaling powers; instead, the oncogenic mutations affecting ras genes compromise Ras GTPase activity, which i c i e C C ei u d ac eti c i l 1 t t I c l Wen s i al tc 1 enR sl i C ti di I t d ac eti c l de C 9atl teti c 0 u i d ad C1i tc ei ( t R Wen tc c C c i c i e i ddi R l 1 t t de C eti c i en c i Cu d ddad C n o1i tc el a ei n c I l tc en I c et l i C 1tI c et l i l 1 t t I c l 0 i u ae eti c d l 1 eCau tc 1 C i Cu 1 tCl 0 n UW )i u u ae eti c l i di C e d 1eaC c EW U LW c C I c l R C W qW et( etc I u ae eti c l ) C al a dds i c i I c t x a n Cd 1 et F CW n ci u l 9a c tc I i c LLE eau i C c u i l e C 9a c eds u ae e u ae eti c l R C tc c di ed l 1Ci r e c i Cu d u e n W : ZW LW qLZ 1e i C e tc en c tc en W c W qW W W I c l WR ni l i i c qLWqZ i C /q 4, 2011 ª2011 Elsevier Inc. 647 n d CWL8qL% 0 c en l uCell 144,RMarch i CoW en s i u 1 C etc I C d ( c e I c l l a n l Z ó0 dd nCi u i l i u d c l a z nCi u i l i u d n c I l tc L: U eau i Cl W e etc I L7 C aCC c e L7 i aI d l This illustration encompasses the six hallmark capabilities originally proposed in our 2000 perspective. The past decade has witnessed remarkable progress toward understanding the mechanistic underpinnings of each hallmark. number and thus maintenance of normal tissue architecture and function. f a Cancer 0 d cells, o by deregulating v , r thesea signals, u become v , masters of their own destinies. The enabling signals are a f oin n r part byoofgrowth o a factors r athatnbind m r el conveyed large cell-surface receptors, typically containing r nf l eaw c ael en r intracellular r o l l tyrosine n erkinaseu domains. The latter proceed to emit signals via branched intrau o ec l r n h c n ael r r| cellular signaling pathways that regulate progression through the cell cycle as well as cell growth (that is, increases in cell size); often these signals influence yet other cell-biological properties, such as cell survival and energy metabolism. Remarkably, the precise identities and sources of the proliferative signals operating within normal tissues were poorly understood a decade ago and in general remain so. Moreover, we still know relatively little about the mechanisms controlling the release of these mitogenic signals. In part, the understanding of these mechanisms is complicated by the fact that the growth factor signals controlling cell number and position within tissues are thought to be transmitted in a temporally and spatially regulated fashion from one cell to its neighbors; such paracrine signaling is difficult to access experimentally. In addition, the bioavailability of growth factors is regulated by sequestration in the pericellular space and extracellular matrix, and by the actions of a complex network of proteases, sulfatases, and possibly other enzymes that liberate and activate them, apparently in a highly specific and localized fashion. The mitogenic signaling in cancer cells is, in contrast, better understood (Lemmon and Schlessinger, 2010; Witsch et al., 2010; Hynes and MacDonald, 2009; Perona, 2006). Cancer cells can acquire the capability to sustain proliferative signaling in a number of alternative ways: They may produce growth factor ligands themselves, to which they can respond via the expression of cognate receptors, resulting in autocrine proliferative stimulation. Alternatively, cancer cells may send signals to stimulate normal cells within the supporting tumor-associated stroma, which reciprocate by supplying the cancer cells with various growth factors (Cheng et al., 2008; Bhowmick et al., 2004). Receptor signaling can also be deregulated by elevating the levels of receptor proteins displayed at the cancer cell C Figure 1. The Hallmarks of Cancer A tl ( c ea dds CI WL888% c c n c F c i Cu d eaC l ei L8qq s en l u ti di I t d1Ci Ci u EW W d eti c l W c nes in putative fusion events, of which 18 were predicted to code for instances at levels of 1003 normal. Altogether, we found 16 differe -frame events (Supplementary Table 6). We found three separate altered WNT pathway genes, confirming the importance of t ses in which the first two exons of the NAV2 gene on chromosome pathway in CRC. Interestingly, many of these alterations were fou are joined with the 39 coding portion of TCF7L1 on chromosome 2 in tumours that harbour APC cmutations, eCi a eti csuggesting that multi upplementary Fig. 5). TCF7L1 encodes TCF3, a member of the lesions affecting the WNT signalling pathway confer selective advanta CF/LEF class of transcription factors that heterodimerize with Genetic alterations in the PI3K and RAS–MAPK pathways a clear b-catenin to enable b-catenin-mediated common addition Z0 c en i c eC transcriptional CsWqU C I ti cregul n l tI c t t c in e iCRC. d In u 1d t t eti to c l IGF2 W and etc IIRS2 overexpression, ion. Intriguingly, in all three cases, the predicted structure of the found mutually exclusive mutations in PIK3R1 and PIK3CA as well c l l alacks n the l TCF37W :W E Wdeletions q inqPTEN c in 2%, 15% W uand i c4% I of i en Cl AV2–TCF7L1 fusionI protein b-catenin-binding non-hypermutated tumou main. This translocation is similar to another recurrent transloca- respectively. We found that 55% of non-hypermutated tumours ha x a n Cd 1 et F n d CWL8qL% 0 ce I C e c dsl tl i u ae eti c l Wu n identified in CRC, a fusion in which the amino terminus of alterations in KRAS, NRAS or BRAF, with a significant pattern TI1A is joined to TCF4,) 1C which mutual 6 and l l tiis cencoded c iby1sTCF7L2, c au aChomologue de C eti c ntI ndtI exclusivity ne en e(Supplementary en u i l e CFig.I ad e Supplementary Table TCF7L1 that is deleted or mutated in 12% of non-hypermutated We also evaluated mutations in the erythroblastic leukemia vi 1 enR 21 sl cases tc iofdi Ctranslocation e d c involving C R C W homolog W Z (ERBB) W zfamily S cof receptors : Z because of the tran mours4. We also observed oncogene TC28 located on chromosome 22 (Supplementary Table 6). In all lational relevance of such mutations. Mutations or amplifications 1 enR sl x tI aC U% 0 3 6 6 # , + β # 6 6 # 0- . # 6 6 # # , + β 3 DKK1-4 . ; LRP5 # # 8 FZD10 TGFBR1 TGFBR2 # ( # # # # # IGF1R ACVR2A ACVR1B # # # # 6 6 # # ( # 1 IGF2 # # ERBB2 ERBB3 # # # # # IRS2 FAM123B # AXIN2 # # APC # # # # # FBXW7 # # # # # ! ARID1A # # # BRAF # # # # 0 # # PIK3CA 0 ! KRAS # # NRAS # PIK3R1 * # # PTEN # # 1 TCF7L2 # # # CTNNB1 # # SMAD3 SMAD2 6 5 & !8 8 & 6 # # * # CTNNB1 # SOX9 # # # 0 6 MYC TCF7 + " 7! " ! 0 9 " " " 2 ! 6! 0 - ! ! & ' / " 5 " # 0 ) 0 6 # # $ #% 0 8 8 8 0 4 4 8 0 9 ! 5 8 0 9 " 8 " 5 !8 8 ) : ! ! ! WNT TGF- RTK/RAS PI3K TP53 gure 4 | Diversity and frequency SMAD4). Alterat f a 3 dof genetic u a ni changes r a t leading f r i e to r n r up o or downregulation r ne a f o nof ergene e expression r oo r c (IGF2, n s iFZD10, regulation of signallingrpathways Red denotes activate h onina CRC. n er aNon-hypermutated t f r a Fc(nHM; a frequencies c a r n are e expressed oo has a percentage r en ofnall u cases. n 5 165) and hypermutated r(HM; shows for each sam rn 5o30) f samples r en with r ncomplete u n rdata h were ennel c genes r o and es blue ea denotes linactivated co nogenes. nerBottom r panel r e ndefined u by c somatic n s i mutations, a r n f a if at on least a hone gene c n inael n| o am in this figure is alter alysed separately. Alterations are homozygous each off the ao fivec pathways described 2. p2h etions, high-level focal amplifications, and, in some cases, by significant i aCl Wdden l u ae eti c l i c i ei aCtc en l u eau i Cc1 9ten J U LCY een 2 0 1 2 l| VuO L ©2012 Macmillan Publishers Limited. All rights reserved etu 0 au i Cl ( i d( Ci u u ae eti c l u c eti c c c tI c ei u dtI c c e d l ti c l i ( 0 n C tl s R dd l e dtl n ui C i C en I tc tc I i en l u ae eti c l x i I dl e tc I e o 1tc I Wu ae eti c 1Ci ( t l l d et( 1ten dt d ddW ddi R tc I en i ( CI Ci R en i en di c x tI aC 7% 0 e o 1tc I u ae eti c l tc en I c x CI F tc pd CWqóóU% 0 n l u dd I Ci R l l di R dsW ae l i c u ae eti c tc ci u I Ci R en d tc i en i di C e d WL8qZ% 0 n tCl eWi C ( ce I dd c ei i u tc I i di c u i l ei e c i c i Cu d u t Ci l i 1t aCtc en en e C l adel Ci u entl u ae eti c t C c e I c Wl a n l l i c Ci ac i di c dI Ci R en en e ddi R l c ) 1 c l ti c i F i I dl e tc Wqóó8%0 tc I d u ae c e 9atCtc I l i u ddc au WeCtI I Cl Cx Ci c ddl u s 1 Cl tl e tc en eau i CWni R ( C Ló 4 8 7 | N AT U R E | 3 c eCi a eti c en s C 1C l c e i u 1i l s l u dd 1Ci 1i Ceti c tc en R ni d 1i 1ad eti c WR nt n tl u tc ds ddl en e n ( u ae eti c i ddi R s 9atC u ae eti c l tc i en I c l 0 ntl 1Ci di c d ) 1 c l ti c u ae eti c l tc I c l l a n l u dtI c c e eau i C en e Z c W c tc ( l d eti c E c l l i i c etc a l R ten c R : ZW ( c ea dds I c C etc I 1Ci ) tu d etl l a l c u e l e l tp ei tl e c e i CI c l 0 Downloaded from www.sciencemag.org on July 31, 2013 Fig. 2. Genetic alterations and the progression of colorectal cancer. nents of these pathways can be altered in any individual tumor. Patient age indicates f a I d r n on a n er r n c ae a er e eoea n o r a n aef i a v er u r n er o The major signaling pathways that drive tumorigenesis are shown at the transi- the time intervals during which the driver genes are usually mutated. Note that ctionsnbetween s i ,each h tumor c aestage. f One ofael e genes o n that r encodem 2. pPhthis model may not apply to all tumor types. TGF-b, transforming growth factorñ b. several driver compo- Ct( C u ae eti c l C eni l mutations, en e ias cwell Cas lthe dnumerous et( epigenetic I Ci R enthose mutations ( c ethatI truncate l Wtethenencoded l protein c and other genetic abnormalities. When a large part of a chromosome is duplicated or deleted, it is difficult to identify the specific “target” gene(s) on the chromosome whose gain or loss confers a growth advantage to the tumor cell. Target genes are more easily identified in the case of chromosome translocations, homozygous deletions, and gene amplifications. Translocations generally fuse two genes to create an oncogene (such as BCR-ABL in chronic myelogenous leukemia) but, in a small number of cases, can inactivate a tumor suppressor gene by truncating it or separating it from its promoter. Homozygous deletions often involve just one or a few genes, and the target is always a tumor suppressor gene. Amplifications contain an oncogene whose protein product is abnormally active simply because the tumor cell contains 10 to 100 copies of the gene per cell, compared with the two copies present in normal cells. Most solid tumors have dozens of translocations; however, as with point mutations, the majority of translocations appear to be passengers rather than drivers. The breakpoints of the translocations are often in “gene deserts” devoid of known genes, and many of the translocations and homozygous deletions are adjacent to fragile sites that are prone to breakage. Cancer cells can, perhaps, survive such chromosome breaks more easily than normal cells because they contain mutations that incapacitate genes like TP53, which would normally respond to DNA damage by triggering cell death. Studies to date indicate that there are roughly 10 times fewer genes affected by chromosomal changes than by point mutations. Figure 3 shows the types and distribution of genetic alterations that affect proteincoding genes in five representative tumor types. Protein-coding genes account for only ~1.5% of the total genome, and the number of alterations in noncoding regions is proportionately higher than the number affecting coding regions. The vast majority of the alterations in noncoding regions are presumably passengers. These noncoding en x i pt Cl C l adel tc C tc i u u ae eti c R l C ( tl tc i u 1 etet( ( ce I le u aCen Cu i C W : Z u ae eti c l t I ci l en C i C i R c en 1i e c et dei C a 1548 iR di i Z8 sl en C e l ex ce C ci e ddl 0 C a de C eti c l m a to llo bl as as to ei :Z ( ce I W c iu C tc i u l CC eti c l 0 ntl 1Ci c i aI n etu i di C e d c m G lio bl tic 1tI c et c s l su 1ei u i ad aeni Cl s R td zes1 l e u ed u c Cl WR n e I t( l al c en e u ae eti c l M au ad eti c i i en I c et q8 i C u i C s ca nc er c i u ei al 1i ds1l ta lc i C W re c l u c eti c er r e lo r Co a r r e Cu tc i c teti c z 1 c nc ( i C 0 n et( eti c W c tc e l etc l W di c l n C i Ctc I eni l an ce r e i WL8qZ% WR ni l ddl C C 1d tl 1d s i ( C en ( ce I di l l W tc e l etc 0 n s c u c s u ae e l 1 t dds tc i dtetl z i re a u i al ddl 0 n c e l ea s x Cu ad c ca u ae eti c l tc en e Cu tc tl et C tddti c l i nc en i c e tc tc I Pa 9a c et t WL8q8% Wentl l dtI ne tc C l s en ll u s e o 11ds l C c tc I u eni l ei 11 Cl 0 i CC e l C c tc I 1i dt t l C en s /8D x F Ci c WL8qq% 0 C enC u tc l C c tc I u eni l 2 n c i c ztc ( l t( 29 MARCH 2013 VOL 339 SCIENCE www.sciencemag.org % Wen tc ( l t( l tI u i t i l i 1s c en i di c i l i 1s0 di ade i ad CREDIT: FIG. 2, E. COOK dd tCen c the gene, as well as protein-truncating mutations in the C-terminal 1200 amino acids, are passenger gene mutations. Numerous statistical methods to identify driver genes have been described. Some are based on the frequency of mutations in an individual gene compared with the mutation frequency of other genes in the same or related tumors after correction for sequence context and gene size (22, 23). Other methods are based on the predicted effects of mutation on the encoded protein, as inferred from biophysical studies (24–26). All of these methods are useful for prioritizing genes that are most likely to promote a selective growth advantage when mutated. When Translocations 80.0 the number of mutations in a gene Deletions is very high, as with TP53 or Amplifications 70.0 Indels KRAS, any reasonable statistic 60.0 SBS will indicate that the gene is extremely likely to be a driver gene. 50.0 These highly mutated genes have 40.0 been termed “mountains” (1). Un30.0 fortunately, however, genes with more than one, but still relatively 20.0 few mutations (so called “hills”) 10.0 numerically dominate cancer genome landscapes (1). In these cases, methods based on mutation frequency and context alone cannot reliably indicate which genes are drivers, because the background rates of mutation Fig. 3. Total alterations affecting protein-coding genes in vary so much among different paselected tumors. Average number and types of genomic altera- tients and regions of the genome. tions per tumor, including single-base substitutions (SBS), small Recent studies of normal cells insertions and deletions (indels), amplifications, and homozygous have indicated that the rate of deletions, as determined by genome-wide sequencing studies. For mutation varies by more than colorectal, breast, and pancreatic ductal cancer, and medulloblastomas, 100-fold within the genome (27). translocations are also included. The published data on which this In tumor cells, this variation can be higher and may affect whole figure is based are provided in table S1D. Though it is easy to define a “driver gene mutation” in physiologic terms (as one conferring a selective growth advantage), it is more difficult to identify which somatic mutations are drivers and which are passengers. Moreover, it is important to point out that there is a fundamental difference between a driver gene and a driver gene mutation. A driver gene is one that contains driver gene mutations. But driver genes may also contain passenger gene mutations. For example, APC is a large driver gene, but only Number of alterations per tumor s c within its N-terminal 1600 amino acids are driver changes found in cancers, will be discussed later. geneED mutations. throughout n Ct( C uDrivers ae Versus eti c Passenger tc C Mutations l l i ae 80 en Missense etu mutations i u 1Ctl ea st eR en e Br l etu e Introduction be guaiac based (gFOBT) or immunochemical (iFOBT), which is much more accurate and specific (Hol et al., 2010). FOBT screening has shown a decrease in mortality about 15-­‐20% (Faivre et al., 2004). Many other non-­‐invasive screening markers have been proposed, mainly through the stools or blood analysis. For example, detection of mutations in DNA obtained from stools has been suggested as screening method since early 90’s. Genetic tests that included TP53, KRAS, APC and BAT-­‐26 demonstrated sensitivities for cancer and adenomas between 52–91% and specificities of 93–100% (Ahlquist et al., 2000; Imperiale et al., 2004; Syngal et al., 2006; Tagore et al., 2003). Also enzymatic activity can be used as a diagnostic marker, for example M2-­‐PK has been identified as a key enzyme for colorectal cancer cells. Thereby, fecal M2-­‐PK tests are able to detect specific alterations in intestinal cells and it can detect carcinomas and even bleeding and non-­‐bleeding polyps with high sensitivity and specificity (Newton et al., 2012; Pox, 2011; Tonus et al., 2012). Abnormal DNA methylation of gene promoters has also been studied as a diagnostic marker in both blood and stools. Different markers such as SEP9, MLH1, EN1, VIM and WNT2 have been extensively studied, and the detection values range from 30 to 60% in most cases and the specificity between 80 to 100% (Azuara et al., 2010; Bosch et al., 2012; Herbst & Kolligs, 2012; Mayor et al., 2009). However, it has been shown that different cohorts exhibit important differences in specificities and sensitivities, maybe due to the different approaches used to analyze the samples (Herbst & Kolligs, 2012). Independently of the marker, any positive result requires additional examinations, normally colonoscopy. In this case it is possible to perform a biopsy of the putative tumor to obtain an accurate diagnosis. If the tumor is confirmed, next step would be the classification into TNM stage, which describes the spreading of primary tumor, also the lymph nodes affection and if there are metastasis and how many they are (Cunningham et al., 2010). In general, colonoscopic surveillance and polypectomy have had a tremendous impact on reducing CRC-­‐related deaths: colonoscopies have resulted in an overall reduction of CRC-­‐related deaths by 29% and deaths from distal CRC by 47% (Limketkai et al., 2013). Curiously, colonoscopies have resulted in no observed reduction in deaths caused by proximal CRC (Baxter & Goldwasser, 2009; Singh et al., 2010). 31 Introduction Treatments Surgery to remove the cancer and nearby lymph nodes is the most common treatment for early stage tumors (TNM stage I and II), whereas in more advanced cases, chemotherapy is used after or before surgery (TNM stage III and IV). Nowadays, in the era of personalized medicine, before the election of the treatment it is feasible to investigate some allele variation in some key genes in order to predict how the patient will respond to chemotherapeutic agents. The agents more frequently employed in the treatment of colorectal cancer are: ·5-­‐Fluorouracil (5-­‐FU): an antimetabolite, it is the mainstay of all current standard colorectal cancer chemotherapy therapies. It is known to cause side effects such as myelosuppression, mucositis, diarrhea, hand and foot syndrome and cardiac toxicity. Up to 30% of patients will experience serious side effects, with 0.5% of these being fatal. Some deaths by toxicity could be avoided by checking DDP (Dihydropyrimidine dehydrogenase) gene mutations. DDP is the enzyme responsible for metabolizing the 5-­‐FU in the liver (Meinsma et al., 1995), at least 17 known germ line mutations could affect the efficiency of the enzyme and produce the accumulation of the agent until systemic fail. ·Irinotecan is a topoisomerase inhibitor. It is known to be efficacious in the treatment of metastatic CRC when used in combination with 5-­‐FU. Side effects of Irinotecan are diarrhea and myelosuppression. Irinotecan is inactivated by UGTA1 enzyme, for which more than 50 less active variants or inactive ones have been described, the most studied is UGTA1*28 that has been investigated as a cause for increased irinotecan toxicity. Taking into account pharmacogenic trials (Ando et al., 2000; Innocenti et al., 2004; Marcuello et al., 2004; Rouits et al., 2004), the US Food and Drug Administration (FDA) has advised that patients homozygous for the UGTA1*28 allele should receive a lower starting dose of irinotecan. ·Oxaliplatin inhibits DNA synthesis by forming both inter-­‐ and intra-­‐ strand cross-­‐links in DNA. The main side effects are diarrhea, myelosuppression, hypokalemia, fatigue and neurotoxicity. Normally these drugs are combinated for the treatment of stage III and IV colorectal cancer. These combinations are 5-­‐fluorouracil, leucovorin and 32 Introduction oxaliplatin (FOLFOX); 5-­‐fluorouracil, leucovorin and irinotecan (FOLFIRI); and capecitabine (the oral form of 5-­‐fluorouracil) plus oxaliplatin (XELOX). Radiation in combination with chemotherapy is used in rectal cancer (Cunningham et al., 2010) and not routinely in colon cancer due to the sensitivity of the bowels to radiation (Shaib et al., 2013). Three targeted monoclonal antibody therapies approved by the FDA to treat patients with metastatic colorectal cancer are bevacizumab (inhibiting angiogenesis by inhibiting vascular endothelial growth factor A), cetuximab (epidermal growth factor receptor (EGFR) inhibitor) which is ineffective when KRAS is mutated, and panitumumab (EGFR inhibitor) (Newton et al., 2012). Besides, many others are in clinical trials or applied to other cancers (Scott et al., 2012; Vanneman & Dranoff, 2012). It is worth to note that aspirin treatment has multiple advantages and it has been demonstrated it antitumoral role in almost all stages of the cancer. In polyps, aspirin inhibits WNT signaling and reduces the size and frequency of sporadic colonic polyps and polyps in patients with familial adenomatous polyposis. Moreover, aspirin hampers epithelial to mesenchymal transition (EMT) in cancer by inhibiting COX-­‐2 cyclooxygenase (Oshima et al., 1996). In EMT and in metastasis, aspirin reduces lymphatic dilation and lymph node metastases in mouse models of tumor lymphatic metastases. 10% reduction in overall cancer incidence could substantially broaden the indications for prophylactic daily treatment with low-­‐dose aspirin (80mg) (Chia et al., 2012; Thun et al., 2012). Not only drug treatment is important; recent papers highlight the importance of gut microbiota as enhancer of the immune anticancer response, these papers demonstrate the importance of the bacterial environment in colorectal cancer (Iida et al., 2013; Viaud et al., 2013). 33 c eCi a eti c c ao Csi et 1 o I ddl WI c et tc i Cu eti c tl c i Ci ac tc en c i e u Ci tI ne i C ntl ei c l W i Cu tc I WR nt n tl etI neds sc u t l eCa eaC oc i R c l nCi u etc x aI CWL88/%x tI aC ó% 0 c ao Csi et i CI c tl u l tc da tc I 1d c el W c tu dl la r e tu 1 Ce c ei c psu et u i t t eti c l e i en en c ac I t, c 1Ci e tc d ( dl WR nt n teti c d d s C i n Cte d tc i Cu eti c ei en l l c et d i C C I ad etc I I c n Cte d Ci u i c ) 1C l l ti c 0 I c C eti c ei en i c R i ad n c l a n u i t t eti c l c ) eWen s u i t t eti c l c c Ctc I n c I l tc I c POLYGAMOUS DNA L8qq, R F i l c WL8q8% 0 fl nCi u etc tl C C CC ) 1C l l ti c x ei C 1tI c et c toi F ntd et C W Trojer and his colleagues blocks an enzyme f a T d use el ac number n er eof epin n aef n active aelin an n epigenetic r naf nf patha m r cards n nand s e stored af indefinitely o c r nby hospitals and genetic techniques. ChIP-seq way but not its nearest l e n er ais aflab o nstandard r n c ae m l n ineighbours, o n er r he says. nerIt is l ehealth-care n ersystems. h cScientists n aelat Queen Mary, in which antibodies “the key” to the tech- a selectivity that has been difficult to come by in University of London are exploring how DNA aFm2.are p2h nique, he says. But the company has also made the development of biotherapeutic drugs. methylation patterns change between newborns histone mass spectrometry a priority, because Copeland believes that epigenetics drugs and in cells from the same children when they c qóEL i c C tc I ei c tc 1tI c et l l 5en C c n i ti di I s R nt n it allows the scientists to query the chromatin fit into a trend of defining a cancer not by its are three years old. Differences in epigenetic changes without using antibodies and to query anatomical location but by its molecular pro- marks could be clues to health. ea t l en at once. al The d tccome C file, eti which c l includes eR epigenetic c I c lsignatures. c enLike tC 1Ci If the a elsequencing WR nt n companies Ctc I l are betting a number ofl modifications pany set up an in-house high-throughput facil- many companies in this field, he and his col- right, then genome sequencing could become 1n c icompounds. es1 tc ei tc Ileagues ; 0 Cn u s 1Cavailable CC databases, tc teticommonplace c R i ad for many en patients, i c perhaps even ity to screenen for potential mine1l the publicly Although other companies tend to out- noting that many genetic alterations in epige- part of an annual physical examination. An u the company c tl wants Cdi toRintetc W Cinetic u pathways t c arecfound t( Clintes tc L88/2 c etread-out, l n l updated dR slat regular intersource these Ci tasks, human cancers. 5 1tI epigenetic grate findings about chromatin biology into Kouzarides believes that many cancer cells vals, might be an important companion file to c anddin-house en Rsuite tCof tools c Rwill i cbe very C ad entc I l toenepigenetic e c 6edrugs )that 1dgenome tc s I c et l 40 vulnerable drug discovery with sequence. that includes mass spectrometry and biophys- because they rely on only one or two epigenetic But this type of progress depends on deeper n C explains. l en u i l e 1epathways, c i R whereas sl normal tl 25 1tI c etonlsevtl enunderstanding l ea s i ofuepigenetic tei et dmechanisms ds ics analyses, Dionne cells draw and Another Cambridge-based epigenetics com- eral pathways for their functions. At the same technology that has yet to evolve, Kouzarides pany, Epizyme, focuses on a family of proteins time, he believes that epigenetics researchers says. Because epigenetic events change concalled histone methyltransferases. These epige- and technology developers will still want to stantly in the cell, “whatever you see in one ZEact on histones, by catalysing the develop and refine experimental methods, for moment will change in the next”, he says. ■ netic modifiers transfer of methyl groups onto specific positions example to explore the three-dimensional strucin the protein. The company has partnerships ture of epigenomic events, to see how chromatin Vivien Marx is technology editor at Nature and with the pharmaceutical companies Glaxo- is changing throughout the genome. “It’s very Nature Methods. c eCi a eti c c Mi C u ti et dds n Cte d n c I l tc I c ac eti c en e s n c I l tc n l 9a c 1tI c i u ea dds te tl tl ; x al l i sc u t e c c ( tCi c u c e c t C c et eti c 1Ci es1 i c eCt ae l ei en dtc c L8q8, l ac d enCi aI ni ae dt W CI i l 1C tl ds i c eCi dd l l 0 ntl eC c l teti c tl t C c e I ) 1d tc WqóóU% 0 i l c i e 1 Cl tl e ac n c I s en i ( Cen cci e c etl l a 1 c tc I i c en dd ddad C i u u teu c e x i e F tdW toWL88U% 0 n i o n er mn n c nau c l R C C ei u ensd I Ci a1 tl u ensd eti c l en ei en R nt n tl oc i R c l en t en ti n u t d 1Ci sei l tc x % i Cu tc I l i en I c i u t( en c u : zu ensd sei l tc x: u % W x tI aC q8%x u ensd eti c R l en tCl e 1tI c et u i t t eti c i e notl l c tc tet dds C ll Rn C s C) WL8qL% 0 tl i ( C tc qóE7 s C0 i 1t sei l tc x i e notl l qóE7% 0 u ensd eti c tl l su u eCt tc i en l eC c l en sei l tc c i aCl tc R tentc en 1 i c e ) e0 e tl R i Cen ei c i e en e en C tl u tc i Ctes i u ensd eti c en e i tc f a p. d l n c e n er e n l n i o aef c r n eaa c er r i ne r i n r gi l h cn ael n eeC c a r c o e r n m2. . Th R n C te R l i ac tc et( eti c x tl e C ci cz 1 ac c Ct n WL8qZ% 0 CC 1C l c e u i c I en u /8A78D tc a d i et Cl ei i 0 1 e tc eW tl l c CWL8qZ% 0 nC i c l C( C I di dds C L7 u tddti c 1 l tc nau c c l tes tl en l e etl et dds ) 1 e c u d u ensd eti c tc tc a d i et l z c l C I ti c l 0 n l e en 1Ci u i e C C I ti c l i ni al o 1tc I c etc c aCi c l nCi u i l i u C I c C dds u ensd e 0 x 1 t%x c e 9a C F tC WqóóZ% 0 1 t e c ei x u ten F ce i c e ) eWc te tl ac 1 i en tc u u u dt c I c i u l 0 n C 1 l tc a d i et l C di 1 l 1 t dds l 1te entl C i c e ) e tl l etdd 1i i Cds ac I ci u Wc en tc I c l en e l ci cz 1 aCl l l en c q8D i Ct n C I ti c l R n C C e Cu ac u ensd e 1 tl d c l c i e c di e ( di 1u c e d C I ad ei Cs I c l c psu l W u ensdeC c l C l q Z: c eCi a eti c x q% W Z u tc e c c x t c x c i Z C C l 1i c l t d i C en u ensd eti c x tI aC q8% c WqóóL, o c i C l l c et d i C u ensd eti c n c I l ral e i tr i c eC CsWen C l a Cl c WL8qZ% 0 c en ( di 1u c e0 u u et( ( di 1u c e aC tc di dtp C I ti c l C l eCtotc I n c I l tc en I Cu dtc tc t e ds e C Cetdtp eti c Wen 1 e Cc dI c i u u ensd eti c c C u tc l tc en e l e e i C u adet1d Ci ac l i dd t( tl ti c l 0 aCtc I entl etu Wen 1 l l t( c Wqóóó% 0 dd t C c et eti c Cds l e I l i 1i l teti c u ensd eti c 0 u e Cc d I c i u u ensd eti c 1 ee Cc l C u ensdeC c l C l l Z c Z ) 1 Ct c l I C a dW l e dtl n aCtc I en s en ( di 1u c e i en REVIEWS d l ei sl ex tI aC qq%x a F n c I WL8q8% 0 Female Male Fertilization Zygote ICM De novo methylation DNA methylation a 2 cell 4 cell 8 cell Morula TE Blastocyst TE ICM Developmental stage l bf a pphd i r l e r ne n naec ne deni aI n u i l e i ExE en l n i o n er r aoi n al h c n ael f | I ci u Epi l 9a c tc I i c tCuVEl en e l i u E3.5 E6.5 tl u r nh a a ne r r a u ensd e WR ni d I c i u PGC founders I c i u t C I ti c l E7.5 E8.5 u ensd eti c 0 n lInitiation I c i u t Specification C I ti c l tc da Blastocyst BLIMP1 de CWqóóU% Wl i PRDM14 15meC Ct c eCt n e Ci e u oec l r m2. p. h tl ad1nte C C l tl e c e ei l a n R ( i E9.5 E10.5 E11.5 tu 1Ctc etc I i c eCi dI c lGenital x dridge oF Migration C eCi eC c l 1i l i c l x C( tc nCi u etc x i aI t C oo WL8qq% c Wqóó7% 0 u 1Ctc e I c l c eCt c C eni l Figure 2 | Dynamics of DNA methylation during development. a | Active demethylation in the zygotic paternal genome. a sperm active demethylation I Shortly c l after ) 1C l l fertilizes tc an egg,1 the C paternal c ezi zigenome CtI tcrapidly zl 1 undergoes t t u genome-wide c c CW Rn e DNA d| Molecular l eiCellen Nature Reviews Biology and remains demethylated following multiple rounds of cell division. During this time, the maternal genome experiences gradual, methylation by the methyltransferases DNMT3A l td c tcpassive I i demethylation. en c i De c znovo ) 1C l l tc I patterns dd d are established s uDNA ensd eti c 0 teti c d and DNMT3B during the development of the blastocyst. b | Active demethylation in primordial germ cells (PGCs). After implantation ectoderm i (ExE) (VE) u ensd ofetithecblastocyst C l tl at e embryonic c e C Iday ti c7.5l (E7.5),Cthe extraembryonic dl i C 9atC C and di visceral c I ze endoderm Cu produce signals that specify a subset of epiblast cells (Epi) to become PGCs. This process requires two key transcription PR 1 (PRDM1)) and PDRM14, are expressed thisc ufactors, ensdBLIMP1 eti c (also l tdknown c tcasI W endomain etl zinc l alfinger e tc protein enCi aI ni aeen ( which di 1u c e c during dt l 1 stage of development. Following specification, PGC founder cells divide in the presence of the DNA methyltransferase and migrate towards the genital ridge. During this migration and on arrival at the genital ridge, 5-methylcytosine i DNMT1 c i CI c tl u x u ten F tl l c CWL8qZ, a F n c I WL8q8% 0 (5meC) is erased through an active mechanism. ICM, inner cell mass; TE, trophectoderm. regions are resistant to this wave of DNA demethylation, but one possibility is that methylation of these regions Z/may be required to ensure transcriptional repression and chromosomal stability. Additionally, the maternal genome remains methylated during this time even though it is exposed to the same cytoplasmic factors. Insight into of transposable elements and repeat sequences results in their reactivation and, if so, what the significance of their reactivation is remains to be determined. Genome-wide DNA demethylation of primordial germ cells. After fertilization, the one-cell zygote undergoes Introduction Two key papers in the 1970s proposed DNA methylation as a silencing epigenetic mark (Holliday & Pugh, 1975; Riggs, 1975). Nowadays this function has been confirmed in several papers and now this mechanism is widely accepted (Garinis et al., 2002). Today, thanks to the possibility of genome-­‐scale mapping of methylation, it is feasible to evaluate DNA methylation in different genomic compartments, such as gene promoters with or without CpG islands, gene bodies, regulatory elements and repetitive sequences. The silencing effect of DNA methylation into gene promoters with a CpG island has been extensively studied in cancer and other diseases and it is widely accepted. However, the scenario is not that clear in the genes that do not have CpG island in their promoters. Genomic analyses have identified low CpG promoters that are both transcriptionally active and DNA methylated. It has been shown that the CpG methylation of the CRE motive (TGACGTCA) enhances the DNA binding of the C/EBPα transcription factor, a critical protein for activation of differentiation in various cell types (Rishi et al., 2010). Furthermore, C/EBPβ has also been described to bind methylated DNA (Mann et al., 2013). CpG dinucleotides density in the promoter is a key factor to understand the role of DNA methylation in regulating gene expression. In this field, the work of Dr. Dirk Schübeler has shed some light on how some CG poor regulatory regions are protected from DNA methylation. By using whole genome bisulphite sequencing in mESC and differentiated neurons, he observed that low-­‐methylated regions (LMRs) are occupied by DNA-­‐binding factors, which attachment protect DNA from being methylated (Schübeler, 2012). He has also observed that cell-­‐type-­‐specific LMRs are occupied by cell-­‐type-­‐specific transcription factors, meaning that transcription factors are shaping the methylome (Bell et al., 2011; Stadler et al., 2011). In the same field, Dr. Daniel G. Tenen recently described a new mechanism by which DNA is protected from DNA methylation. He observed a new non-­‐coding transcript (ncRNA) transcribed some Kbs upstream the promoter of CEBPA gene that modulated the expression of a gene by inhibiting the methylation (Figure 12.A). The extra-­‐coding CEBPA ncRNA (ecCEBPA) binds at the same time to the DNA sequence (by sequence homology) and to the DNMT1, preventing by this way the DNA methylation of the DNA (Figure 12.B). In the same study the authors demonstrate that DNMT1, 37 , 8 5 7/ @ ,(8 5? )' ; : 0 54- 40; ? 54- ? c eCi a eti c90 ; 78 8<0 5 990/ =4 3 , 8 5 )' ;0 : 54- ? 78 =4 3 ;0 : enCi aI n tel 87/ 7058. 4 !' & + -087/ 2070 58. 4 e dset i u tc W tc l control. In conclusion, we have generated the fir cross-referencing DiRs to DNA methylation These data demonstrate that RNA–DNMT DNA m R ten ntIspread n C tcand tes eimight i d modulate en c genomic ei u ensd eti 5c 5))*d ( d.l 8<0 C0/ tc ( Cl ds i CC d e al ti WL8qZ% 0 R ten Discussion 2070 58. 4 d ( dl x t This study explores the role of a new class of RN I c C the dWu iCEBPA l e i en gene I c as a model, we RNAs.c Using ecCEBPA a A i t is l accompanied C 1 1i i C C Iby ti c lthe production scription CEBPA 5)& ) species, ecCEBPA. studied, D ! x deni aI n te tl cIn i e every ac al a instance d ei CEBPA are inversely correlated with ecCEBPA levels, tc 1 tl d c l en C % & 0 3?5 487 50<0 5 & 0 3?5 487 50<0 5 7 50<0 5 methylation is determined by the absence or " 39 48 757 / ! " * ′ +) ? c i Cu dds ) e c l t( ds dB + 77;?. 49 487 55? 47 . 47<0 207864. (Fig. 2). 7 ;4 0; ensd e c that i cecCEBPA e tc tc I 5 582 60 3?5 7;1 -0 ;0 / 449. . 0;;4 - 50 ecCEBPA b c Weudemonstrate associates w ecCEBPA CEBPA 5)& 8ad 75et1d 7/ C 1 etet( d u c el 0 ecCEBPA and lish " a39u4functional link between !' & + SP29 through RNA–DNMT1 36!' u ensd eti c association. etc I 50<0 5 WeI show of adopting c ) i cthat l tl RNAs u ri C capable al i + 7;. 49 487 55? . 4<0 207864. ;4 0 exhibit the potential to associate with DNM u ae eti c l al s en 60 3?5 7;1 0 ;0 0 ; 4. 4<0 basis of this preferential interaction is recogni USP29 tc eti 3). c i :u → 0 & + 0. 4fi. 9 0 ; structureu (Fig. d e / 449 !' & - 4/ )& 9 u′ tl+)uwee demonstrate n l d ei that this type Importantly, ecCEBPA " 39 4 ! " *n l CEBPA 8 757 / 5)& CEBPA 5)& ecCEBPA ciationtlis lnot restricted toc the z al tc I u ae eti l tc CEBPA gene l 36!' USP29 identified associated with DNM en IRNA Cu dtcspecies c c Cz ship to DNA methylation and gene express f a p2 d e o e and -unbound p t f na n er h y de alignment of DNMT1-bound al tc I u) ae) eti c l tc l i u et ) ) ) ) na r a c n a er) r) a o n er ne n l h r defined mnec m ) ) a large set of expressed unmethylate hylation and gene expression. a, Two-way p r ne l Venn l n ion r el d d l x t i ae Wqóó8% 0 genes that co f g / 449 "3 9 48 7 57 set / mentary of silent methylated a overlapping er h ennel m r r en ne n u MT1-specific peaks withp transcribed l l n *i1 a 69<er h763= / c. n ael f 763 e= / . <6o- n 2 763= / . r el 6 - 2 69<6eti - 2 763 ensd c = /tc. en of I cthe iDiR. s CEBPA expression RNA-seq libraries. * <6 - 2- following HL-60transcripts. total and poly(A) - / 449 / 449 - / 449 - / 449 m2. pPh -depleted EBPA (small white Our tl findings 1i l tet( dssuggest i CC d ea model R ten of site-specific nting genesregion within DNMT1-unbound, -bound and all the coding stratified expression transcripts by by DNA methylation act asd ac shield, ) 1C l l ti c x i and c lW qóóó% W ( levels. c t en All I c ini which s i c eRNAs tc l 1 tl c tl halting DNMT scripts in cellular Supplementary Data 2. c, Examples of genes from the C DNA genomic methylation at their site of t scales. qRT–PCR ) e cvisualized l t( ds u ensd e the Wentl R i ad c i e tc nt te di c I eti c 0 1 Ce Ci u entl W 9) clusters. Peaks are using SSIRs (site Indeed, the loss of CEBPA locus methylation fo eti c uof sDNMT1 n ( Cisequestration. d tc l 1dt tc I 0 e n l c u i c l eC e en e d, Model rt sequence reads)u48.ensd of ecCEBPA does not support azmodel of trivial Figure demonstrate transcriptionally genomic nsssCEBPA tc inactive tc I2 | Losseihemimethylated Cand x gain-of-function % c 1Ci ustudies i e tc dalofti DNMT1 c i that R ecCEBPA obut a1lsuggests eC u )ai ccis-regulatory l s role o maintains CEBPA expression by regulating methylation of the CEBPA MT1 cannot access transcriptionally active locus. a, Diagram the position of1 target shRNA model wherein contain t etc I di d indicating 1i dsu Cl al tc Isequences tc u for uu dt c uRNAs i d l sl e u i C a locus-selectiv he regulation mic regions. of uconstructs (sh1–sh3); the fragment derived from ecCEBPA used for the ‘anchor’, mooring the DNMT gain-of-function overexpression de Cc et( l 1d t tc Iregions W denianalysed aI n entlfor1Ci l l in c forming l ei n part, ( en (distal ac u ensd e (R1); changes DNA methylation ell line (up to a promoter; coding sequence (CDS) and 39 untranslated locus, a 0DNMT1-interacting part, the ‘b region and (UTR)). c te tlstatus tc nt tewas R nobserved c u ensd (Supe x naod WL8qq% n C i C Wte l u l ne locustargetmethylation shRNAs) Asterisks indicate number of base pairs away from the CEBPA TSS. b, c, The serving to lure the DNMT1 in forming sequence crease of CEBPA dto results loss-of-function ds of enecCEBPA e u ensd eti c in tc CEBPA-expressing I c i t l RU937 tdd n cells. ( iEffect ae i of l si c en byuRNA does resemble a comp ecCEBPA-targeting shRNAs on CEBPA mRNA levelssequestration (qRT–PCR, bars indicate , suggesting that d genes within both groups according to levels of i I c6tps.d. (b)) ac and eti cmethylation tc en l tdofc the tc ICEBPA i tc eCpromoter I cribed c t C(c). 1for etet( l 9a c l 0RNAs, for example, DNA other regulatory g of the CEBPA Cmean 6,7,23 methylation changes are shown as the ratios of methylated (M) to hylation. We defined genes as ‘expressed’ or ‘low 15,16,41 promoter . To . i5However, c n c Cl C l tea e in all e (clones Ct analysed d tl e per c RNAs l Ciconstruct u 1Ci u(n e 14). Cl c C unlike o s ei competing e unmethylated (UM) CpGs each score was above or below 4, respectively; the log EBPA and2 methys.c., scrambled d, e, The studies i c eCi ddtc I I control. c ) 1C l ti cresults tc of( ecCEBPA di 1u c gain-of-function eecCEBPA c dd acmodel eti c xinalso c c introduces nti W the requirem within the distal K562 d’ or ‘methylated’ ifcells, theinmean of lall scores which CEBPA is CpG methylated and silenced. d, Effect of ecCEBPA and physical co-compartmentalization of the PA TSS; Fig. 2a). L8qZ% 0 e n on l This c l approach nimRNA R c enlevels. e allowed cUR, n cunrelated Cl ns1 qRT–PCR, Cu ensd bars eti c i ad C l ade tc upregulation CEBPA region. 0%, respectively (Methods). increase in DNA indicate mean 6 s.d. (n 5 4). e, Effect of ecCEBPA upregulation and DNMT1. Given the ability of DiRs to bind on methylation usters DNMT1-bound, rol (Fig.within 2c andDNMT1-unbound, of the CEBPA locus (DNA methylation changes weretoassessed as described in suggest that DiRs represent a novel class of c (nHypomethylated 5 14 for distal promoterand and nexpressed 5 6 for CDS and 39 UTR)). f, g, The results d groups (Fig. 5b). Z7 Takenlevels together, these data support the hyp of transcription inhibition in U937 cells. f, ecCEBPA expression after CEBPA was suffipredominant intreatment the DNMT1-bound group (cluswith actinomycin D (actD) and ML-60218cipates in synchronized in theand establishment of genomic methy gion of ecCEBPA unsynchronized cells. qRT–PCR, bars indicate mean 6 s.d. g, DNA or 56.64%, whereas hypermethylated and low or essing ecCEBPA acting with DNMT1 and pave the way for the s 92 92 92 9- ! 8$ 5 / 2< 4 376 37 % ! 8$ 9 % ! 8$ 9 92 92 92 9- > > > ) / 4 3: / / ; 8 / 99376 4/ : / 49 70- 76 74 67 5 43= / . 718S 92 92 92 4< 9- > > > ) / 4 3: / / ; 8 / 99376 4/ : / 49 70- 76 74 67 5 43= / . 7 18S ? 0 - 37 6 37 6 - 4) & 0 3- (7 +7 95 4 " - % " % *' % ! 8$ 9 % ! 8$ 9 37 5 / 2< 4 376 ! 8$ " - % " % *' > > " - % " % *' ) / 4 3: / / ; 8 / 99376 ecCEBPA 4/ : / 49 705 7- ! 8$ 5 / 2< 4 376 37 % ! 8$ 9 % ! 8$ 9 ! 8$ 5 / 2< 4 376 37 % ! 8$ 9 % ! 8$ 9 074. > 074. > > > " - % " % *' ) / 4 3: / / ; 8 / 99376 ecCEBPA 4/ : / 49 705 7- ) / 4 3: / / ; 8 / 99376 4/ : / 49 70- 76 74 ) 67 5 43= / . 7 18S ! < 78 92 % 92 92 $ Introduction reduced activity of the enhancer in reporter assays (Schmidl et al., 2009). The emerging picture is that DNA methylation has different functions and varies depending on the genomic context. DNA demethylation, the sixth, seventh and eighth bases of the genome In the last decades science has been committed to elucidate the mechanisms of DNA demethylation. There were some DNA demethylases proposed but the results obtained could never be reproduced in other labs (Jin et al., 2008). It was in 2009 when the enzymatic activity of TET proteins (Ten-­‐eleven translocation) was described (Iyer et al., 2009; Tahiliani et al., 2009) and related to a new mechanism of demethylation. TET proteins (TET1, TET2 and TET3 in humans) are Fe2+-­‐ and 2-­‐oxoglutarate-­‐dependent dioxygenases that successively oxidize 5-­‐methylcytosine (5mC) to 5-­‐hydroxymethylcytosine (5hmC), subsequently to 5-­‐ formylcytosine (5fC) and 5-­‐carboxylcytosine (5caC) in DNA (Figure 13) (He et al., 2011; Ito et al., 2011; Iyer et al., 2009; Tahiliani et al., 2009). These oxidative reactions have been observed to be modulated by vitamin C (Chen et al., 2013). All three forms of oxidized methylcytosine are now known to be present in different amounts in numerous mammalian tissues (Globisch et al., 2010; Kriaucionis & Heintz, 2009; Szwagierczak et al., 2010). For example, 5hmC is found at different levels in mammalian cells: it is present at 1% of the total level of 5mC in bone marrow populations (percentage that is decreased in some types of leukemia) (Ko et al., 2010), about 5 to 10% of the level of 5mC in embryonic stem cells (Iyer et al., 2009) and as high as 40% of 5mC in Purkinje neurons (Kriaucionis & Heintz, 2009). Until now, neurons are the cells with the higher content of 5hmC (Lister et al., 2013). In the case of 5fC and 5caC, they are present in mammalian cells at much lower levels than 5hmC (0.03% and 0.01%, respectively, of the level of 5mC in mouse ES cells) (He et al., 2011; Ito et al., 2011). This could be explained by the enzymatic mechanisms responsible for their removal. There are two different mechanisms proposed to remove DNA methylation, the first one and more accepted is thymine DNA glycosylase (TDG) (Figure 13, upper part) (Pastor et al.,2013). It is known that 5fC and 5caC can be excised by TDG and their replacement with cytosine results in demethylation. 39 c eCi a eti c i u 1d ) C i I c tp l : 2 u tl u e n l R ten ntI n C tc tes en c u tl u e n l W aCen Cu i C d ( dl i : c c : dll 1d eti c tc L ei q8z i d tc C l ddl x i ndt F n c I L8qZ% 0 n l 1e Wtc ( i d( l en x: nu % s al l c u tc eti c i : nu c psu l W: nu I ds i l sd l l c adetu e ds C 1d 2 tc en ic u n c tl u ei : zns Ci ) su ensdaC td tl en c C u i ( s qiC s sei l tc x tI aC qZWdi R C 1 Ce%x ai WL8qq% 0 # #$* # & $+ ,! ' # #- ," ' NH2 NH2 %&$( # N N O OH N O R R O NH2 %&$( # N N O R R % NH2 O OH N N O N O NH2 %&$( # N N R $& OH O HN $& # N O R " f a pP d l n i o n er c aen r t f eal i o i ne r N O i C i ( CW: nu N O ' n % lR c 1Ci 1i lR u ensd eti c 1Ci li u " Ci d " O u i tdtes c ei " l tc " " " " WL8qL% 0 % ! ei C tc tc I l te l Wl R dd " " | *+ 3* *! , 10 0&2" , 0%3 5/ + # !")"0%5( 0&+ * ! " #" ." 0% 0 &*2+ (2" + 4&!&6"! )"0%5( 50+ /&*" &*0". )"!& 0"/ "* "("2"* 0. */(+ 0&+ * ,. + 0"&*/ / -1 *0& ((!5 + 4&!&6" % )"0%5( 50+ /&*" ) 0+ %5!. + 45)"0%5( 50+ /&*" %) #+ . )5( 50+ /&*" # *! . + 45( 50+ /&*" # *! * " . ")+ 2"! 5 0%5)&*" $(5 + /5( /" *! . ", ("! 550+ /&*" 2& /" "4 &/&+ * . ", &. (0%+ 1$% 0%" "40"*0 0+ 3%&% 0%&/ )"% *&/) + , ". 0"/ &* /, "&#&"(( 05, "/ !1. &*$ !"2"(+ , )"*0 &/ 1*'*+ 3* 0%". ,. + , + /"! )"% *&/)/ + # !")"0%5( 0&+ * . " ("// 3"(( "/0 (&/%"! &* (1!&*$ !" . + 45( 0&+ * + # 8 )"0%5(0. */#". /" )"!& 0"! . ")+ 2 ( + # 0%" %5!. + 45)"0%5( $. + 1, + # %) *! !" )&* 0&+ * + # %) *! ) /"" ) &* 0"40 5 0%"50&!&*" !" )&* /"/ 0&2 0&+ * &*!1 "!50&!&*" !" )&* /" *! , + (&, + , . + 0"&* ) "!&0&*$ "*65)" 0 (50& , + (5, ", 0&!" "*65)"/ !" )&* 0"50+ /&*" /"/ &* 0+ *! 0%" ( . $". # )&(5 + # "*65)"/ % 2" ""* ,. + , + /"! 0+ "##"0 !")"0%5( 0&+ * 5 !" )&* 0&*$ ) *! %) &* 0+ 5&"(! 0%5)&*" *! %) . "/, "0&2"(5 / 0%"/" . " ,. "/"*0 &* )&/) 0 %"! *! %) /", &. / 0%"5 % 2" ""* ,. + , + /"! 0+ " "4 &/"! 5 /&*$(" /0. *! /"("0&2" )+ *+ #1* 0&+ * ( 1. &( $(5 + /5( /" +. %&/ )"% *&/) &/+ *0. + 2". /& ( %+ 3"2". /"" ) &* 0"40 | β 9 $(1 + /5( %5!. + 45)"0%5(1. &( &+ /5*0%"/&/ %" 0%5)&!&*" + 4&! 0&+ * /0", )"!& 0"! 5 &*!&*$ ,. + 0"&* +. 0+ ,. + !1 " %5!. + 451. &( %) &/ * (+ $+ 1/ 0+ 0%" ) + 4&! 0&+ * )"!& 0"! 5 ,. + 0"&*/ / . " 0%" #+ 1*!&*$ )")". / + # 0%" 7 /1, ". # )&(5 0%" ,. "!&0"! + 45$"* /" !+ ) &*/ + # *! 3". " 1/"! / 0%" /0 . 0&*$ , + &*0 #+ . 0%" /"-1"* " ,. + #&(" /" .%"/ 0% 0 . "+ 2". "! 0%" %+ )+ (+ $+ 1/ !+ ) &*/ + # 0%" 0%. "" ) )) (& * | "% *&/) 5 3%&% %)+ 1(! #&(&0 0" . ", (& 0&+ * !", "*!"*0 !")"0%5( 0&+ * /5))"0. & ((5 )"0%5( 0" ! , /"-1"* " &/+ *2". 0"! !1. &*$ . ", (& 0&+ * &*0+ 03+ /5))"0. & ((5 )"0%5( 0"! /0. *!/ ("#08 , *"( ")&)"0%5( 0"! , /&0"/ . " . "+ $*&6"! 5 0%" + (&$ 0" , . 0*". + # 0%" ) &*0"* * " )"0%5(0. */#". /" 3%&% . "/0+ . "/ /5))"0. & ( )"0%5( 0&+ * ,. + 0"&*/ 0 0 )"0%5( 0"! , /&0"/ 0+ $"*". 0" /5))"0. & ((5 %5!. + 45)"0%5( 0"! , /"-1"* "/ %) *! + 0%". + 4&6&!"! )"0%5( 50+ /&*"/ ) 5 &), &. ) &*0"* * " )"0%5( 0&+ * 5 &*%&&0&*$ &*!&*$ 0&2&05 +. + 0% . &$%0 , *"( / . "/1(0 0%" , /"-1"* " ,. + $. "//&2"(5 (+ /"/ )"0%5( 0&+ * 0%. + 1$% /1 "//&2" . ", (& 0&+ *5 ("/ n er sc u t l eCa eaC en e u al e C l 1i c C 1t ds ei u adet1d l etu adt0 c i C C ei C I ad e C OH N l tc tl e dC I ad ei Cs dβu ! c%Rel% x$% a ntl ei c l c e i en #tc # c aCi c l ntI n d ( d i u 1 CeuOH c el 0 i Ctc l e c" (#(,!W l ( $# O nCi u etc tl 1 c "% & " #( # # " ( ,! ( $# O OH c l Ct1eti c x c di R i : u %HNC i ac tc eC HO ner l e c tc " O dtc o ei 1d s l l Wu tc ds β # !)a#$$*'#,!(ei& #'en& ' l 1 t d c Ct nu c e i entl o s C I ad eti c I c i u t i : nu " %&$( # r es r v eo aaes , r c f n n u v er n r f" aaes , c n "s i e ( $# $# v n n r ueou eF g l n i o i ne r & r n al n h %! r w o u r na r oe%! n(er , O r n ooi eF g Bwl n i oOi ne OH r vBl , ne Bw i aeFi l n i o i ne r vB l , mBw vB , HN r Bw a eFi o i nHN e r vB , h c ae f nea 2. pPh "m " ael l l ei u ri C u W1i l ezeC c l d eti c d u i t t eti c l x n c tl u eaCc i ( C x c ec C F l l c et dds ( Cs s R nt n en dd c u i ad e c a d i l i u c toi WL8qZ% 0 tl ei c ddad C 1Ci l l C 9atCtc I l l Wtc da tc I 1C i u tc c eds I di ad C ) ac l eCa eaC 0 l eCtotc I eaC i ntl ei c l W c 1 Cet ad Cds i en tC e tdl Wtl en 1e i C en tC ll u d C c E8 tl ei c l u i t t eti c l eC c l Ct1eti c WC 1dt eti c | JUNE 2013 | VOLUME 14 C 1 tC0 %i tc en iC C ze Cu tc d vve tdl W jj R nt n C c eCi a eti c Rt ( Ct es i 1i l eeC c l d eti c du i t t eti c l en e t C c e ntl ei c C l t a l 0 deni aI n u i l e i en e Cu tc d i u tc Wl ( C d i en Cl n ( e Cu tc d i u tc x Ci 1 c C 1i Ce ntl ei c c CI CF c i ac c esCi l tc ns Ci ) sd eti c x c u i t t eti c l n CI l i ad c C i tc en z tc en z ln ( t C l t a l i c ntl ei c l Wtc da tc I esd eti c W 1Ci 1ti c sd eti c W aesCsd eti c W i Cu sd eti c W Ct i l sd eti c c en C s R nt n ntl ei c e tc en I di ad C c 1ni l 1ni Csd eti c W a t9atesd eti c W l au i sd eti c W tl i u Ctp eti c W C di nc t CWL8qZ% 0 ed l eqZ es1 l i e i ( C q: 8 t C c e u tc i u ensd eti c W l e d CI c au c eds tl i ( C WL8qq% 0 n C i c eCt ae ei teCaddtc eti c W 1Ci dtc dsl tc Ci ei c sd eti c C eR i oc i R c u n c tl u l nCi u etc C I ad eti c 0 tCl eWntl ei c tC eds u i ad e en 1 o I tc I i en s de Ctc I c e i en ntl ei c i C s de Ctc I tc e Czc a d i l i u d tc e C eti c l W tc I entl d l e i c l 1 t dds tu 1i Ce c e tc I di ad C c ec CF CI C F nc t CWL8qZ, c toi WL8qZ% 0 i c dsWntl ei c l 1 t t l x Ci 1 l C I ad e nCi u etc l eCa eaC tc tc I i u tc l WR nt n C i I c tp u i t t c ac eti c s C Catetc I ntl ei c l ( t l 1 t dtp l eCa eaC l x tI aC qE%x i ap Ct l WL88U% 0 Figure f a 1. pRRecruitment dv , el of Proteins r f to Histones ea n a e r n er e el l e a f v , F l c o e c aen r (A) Domains used for the recognition of methylated lysines, acetylated lysines, or phosphorylated serines. (B) Proteins found that associate preferef r ne n a c a r n l e a f r P r Rh c n ael ef g a m2. . 3h entially with modified versions of histone H3 and histone H4. Ci e tc lpathways en e Cneedi toI cbetpactivated l 1 tot observe d ntl eithec C that l t aacetylation l C of dH4K16 l l t thas atcnegative ei enCeffect es1 signaling on thel 2 modifications. In some cases, the specificity of enzymes formation of a 30-nanometer fiber and the generation ofs higher-order et ial., enthat modify i c l histones en e can C be i Iinfluenced c tp cby other l a factors: l 9a c ed u i t s structures en C l(Shogren-Knaak t a C oc R2006; c l complexes in which enzymes are found may specify also see Minireview by D. Trementhick, page 651 of this preference for nucleosomal RaCte Cl , en C l 1i cverses l t d free l histones i en(Lee t cissue). et t Phosphorylation ti c c isCanother u i ( modification u c e ithat may en et al., 2005a); proteins that associate with the enzyme well have important consequences for chromatin comaffect its selection of residue to modify (Metzger via charge changes. The role of this modification umay i t t eti c l C en C l Cl W tc dds en dpaction l e I Ci a1 C eni l 1Ci e tc l en e c et al., 2005) or the degree of methylation (mono-, di-, or has not been demonstrated rigorously in vitro but demontri-) at a specific site (Steward et al., 2006). strations of it’s role in mitosis, apoptosis, and gametogenC i I c tp l 1 t t C l t a xu i t t i C cesis i e% Wsuggestive tc ei oftesuchc a role)(Ahn C ettl al., en i Rc are 2005;tC Fischle Mechanisms of Histone Modification Function et al., 2005; Krishnamoorthy et al., 2006). ac l Wen l C mechanisms en l i z for ddthe C aC q:are%recruited x R l to i cmodifications WL8qL% 0 via Thereeti arectwo characterized function Cl x tI Proteins and bind of modifications. The first is the disruption of contacts specific domains (Figure 1A). Methylation is recognized between nucleosomes in order to ‘‘unravel’’ chromatin by chromo-like domains of the Royal family (chromo, and the second is the recruitment of nonhistone proteins. tudor, MBT) and nonrelated PHD domains, acetylation is The second function is the most characterized to date. recognized by bromodomains, and phosphorylation is Thus, depending on the composition of modifications recognized by a domain within 14-3-3 proteins. on a given histone, a set of proteins are encouraged to A number of proteins have been identified that are rebind or are occluded from chromatin. These proteins cruited to specific modifications (Figure 1B). The recent isolation of several proteins that recognize H3K4me has carry with them enzymatic activities (e.g., remodeling ATPases) that further modify chromatin. The need to highlighted the fact that their purpose is to tether enzyrecruit an ordered series of enzymatic activities comes matic activities onto chromatin. BPTF, a component of from the fact that the processes regulated by modificathe NURF chromatin-remodeling complex, recognizes tions (transcription, replication, repair) have several steps. H3K4me3 via a PHD domain. This recruitment tethers Each one of these steps may require a distinct type of the SNF2L ATPase to activate H0XC8 gene expression Eq chromatin-remodeling activity and a different set of (Wysocka et al., 2006; Figure 3A). The PHD-finger protein modifications to recruit them. Below is a more detailed ING2 tethers the repressive mSin3a-HDAC1 histone dedescription of the different mechanisms by which modifiacetylases complex to highly active, proliferation-specific c eCi a eti c ! ! &.&* ) * # % " ( & ' ! ! &.&* ) * # % " ( & ( * ! & &# . & * ) ( * ! & &# . & * ) +&$ " ") +&$ ' . & 21 , &. " , 3 " )" . & 21 , &. " , 3 % ! ! " ( * 0 ' * # " ( * 0 ' * # ( * ! & #& . & * ) ( * ! & #& . & * ) +&$ " ") +&$ . & 2" , - " , 3 " )" . & 2" , - " , 3 ! # ! " , / &.( " ) . " , / &.( " ) . +&$ " ") +&$ . & 2, " ! " , 3 " )" . & 2, " ! " , 3 '." , .&* ) * # '." , .&* ) * # . " ( +' . " ! + , * " - . " ( +' . " ! + , * " - - ! " ! ! " ! l ! f a & pB d ! $r ! c $ r n " ! % ! & ! $ ! $ " ! & % m ean ! a f ! o n! ea r !n a & % ! ! # aef! c y s a! n a m a! a ! r # ! ! ! ! a ! ! a h c& % n& % ! ael!! ! ! % ! s& % ! &er! m # # # m2.! p2h ! ! ! # ! ! ! ! ! $ ! & ! ! ! $ ! & ! ! & ! # ! ! ! & ! # ! ! ! ! ! ! ! & ! ' ! ! ! & ! ' ! ! ! ! ! ! & ! !$ ! ! ! ! & ! !$ " ! ! ! ! $ ! # " ! ! ! ! $ ! % # " ! # ! ! ! ! % # " ! # ! ! ! ! " ! ! ! ! " ! ! ! ! ! ! ! ! " ! % ! % $ ! " ! % ! % $ ! $ ! ! % ! % ! $ ! ! % ! % % ! $ % ! $ ! ! ! ! !" ! ! ! ! ! ! !" ! ! ! ! " & ! ! " & . 3 .! 3+ 8! + 8 31 8/31 38/. / 3' . / -' : / - 1 : ./ + (1 . $ + (-,$ .,3(% . 3(% (& (& 6 ' 6 $ -' $ 3'- $ 3' 2$ ,2 $ , + 82($ 1 $ 2(# 4$ 4# $ 1 & . $ 2 $ + 82(- $ 1 $ 2(# 4$ 4- # $ 1 & . $ 2 . 3'- .$ 3'1 $ 1 , .,# (%. # (" (% 3(. 24" ' ' 2 "2$ 38+" $ 38+3(. -3(. (3 (" 3(. - 24" - ,(3 ,8 3' 8$ 3'- $ / -1 ./ 1 . 5 (# 5 $ (# # $ . " # * . (-" * & (-2(3$ 2 % . 1 . 3' $ 1 / 1 . 3$ & 2(3$ 2 % . 1 . 3' $ 1 / 1 .(-3$ 2(-" 2. -" 3. -(-3 (-(-& (- & iu l C tc i u 1 et d R ten i en Cl Wi i aCl " $eni l en e u i t s en l 2u24" 38+ : + 82($ ! ' ' 2 ! 21 .! ,1 .., . " $ 38+ : + 82(- $ (-! # (-(-# & (-# & . ,# . ,(- 2(- 24" " # . , (2 (+ + 8 3. # # 3. 3' $ " 3. 3' " $ . ," ./ ,+ $ / 7 + (38 $ 7 (38 c a d i et C u aea " dds ) dal t( W" ae i en Cl C , # -d.l8,i " ' (-1 .)2, dal t(1 (-$ & 4++ + 8a3. 3.1 2 ei' # 5# $ 1aC 3(" " , - 8 " ' 1 . , 3(- 1 $ & 4+ 3. 1 2 ' 5 ,$ .,1 $ . 1 3'$ 3'- .- - $ . - $ $ 3'(1 $ (1" ' 1 " .' ,1 . ,3(- 3(# $ # 1 l. i,# u . ,(- (- -l# -l# 3' en 1nsl t d ddi l e" Ct tc e C eti c l , l i u i en C l 38/ i 38/$ ) tl.$ e% . 1 % $ c 1 # $ $ 1tc " ! (# (& " ! $ % 41 3' $ 1 (% + 4$ " $ # ! % ! (- # (- & " - ! $ % 41 3' $ 1 (- % + 4$ - " $ # 8 ! - 8$ (&- $ ' (&! .' 1 ! (-. 1 & (- & % ' (23. -d $ tl-, $nu .,# (%. # ("c(% e("3(.i -3(.2 -c2. " + "+ C $ # + i+ $ ,c# 4+, 0 3(54+ 3(5+ $ - + 3$ -$ -3 $ 1i l teti c i l 1 t t u i t t eti c c n c l en l e' (23. 2i en 2. & & & $ ,& $ $ ,- 3$ .- % 3' . (23 . $ , . # (% (" 3(. 2 % ' (23. - $ , . # (% (" 3(. - 2 ' $ 2$' $ 2$$ 7 $ ,7 , dd en l tc e C eti c l C oc i R c l ntl ei c u i t t/ + $ / 2eti '+ $ 2(&c' ' (&+ (& 'Ci' + (&3l ' 3'l 3ze $ 3' , $ do 4+, 3(%x4+ 3(%tI " $ 3aC $ ," ' $ " -' (2,- (2, 2 3'2 3'3 3 " $ $ # 3$,# q/% " ' 1 . , 3(1 $ # $ 1 2 42$ 3 . # $ " (/ ' $ 1 3' $ (31 npg " ' 10 . , 3(- 1 $ # $ 1 2 42$ 3. # $ " (/ ' $ 1 3' $ (-(" 31 ("3$ 3$ c x ctl e CF i ap Ct l WL8qq, aen c aCI WL88U% $ / (& $ ' " 1 ' " 1 3$ "1 (93$ $ 1 (9# $ / # 1 ./ 1 . $ / (& $ $ 3("- $ 3("+ - + # 2"- # 2"/ $ / $ ' $ ' ! $ $ 23 ! $ " 23 388 3$ (-3$ ! (-(-! # (-(-# & (- / & . " / * . $ " 32 " . 3 ($ # (- (-" ' 1 " .' ,1 . , * $ 32 " . - 3 (- $ 6 # (3'6 (3' 3(- 3(-22. 22. " ( 3" $ (# 3$/ # 1 ./ 31$ .(-3$2(- 12$ 24, , 1 (9 $ # 1 $ 24, , 1 (9 $ (-# (-(& (& ' $ ' (,$ /(,. 1 / 3. 1 -3" $ - ". $ % ". ' % 1 " .' ,1 . ,3(- 3(1 $ 1 # $ $ 1 # # $ 1 . ,# . ,(- 2(- 2 " (- ,(- ,(- 3(-(-3(-(-& (-' & . ,' .$ ,. 23 2(2 6 2 (+ + 8 + 1 + $ 85 1 $ $ 5 + $ $ # + $ # " $ . 23 2(2 6 2(3( (- (3( (- (-3' $ 3' 2$$ ,2$ (-, (-+ . + ! 2$. ! 1 2$5 1 3(. 3' 3 , 43 3(. 3(. - 2 -(-2 (5 3(. - 3' 3 , 43 3' $ 3' $ % (- % & (-$ 1 & $ . 1 % . % ! 1 .! & 1 . 3$& 3$3' $ 3' / $ 1 ./ 3$1 .(-3$ 2(- 2 $ 7 (232 ! 8 ! 5 (18 34$ $ 1 $ $ 2(#1 $ 2(# 4$ 4$ ! (+ (38 3. 3. ! (-! # (-31# (,31 $(,3' $ 8+3' 8+3$ # 3$ # 1 $ # 1 4"$ # $ 4" $ $ 7 (232 5 (1 34$. % 3'. % $ 3' % $ " % 3 3'" 3 3'3 $ 3" $ ' " + 82(' + 82(! (+ (38 , ,8 ! 8$ ! 4-$ ,4-$ ,3' $ 8+3' 38+$ # 3$ ,# .,- .. ,- .$ ,3' $ 8+3' 38+$ # 3$ # # (, # $ (,3' $ 8+3' 8+ 1 $ " 1 .$ ," .! ,(-! (-3(. -3(. -(- (-6 ' 6 (" ' ' (" 5 ' 1 5 ( !1 (+ $ ! + $ # (5 # $ 1(5 2$$ 1 2$ - # - # 3$ # 3$ .# 1 .31 1 (,31 $ (,3' $ 8+3' 38+$ # 3$ # . 1 .(-1 23 - " $ - " 3'$ $ 3' / $ + / - + 3 -' 3. ' . ). (-).(-(-& (-& & $ -& $ $ -2$$ & 2$, & $ ,- 32 (- 23 $ - 321 $ 11 $ -1 # .- ,# .+ ,8 " + 8. ," .! ,(-! $ (-# $ # , $ ,. # $ .. ,# . ,(- (% (- %& (-$ 1 & $ (2 1 $ & (. 6 (3' (# 1 $ 24+ 3 ((, , 4. # # 1 .# ,1 .$ ,2 $ 2 4 4 1 (2 1 $ & (. - 6 (3' (- # 1 $ 24+ 3 (- (, , 4- $ .% # (" $ ($% ("- ($" 8- "288 28/ 1 ./ 31$ .(-3$ (-3' 3'3 (23 (2 " / " ! / + $ ! + .$ % .# % $ 3# $ $ " 33(1 $ 1 # $ (-# & (-" & " $ " &3(- ,& $ ,3' $ 8+3' 38+$ # 3$ # 3 3(.3 -3(.2 -3'2 3'3 3! 1 .! & 1 . 3$& 3$3' $ 3' " $ ' 1 " .' ,1 . ,3(- 3(' (23 . $ 2 ' $ % (& $ 1 2 . % 3' $ / 1 . 3$ (2 / " (38 . % , 8 $ / (& $ $ 3(" 1 $ & 4+ 3. 1 2 ' (23. - $ 2 ' $ % (- & $ 1 2 . % 3' $ / 1 . 3$ (- 2 / " (38 . % , - 8 $ / (& $ - $ 3(" 1 $ & 4+ 3. 1/ 2+ / 8+ 8- (-- (-# -# / 1 $ / % $1 $ 1 $% $ -1 3($ - + 3(+ 8 + + ! 8(-! # (- 4, $ 3' 8+ 3 $ # % + 4$ . % .# % (2$# (2$2$ 22$ (# 4- , $ 3' 8+ 3$ # % + -4$3(- +3(1 .+ + 1$ . (+ $ (- 5 1 5 ($ 38 1 ($ 38 2 " (-+ 4#" + (4# & (- & 6 ' $ 1 $ 2 3' $ % (& $ 1 . % + 82($ 1 $ 2(# 4$ 2 2(& 3' $ 2$ " ' 1 . , 3(1 $ # $ 1 , . # 4+ " " $ 1 + 82(- $ 1 $ 2(# 4$ 2 6 ' $ 1 $ 2 3' $ % (- & $ 1 . % " - " $ 1 2(- & 3' $ 2$ " ' 1 . , 3(- 1 $ # $ 1 , . # $ 4+2 $ 2 ! (-! # (-2 # ,2.,23. 235 (# 5 + 8(# 3+ .8 3# . (, # $ (,3' $ 8+3' 38+$ # 3$ # - # -31# ( 31 ( 2 3' 2$ 3'1 $ / 1 $ 43(" / $ 43("3 1 3& $ 1 32 & $ ,32 ,8 . 8% % .$ %1 % $ 1 4- (04$ 4- (04$. / / . ./ 1 / . 1 3' $ 1 2(, (+ 1 , $ 3' 8+ : + 8 , $ ,3' $ 8+3' 38+$ # 3$+ #82($ 2 34(38 3. 3 (+ . 1 3' $ 1 / ($ 2 3. 2/ $ " (% (" # + 82(- $ 2 3' $ 1 2(, (+ 1 , $ 3' 8+ : + 8 34- (38 3. 3 (+ . 1 3' $ 1 / ($ 2 3. 2/ $ " (% (" (2$# (2$2$ 22$ 2- Figure 2 2($ 1 $ " . & (3(. , . 3(% 2 $ 7 (23 (- " + 4#n & " 1" . ,1 . . $ 7 $ $ ,7 / , + . % n.3'u% (2 / 1 . " $ 22 ' 2 1 $ " $ - 3+ -83+! 8$ $ ! -$ $ / -1 ./ 1 . 2($ " .& -(3(. - , . 3(% 2 (23 " + (4# (& e' ' ,n .er / 1 e + (2 22 f a p0 d ner l$ 1 e er ae n o7 Ch er l c o3'i ea/ r1 . " $ n u ' oi 2 1 $ " $ n n w $ ( $ r 1 [53] # . , (2 34# . 1 # . , (2 # 3' $ # . , (5 (# $ # 6 (3' 2, + + , . + $ " 4+ $ 2 3' en a l e n er n u. 1 # . , n (- 2r - # 3'n $ i r # aaes $ r2 3'3 2/ 3 n$ 2/" (%$ ("" (% ("+ + 8 + + 8- # - # # . ,h (-c e 2 34# . , (- 5 (# r$ # 6 r(3' 2,n u + + , . + $ n" 4+ , $ # % . 1 (32 " ' 1 " 3$ 1 (23(" / 1 . + ($ : 31 8/ 3 . / ' : 5 (# + 8 (' (! (3 3' $ 3 # $ , ! 1 . , . # i on h -cn , $ # ael % . 1 (32 " r' r 1 n" 3$a |1 (23("ef / g1 .a+ (- $ : m 312.8/ pph 3. / ' - : 5 (# + 8 (- ' (! (3 3' $ 3 - # $ , ! 1 . , .. ,# . ,(- 2(-. 2% .3' % $ 3' $ of binding of many chromatin prointeraction is stronger when H3K9 and H3K14 are also n ac eti c i u i l entl ei c l l analysing etddC u thetcpattern l ac oc i R c Wdeni aI n en Ci d en e teins [84]. However, given that most is known about the acetylated on the same tail of H3 [60]. However, this staNewsimple England Journal of Medicineabove, references below domains described bilization of binding may be due to additional factors in Thetwo The New England Journal of Medicine l i) u(% i from en u 1d tc d d jl% ti diIDE s DE tl( ee C-ac Cl ei% i26,!% 0 d Z ! l au Ctp l enuses without permission. Downloaded nejm.org atsCRAI UNIVERSITAT BARCELONA on November 2013. For personal useuonly. No other % !% $ ( *" $! ! only. $ ! " # % # % # % ! Downloaded from nejm.org at CRAI UNIVERSITAT BARCELONA on November 26, 2013. For personal use No other uses without permission. Copyright © 2012 Massachusetts Medical Society. All rights reserved. Copyright © 2012Both Massachusetts Medical Society. All rights reserved. heterochromatin and euchromatin are enriched, itself. Ci d i en eoc i modiR c ntl ei l 0depleted, of certain characteristic histone andcindeed also There ac may eti alsocbed cooperation betweenlhistone - % !$ % * % ! ! # $% % modifications. However, there appears to be no simple rules governing the localization of such modifications, protein binds to nucleosomes bearing H3K9me3, but this $ $ % * (% & !$ ! and there is a high degree of overlap between different chromatin regions. Nevertheless, there are regions of DNA isEL CpG methylated [61]. Conversely, DNA methydemarcation between heterochromatin and euchromatin. lation can inhibit protein binding to specific histone $ +!&# * $% , # !&* $" - % !# $ ! - % ! $ !! )" # $ ( such as CTCF that play a role in maintaining the boundonly binds to nucleosomes bearing H3K9me3 when the c eCi a eti c Table 1. Different Classes of Modifications Identified on Histones Chromatin Modifications Residues Modified Functions Regulated Acetylation K-ac Transcription, Repair, Replication, Condensation Methylation (lysines) K-me1 K-me2 K-me3 Transcription, Repair Methylation (arginines) R-me1 R-me2a R-me2s Transcription Phosphorylation S-ph T-ph Transcription, Repair, Condensation Ubiquitylation K-ub Transcription, Repair Sumoylation K-su Transcription ADP ribosylation E-ar Transcription Deimination R > Cit Transcription Proline Isomerization P-cis > P-trans Transcription Overview of different classes of modification identified on histones. The functions that have been associated with each modification are shown. Each modification is discussed in detail in the text under the heading of the function it regulates. o Pd el r r n a | e n l ea nf ef g a m2. pph r n a a f o neai f r n er e n h cn ael a protein has to be digested before such analysis can take for the biological response. However we know that many place limits its potential. New methodology that uses of the histone-modifying enzymes have other nonhistone ei c proteomics l approach C c i e(identify protein l 9a tc 1 cSo the c eW C mayc ebe 1a eti c atltop-down first c substrates. response goingdt through and digest subsequently) gives promise that we may, in another unidentified protein substrate. Furthermore, there i c l look eC eat the intact en emodification ntl ei c pattern u i oft t adsignaling redundancy e such s that l i umoreIthan c one et theufuture, differ-eti c l mayi be ent histones in a given nucleosome (Macek et al., 2006). enzyme may be capable of modifying a specific site. In ( Once Ct c el x analysis t o ofCall histone WL8qZ% WR nt c i entheCeffects ) uof 1d i enone enzyme 1 Cu may c be ce global modifications is n tlthis case, inactivating done, a prediction would be that every single nucleosome masked by an upregulation in the activity of a second would Ci l l be zefound do to be eRmodified c I incsome et way. l cThis picture 1tI isc et distinct l 0 but related enzyme. Showing that mutation of of course very static. The truth is that modifications on histhe modified residue gives the same output as mutating tones are dynamic and rapidly changing. Acetylation, the enzyme is a second stringent test. However, this is methylation, phosphorylation, and deimination can not possible in humans due to many histone genes appear present in the genome, but it is possible in yeast. nerand udisappear a r n on chromatin within minutes of stimulus arriving at the cell surface. Thus examining bulk So the truth is that we have ‘‘levels of confidence’’ histones under one specific set of conditions (with either regarding the causative nature of different modifications 5antibodies c i c t or d;mass ntl ei c I c l C i ac tc daldepending e C Con1how el WR n C l i en C ntl ei c spectrometry) will identify only a far the analysis has gone to prove the proportion of the possible modifications. issue. We also have to be realistic and accept that, howI There c lW enalsol iproblems z dd of ntl ei c that( are Ctspecific c el W C ever es1tfar we ddsgo iinac I d modification i 1s I cis are detection proving lthat al tc histone for antibodies. Firstly, there are the obvious issues of causative, we can never exclude the possibility that xspecificity. u o These o Fare difficult tI I tctol W L88: % 0 are n no tl l tumodification td Ctes of other eR substrates c en byu theri same C ntlenzyme ei c avoid as there true controls for modifications in mammalian cells (unlike will play a parallel role in the biological response being l yeast) a es1 l it cis impossible en ( toCtmutate c el thei ad Ci u Rmanyuother tc i nonhistone t l eisubstrates d CIof where residueCtoc I monitored. The make sure reactivity is lost. In addition, an adjacent chromatin-modifying enzymes are not covered in this modification binding or CsiReview. t( CI c mayxedisrupt d the E% 0 i u of the i antibody en ao et ntl ei c ( Ct c el Wl a n l z W a protein may occlude its recognition, both of which may give a false Z0ZW L reading. 0 i CSimilarly, L 0 there W Care problems du i l e of ac t( Histone-Modifying Cl dds i c l C(Enzymes enCi aI n ao Csi et detection that are specific to mass spectrometry. Peptide The identification of the enzymes that direct modification coverage for all parts the L8q8% histone and has been the focus of intense activity over the last 10 years ( i daetiiscnotx equivalent d CeF c toiof W 0 this reduces the sensitivity of detection in these regions. (Table 2). Enzymes have been identified for acetylation These facts undoubtedly contribute to our underestima(Sterner and Berger, 2000), methylation (Zhang and Reinl 1te i c l C( Ci d i ntl ei c l l I c Cd 1 o I tc I I c el Wte tl c i R tion of the extent of modifications present on histones. berg, 2006), phosphorylation (Nowak and Corces, 2004), We assume that each individual modification on hisubiquitination (Shilatifard, 2006), sumoylation (Nathan d Cleads en toe a biological c i en Cconsequence. o s ac However eti c iproof en l et al., 1Ci2006), e tcADP-ribosylation l tl ei i c(Hassa C et ( al., Ct2006), eti cdeimil tc tones of a consequence is not always easy to provide and is nation (Cuthbert et al., 2004; Wang et al., 2004b), and pronCi ubasedetcon laeCa eaC aeimodification c l aC appears sc uont 1 line ee isomerization Cc l i eC(Nelson c l Ct1eti c dC I ad eti c tc often correlation: et al., 2006). a gene under certain conditions (e.g., when it is tranMost modifications have been found to be dynamic, ao Csiand e ldisappears x p when that state W L8qE% 0 n tcand i C1i C etithat c remove i ntl c ( Cthave c elbeentl scribed) is reversed enzymes theeimodification (e.g., when the gene is silent). Proving causality for a identified. One major exception is methylation of involves showing catalytic although they 1modification Cet ad Cd s tu 1i Ce c that e ei the1Ci l l activity l l a n arginines: l C 1 tCW u areti thought et C toi ube dynamic, tc eti ca W of the enzyme that mediates the modification is necessary demethylating activity has not yet been found. Instead nCi u i l i u l I C I eti c W eC c l Ct1eti c 694 Cell 128, 693–705, February 23, 2007 ª2007 Elsevier Inc. nCi u i l i u tc ic c l eti c CI WL88ó% 0 c c l 1 Cu d E li u tc tet eti c c e Cu tc eti c W l ) nCi u etc 1 o I tc I x u 1i l F i en l ac eti c l C C de ei en i CC l 1i c tc I ( Ct c e0 EZ c eCi a eti c %& /) < " ! " ,427+,2766,)+)120 ) 24),-5621) " ,427+,2766,)+)120 ) 4)3%-4 0 )( -%6)( & :6,) 3,253,24:/%6)( *240 γ " %1( +)120 )-16)+4-6: $ ,427+,2766,)+)120 ) )1)%'6-8 %6-21 +)1) 5-/)1'-1+%1( ',420 2520 ) 5)+4)+%6-21 %'42 255-& /: &( 1%'6-8 )" ',420 2520 ) )1)5-/)1'-1+ '6-8 )" ',420 2520 ) %1( )7',420 %6-1 '6-8 )64%15'4-36-21 ,427+,2766,)+)120 ) ! %/)-1*)46-/-6: 6,%6-5 ( )*)'65 -1 53)40 0 )-25-5 -1 0 -') 0 & 4:21-' /)6,%/-6:-1 $ .12'.2760 -')%6 = 4%-1 0 %/*240 %6-21 -1 ;)& 4%*-5, = 24),-5621) 255-& /: ,427+,2766,)53)40 ,420 %6-1 62 +)120 )%1( -1 6)/20 )4)5 17'/)23426%0 -1)64%15-6-21 2*520 %6-' ')//5 255-& /: 4-0 %6)6)/20 )4)5-1 53)40 %56,)4)-512 +)1) 342( 7'6-1 0 -') ,427+,2766,)+)120 ) 2*2/*%'624:1)74215 8 )4)934)55-21 2*2/*%'624: 4)')3624 -1 0 -') %1( ,427+,2766,)+)120 ) 24),-5621) ,427+,2766,)+)120 ) 24),-5621) ,427+,2766,)+)120 ) )1)%'6-8 %6-21 5-/)1'-1+%1( ',420 2520 )5)+4)+%6-21 %( 7/6-1*)46-/-6:-1 +)1) 64%3 %1( .12'.2760 -') = 3)40 +)120 )%1( 17'/)2/752*520 %6-' ')//5 255-& /: " %1( # 2*)%', 7',420 %6-1 -1 ,20 -1-( 6)56-5 255-& /: %56,)4)-512 +)1) 342( 7'6-1 0 -') 7',420 %6-1 -1 34-0 %6)5 )16420 )4)5 ,420 2520 )5)+4)+%6-21 ,427+,2766,)+)120 ) ,-5621) /-.)')16420 )4-' 3426)-1 4)3/-'%6-21 -1( )3)1( )16 o R d ea m 2. pRh ner u a r n )0 & 4:21-' ( %: nf a %56,)4)-512 +)1) 342( 7'6-1 0 -') ! 0 & 4:21-' /)6,%/-6:%6 = -1 0 -') 24),-5621) ,-5621) r u an a n 6:3)! 126( )6)40 -1)( u oec l r nh 4)3/-'%6-21 ( )3)1( )16 c ae f ael g Therefore, enhanced dynamicity of nucleosomes that In addition to testis-specific variants, somatic hiscontain testis-specific histone variants may be required tone variants have been shown to be involved in meiosis for appropriate chromatin reorganization during sper- when the X and Y chromosomes condense together to matogenesis. With the exception of recent evidence21 form XY bodies. These XY bodies are transcriptionthat shows a specific role for the H2B variant TSH2B in ally silenced through a process known as meiotic sex eoi el r achromatin-to-nucleoprotamine n ea F el c o F transitions, functional chromosome inactivation (MSCI) and are considered roles for most variants during mammalian spermato- to be recombinantly inactive, thus protecting sex chroi ds i u c Cteni ) Cthose 1Ciof etheir tc biophysical i u 1d properties ) l tl 1d stc I from i 11i l te ac eti events, c l 0 which are genesisCbeyond mosomes illicit recombination remain unknown. However, an increasing amount hallmarks of active meiosis. The XY body is enriched in i ds i u R l tClofed s l indicates Ct tc active incorporation of specific H2AW R n C(including i dsmacroH2A iu evidence that variants (mH2A)24 25 these variants might directly affect transcription. For and H2A.X ) and H3.3 (REF. 26). The phosphorylated depletion u ae c e dt l ( dexample, i 1 c i Cu d iof H2A.Bbd s l I uresults c elin widespread ae tc en form R CiofcH2A.X I 1d(γH2A.X) W i Calso)hasua crucial 1d Wrole in male reduction in basal gene expression and disruptions germ cells, as H2A.X-null and transgenic mice fail to properly l i u i en u ae ctoelalternative ( dsplicing i 1 1n22. Furthermore, c i es1 l lhuman a n cells l in ad e c tuformdlXYRbodies ten dand I l undergo tc en MSCI, which which H2A.Bbd has been ectopically expressed show an results in male sterility 27. Another variant, H2A.Z, is also Canonical histones variant throughout active regions of enriched at heterochromatin domains of postmeiotic 1d i histones c eof a c c enrichment x c c tlfori this cW qóó: % 0 n l u d i Cu eti c l C a ei CC c e Archetypical the genome22,23, which collectively indicates a putative haploid spermatids, including at the sex chromosomes28, given family to which all other this testis-specific variant in the regulation of although its functional role during spermatogenesis of that same Ihistone c proteinset( eti c irole c lfor 9a c i en u ae eti c tc en remains i ds unknown. iu i u 1d ) x % gene expression. family are compared. I c l Wl NATURE REVIEWS | et( eC c l Ct1eti c dds tc i ds i u l Cteni C ) I Ci a1 x C) % WR nt n i ac e C e en et( etc I I c EE t c et t nCi u etc tc ADVANCE ONLINE PUBLICATION | et( i Cvi j l e e x tddl WL8q8% 0 e Ci c WI c et l ea t l tc oc i R c l 1Ci e tc l u s td ei o 1 i c I Ci a1 i 1Ci e tc l W eti c i ) 1C l l ti c tc ni u i et I c l x tu i c Wqóó: % 0 i u 1d ) W c eCi a eti c $)*3 - B >1 5/C: :)9 + 64 ) *9 -):; 69 )3 # 0-7); 6+ -3 3 <3 )9 + )5+ -9 79 6:; ); - + )9 +1 564 ) 4 -3 )564 ) + )5+ -9 )5, -5,64 -; 9 1 )3 + )5+ -9 !" # & 9 -7-); : "-8<1 9 -, .69 ; 0- $ )+ ; 1 = 1 ; @ 6. ( ( ( )5, ( #$ $ -:; )*3 1 :0-: 4 - 4 )9 2 #%( #%( (1 5+ .1 5/-9 "-8<1 9 -, .69 ; 0- $ )+ ; 1 = 1 ; @ 6. ( %" "! )5, "! 1 :; 65- *1 5,1 5/ 69 4 : 41 51 4 )3 5<+ 3 -6:64 - *1 5,1 5/ 4 6,<3 - >1 ; 0 #%( !" ! ' ' )5, ' 09 64 6,64 )1 5 1 5,: 4 - 4 )9 2 -:670)/-)3 + )5+ -9 4 -,<3 3 6*3 ):; 64 ) 3 -<2)-4 1 ) 3 @ 4 7064 ) 5-<9 6*3 ):; 64 ) 0-7); 6+ -3 3 <3 )9 *3 ),,-9 + )9 +1 564 ) ):; 9 6+ @ ; 64 ) )5, + )5+ -9 79 6:; ); - + )5+ -9 ! ! ! )5, ! (1 5+ .1 5/-9 )5, #! "-8<1 9 -, .69 :1 3 -5+ 1 5/ " " )5, " " A 1 5+ .1 5/-9 %*1 8<1 ; 1 5 3 1 /):- !# ! )5, ( (1 5+ .1 5/-9 !9 6; -1 5D79 6; -1 5 1 5; -9 )+ ; 1 65 $"' )5, #$ )5, $ 0662 E $ -:; )*3 1 :0-: -<2)-4 1 )D 4 - 4 )9 2 )5, *1 5,1 5/ # # #$ $ -:; )*3 1 :0-: 4 - 4 )9 2 # # & " & 9 -7-); : ::-5; 1 )3 .69 4 - )5, E E E E " "0)*,61 , ; <4 6<9 :D 3 <5/ D 69 )3 + )5+ -9 + )5+ -9 #& D# 3 1 2- 0-3 1 + ):- $! ):- )+ ; 1 = 1 ; @ /):; 9 1 + + )5+ -9 # :21 5 + )5+ -9 9 64 6,64 )1 5 1 5,: )+ -; @ 3 ); -, 01 :; 65-: )5, " #" E E #" # " )5, " E 65 + ); )3 @ ; 1 + + 69 - :<*<51 ; E#& E#" #$ )5, 1 :; 65- *1 5,1 5/ )5, #& D# 3 1 2- 0-3 1 + ):- $! ):- )+ ; 1 = 1 ; @ %" !$ ! A 1 5+ .1 5/-9 )5, *9 64 6,64 )1 5 1 5,: 4 - )5, *1 5,: )+ -; @ 3 ); -, 01 :; 65-: %" "! )5, "! E E E )5, 09 64 6,64 )1 5 )5, E$! ):- )+ ; 1 = 1 ; @ #& D# 3 1 2- 0-3 1 + ):- )5, 09 64 6,64 )1 5 E$! ):- )+ ; 1 = 1 ; @ #& D# 3 1 2- 0-3 1 + ):- )5, ! A 1 5+ .1 5/-9 # 09 64 6,64 )1 5 E$! ):- )+ ; 1 = 1 ; @ )5, #& D# 3 1 2- 0-3 1 + ):- )5, ! A 1 5+ .1 5/-9 # 9 -3 ); -, #& D# # " )5, " " #& " E E 3 1 64 ) 5-<9 6*3 ):; 64 ) D 4 -3 )564 ) 4 -51 51 /1 64 ) D 70-6+ 09 64 6+ @ ; 64 ) 63 1 /6,-5,9 6/3 1 64 ) D 565 6,/21 5C: $ ; 0@ 9 61 , 3 @ 4 7064 ) + 63 65 + )5+ -9 + )5+ -9 *9 -):; + -9 = 1 + )3 + )5+ -9 D )5, 6= )9 1 )5 + )5+ -9 + )5+ -9 " $91 + 0 1 5; -9 )+ ; 1 = - ,64 )1 5 # )*:-5; :4 )3 3 69 064 -6; 1 + ' + 09 64 6*6? 064 63 6/<- + 09 64 6,64 )1 5 0-3 1 + ):- *1 5,1 5/ + 09 651 + 4@ -3 61 , 3 -<2) -4 B 1 ) -4 *9@6 51 + -+ a ; 6,-94 , -3 674 -5; ( -50) 5+ -9 6. A -: 064 63 6/<- 06: ; +ea -3 3 .)+F; 69 $ -; ; # 0-), o5-+ d)4 r n c-= an r a e4 <3 n eo i ;- el r a n3 caen r01:;65- el4-6: c0@ o3 F9)95: .-9):- u c69 )5, 2 :8< 6<: + -3 3 + )9 +1 564 ) # 21 :4 -; ; 1 73 - -5,6+ 91 5- 5-673 ):1 ) 41 ? -, 1 5-)/- 3 -<2)-4 1 ) %" 5<+ 3 64 - -4 6,-3 3 1 5/ .)+ ; ! c aec n e @+ n64 * F @0 r64 -6; l 1+ C n @0 f64n-6;1+o r)5; n f r-6, n64er)15 h!" c ae ael o ! m2. 763 @+6 4an * !+ 763 /el 9 6<7c !o 763 ! 763 064ea 63 6/<- ! a 73 064 763 @+6 4f* 9 -79 -::1 = - + 64 73 -? o " p. h 9 -; 1 56*3 ):; 64 ) *1 5,1 5/ 79 6; -1 5 # :8<)4 6<: + -3 3 + )9 +1 564 ) #%( :<779 -::69 6. A -:; - 064 63 6/<- #! $ $ + -3 3 )+ <; - 3 @ 4 706*3 ):; 1 + 3 -<2)-4 1 ) $9? ; 91 ; 069 )? /9 6 <7 & " & 9 -7-); ,64 )1 5 tc en c te R l ) e c l t( ds 1Ci ( en e i en i u 1d ) l R i Co ei I en C ei | CNATURE I adREVIEWS e nCi u etc sc u t l c I c ) 1C l l ti c Wl R dd l © 2010 Macmillan Publishers Limited. All rights reserved dd ddad C 1Ci l l l x Ci o F c Cteni C ) I Ci a1 C ntI nds sc u t en e l l tI c l 1 t d eaC l ei en i en I Ci a1l u i ad e de Ctc I ntl ei c c u ensd etc I i natp c WL88q% 0 n c c i u 1d ) x nCi u etc x tc e I C e iCu C ddad Cu u i CsWtc i ds i u c en s t C c e 1Ci e tc l d :% 0 l Wn c I tc I en 1i l teti c i C en x na ee c I Ca VOLUME 10 | O CTOBER 2010 | t e lli t e 1Ci e tc l % s i u 1i l teti c i c a d i l i u l WL8qq, tu i c F tc I l ei c WL88ó% 0 E: Introduction RNA epigenetics, brave new world Protein-­‐coding genes represent about 1% of the mammalian genome (Harrow et al., 2009), although up to 70 to 80% of the human genome may be transcribed at some point (Djebali et al., 2012). Those transcripts that do not codify for proteins are known as non-­‐coding RNAs (ncRNAs) and have been demonstrated to be extremely relevant in epigenetic regulation in a myriad of physiological and disease circumstances (Esteller, 2011). Within ncRNA family there is a number of different subfamilies such as transfer RNA (tRNA), ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), micro RNA (miRNA), small nuclear RNA (snRNA), extracellular RNA (exRNA), piwi-­‐interacting RNA (piRNA) and long ncRNA (lncRNA). In the last decade, micro RNAs and long non-­‐coding RNAs have gained relevance as major epigenetic regulators. miRNAs are a large family of post-­‐transcriptional regulators of gene expression that are ~21 nucleotides in length and control many developmental and cellular processes in eukaryotic organisms. Drosha and Dicer complexes process pre-­‐miRNA to miRNA, which are exported to the cytoplasm, and form a protein-­‐miRNA complex called miRISC. The complex is guided to the target mRNA by miRNA sequence homology and induces its translational repression by deadenylation and degradation of the mRNA. In mammals, miRNAs are predicted to control the activity of ~50% of all protein-­‐ coding genes (Krol et al., 2010). Long non-­‐coding RNAs must have at least 100 nucleotides in length. The first lncRNA discovered in mammals was the X-­‐inactive-­‐specific transcript (XIST) (Brown et al., 1992). The Xist gene is expressed in the female X inactive chromosome (Xi), and produces a 17 to 20 kbs RNA that coats the Xi and in cooperation with the Polycomb Repressive Complex 2 (PRC2) complex triggers chromosome silencing (Lee, 2012; Wutz, 2011). Another well-­‐studied lncRNA is HOTAIR (HOX antisense intergenic RNA), localized in chromosome 12 within the homeobox C (HOXC) gene cluster. HOTAIR transcript is about 2.2 Kbs, it is co-­‐ expressed with HOXC genes and participates in the downregulation of various genes all along the genome, such as the HOXD gene cluster present in chromosome 2 (Tsai et al., 2010). In vitro studies demonstrated that HOTAIR 46 Introduction interacts with various chromatin-­‐modifying enzymes, like PRC2 (Greer and Shi, 2012; Tsai et al., 2010). These are just two examples of lncRNA regulation, but there are some other examples and presumably many more to be discovered. In fact, the ENCODE project revealed that in average there are approximately 10 transcripts overlapping any previously annotated gene (Djebali et al., 2012). Chromatin conformation, entering in the third-­dimension The spatial organization of the genome is closely linked to its biological function, yet the understanding of higher order genomic structure is still poorly understood. In the nucleus of eukaryotic cells, interphase chromosomes occupy distinct chromosome territories (Cremer & Cremer, 2010; Pennisi, 2011). Nowadays it is known that the location of these territories has functional implications. For example, it is known that the DNA bound to the nuclear lamina is completely silenced and this type of chromatin has been called “black chromatin” in D.melanogaster (Steensel, 2011). It is also described that these domains are highly dynamic during mammals cell differentiation (Peric-­‐Hupkes et al., 2010). In the last decade the field has gained important insights thanks to the development of chromosome conformation capture (3C) and derivate techniques (see materials and methods) to identify chromatin interactions. These techniques allowed the development of three-­‐dimensional (3D) chromosome structure models (Dekker et al., 2013; Dekker, 2006). This new technology confirmed what was previously observed using less resolutive techniques; that chromatin was organized into nuclear domains, perhaps with different functions and regulation events taking place on them. A recent study indicates that only a small fraction of the boundaries show clear differences between two cell types, suggesting that most structural domains are preserved among different cell types (Dixon et al., 2012). Noteworthy, most of the boundaries appear to be shared across evolution (53.8% of human boundaries are conserved in mouse and 75.9% of mouse boundaries are conserved in humans). CTCF creates boundaries between topologically associating domains in chromosomes and facilitates interactions between transcription regulatory sequences and promoters. Thus, CTCF links the architecture of the genome to its 47 Introduction function (Ong & Corces, 2014). Most of the topological boundaries are enriched for CTCF binding, whereas boundaries constitute just the 15% of the whole CTCF binding, which indicates that something else is needed to form a boundary. It has been shown that boundaries are enriched near house keeping genes and also in some repetitive sequences such as Alus (Dekker et al., 2013; Dixon et al., 2012). Single cell Hi-­‐C (whole genome based 3C technique) shows that individual chromosomes maintain domain organization at the megabase scale, but show variable cell-­‐to-­‐cell chromosome structures at larger scales. Despite this structural stochasticity, localization of active gene domains to boundaries of chromosome territories is a hallmark of chromosomal conformation (Nagano et al., 2013). There are many long range interactions within chromosomal territories and also between them. One of the most studied types of interaction are those associated with elements that modulate gene expression from a relative far away distance (in a DNA linear manner), known as enhancers (Pennacchio et al., 2013). The ENCODE project revealed more than 1,000 long-­‐range interactions between gene promoters and distal sites (Sanyal et al., 2012). In the same work they found that looping interactions and long-­‐range interactions were enriched for CTCF and also for histone modifications such as H3K4me1, H3K4me2, H3K4me3, H3K9ac and H3K27ac (typically in active enhancers), but were not enriched or significantly depleted for H3K27me3, a mark typically found at inactive or closed chromatin (Sanyal et al., 2012). Nowadays we know that there are different combinations of histone PTMs that define an active enhancer (Ernst et al., 2011), although the classical features are presence of H3K27ac and H3K4me1. Furthermore, active enhancers can express bidirectional transcripts known as enhancer RNAs (eRNAs) (Kim et al., 2010), nevertheless the biological function of eRNAs remains unclear and there is no consensus about whether they mediate specific biochemical functions (Shlyueva et al., 2014). 48 c eCi a eti c n ci u ei C tc i u i I dl e tc tc qóó8 n dtu te Ct( c i Cu d i di c ei en e en C en l 1 enR sl tc ( i d( ei Cx Ci c F Ci c i di C e d l Ct %c c ei en CC l c I t( l etu adal 0 1tI c et C n t d 2 ntl ei c 1i l ezeC c l d eti c d u ensd eti c W nCi u etc C u i Cteni C ) W u i c I i en Cl % c l u C c 1tI c et de C eti c l ) 1d tc ni R eR i t c et dI c i es1 l c c de C eti c l en e R i ad tc I ei i en I c et x l 1C ( ti al ds C u tc ei 1t l i u i t t eti c l W s i I dl e tc Wqóó8% 0 e tl c i R R ddoc i R c t C c e 1n c i es1 l tc C l 1i c l de C eti c l c c d 1Ci 1i l C 1 Cei tC i I c et C u adet1d u i d ad C 1 enR sl d de C eti c l 0 1tI c et Ctl 1Ci I C l l ti c u i c i c i tc I dtc I i u 1d ) l x i ds i u Cancer epigenomics Sandoval and Esteller 53 l x tI aC qU%x c i ( d F l e dd CWL8qL% 0 Figure 1 NORMAL CELL CANCER CELL DNA methyl modifying complexes DNA methyl modifying complexes Tumor supressor genes Promoter specific hypermethylation DNA methylation DNA methylation Tissue specific genes Onco-genes repetitive regions Global hypomethylation CHROMATIN STRUCTURE Histone modifications NORMAL GENE REGULATION Aberrant histone modification landscape Histone Modifying complexes AcK4H3 AcK9H3 AcK18H3 AcK16H4 dimeK4H3 trimeK4H3 trimeK9H3 trimeK27H3 trimeK20H4 ABERRANT CHROMATIN STRUCTURE Histone modifications Histone Modifying complexes GENE MISREGULATION epimiRNAs Onco-miRNAs miRNA miRNA Tumor suppresor miRNAs miRNA Machinery Aberrant global miRNA expression miRNA Machinery Current Opinion in Genetics & Development f a p3 d oe o c n er e c r el on a n er f a r er e r h a r aa r n Global oncogenesis. In conjunction an aberrant for the c nndepiction ar eaofnepigenomicaalterations r n c during r n nea y l withn accumulation i o n er mof genetic ner lesions, l e there niser r pattern l h different epigenetic effectors: DNA methylation, histone modifications, and miRNAs. In normal cells, the interplay between the epigenetic factors and c ae f ael r eu o | n o o am 2. p2h the chromatin structure leads to a tuned gene regulation. However, in cancer cells tumor suppressor genes promoters become hypermethylated and with an altered global pattern of histone modifications resulting in aberrant gene silencing. Moreover, global hypomethylation leads to chromosome instability and fragility. Epigenetic changes, including DNA methylation and histone modifications are responsible for abnormal mRNA and miRNA expression producing altered activation of oncogenes and silencing of tumor suppressor genes. n Ci d i s u ensd eti c tc i c i I c l tl n l Cl Wi Ctc I e td 1t eaC i ae en between aberrant and cancer. en C I adepigenomics eti c i en c InC the I cfield i uof genomics, many laboratories around the world are working together as part of the International Cancer Genome Conl ea t d l l tc e c l ds ae en c ol ei sortium, or collaborating in the Cancer Genome Project and the Cancer Genome Atlas research program. l a l e c et d ( c ln ( cu The combination and integration of epigenomics, genomics and all the other ‘omics’, including transcriptomic, proteomic, and metabolomic aspects, will be essential to maintain the increasingly rapid progress towards a full understanding of the underlying molecular mechanisms that govern the initiation and development of cancer processes. Furthermore, these cancer signatures will help us identify new potential prognostic and detection tools and, eventually, to develop effective clinical therapies. However, although the large-scale studies are invaluable, c l ea t i C u i C en c L8 t C c e Ci d l i u ensd eti c tc 0 near n future i en Cto analyze 1tI c the et vast u amount Col nof(information c generated by powerful epigenomic platforms such as the 450 K DNA methylation microarray [65]. en ( di 1u c e i c R e nc t9a l W Acknowledgements aCtcSupported I en bydGrants l e SAF2011-22803, 0 the European Research Council (ERC) Advanced Grant EPINORC and Fondo de Investigaciones Sanitarias Grant PI08-1345. JS is funded by the Juan de la Cierva Research Program (MICINN). ME is an ICREA Research Professor. References and recommended reading Papers of particular interest, published within the period of review, have been highlighted as: ! of special interest !! of outstanding interest 1. Eó Kinzler KW, Vogelstein B: Lessons from hereditary colorectal cancer. Cell 1996, 87:159-170. Introduction DNA methylation in cancer In breast cancer it has been demonstrated that hypermethylated genes are the effectors of the earliest steps in cancer formation. Aberrant methylation of genes is associated with immortalization as well as with subsequent steps in the malignant progression of these cells (Novak et al., 2009). It has been also proposed that the aberrant methylation of specific genes might lock stem cells in an undifferentiated state, enhancing them to malignant transformation (Widschwendter et al., 2007). This aberrant methylation is not occurring exclusively in the tumor, Shen et al. observed that the 50% of normal colon tissue adjacent to a tumor carried detectable hypermethylation within the promoter of the DNA repair gene MGMT (O6-­‐methylguanine methyltransferase) when the tumor was methylated. On the other hand, it only occured in 12% of normal tissue from cancer-­‐free control patients and only 6% of the tumor-­‐adjacent normal tissue carried methylated MGMT when the tumor was unmethylated (Shen et al., 2005). A similar phenomenon has also been described regarding hypomethylation of CDH3 and hypermethylation of EVL and p14 in normal colon epithelium adjacent to the tumor (Grady et al., 2008; Milicic et al., 2008; Shen et al., 2003). It is worth to note the genomic-­‐epigenomic cross-­‐talk observed in DNA repair methylation in colorectal cancer. It has been described that hypermethylation of MGMT and MLH1 (DNA repair genes) in the adjacent normal mucosa correlates with tumor alterations such as KRAS mutations or microsatellite instability, respectively (Hiraoka et al., 2010; Ramírez et al., 2008). The epigenetic silencing of repair genes in the normal tissue would create a scenario where mutation rate and other genetic alterations would be enhanced; these studies bring to light the importance of the genetic-­‐epigentic cross-­‐talk equilibrium. There are three main DNA methylation alterations in cancer: hypermethylation, hypomethylation and loss of imprinting. The most widely studied epigenetic deregulation in cancer is DNA hypermethylation. There are many studies that point out aberrant DNA methylation within the colorectal cancer genome, although only a subset of these genes are likely to be important in the development of the cancer. 50 c eCi a eti c iu i en u i l e C 9a c e I c ns1 Cu ensd eti c l n ( tc tet eti c c 1Ci I C l l ti c i en 1i ds1 ei Cds ns1 Cu ensd e REVIEWS x i F i I c l tc da c dtc o ei en C tc i u x tI aC q7% 0 ) u 1d l i en EW W : 7W L c q C sWL8qq% 0 i e dsWen u i l e l a l e c et dtc C l tc I c u ensd eti c aCl tc en l e 1 Ci u c i Cu d i di c u a i l ei Normal colonic epithelium Aberrant crypt focus SLC5A8 MINT1* MINT31* SFRP1 SFRP2 CDH13 CRBP1 RUNX3 c i u x tu Polyp/adenoma p14 ARF HLTF ITGA4 CDKN2A/p16 CDH1 ESR1 WL88/% 0 Adenocarcinoma TIMP3 CXCL12 ID4 IRF8 Methylated genes Figure 2 | Commonly methylated genes (and loci) identified at the histological steps of the colorectal cancer polyp f a pI d sequence. el l er oiSpecific l n gene i o nand locirhypermethylation v r oe ,has been r n observed nn neoe steps o of nthe c cancer e n adenocarcinoma in the different eoea n osequence, r a which c eoi cimplicates r e these a rgenes el in either t f the r initiation h c or progression r i ccolorectal al n icancer. o n erThe genes r progression of between epithelium as well those elisted au r normal n a r n nand c aberrant e n crypt r focus a c ae a as er genes t f r listed h between c ae f aberrant aelcrypt focus e | and a im polyp/adenoma might be involved in the initiation of colorectal cancer. Those genes listed between polyp/adenoma and 2. pph adenocarcinoma could have a role in the progression and metastasis of colorectal cancer. Note that only the genes (and loci) that have consistently been found to be hypermethylated at specific points in the progression sequence have been included. I tl c tu 1i Ce c eCtl o ei Ctc en ( di 1u c ei i di C e d c C0 n I tc I *MINT1 and MINT31 are not genes; rather they are loci that have been found to be ‘methylated in tumor’ (aka MINT). i i di c t u a i l tl 1d sl I zC d e class of genes that seem to be more lno 1 clear t tfunctionalns1 Cu ensd eti c x l l F commonly affected by DNA methylation in the adenoma I di dns1i u ensd eti c l R dd l di al z DNA methylation and metastatic CRC nar WL888% 0 nal Wtc I tc I c i en C The progression of colonic adenomas to adenostep of colon cancer development compared with other carcinomas is believed to be driven by genetic alteratC au l e c l WR c tc CC c e u ensd e I c l tc en c i Cu d u a i l W steps in the progression sequence.129 Despite the lack tions, such as mutations in TP53, but is also probably For0 definitive proposed Rofnt n R i proof, ad tcit has C been l en Ctl othat i aberrant l a Ctc I a consequence i di C e dof epigenetic c Cx alterations l nt (Figure 2). WL88q% example, the aberrant methylation of CXCL12, a chemomethylation of DNA repair genes, such as MGMT and kine ligand, in CRC MLH1, adenomas n iin( colon C ) 1C l l ti cmight i promote thel progresn l c 1Ci 1i occurs l eihuman ) 1d tc andencan promote CC the ce metastatic behavior of colon cancer cell lines.135 In addision of adenomas to cancer by creating a permissive state mostIcommon ufor G>A ensdmutations—the eti c i aCCtc tc enmutation c seen C I ction, i u the0 frequency i en tcof Ctumors l carrying ) 1Ccertain l l ti cmethylc in KRAS in the case of methylated MGMT, and a perated genes, like TIMP3, ID4 and IRF8, is higher in colon missive satellite in thelcase metastases adenomas, thatc tc C state l for micro et( tes i instability en W iofu 1 cancer C and R ten c i Cu than d etl l a l Wsuggesting n ( methylated MLH1.131,132 the inactivation of these genes by methylation provides 128,136 the detection In addition to specificW C In 1i addition Ce tctonau c c ofClmethylated tc da tcgenes I i di ca clonal c growth C x l advantage. l WqóóZ, i l ni in adenomas, CIMP can be detected in advanced aberrantly methylated genes being present in advanced tubular 0 adenomas but is not commonly observed in CRCs, hypomethylated LINE-1 elements are found to L88ó% early tubular adenomas.128,133 Interestingly, Kwon et al. increase linearly in more progressed colon neoplasms detected of e n l CIMP adenomas c u iincal collection eC e tcserrated i enW (Figure 1). dd dtc130,137,138 l However, c c in tugeneral, d u iti seems dl thatenthee adenomas but not in tubular adenomas, which suggests aberrant DNA methylation of genes is predominantly serrated be theqprecursor polyps Z involved withathe early events ithat ( C ) 1C adenomas l l ti c i could c c tc CC cofecolon u cancer ensd formation eti c i for CIMP CRCs.133 It is not clear whether the detecand less with progression events. ction i Cuof CIMP dds ac u inensd e phase 1 oftlCRC d c formal Wl tu td C ei R n e tl i l C( tc nau c i di c late the polyp tion reflects a technical issue regarding the number of DNA methylation epigenotypes of CRC C x ini the l nistudies of methylated WL88ó, genesnu t e Epigenetic WL88U% 0 in CRC i R is(manifested CWen Cin a variety tl l etd locic assessed in adeinstability ofd nomas, or demonstrates that CIMP occurs late in the ways, including hypermethylation of gene promoters that i c eCi ( Cl sequence. s tc en128 This t dis W i en t lCpG l niislands R and englobal e tcDNA C hypomethylation. l q polyp→cancer contain an issue al because it is C l ea Essentially all CRCs have at least some aberrantly methylwidely believed that CIMP tumors might arise from ser) 1Cadenomas, l l ti c Win cwhichl acasel it would 9a cbe e reasonable ns1 Cu to ensd etigenes, c Wtlandcthere i e lseems tu 1d l i t e distribuR ten ated tos be al unimodal rated tion of colon cancers when the proportion of methylated assume that CIMP would be detected in early adenomas. genes to cancer genome is assessed. In 1999, Toyota and To date, methylated genes that distinguish sessile serIssa observed that some CRCs have a high frequency of rated adenomas from hyperplastic polyps (CDX2, MLH1, :q methylated genes, and they put forth the concept that and TLR2) have been identified, but there has yet to be these tumors have a unique molecular patho genesis, consistent reporting of a subset of early adenomas with naming them CIMP cancers.93 This concept was met with the CIMP signature of methylated genes.134 c eCi a eti c c C x nCdt n WL88/% 0 c c i e c tc C l l u c eti c et( tes i en en e en ac qW c i l sdu enti c tc Z ei c e tl et( tes0 I c tl C I ad e s lW Z WR nt n eC c l C u ensdI Ci a1l Ci u tc l nti c x u ce d l W aeC en C u tl tC e 1C ( ti al dsWen u ensd eti c l e e i tc da tc I u tc e c c eWte u tI ne ten C q% 0 x tc e c c Z c u ensd eti c i C 1dt eti c WR n c n u tu ensd e tl i ac s z Z %i C aCl aCtc I q R ten ntI n tc tes0 c c i Cu d i c teti c l u i l e i en c ic C ddl 1 tl d c l C u tc ac u ensd e WR n C l tc CC c e ns1 Cu ensd eti c i l 1 t t c l eti c i en nCi u etc c 1 tl d c l C l adel tc en en l td c tc I i u adet1d I c l Wtc da tc I eau i Cl a11C l l i CI c l x tI aC qó% 0 Normal colon epithelium Exon 1 Exon 2 Exon 3 Repetitive sequences i.e. LINE-1 Genomic stability Open chromatin structure Colorectal cancer Exon 1 Exon 2 Exon 3 Repetitive sequences i.e. LINE-1 Closed chromatin structure Genomic instability Methylated CpG site Unmethylated CpG site Figure 1 | CpG island DNA hypermethylation and global DNA hypomethylation in colorectal cancer as compared with f a pT d cepithelium. o r Unmethylated i c alCpGnislands i o n er r theopromoter e o region i cofelgenes n iare o ncorrelated er r eo eaannopen o r a normal colonic within with el c a structure s n r eal o eoer whereas c n methylated o f l h r CpG l nislands i o n are correlated c o r with s a n r n c ael enchromatin a a er e chromatin (euchromatin), condensed, closed structure silencing. colonic r a(heterochromatin) eaa o n s and n transcriptional r ec r ael n r Normal naf n f a vepithelium f ael generally n r ,ms hasaunmethylated l n i oCpG n c CpG islands islands o r in the a promoter eaa o regions n s ofngenes, whereas er r aberrant m oe hypermethylation ael n of r promoter naf nf associated a v n ae ael nisra, r hypermethylation seen in colorectal cancers, global nahallmark r a cofnneoplasms. er o o r In raddition h c to aethef aberrant aellocal e | a i m2. pph hypomethylation at LINE-1 sequences is also observed, which has been shown to be associated with genomic instability. Interestingly, an inverse association exists between local CpG island hypermethylation and global LINE-1 hypomethylation td c tc Iprogress. s u ensd eti c c i u 1dtl n s t C c e as ccolonicl neoplasms urepression n c tlinvolves u l 2 proteinsu commonly ensd etioverexpressed c i ad tu 1 tC en tc tc I i eC c l Ct1eti c DNA methylation and cancer cancer, such as EZH2, and cooperates with aberrant in ei Cl Wl a n l zLW WL W c DNA methylation to silence gene expression by regulat- Although the importance of gene mutations in the z3 x u 1 c Ci WL888, i u pathogenesis of cancer is widely accepted, the role of ing chromatin compaction.49 A close association exists in cancer has been controversial Fbetween i i methylated u c Wqóó8, cI WL88q, epi i genetic F Calterations sWL8qq% 0 aCen Cu i C W until the past decade. The first epigenetic alteration CpG islands and histones containnearly three decades ago by repressive post-translational modifications (such uing ensd eti c u s C Cate c psu l en e in c cancer i u 1was ereported en nCi u etc c C 1C l l Feinberg and Vogelstein, who showed extensive global as H3K9me3 and H3K27me3). The establishment of loss of 5-methylcytosine content in colon cancers comI these c histone ) 1C modifications l l ti c x (which CF cause CI uchromatin c WL88ó% 0 ensdz tc tc I 1Ci e tc l C tc ( i d( pared with the normal colon.54 The global loss of DNA condensation) is thought to be mediated by polycomb50,51 predominantly affects CpG dinucleotides tcrepressive en l tdcomplexes. c tc I i enThis association nCi u etchas sraised tc tcmethylation I R ten ntI n tc tes ei u ensd e found in repetitive sequences of DNA, such as LINE-1 the possibility that abnormal activity of PRC2 might be the and satellite repeats. This global hypomethylation can mechanism for inducing aberrant DNA methylation be found in the colon in an age-dependent fashion as in cancer.31 steps of the polyp→cancer progres: LFeinberg and colleagues have extended the concept well as in the early sion sequence.55–57 Thus, it seems that the global hypoof CpG islands to ‘CpG island shores’, which are also abnormally methylated in cancer. CpG island shores methylation of DNA is an early event in the formation of refer to areas of less dense CpG dinucleotides within CRC. A study in Dnmt1+/– mice demonstrated that DNA 52 REVIEWS Introduction and start a cascade of events altering chromatin structure by recruiting other proteins. These proteins include a wide variety of epigenetic remodelers such as histone deacetylases, histone methylases and chromatin remodeling complexes, thereby condensing the chromatin and blocking access of transcription factors to the promoter region (Bird, 2002). Some examples of these methyl binding proteins are MeCP2, MBD1, MBD2 and MBD4; the zinc finger proteins Kaiso, ZBTB4 and ZBTB38; and the SET-­‐and RING-­‐finger associated proteins, UHRF1 and UHRF2, among others (Tsai & Baylin, 2011; Engeland et al., 2011). The first epigenetic alteration in cancer was observed in 1983 by two independent studies showing extensive global loss of 5-­‐methyl cytosine content in colon cancer (Feinberg & Vogelstein, 1983; Gama-­‐Sosa & Slagel, 1983). This global demethylation affects predominantly repetitive elements, such as LINEs and satellite repeats (Figure 19). DNA hypomethylation is an early event in the development of colorectal cancer and is age-­‐related (as hypermethylation) (Issa & Ahuja, 2000; Suzuki et al., 2006). A study in Dnmt1+/– mice demonstrated that DNA hypomethylation might contribute to cancer formation by allowing or inducing genomic instability (Laird et al., 1995). Later on, other studies have added further insights into the role of DNA hypomethylation in tumorigenesis (Eden et al., 2003; Gaudet et al., 2003). Loss of imprinting is defined as the loss of parental allele-­‐specific monoallelic expression of genes due to aberrant hypomethylation profiles at one of the two parental alleles. For example, loss of imprinting of IGF2 has been associated with an increased risk of colorectal cancer among other cancers (Lim & Maher, 2010). Histones in cancer Aberrant patterns of histone posttranslational modifications (PTM) are a hallmark of cancer, although it is still poorly understood whether they are cause or consequence of the malignant transformation. There are common alterations in the histone modifications patterns in cancer, for instance a global reduction of H4K20me3 and H4K14ac in repetitive sequences (Fraga et al., 2005), H3K27me3 targeting loci for de novo DNA methylation in cancer cells (Vire et al., 2006; Widschwendter et al., 2007) and loss of the active enhancer mark H3K27ac in cancer (Aran & Hellman, 2013; Ferrari et al., 2014). Some specific histone PTM 53 c eCi a eti c de C eti c l n ( c c i l C( CR n C I di Z Eu L c tl Ca1eti c i en x dtI l i c 1tI c et u c C es1 Wl a n l tc 1Ci l e e d de C 1i l teti c i WL88: % 0 ntc Ct l W ten C s u ae eti c W d eti c i C de C c s i en tC i u 1i c c el Wtl oc i R c ei 1Ci ( i o ) 1C l l ti c 1 ee Cc l en e I t( de C eti c i en 1 t t 1 Cet ad C dntl ei c u i t t eti c 1 ee Cc l C ( L q7 ) 1C l l ti c i tc l Ctl ei dd es1t d Ci l l en I c i u 1tu ae eti c l n ( c dtc o c C n C e Ctl et l Wl a n l x i CgI a pz C ei CC c e I c l F Ce tc es1 l i c l e dd CWL8qq% 0 Cx p y W L88/% 0 c et d l ti c l tc nCi u etc u i t t Cl dc l 1 c i e i c ds tu 1ds 1Ci ( t n ( c I di d de C eti c l tc en al et( Ci d i C en l 1Ci e tc l tc 1i e c et d e CI el i C en C 1 aet tc e C( c eti c 0 dC s c ( di 1 c au c 1tI c et C ae dl i C i tc nt tei Cl I tc l e nCi u etc C I ad ei Cl x tI aC L8%x Rli c F i ap Ct l WL8qL%0 Figure f a 1.2.Epigenetic d Inhibitors l as Cancer c n Therapies n c ae ea c r n af u oec l r n r n f aa r n n nf This schematic depicts the process for epigenetic drug development and the current status of various epigenetic therapies. Candidate small molecules are first etested u ain ef c r cell n lines n foraspecificity c hand phenotypic c n ael s ermay, | in the effirst g instance, a m 2. p2h vitro in malignant response. These assess the inhibition of proliferation, induction of apoptosis, or cell-cycle arrest. These phenotypic assays are often coupled to genomic and proteomic methods to identify potential molecular mechanisms for the observed response. Inhibitors that demonstrate potential in vitro are then tested in vivo in animal models of cancer to ascertain whether they may provide therapeutic benefit in terms of survival. Animal studies also provide valuable information regarding the toxicity and pharmacokinetic properties of the drug. Based on these preclinical studies, candidate molecules may be taken forward into the clinical setting. When new drugs prove beneficial in well-conducted clinical trials, they are approved for routine clinical use by regulatory authorities such as the FDA. KAT, histone lysine acetyltransferase; KMT, histone lysine methyltransferase; RMT, histone arginine methyltransferase; and PARP, poly ADP ribose polymerase. iu i en n ( dC CaI l s 1t e tc tI aC L8 xe CI etc I c 11Ci ( s en 0 ntl l a lW l c L% W l l tl en C d ) i en tc e C l e en e 1tIin acvastetarray CaI l n has ( provided 1Ci aacatalogtcof enregulators t dhave i (raised C enintriguing d l ecorrelations between 0 i Rcancer( CW sequencing of cancers recurrent somatic mutations in numerous epigenetic regulators (Forbes al., 2011; Stratton en C etdtes tl en e enet al., t 2009). d i A central 1tI tenet c etin analyzing these cancer genomes is the identification of ‘‘driver’’ mutations (causally implicated in the process of oncogenesis). A key feature of driver mutations is that they are recurrently found in a variety of cancers, and/or they are often present at a high prevalence in a specific tumor type. We will mostly concentrate our discussions on suspected or proven driver mutations in epigenetic regulators. For instance, malignancies such as follicular lymphoma contain recurrent mutations of the histone methyltransferase MLL2 in close to 90% of cases (Morin et al., 2011). Similarly, UTX, a histone demethylase, is mutated in up to 12 histologically distinct cancers (van Haaften et al., 2009). Compilation of the epigenetic regulators mutated in cancer highlights histone acetylation and methylation as the most widely affected epigenetic pathways (Figures 3 and 4). These and other pathways that are affected to a lesser extent will be described in the following sections. Deep sequencing technologies aimed at mapping chromatin modifications have also begun to shed some light on the origins of epigenetic abnormalities in cancer. Cross-referencing of DNA methylation profiles in human cancers with ChIP-Seq data for histone modifications and the binding of chromatin tc l e c l tc nt tei Cl WR nt n n ( ( Cs dteed c psu C t CaI x tc a t F etc I 1tI c et CCnsenu t c el tc en c i Cu d etl l a 0 i C c c psu l tc 14 Cell 150, July 6, 2012 ª2012 Elsevier Inc. c l 1 t t tesWi ad n ( ( i u tetc I ei i c u CCi R c aCi di I t d ei ) t tesW 1 c tc I i c dt tWL88/% 0 c tI aC Lq C C d e c eteau i Cen C 1t l 0 :E el C c I tc I Ci u etI a Wc al ei ) t tesWC ( Cl t d en CaI l t tl i ( Cs tl l etddtc tel tc c s c C c (i t CaI u i C l ea t l l ( C lt ei associated DNA hypermethylation and genes marked with ‘‘bivalent’’ histone modifications in multipotent cells (Easwaran et al., 2012; Ohm et al., 2007). These bivalent genes are marked by active (H3K4me3) and repressive (H3K27me3) histone modifications (Bernstein et al., 2006) and appear to identify transcriptionally poised genes that are integral to development and lineage commitment. Interestingly, many of these genes are targeted for DNA methylation in cancer. Equally intriguing are recent comparisons between malignant and normal tissues from the same individuals. These data demonstrate broad domains within the malignant cells that contain significant alterations in DNA methylation. These regions appear to correlate with late-replicating regions of the genome associated with the nuclear lamina (Berman et al., 2012). Although there remains little mechanistic insight into how and why these regions of the genome are vulnerable to epigenetic alterations in cancer, these studies highlight the means by which global sequencing platforms have started to uncover avenues for further investigation. Genetic lesions in chromatin modifiers and global alterations in the epigenetic landscape not only imply a causative role for these proteins in cancer but also provide potential targets for therapeutic intervention. A number of small-molecule inhibitors have already been developed against chromatin regulators (Figure 1). These are at various stages of development, and three en u tc u ae eti c l CW c 1 Cn 1l CaI e CI e d 1Ci e tc l i C and JAK2) have already ood and Drug Administrat that the interest in epigediscovery had been high reality is that the field of held back due to concerns he drugs and their targets. (against HDACs) have little anism of action remains 6). netic cancer therapies may w level of support following hibitors against BRD4, an ein (Dawson et al., 2011; s et al., 2010; Mertz et al., lar mechanisms governing have also been largely This process is pivotal for e inhibitors methylated onthe theclinic. side into inelistresidues. Methylation, g of genetic lesions in tion, not have alter now the fact does that we nes may be mono-, di-, or herapies. es may be symmetrically est-characterized sites of to Cancer occur on lysine residues s of this residues section. Although cytosine (5mC) in histones are methylated, cribed covalent modifica3K27, H3K36,characterized H3K79, and extensively 36, and H3K79) are noted often hylation is primarily hromatin, whereas others ive X-chromosomes, and with heterochromatic ,ated 2011; Robertson, 2005). 007). Differentobserved methylation commonly in so localize differently. For enetic alterations in cancer sccur the within transcriptional start CpG islands, i et al., promoters. 2007), whereas ammalian CpG ed with active enhancers role in transcriptional reguwhereas monomethylation ing malignant transformaes, trimethylation of H3K9 son, 2005). NGS platforms arski of et al., 2007). maps CpG methylation. sine methylation contain a %–10% of normally unmesesses methyltransferase me abnormally methylated hDOT1L, the enzyme that so demonstrate that CpG enly KATs, thethe histone lysine affects expression ehehighly specificofenzymes expression various ne residues. Cytogenetic e a role in malignant transs cancer genomes, have mportantly, these genomesalso and/or coding mutations uncovered intriguing MMSET, hin gene EZH2, bodiesand andMLL at sequences upstream and erted by the MLLoffusions ctional relevance these viewed (Krivtsov and Armyet to be fully deciphered, nterest is the dichotomous hey have challenged the es. EZH2 is equates the catalytic n invariably with ich is primarily responsible e studies have established studies s gene-expression have high levels of DNA H2 as a progressive event uggesting that the context rostate isand breast cancer ylation vital in transcripThese 011). initial studies sug. However, NGS and tares have recently identified ous lymphoid and myeloid muddied the waters by mor-suppressive roles for utations resulting in the within the SET domain of s with diffuse large B-cell ctional characterization of conferred increased cataconverting H3K27me1 to ontention that EZH2 is an contrast, loss-of-function g a poor prognosis, have alignancies (Ernst et al., -ALL (Ntziachristos et al., ting a tumor-suppressive c eCi a eti c enzymes. In addition to their catalytic function, many chromatin modifiers also possess ‘‘reader’’ domains allowing them to bind to specific regions of the genome and respond to information conveyed by upstream signaling cascades. This is important, as it provides two avenues for therapeutically targeting these epigenetic regulators. The residues that line the binding pocket of reader domains can dictate a particular preference for specific modification states, whereas residues outside the binding pocket contribute to determining the histone sequence specificity. This combination allows similar reader domains to dock at different modified residues or at the same amino acid displaying different modification states. For example, some methyl-lysine readers engage most efficiently with di/tri-methylated lysine (Kme2/3), whereas others prefer mono- or unmethylated lysines. Alternatively, when the same lysines are now acetylated, they bind to proteins containing bromodomains (Taverna et al., 2007). The main modification binding pockets contained within chromatin-associated proteins is summarized in Table 1. Many of the proteins that modify or bind these histone modifiFigure 2. Cancer Mutations Affecting Epigenetic Regulators of DNA cations are misregulated in cancer, and in the ensuing sections, Methylation weThe will5-carbon discussof the mostnucleotides extensively histone modificacytosine are studied methylated (5mC) by a family of DNMTs. One oftothese, DNMT3A, and is mutated in AML, myeloproliferative tions in relation oncogenesis novel therapeutics. diseases and myelodysplastic syndromes addition to of(MDS). lysineInresidues is its Histone (MPD), Acetylation. The Nε-acetylation catalytic activity, DNMT3A has a chromatin-reader motif, the PWWP domain, a major histone transcription, chromatin which may aid inmodification localizing this involved enzyme toinchromatin. Somatically acquired structure, DNA may repair. neutralizes lysine’s mutationsand in cancer alsoAcetylation affect this domain. The TET familyposiof DNA hydroxylases metabolizes 5mC into several weaken oxidative intermediates, including tive charge and may consequently the electrostatic 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxinteraction between histones and negatively charged DNA. For ylcytosine (5caC). These intermediates are likely involved in the process of this reason, histone acetylation isthree oftenTET associated withare a more active DNA demethylation. Two of the family members mutated in cancers, including conformation. AML, MPD, MDS,Consistent and CMML. Mutation types are as ‘‘open’’ chromatin with this, ChIPfollows: M, missense; F, frameshift; N, nonsense; S, splice site mutation; Seq analyses have confirmed the distribution of histone acetyla-and T, translocation. tion at promoters and enhancers and, in some cases, throughout the transcribed region of active genes (Heintzman et al., 2007; Wang et al., 2008). Importantly, lysine acetylation also serves Three active DNA methyltransferases (DNMTs) have been as the nidus for the binding of various proteins with bromodoidentified higher eukaryotes. DNMT1 is(PHD) a maintenance methylmains and in tandem plant homeodomain fingers, which transferase that recognizes hemimethylated recognize this modification (Taverna et al., 2007). DNA generated during DNA replication then methylates newly synthesized Acetylation is highly and dynamic and is regulated by the CpG dinucleotides, whose on families, the parental competing activities of two partners enzymatic the strand histoneare already methylated (Li et al., 1992). Conversely, DNMT3a and lysine acetyltransferases (KATs) and the histone deacetylases DNMT3b, although also capable of methylating (HDACs). There are two major classes of KATs: (1) hemimethylated type-B, which function primarily as de and novomodify methyltransferases estabareDNA, predominantly cytoplasmic free histones, to and (2) lish DNA methylation during embryogenesis al., 1999). type-A, which are primarily nuclear and can be (Okano broadlyet classified DNA provides a platformfamilies. for several methyl-binding into themethylation GNAT, MYST, and CBP/p300 proteins. These include MBD1, MBD2, MBD3, and MeCP2. KATs were the first enzymes shown to modify histones. The These in turn function to recruit histone-modifying enzymes importance of these findings to cancer was immediately to coordinate chromatin-templated (Klose and apparent, as onethe of these enzymes, CBP, processes was identified by its Bird,to 2006). ability bind the transforming portion of the viral oncoprotein in DNA methyltransferases and that MBD E1A Although (Bannistermutations and Kouzarides, 1996). It is now clear proteins been known contribute to developmental many, if nothave most,long of the KATs have to been implicated in neoplastic abnormalities and (Robertson, 2005), we have only recently become transformation, a number of viral oncoproteins are known of somatic mutations of these key genes in human maligto aware associate with them. There are numerous examples of recurnancies (Figure 2). Recent sequencing of cancer[Wang genomes has rent chromosomal translocations (e.g., MLL-CBP et al., identified recurrent [Huntly mutations in 2004]) DNMT3A in up mutations to 25% of 2005] and MOZ-TIF2 et al., or coding patients with acute leukemia (AML) (Ley 2010). (e.g., p300/CBP [Iyer myeloid et al., 2004; Pasqualucci et et al.,al., 2011]) Importantly, these invariably and involving various KATsmutations in a broadare range of solid heterozygous and hematologaremalignancies predicted to(Figure disrupt3). theFurthermore, catalytic activity of expression the enzyme. ical altered Moreover, theirofpresence to been impact prognosis (Patel levels of several the KATsappears have also noted in a range al., 2012). However,and at present, the mechanisms by which of etcancers (Avvakumov Côté, 2007; Iyer et al., 2004). In A C B D Figure 3. Cancer Mutations Affecting Epigenetic Regulators Involved in Histone Acetylation These tables provide somatic cancer-associated mutations identified in histone acetyltransferases and proteins that contain bromodomains (which recognize and bind acetylated histones). Several histone acetyltransferases possess chromatin-reader motifs and, thus, mutations in the proteins may alter both their catalytic activities as well as the ability of these proteins to scaffold multiprotein complexes to chromatin. Interestingly, sequencing of cancer genomes to date has not identified any recurrent somatic mutations in histone deacetylase enzymes. Abbreviations for the cancers are as follows: AML, acute myeloid leukemia; ALL, acute lymphoid leukemia; B-NHL, B-cell non-Hodgkin’s lymphoma; DLBCL, diffuse large B-cell lymphoma; and TCC, transitional cell carcinoma of the urinary bladder. Mutation types are as follows: M, missense; F, frameshift; N, nonsense; S, splice site mutation; T, translocation; and D, deletion. some cases, such as the leukemia-associated fusion gene MOZ-TIF2, we know a great deal about the cellular consequences of this translocation involving a MYST family member. MOZ-TIF2 is sufficient to recapitulate an aggressive leukemia in murine models; it can confer stem cell properties and reactivate a self-renewal program when introduced into committed Figure 5. Cancer Mutations Epigenetic Regulators hematopoietic progenitors, andAffecting much of this oncogenic potential Involved in Histone is dependent on itsPhosphorylation inherent and recruited KAT activity as well as Recurrent mutations in signaling kinases are one of the most frequent oncoits ability to bind to nucleosomes (Deguchi et al., 2003; Huntly genic events found in cancer. Some of these kinases signal directly to chroet al., Activating 2004). and inactivating mutations of these have been noted in matin. a range of malignancies. Thus far, contains with a BRCT domain,to is Despite these insights, theBRCA1, great which conundrum regards the only potential phosphochromatin reader recurrently mutated in cancer. It unraveling the molecular mechanisms by which histone acetylshould be noted, however, that BRCA1 binding to modified histones via its transferases contribute to firmly malignant transformation has been BRCT domain has not yet been established. As our knowledge about histone phosphatases and phosphohistone increases, we are likelyon to dissecting the contribution of alteredbinders patterns in acetylation find mutations in many of these proteins that contribute to oncogenesis. histone and nonhistone proteins. Although it is clear that global Abbreviations for the cancers are as follows: AML, acute myeloid leukemia; histone patterns arechronic perturbed cancers (Fraga ALL, acuteacetylation lymphoid leukemia; CML, myeloidinleukemia; NHL, non- Hodgkin’s lymphoma; MPD, myeloproliferative diseases; and T-PLL, T cell prolymphocytic leukemia. Mutation types are as follows: M, missense; F, S, 150, spliceJuly site6,mutation; T, translocation; and 17 D, Cell 150, July 6, 2012 ª2012 Elsevier Inc. 15 frameshift; N, nonsense;Cell Figure 4. Cancer Mutations Affecting Epigenetic Regulators 2012 ª2012 Elsevier Inc. Involved in Histone f a 2p d f nMethylation n er er c r n s a n a m a a deletion. ea a a mn oe n er e n l f n n er r n methyltransferases, demethylases, and nfRecurrent l ea smutations a in histone r ef r h c n ael s er | methyllysine binders have been identified in a large number of cancers. These mutations may significantly alter the catalytic activity of the methyltransferases or demethylases. In addition, as many of these enzymes also contain chromatin-reader motifs, they may also affect the ability of these proteins to survey and bind epigenetic modifications. Abbreviations for the cancers are as follows: AML, acute myeloid leukemia; ALL, acute lymphoid leukemia; B-NHL, B-cell non-Hodgkin’s lymphoma; DLBCL, diffuse large B-cell lymphoma; HNSCC, head and neck squamous cell carcinoma; FL, follicular lymphoma; MDS, myelodysplastic syndromes; MPD, myeloproliferative diseases; and TCC, transitional cell carcinoma of the urinary bladder. Mutation types are as follows: M, missense; F, frameshift; N, nonsense; S, splice site mutation; T, translocation; D, deletion; and PTD, partial tandem duplication. The precise mechanisms by which gain and loss of EZH2 activity culminate in cancers are an area of active investigation. In light of the varied roles that polycomb proteins play in Cell 150, July 6, 2012 ª2012 Elsevier Inc. 19 ef g a m2. p2h replication, and transcription. Generally speaking, the specific histone phosphorylation sites on core histones can be divided into two broad categories: (1) those involved in transcription regulation, and (2) those involved in chromatin condensation. Notably, several of these histone modifications, such as H3S10, are associated with both categories (Baek, 2011). Kinases are the main orchestrators of signal transduction pathways conveying extracellular cues within the cell. Altered expression, coding mutations, and recurrent translocations involving signaling kinases are some of the most frequent oncogenic phenomena described in cancer (Hanahan and Weinberg, 2011). Many of these kinases have established roles as signal transducers in the cytoplasm; however, it has recently been recognized that some kinases may also have nuclear functions, which include the phosphorylation of histones (Baek, 2011; Bungard et al., 2010; Dawson et al., 2009) (Figure 5). One such enzyme is the nonreceptor tyrosine kinase, JAK2, which is frequently amplified or mutated in the hematological malignan- :: been given a broader a as Hodgkin’s disease an in which this mechanism genesis (Rui et al., 20 inhibitors against kinase pies, it is interesting to n Aurora inhibitors) result i fications laid down by th fore be considered as p Histone phosphorylat modification, which is re activities of protein kina phatases, like protein kin serine/threonine residue dual specificity; they a requirement for a metalli there is little doubt tha chromatin biology, outsi lation of mitosis, little is these enzymes at chrom in cancer (Xhemalce et a The phosphorylation residues may serve as proteins. Proteins such breaks by tethering to (Stucki et al., 2005). Fur of which there are seve conserved phosphoseri as 14-3-3z, use to bind proteins, including 14-3human malignancies an ing them may prove ben Cancer Mutations in H Two recent studies have tions in genes encoding variant H3.3 (H3F3A) and in up to one-third of ped et al., 2012; Wu et al., heterozygous and are c in amino acid substitut of histone H3 (K27M, G they disrupt, these mut influence on chromatin mutation alters the abilit ylated and acetylated. T H3K27 have different ge and heterochromatin; th netic readers and are u scriptional outcomes. S mutations, due to their transcription. In support carrying the K27M and G expression profiles, and strated a global increase Introduction ALDO-­‐KETO REDUCTASES IN CANCER Aldo-­‐Keto reductases (AKRs) are multifunctional enzymes that catalyze the reduction of several endogenous and xenobiotic aldehydes and ketones (Penning & Drury, 2007a). The AKR superfamily comprises 15 families containing over 150 members, which are further classified into subfamilies (Salabei et al., 2011). These enzymes utilize a wide range of substrates, among them steroid hormones, prostaglandins, retinals, lipids and sugars. Most of them prefer the use of NADPH over NADH as the reducing cofactor (Barski et al., 2008; Penning & Drury, 2007b). The AKRs are about 35–39kDA in weight and generally cytosolic and monomeric, although some, such as AKR7 can exist as a dimer and associated to membrane (Kelly et al., 2002; Kozma et al., 2002). Some of AKR proteins do not have or have a very poor enzymatic activity for typical substrates (such as MVDP, AKR1C12-­‐C13, Kvβ), and some of them have been shown to have structural roles, like Rho in the crystalline (Fujii et al., 1990; Weng et al., 2006). Mammalian AKRs have been classified into 3 families: AKR1, AKR6 and AKR7. Among them, the AKR1 family is the largest and has been further divided into subfamilies, from A to E. To date, 13 human AKRs have been described, and they participate in xenobiotic detoxification, biosynthesis and metabolism. Increasing evidence suggests the involvement of human AKR proteins in cancer development, progression and treatment. Some of them demonstrate multiple functional features in addition to being a carbonyl groups reductase. In this section we are going to review the most studied AKRs in cancer: AKR1B1 and AKR1B10. AKR1B1 in human diseases The most widely expressed member of the AKR1B subfamily is AKR1B1. Historically, it is the one that has received most of the attention, because of its role in diabetic complications and development discovered many years ago (Pastel et al., 2012). AKR1B1 is considered a causative factor for diabetic complications by converting glucose to sorbitol under hyperglycemia. Several studies have shown that inhibition of AKR1B1 could prevent, delay or even reverse tissue injury induced by hyperglycemia (Gabbay, 2004). Moreover, 56 c eCi a eti c q q l ni R l ntI n l 1 t t tes tc C a tc I i en C Ca t d1nsl ti di I t dl a l eC e l tc da tc I d ns ( c I ds eti c c l xl a tc t l u t d ns Ci u et d ns l x C i )s o ei c l xc teCi c p d ns c psu c ei 1n c i c % W-­‐ W Szac l eaC e Ct( l e ( x c c teCi o ei c l x q q u s % W Ci u et ei c c % W 1ni l 1ni dt1t l x e l ac t( Cl d 1Ci e et( I tc l e C i c sdl 0 a1C I ad e tc u c s C( t dW l i 1n I 1Ci l e e c c dWn d ao u t W nCi c t tc nau c etl l a l W c Cl 2 d c c te n l c i R c C I ad e & ! ! & & #% f a 22 d aec e nf l eah C er e ( Cti al r u c n s i s n c tl u l & CaI C l tl e c s C a tc I en i ) i Ca t tc x t tc a p p 1Ci 1i l ei i C W dtu tc etc I ) 1d tc r r r R ns q q ae n q q tl c tc a c eteau i C CaI l Wl a n l c c tc I WL88U% 0 aCen Cu i C W sei ei ) t q q 1Ci a l ns1 CI ds & ! r ueou C i c sdI Ci a1 i l i u WL8qL, tc F dd l aC( t( d s & '$ ( c e I i al i C en eau i C0 i C ) u 1d Wte tl oc i R c en e 1Ci u i e l tc eC l nWL8qL% 0 " & l Ct oWot c sW z dd ae d ao u t W z dd ae d ao u t Wdsu 1ni u Wu d c i u , Cx tc F c CW l eCi sei u l WI dti d l ei u l Wdt( CW & l Ct q/zo ei l eCi c % W c p d ns ti c % c i ) t tp WL88E% 0 q q tl a t9atei al ds ) 1C l l n C % 1C aCl i Cl W dt1n et WqW Lzc 1neni 9atc i c t C i sdxu ensdI dsi ) d c n ) c WL88ó, 1Ci a el q q C i c sd i u 1i ac l 0 l u t en ed l ei i ) t et( l eC l l W :U c eCi a eti c Rn e et( e l 1Ci u i e l l i dd I Ci R en u u dt ( c el c c tc I tc en et( eti c i 1Ci dt C eti c x tI aC LL% x WL88/% 0 iC i( C q q c u c e l L-­‐ l sc en l WR nt n tl c tc d u u ei Cs u i d ad en e eCtI I Cl c C de R ten c n c1- + 1ten dt d z3 R nt n WL88/, 1Ci l e I d c tc u " -+ n . 0( c 1- tl , -u %2' $ en . 0- 2$e( , n1$ / l3$ , " $ dd 1Ci dt C eti c tc -% 5 ( 2' c i u eCt d ( , ' $ 02 1. * $ $ , , # * 3, * * - " * ( 8 2( - , + ( & ' 2! $ # 3$ 2- 11- " ( 2( - , 5 ( 2' , - 2' $ 0 1 7$ 2 3( 2- 31* 7 $ 6. 0$ 11$ # 3, ) , - 5 , + $ + ! 0 , $ . 0- 2$ ( , c i C tc i u x d l WL88ó% 0 aCen Cu i C Wtc nt teti c i q q *i ad 5 ( 2' 2' $ * - 5 $ 12* $ 4$ * 1%- 3 2 * 72( " " 2( 4( 27 5 1 + $ 130$ # ( , 2' $ 1- * 3! * $ , # + ( " 0- 1- + 2' $ * $ 4$ * 1 - %2' $ %0 " 2( - , 1- %2' $ . 0- 2$ ( , $ 620 " 21%0- + 20 , 1%$ " 2$ # , # 3, 20 , 1%$ " 2$ # 1C ( c e tc d u u ei Cs tl l 9l " $ l * a* 1 31( n , & l. 9,l( 20-1l! $ tl, 8 * # c$ ' 7# $ l enu tc u t u i1 dl* - 5 ( , 2' $ ' $ 02 , # 2' $ , # dl9& * 7" $ 0 * # $ ' 7# $ ( , 2' $ * ( 4$ 0 " - * - , , # * 3 1' - 5 , ( , ! *$ 2' $ 1- * 3! * $ %0 " 2( - , - %2' $ 920 , 1%$ " 2$ # x u c WL88/, W " $ * * (1 $ 6' ( ! ( 2$ # WL88ó% 9%- * # ' 0( & ' $ 0l t" 2( 4(l 2 7 " -C0 + . 0$ # ( tc 5 ( 2' C3,c 20en , 19 c %$ 0 1- + $ 5 ' 2! $ 25 $ $ , 1 2' $ $ , 87+ 2( " " 2( 4( 27 # %$ " 2$ # " $ * * 1 5 ( 2' . 9, ( 20- ! $ , 8 * # $ ' 7# $ 1 13! 120 2$ - 5 $ 0 ! 32 i dd I a l n ( dl i l ni R c + en$ 130 eu ! t* $ i" 2(( 4( 2C7 )51C c! $ 25 $ $ , ,# , 1 # l$ l2$tc " 2$I # nau ( , ! - 2'c 2' $ . $ *q * $ 2q, l# ni 13.R$ 09 , 2 , 2 -% 920 , 1%$ " 2$ # " $ * * 1 ( , # ( " 2( , & 2' 2 2' ( 1 , - 4$ * cn c tc d u u ei Cs C . l0-1i2$ ( c, l+ ( & ' tc2 ( , d# a$ $ # tc. I- 11$tc11 C - 6( # l- 0$ # 3" 2sei 1$ $ otc , 87+ l 2( " d ( " 2( 4(dl27 c - " 2( 4( 27 5 1 %- 3, # ( , 2' $ 920 , 1%$ " 2$ # " $ * * 1 # $ 1. ( 2$ ( 21 c aeCi 1ntd au ad eti c tc en dac WL88ó% 0 " 72- 1* ( " I* - " c * ( 8 i2( en -, ! d 7t d$ 12$ d 0,dl ! x * - 2 ( tc C c en , 2' ( 1 0$ . - 02 5 $ # $ 1 aCC c eds c i d i l C a e l x %tc nt tei C tl ac C dtc t d ( da eti c tc25 - 17$ 23, ) , - 5 , + $ - + . 32 2( - , * , * 71( 1! ! # ! " # " 2 ' nau c l i C en 1C ( c eti c i c C0 i R ( CWl i u i q q I c tc nt tei Cl 2 2' $ 1$ 25 - & $ , $ 1 $ 6( - , . 0$ # ( " 2$ # 1$ / 3$ , " $ 1 5 ( 1 # $ 1( & , 2$ # 1 + 30( , $ - 02' - * - & - % ( , 2' $ ( 1 ( + t . l- 02 i , 2C! $ " t31$ n ( dC s I i c enCi aI n # 2 ! jl1$ 1 n' $ l/ 3$z12( - , -d%tc- 02 t ' -d* - & l7ea et + . * ( %7 %0- + 2' $ 2- 2 * 1. * ( " $ # 20 , 1" 0( . 21 5 ( 2' ( 2 " - 3* # * $ # 2" * $ 0 ( # $ , 2( " 2( - , - % 2' $ + 30( , $ - 02' - * - & - % ! 7 " - + . 32 2( - , * , * 71 # 2' $ 0$ ! c 7 al $ , ! *x $ 2' $u 31$ ) , - " ) - 32 i u 1dt eti c l c i ac ei l i ,Cnau u -dt% + - 31$ WL8qq% 0 ,# " 2( 4$ & $ , $ 1 , # 2' 22' $ 20 , 1& $ , ( " 2$ " ' , - * - & ( $ 1 2- ( , 4$ 12( & 2$ 2' $ . ' 71( - * - & ( " * %3, " 2( - , 6. 0$ 11( - , - % -% - " - + . 0$ 2( 113$ # ( 120( ! 32( - , - %2' $ 25 - 20 , 1" 0( . 21 $ 6. 0$ 11( - , 1712$ + 1 . 0- # 5 $ . $ 0%- 0+ $ # -, . , $ * - %2( 113$ 1 31( , & . 0( + $ 01 1. $ " ( " %- 0 * ( 22* $ 2- , - " 2 * 72( " " 2( ,# ! 0$ 1. $ " 2( 4$ * 7 ' $ . 0( + $ 01 5 $ 0$ # $ 1( & , $ # p p. r p pB r r a ! . 9, ( 20- ! $ , 8 * # $ ' 7# $ + - , # ( %%$ 0$ , 2$ 6- , 12- 4$ 0( %7 2' 22' $ " - 00$ " 2 1. * ( " ( , & - " " 301 1 1' 5 , ( , ( & ( 13! ( / 3( 2 31* 7 $ 6. 0$ 11$ # ( , + 30( , $ 2 ( 113$ 1 n i en C eR i u u Cl i en q u tds tc nau c l C q q8 c 1- , 1 %- 0 2' ( 1 0$ 3, " * $ 0 5 ( 2' 2' $ . 0- 2$ 5 ( 2' 2' $ $ 6" $ . 2( - , - %2$ 12$ 1 ( & ' $ 1220 , 1" 0( . 2* $ 4$ * 1 5 $ 0$ %- 3, # q q: 0 i C u c s s q q8 c eds d q q8 q q: WR l eni aI ne ei 0- 2$ ( , 1$ / 3$ , " $ ( # $ , 2( 2( $ 1 %- 0' 3+ t x d l Ct l 1Ci e tc s C0 ac eti c d i tc I t l 9a c I c ) 0 ! ) 0 ! ) 0o! ) 0 ! ael WL8qq% 0 Wc 0 d aen r t f r o m2. pph q q8 U8D i C /UD c eR C I ad eti c c ac eti c i i c eC CsWen C C0 l R c C l 1 t t tet l W i C r n n ea f l r h R ten R tdd l n 1Ci e tc q qWC l 1 et( ds x q q8 c cn d /% 0 q q: W( Cs dteed tl oc i R c li u dtI ne i c en 1tI c et q q: 0 u sCt ral e u c eti c q qWR n C l en l :7 1 q q: l n C óqD i en iu1 C i ae en d l e i c 0 c entl R i Co R c , # + - 31$ ) 0 ! l 1te en ntI n ni u i di I s c en , 1l a i I c Woc i R c l W te R l i R ( CW dto % 0 C x Cl i 1 1 Cl e dotc I W t C c i ae q q8Wu tc ds tc q q8 tl l tu td C tc 1Ci e tc l 9a c l ddi R en u ei n ( ) u 1d tc l aI C u e i dtl u W ei t C c e l a l eC e l q q8 c ci e C a ) Introduction efficiently glucose to sorbitol (as AKR1B1 does). AKR1B10 has similar reducing efficiency with AKR1B1 in a wide range of substrates, such as lipid peroxides (Aldini et al., 2007; Ravindranath et al., 2009), cigarette and environmental pro-­‐ carcinogen polycyclic aromatic hydrocarbons (PAHs) (Quinn et al., 2008) and cytostatic anticancer agents such as daunorubicin (Heibein et al., 2012; Plebuch et al., 2007). However, AKR1B10 has a special affinity to reduce All-­‐trans-­‐ retinaldehyde (and other retinaldehydes) to retinol, about 50-­‐fold higher than AKR1B1, what makes AKR1B10 a crucial enzyme in the retinoic acid biosynthesis pathway in some tissues (Ruiz et al., 2009). It has been recently observed the ability of AKR1B10 to do protein prenylation, which is a lipid modification, involving the covalent addition of either farnesyl (15-­‐carbon) or geranyl (20-­‐carbon) isoprenoids to C-­‐terminal cysteines of the target protein (Chung et al., 2012). This modification allows the proteins to be located in cellular membranes. Proteins that undergo prenylation include Ras and Ras-­‐ related GTP-­‐binding proteins (G proteins) and kinases, which are involved in cell growth, differentiation, maintenance of the cellular cytoskeleton and vesicle trafficking (Casey, 1994; Gibbs et al., 1996; Zhang & Casey, 1996). In contrast with AKR1B1, AKR1B10 shows restricted tissue distribution, predominately expressed in the small intestine, colon, stomach and adrenal gland (Cao, 1998; Hyndman & Flynn, 1998). But this restricted expression changes drastically in different cancer types where it is significantly upregulated. For example, in B-­‐cell and T-­‐cell acute leukemia as well as in chronic leukemia (Laffin & Petrash, 2012), liver carcinoma (Schmitz et al., 2011), lung adenocarcinoma, squamous carcinoma and smoking-­‐related Non-­‐small-­‐cell Lung Cancer (NSCLC) (Kang et al., 2011; Laffin & Petrash, 2012), pancreas carcinoma (Chung et al., 2012), breast carcinoma (Ma et al., 2012) and oral cancers (Nagaraj et al., 2006). The fact that AKR1B10 is upregulated in so many cancers is not a coincidence and actually the literature is plenty of examples about the benefits that overexpression of AKR1B10 have for cancer cells (Figure 23). As it occurs with AKR1B1, AKR1B10 can reduce damaging carbonyl radicals and anti-­‐tumor drugs (doxorubicin and others) promoting cancer cell survival. Also, AKR1B10 blocks ubiquitin-­‐dependent degradation of the Acetyl-­‐CoA carboxylase-­‐α (ACCA) and thus enhances fatty acid/lipid synthesis, which affects 59 oncogenic volved inin protein cell proliferation oncogenic function. nvolved proteinprenylation, prenylation, cell proliferation oncogenicfunction. function. nvolved in prenylation, cell proliferation oncogenic function. nvolved in protein protein prenylation, cell proliferation E-cadherin isis d apoptosis (Figure 6). Farnesol and geranylgerE-cadherin glycoprotein present th nd apoptosis (Figure 6). Farnesol and geranylgerE-cadherin is a aaa glycoprotein glycoprotein present present inin in the th and apoptosis (Figure 6). Farnesol and geranylgerE-cadherin is glycoprotein present in th and apoptosis (Figure 6). Farnesol and geranylgeradherens junctions of epithelial cells. Disruption iol, the reduced products of AKR1B10 from adherens junctions of epithelial cells. Disruptio niol, the reduced products of AKR1B10 from adherens junctions junctions of of epithelial epithelial cells. cells. Disruptio Disruptio aniol, the reduced products of AKR1B10 from adherens aniol, the reduced productsare of phosphorylated AKR1B10 from ofof the proteins comprising these junctions leads rnesyl and geranylgeranyl, the proteins comprising these junctions lead arnesyl and geranylgeranyl, are phosphorylated of the proteins comprising these junctions lead arnesyl and geranylgeranyl, are phosphorylated c eCi a eti c ofchanges the proteins comprising these junctions lead arnesyl andand geranylgeranyl, arepyrophosphates, phosphorylated toto in cell adhesion and dedifferentiation. to farnesyl geranylgeranyl changes in cell adhesion and dedifferentiation nto farnesyl and geranylgeranyl pyrophosphates, to changes in cell adhesion and dedifferentiation nto farnesyl and geranylgeranyl pyrophosphates, to changesexpression in cell adhesion and dedifferentiation nto farnesyl and are geranylgeranyl pyrophosphates, E-cadherin isis frequently downregulated spectively, which the intermediates ofof cholesE-cadherin expression frequently downregulate espectively, which are the intermediates cholesE-cadherin expression is frequently downregulate espectively, which are the intermediates of cholesE-cadherin expression isinvasive, frequently downregulate espectively, which are the intermediates of choles1212 or absent in highly invasive, poorly differenrol synthesis involved in protein prenylation. 12 or absent in highly poorly differen erol synthesis involved in protein prenylation. u tei ni c Ct d ac eti c W i ) t et( l e eal c d t1t 1 Ci ) t eti c i d d l c 12 or absent in highly invasive, poorly differen erol synthesis involved in protein prenylation. or absent in highly invasive, poorly differen erol synthesis involved in protein prenylation. ( c ea dds c n c tc I ddl aC( t( dx F i WL8qq% 0 ure 66 The proposed interactive role ofof AKR1B10 inin carbonals, farnesyl and lipid metabolism asas inin maintaining the homeostasis of igure The proposed interactive role AKR1B10 carbonals, farnesyl and lipid metabolism maintaining the homeostasis Figure 6 The interactive role of AKR1B10 in carbonals, farnesyl and lipid metabolism as in maintaining the homeostasis Figure 6retinal The proposed proposed ofapoptosis, AKR1B10 carbonals, the homeostasis inol to that is involved in cellular proliferation to pancreatic carcinogenesis. finteractive a 2P d crole aec e r n a nprotein uin aeo eprenylation p farnesyl p. and r and aand er ilipid o m armetabolism and i oand rcontributes o c asl innmaintaining eo lpancreatic etinol to retinal that is involved in cellular apoptosis, protein prenylation proliferation contributes to carcinogenesi etinol in cellular apoptosis, protein prenylation and and proliferation and and contributes to to pancreatic pancreatic carcinogenesi carcinogenesi etinol to to retinal retinal that that is isr involved involved l r n r in r cellular n el apoptosis, e n e protein a n r eomprenylation r n a r ueou lproliferation r n r a r e rcontributes h cn ael fr logy (2012) 25,25, 758–766 hology (2012) 758–766 hology (2012) 25, 758–766 hology (2012) 25, 758–766 m2. p2h i C en c ó: D i nau c 1 c C et u ae eti c W c nt ( en Cl CCs et( etc I I c 1Ci e tc C 9atC l 1C c sd eti c i C tel s i ( C ) 1C l l tc I q q8 x nac I c 1 Cn 1l i en C 1Ci e tc l W en tc C l c d ( d i WL8qL% 0 s 1C c sd etc I q q8 tl 1Ci u i etc I c C 1Ci dt C eti c 0 tc ddsW q q8 ) 1C l l ti c tc c i 1d l et c psu et C a eti c i C etc dei C etc i dW i c i u te c e c l nt e tc l tI c dtc I Ci u x atp WL88ó, q q8 C i l C( c eds 1Ci 1i l en e en q q8 tc q q8 tc c /8 t W ddad C 1Ci dt C eti c Ws n l nt c i dd I a l Ct u s tc c n c u c c CWen e R i ad l 1: Z e CI e0 n s en ) 1C l l ti c i ) 1d tc en a1C I ad eti c i Cl R ten 1: Z i ( C ) 1C l l ti c x C 9a c eds u ae e % 0 i R ( CW en C tl i ( C ) 1C l l ti c i x n l nt c WL8qL% 0 e tl R i Cen ei c i e en c R Ci d i et( eti c i 1: Z s il z 1 c ddl C l adel tc C l tc C etc i t t C c et eti c ei ac i 11i l CCbl et( tesWR nt n tl q q8 tc c Cl R ten i C R teni ae 1: Z ) 1C l l ti c WL8qZ% Wl i 1: Z tl c i e ) dal t( ds C l 1i c l t d i C en C I ad eti c i Introduction AKR1B10 and the implications of the protein in such crucial pathways makes the regulation much more complicated. However, gathering all the data about AKR1B10 in cancer, appears to be obvious the advantages of upregulating this gene, whereas in biology there is always a case that breaks the rule, and in this case is colorectal cancer, where AKR1B10 is downregulated in most of the patients (Laffin & Petrash, 2012; Ohashi et al., 2013). We are interested in this dual role of AKR1B10 in cancer, and mainly in the special relation between AKR1B1 genes and colorectal cancer. 61 Introduction RETINOIC ACID PATHWAY Vitamin A and its natural or synthetic derivatives (retinoids) have been shown to act as cancer chemopreventive agents (Niles, 2004). The relationship between Vitamin A and cancer was firstly described by Wolback and Howe in 1925; they observed higher proliferation rate in vitamin A deficient epithelial cells (Wolbach & Howe, 1925). Later on it was observed that Vitamin A deficiency elevated the spontaneous and chemically induced tumors in animals (Lasnitzki, 1955). Underpinning these reports, it was also seen that pharmacological concentration of Vitamin A added to the diet decreased the incidence of chemically induced tumors in animals (Bollag, 1972; Harisiadis et al., 1978). Vitamin A or its derivatives (retinoids) cannot be synthesized de novo by any animal species and are only obtained through diet mainly in the form of retinol, retinyl ester or β-­‐carotene (depicted as a carrot in Figure 24), the latter two would be converted into retinol in the intestinal cells. Vitamin A or retinoic acid pathway (head and tail molecules of the pathway) begins with the absorption of the vitamin, which is modified through a number of reductive reactions to the bioactive compound, all-­‐trans retinoic acid (ATRA). In fact, diet contains very little all-­‐trans retinoic acid and intestinal cells are mainly exposed to retinol and retinal. Retinoids are a family of numerous compounds (over 4000) chemically related to vitamin A. The basic structure of retinoid molecules is composed by a cyclic end group, a polyene side chain and a polar end group (Figure 24). Although many retinoids can be found physiologically, just few of them are known to be bioactives per se. Retinoids biological active forms can be summarized under three main structures: retinol and retinoic acid (or RA). · Retinol has six biologically active forms (all-­‐trans, 11-­‐cis, 13-­‐cis, 13-­‐di-­‐ cis, 9-­‐cis and 11, 13-­‐di-­‐cis retinol), being retinol all-­‐trans the predominant physiological form (Baron et al., 2005). · Retinoic acid (RA) active forms include all-­‐trans retinoic acid (ATRA), 9-­‐ cis retinoic acid, 11-­‐cis retinaldehyde, 3,4-­‐didehydro retinoic acid, and less commonly found 14-­‐hydroxy-­‐4, 14-­‐retro retinol, 4-­‐oxo retinoic acid, and 4-­‐oxo retinol (Baron et al., 2005). 62 Introduction It is known that retinol is acting in a non-­‐retinoic acid receptors way, whereas RA and oxo-­‐RA work activating the classical pathway. The starting metabolite can be different, but all of them converge to retinol, which is reversibly oxidized by retinol dehydrogenases producing retinal. Subsequently retinal could be irreversibly oxidized to all-­‐trans retinoic acid (ATRA) by retinal dehydrogenases. Retinoic acid is oxidized to more polar metabolites (such as 4-­‐oxo-­‐RA, which can also activate RARs) by cytochrome P450 family members such as CYP26A1, -­‐B1, and -­‐C1 (Tang & Gudas, 2011) (Figure 24). Retinoic acid exerts its functions through two distinct nuclear receptors, retinoic acid receptors (RAR) and retinoic X receptors (RXR). Both of them have three different subtypes: α, β and γ. Each of the receptors possess different affinities for their ligands, but once bound RAR and RXR form heterodimers and activate downstream factors by binding to the retinoic acid response elements (RARE), which are normally located in the gene promoter (Bushue & Wan, 2010; Tang & Gudas, 2011). More than 500 genes have been reported to be regulated by retinoic acid (Theodosiou et al., 2010). Retinoic acid receptor pathway controls many important and diverse functions such as cell proliferation, cell differentiation, neural and vision functions, immune processes and the proper establishment of the body plan during early development. In the last years retinol has been proposed to inhibit the growth of colorectal tumor cells by an independent RA-­‐receptor mechanism (Park et al., 2005). Although it is unclear how this inhibition is achieved, several labs have found out different antitumor pathways activated by retinol treatment such as the inhibition of β-­‐Catenin (Dillard & Lane, 2007) or the loss of Phosphatidylinositol 3-­‐Kinase Activity (Park et al., 2008). In summary, retinol, ATRA and oxo-­‐RA (and close derivates) are the main bioactive retinoids with antitumorigenic activity described. 63 c eCi a eti c Cyclic Polyene side chain Retinil etinil Ester Polar All-trans tran trans ns retinol ns reti ns retinaldehyde re etina et All-trans reti et acid All-transs retinoic All-trans 4-oxo o retin retinoic acid and other polar retinoic acid metabolites r f a 2R d a r c o l n eo n e n a n r e n n c a r e n el c ef r r n 1t u ti di I t d c c tu d u i d l ea t l n ( 1Ct( eti c tl tC eds i CC d e i e c WL88L, d t C c et eti c c n u i 1C ( c et( 1C u dtI c c e c d1 Cc l ic R ten n l 1Ci z 1i 1ei et I c el x c ddt ntI n C Ctl o i WL8q8, C tc F eau i C ( c e x i c I Wqóó8, WqóóZ% 0 n l C etc i t z l C x ac F C tc I al l s d Cl otWL8q8%ei eC e WL888% c bc C c c etz1Ci dt C et( W1Ci z Wqóó/, Wqó7/, aCt aaen en e ( te u tc ( di 1tc I el i C etc i t l Wen l u dtI c c e d l ti c l x d c l i cI o naf nf a h u i c l eC e Wqó78% 0 aCen Cu i C W a ei en WqóóE, l ei Ctc i c ns i r nh WL88q, eC eu c el n ( ( tc o Wqóó: , ( c ei 1C ( c e aei Wqóó/, c 11dt ei du i l e ( Cs etl l a 0 n tu 1i Ce c i C etc i t l tc c C 1C ( c eti c c eC eu c e n l C t( di e i ee c eti c WR n C l en C I ad eti c i c i I c i al C etc i t l 1 enR s tl l etddc i eR ddac C li u C etc i t /E Cl ei i 0 n C t 1 enR s x da l i ae C I ad eti c i l i u i en 1 enR s%I c l W i C ) u 1d W S R nt n tl 1d sl Introduction hypermethylation in some cancers (Hayashi et al., 2001; Narayan et al., 2003; Wang et al., 2003); ALDH1A2 which is downregulated in prostate cancer (Kim et al., 2005); CYP26A1, which is found highly expressed in breast cancer (Osanai et al., 2010) and LRAT which expression is also decreased in some cancers (Mongan & Gudas, 2007). To date, no attempt has been made to fully characterize the epigenetic regulation of the retinoic acid pathway in cancer. In this study, we perform a comprehensive analysis of genetic and epigenetic alterations in this pathway and we evaluate the prognostic and diagnostic applications of gene expression and DNA methylation markers in human colorectal cancer. 65 Objectives OBJECTIVES AKR1B1 enzymes have an important role in multiple biological processes, such as inflammation, differentiation and sugar metabolism. AKR1B1 genes are included in the retinoic acid pathway; these enzymes reduce retinal to retinol, which finally will end up in retinoic acid. We hypothesize that retinoic acid pathway genes, especially AKR1B1 subfamily, display an altered expression pattern through the specific DNA hypermethylation during colorectal tumorigenesis. This work is focused on understanding the epigenetic alterations of retinoic acid pathway genes in colorectal cancer and the applications that those changes may have in terms of diagnostic, prognostic and therapeutic strategies. The general objective of this thesis is to bring light into the mechanisms regulating AKR1B10 and AKR1B15 genes and what is their role in colorectal cancer. To address this goal we propose the following specific objectives: · To elucidate the epigenetic mechanisms regulating the expression of AKR1B10 and AKR1B15 genes in normal colon and in cancer cells. · To determine the functional implications of AKR1B10 and AKR1B15 deregulation in colorectal cancer. · To evaluate the utility of AKR1B1 CpG island hypermethylation as a non-­‐ invasive screening biomarker for colorectal cancer. · To characterize the gene expression and changes in the DNA methylation profiles of retinoic acid pathway genes in normal colon and in tumor samples. · To evaluate the use of molecular alterations of the retinoic acid pathway genes in the management of colorectal cancer patients (prognosis and therapeutic strategy). 69 Materials and Methods SAMPLES Patients’ samples Normal and tumor tissues were available from 25 colorectal cancer patients. DNA methylation and mRNA expression of the AKR1B1, AKR1B10 and AKR1B15 genes were analyzed. A set of 16 patients samples were collected from the Institut Català d’Oncologia (ICO, Barcelona, Spain) and 9 from the Hospital Universitari Germans Trias i Pujol (Badalona, Spain). The mean age of these patients at the time of collection was 69 years, in a range between 48 and 86 years (Table 7). Both genders were well represented, with 12 women and 13 men (Table 7). Tumors were evaluated according to the tumor node metastasis (TNM) staging system (Hu et al., 2011). Samples were fresh-­‐frozen at -­‐ 80ºC within the two hours of removal. !"#$%&'()*$ +,$ -$%*$. '/01'2&",$ 67 8"% 99 (3454 (345: ;< 8"% 999 (345= >; ?)8"% 999 (345< ;7 8"% 999 (345; <; ?)8"% 999 (345@ @; ?)8"% 999 (345> @< ?)8"% 999 (3457 @: ?)8"% 999 (34:4 ;= 8"% 999 <64>5:45 @= ?)8"% 999 47A6 >4 8"% 999 <64>54<@ @4 8"% 999 <64>54;4 <7 ?)8"% 9B <64>54;6 6> 8"% 999 47A;= ;= ?)8"% 999 47A5;4 >6 ?)8"% 9B 47A6<6 >4 ?)8"% 999 47A@=; ;@ 8"% 999 47A>5@ @= 8"% 9B 47A>5= <5 ?)8"% 99 47A6=@ ;6 8"% 999 47A<=4 ;> 8"% 9B 47A5: @= 8"% 9B <64>47>4 @= ?)8"% 9B 47A;7@ >5 8"% 9B Table 7 | Relevant clinical data for the twenty five patients examined, the two sources of samples are represented in different colors, lime for Hospital Universitari Germans Trias i Pujol and green for Institut Català d’Oncologia. Human stool samples and associated carcinoma tissues A total of 143 stool samples were collected at the Institut Català d’Oncologia (Barcelona, Spain); 45 of them from patients with colorectal carcinomas, 35 from patients with colorectal adenomas, 5 from patients with colonic inflammatory bowel disease (IBD) which could be either ulcerative colitis or Crohn’s disease, finally 58 control subjects who underwent surgery for diverticular disease or an endoscopy that revealed no lesions. Stools DNA obtained from healthy individuals paired by age and sex were used as control group. For 7 carcinoma patients (Carcinoma 27, 28, 29, 33, 34, 38 and 41) we also had the DNA from the tumor, what enabled us to compare among the DNA methylation of the tumor and the stool of the same patient. 73 3 ot i7 s 3an 7 P pe’i p t 7 l di 7 u o n 3 ts ts nii o ins R d ts I u an donmt ins R d ts I donmt UG8R donmt UTHR no a 7 l di + - $, $. ( $. ) ( *(+ & $ L751 L752 LL397 LL349 LL392 LL352 LL393 Pn 3a Tj l ts gº 7 l di 7 U8j 1 a o ts 7 ot m l mPplP ps l s HGPR U8U s o1 s s l t R o1 gP l t ' ( ) '#) '#* * ( #' ( #( ( #) ' ( ) * (, + , ! ' ! ( ! ) ! * ( *, i 9x U8HR 3a 3a o ins R d ts IR donmt no 3tns u t3a o3 o1 tM 7 6 tm 7 6 No HGj R R R 3ii 6 R HT) R j T9R j THR a o 3 ot73t 7 s l 3 ot i i 41 $ $ $ $ ! ! ! ! e s Hp p e ’ i p n icr Pn l PpplH cf ii iPn p ii ii its 7 N7 nii 3tns 6 onl jG ts 3at7 u nor u o n 3 ts IR w d3 no 6 n7dt3 i 3 onl 3a Ru at a u 7 donmt in o M 3R d ts I1 l ot s v o1 vd Ni3No s i 73 ii o 3 ot i7 s ii ii7 u o Monu s 3 Uj S n t t its 6 Mi tNl 6 s T-­‐ I u t3a 7nl 7d t t t3t 7 Ni d s ts Mns n07 a ii ii iPn p Hp Pn l Pp plH cf E Hi s gp s PP E h iHl e Pn R E l i s uPn mHe f ii ’ ms H lp m Uf ® ii7 u o jT Ni3No l 3ovd7ts tb R 3l n7da o Rts nl di 3 i 8I1 i q x ii HilHm m HPm e nlp s ml i PHe R cmE s PHe cmHu l R ms e , nuPlms n| mip | | ts H 3an 7 H inu 4) -­‐ n Ni3No U 3tl i 7r 71 niinu ts M 7d ou IR s 3a s s 3t tn3t 7 s a r s 7t3v s 3 inu d 77 M 7Rs n l no 3a s HTR o nl l r RN7ts M ovd7ts B) 1HMg tiN3 G 3n 4 ni 1 d otn t iiv no s 3tns 7R ii7 u o 6 s mt3onM s R oi7 ii7 u o Ni3No ts 7s R n ns 3 l ts 3tns 6 nNs M R H) 9) I1 no a wd otl iN dn7t3tm 7d t t wd otl s 3R ii7 u o ii7 u o w iN nNs 3 IR3a s N7ts M 3a a l n v3nl ii7 u o di 3 3 o 6 ovd s 7 ddondot 3 no 3a s 31 jT 3 ot i7 s 3an 7 ls mp 9 9) Bd ao B s B9 m 3no7 6 donmt v 9 9TBd i 9) I u o r ts iv o1 Nl N3cs nl oo57 6 s tm o7t3 3 o ins R ii27R d ts I 6 s tm o7t3v n B s o1 o s vni i M nNt7mtii R 1 i o7r v s 3N r vR I 9 9TBd B o 7d 3tm iv1 9 9) Bd ao B s B9 ts 7 o37 u o U19 º ins ts 3n d vMon m 3no 6 s mt3onM s R R IRu at a iinu l dt tiits o 7t73 s tM 73 3a 3a P Hm àMx’ donl n3 o 6 tMNo HTI1 ii m 3no 9 9) Bd l d3v m 3no d R 3a avMonl t ts 7 i 3tns 1 ii m 3no7 ns 3 ts s oi7 B s OfCy c ms D u ls me ’ àMf d7 o dt 3 9 9TBd Bao ts s s w 1 B9 m 3no7 s U19g vMon 6º I u t3a 3a o 73ot 3tns s bvl 7 ts t 3 ts i 9) 1 i CI x lHm ps l 9 9) Bd ’ i pe P p e ’ is c B s M on7 M iR 3 9H) 7 s dNot t tni 9 9TBd Bao no U) l ts 1 a s 3a N7ts M 3a M iR po s R ol Not t Pn l PpplH cf N i n dts O l ts N3 7R 7 o nl l tM 73tns u 7 oNs ts 3n 9-­‐ ddondot 3 7tb i s s u 7 N3 ts i s BNd r t3 6 R u t3a s 3 o 3t an7da 3 7 6 u I 3 Uj S no 9 anNoR s 3a s ts s v 3a l s N 3tm 3 jP a o vB s Mi s 3 PTS no T 3No o1 at7 don 77 o l nm 7 3a T0 dan7da 3 7 mnt ts M3a m 3no o B to Ni otb 3tns s ts o 7ts M3a itM 3tns 1 a s vI1 m 3no7 u o ts N 3 7R m oivR B9 t t s v n Materials and Methods Vector and insert were ligated using T4 DNA Ligase (New England Biolabs, Beverly, MA, USA) in proportion 1:3 respectively. The reaction took place at 16ºC during 4 hours. Vector amplification All vectors were transformed in DH5-­‐α Escherichia coli strain by heat-­‐shock procedure. Transformed bacteria were seeded into LB agar, at 50 µg/ml of ampicillin. Plates were cultured overnight at 37ºC. Individual clones were selected and amplified in liquid LB at 100 µg/ml of ampicillin, in a volume of 5ml or 250ml according to the experiment. For small amounts of plasmids, and starting from 5ml of grown LB media, we used the GenElute™ Plasmid Miniprep Kit (Sigma-­‐Aldrich, St Lois, MO, USA), eluting in 100 µl of pure grade water. In larger scale experiments, we started with 250ml of grown LB media and purified the vector with the GenElute™ HP Plasmid Maxiprep Kit (Sigma-­‐Aldrich, St Lois, MO, USA), eluting the purification in a final volume of 3ml of pure grade water. CELL CULTURE DNA transfections All transfections were carried out in 6-­‐well plates, seeding 150,000 cells per well at day 0. Cells were transfected with Lipofectamine® 2000 (Invitrogen, Carlsbad, CA, USA). Transfection (day 1) was performed when cells were 70% confluent, as recommended by the manufacturer. Ten µl of Lipofectamine® 2000 were diluted in 480 µl of Opti-­‐MEM® (Invitrogen, Carlsbad, CA, USA) and incubated for 5 minutes at room temperature. Then we diluted 3 µg of the plasmid in 495 µl of Opti-­‐MEM® and mixed together with the Lipofectamine® 2000/Opti-­‐MEM® solution, incubated for 10 minutes at room temperature. After, we added 1 ml of the mix to each well in a drop wise manner. Cells were incubated at 37ºC for 5h, after this time the transfection media was removed and substituted by fresh medium. 77 Materials and Methods In the case of vectors carrying resistance for hygromycin, selection of transfected HCT116 cells was done by adding 100 µM of hygromycin B (Invitrogen, Carlsbad, CA, USA) to the media for 10 days (changing the media every two days); afterwards the antibiotic concentration was decreased to 50 µM. Untransfected HCT116 cells were used as a control and treated with hygromycin B in the same conditions until death. Lentiviral infection Infectious lentivirus particles were generated and packed using the 293T cell line. We used a second-­‐generation system with co-­‐transfection of three plasmids: (1) the lentiviral vector pLX302 that contains the gene of interest (AKR1B10 or AKR1B15) and LTRs (Long Terminal Repeats), (2) the pCMV-­‐VSVG plasmid for pseudo-­‐typing with VSVG, allowing the lentivirus to infect a broad range of cells, and (3) the psPAX2 plasmid with gag, pol, and rev genes (Naldini et al., 1996). As a transfection and infection control we used a GFP lentiviral plasmid instead of AKR1B10 or AKR1B15. The virus generation and the infection process were performed following the standard protocol (Tiscornia et al., 2006). Dznep treatment In order to know the relevance of the EZH2 protein in the inactivation of the enhancer, we treated HCT116 cells with the EZH2 inhibitor 3-­‐Deazaneplanocin A hydrochloride (DZNep) (Sigma-­‐Aldrich, St Lois, MO, USA). Cells were treated for 72 hours with 5µM of DZNep, replacing the medium every 24h. All-­trans retinal treatment HCT116, Sw480 and HT29 colorectal cancer cell lines were treated with All-­‐trans retinal (Sigma-­‐Aldrich, St Lois, MO, USA) for 24h at 0.5 and 2µM. 5-­aza-­2'-­deoxycytidine treatment To study the importance of the methylation in the regulation of the genes studied, we treated cells with the demethylating drug 5-­‐aza-­‐2’-­‐deoxycytidine (5-­‐ AzadC) (Sigma-­‐Aldrich, St Lois, MO, USA). 5-­‐AzadC is a nucleoside analogue that is converted into nucleotide and incorporated into the DNA. There, 5-­‐AzadC can 78 Materials and Methods trap DNMTs by forming covalent complexes (Sheikhnejad et al., 1999), resulting in global DNA demethylation in a replication-­‐dependent manner. We seeded a total of 1.5x106 HCT116 cells (106 in the case of control cells) in a 10 cm2 plate and treated for 48 hours with 0.5 µM of 5-­‐AzadC, changing the medium every 24 hours. After 48 hours we removed the 5-­‐AzadC medium and let the cells recover with normal medium for 24 hours. Then cells were collected. To verify the success of the treatment we analyzed the re-­‐expression of the silenced genes EN1 and INHBB, by qPCR and the demethylation of their CpG island associated promoter by bisulfite sequencing (primers are in the Annex II and III). Luciferase enhancer assays To test the enhancer capability of some sequences of the AKR1B1 locus we used the pGL4.23[luc2/minP] vector (Promega, Madison, WI, USA), which is specially designed to test luciferase enhancer activity of the fragments inserted. We first amplified the selected sequences using the Phusion® High-­‐Fidelity DNA Polymerase (Promega, Madison, WI, USA) to avoid any PCR error. Then PCR amplicons were inserted in the multicloning site (MCS) of the pGL4.23 vector (Figure 26A). pGL4.23 vector is mainly composed by a MCS, a minimal promoter and the firefly luciferase gene (Figure 26B). The different constructs and the empty vector were transfected in different wells, each of them in quintuplicate (in 5 wells) and in at least three independent experiments. The assay was done using the Dual-­‐ Luciferase Reporter Assay kit (Promega, Madison, Wi, USA) in accordance to the manufacturer’s instructions. Luciferase activity was assayed using 10 µl of the cell supernatant and the Dual-­‐ luciferase reporter plasmid system (Promega, Madison, WI, USA). Luciferase measurements of the different fragments were normalized against Renilla luciferase activity (cotransfected with the pGL4.23) to determine the relative luciferase activity and the fold activation. Luciferase/Renilla signal was analyzed with a Centro LB960 luminometer (Berthold technologies, Bad Wildbad, Germany). Empty pGL4.23 vector was included as control. Next, we detected 79 RVprimer3 Multiple cloning region Minimal promoter luc2 reporter gene 3SV40 ot i7 s 3an 7 late poly(A) region Reporter Vector primer 4 (RVprimer4) binding region ColE1-derived plasmid replication origin (Ampr) 3a toSynthetic iN t β-lactamase o7 3tm t3t 7coding ts region ii7 u t3a Synthetic poly(A) signal/transcriptional pause signal wd Reporter otl sVector 371 primer 3 (RVprimer3) binding region t o 1–70 78–108 141–1793 1828–2049 2117–2136 2374 3165–4025 s 3 m ot s 37 ts 4130–4283 4232–4251 5´...ACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCA Synthetic poly(A) signal/transcriptional pa SfiI Acc65I KpnI BglI EcolCRI SacI NheI XhoI EcoR GGCCTAACTGGCCGGTACCTGAGCTCGCTAGCCTCGAGGATAT 3 i 73 U ts d s SfiI BglI s3 HindIII GGCCTCGGCGGCCAAGCTTGGCAATCCGGTACTGTTGGTAAA Synthetic poly(A) signal/ transcriptional pause site (for background reduction) A AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAGCTT minP Ampr ori Acc65I KpnI EcoICRI SacI NheI BmtI XhoI EcoRV BglII HindIII pGL4.23[luc2/minP] Vector 2067 SalI 2061 BamHI (4283bp) SV40 late poly(A) signal Figure 2. Multiple cloning region for the pGL4.23[luc2/ 15 19 24 26 28 32 34 42 47 66 Sequence information and restriction enzyme tables for the pG available online at: www.promega.com/vectors For more information see the pGL4 Luciferase Reporter Vecto #TM259, online at: www.promega.com/protocols Minimal promoter B 5948MA luc2 Figure 1. pGL4.23[luc2/minP] Vector map. pGL4.23 + Fragment Empty pGL4.23 P Hm à8 x U ’ plH cf . fàOG n 3 73 anu l o Ml s 3R u ddit 3o s 7 l 3 3a d ye Pn j u ls me ’ 3avi 3tns G1HU m 3no u t3a 3a 33a to73 l l sa s 3avi 3 3avi3o s 7 o 7 6 ts s bvl 3n o M on7 M iRu a o 3a 3 ol ts o pP p 37 3a m ot 3tns n 3a 3avi 3 R ts no o 3n nNi U e s sa s o 73 s P m nl ’ d o l ts 7 o3 . fàO Hp tit3v n 3an 7i 3 6 tMNo Hj I1 o Ml s 3 Ns l u a 3a o t o s Pn l 7 ns 3avi 3 l no 3avi 3tns 3tmt3v1 3a d G1HU º R d7u at aR 3a l 3avi 3 7to i s i s B d r t3 6 3a dNot t don N 3 u 7 N7 s o Ml s 3 m 3noR N7ts M 3a R IR 3 ou o 7 u o Ml s 31 a u 7 N3 s u t3a tM 73tns u 7oNs ts 3n 9-­‐ dNot t a o vB M iR po s R ol 3n 77 77 3a l tM 73 77 N7ts M3a s vI1 7l N i n7dts ii l nNs 3 n 3avi 3tns 73 3N7 n 3a o Ml s 3R P P the USA 800-356-9526 · Telephone 608-274-4330 · Intern v 3Promega u n tsCorporation d s · 2800 s 3Woods tMHollow 73tnsRoad·Madison, 7R u t3a WI l53711-5399s U.S.A. l· Toll Free 1 inn3 a s bvl 7 o t7n7 atbnl 3a 4) o7 3a 3 N3 3a 7 hN s 7t3 u t3ats 3a 3 oM 3 t7 l 1 nu m oR l 3avi 3 Ru ati l t7 in r u tii N3 n3aRl ua s 3avi 3 3 ot i7 s s Ns l l 3avi 3 1 3a l N73 in r ns 3oni no l 77 l 3avi 3tns u 7 noo 3 3a 1 s Ns l 3avi 3 3an 7 tM 73tns u t3a 3a u 7 i7n 7 dn7t3tm 1 #) ! ! ! ! & "$ % ! P Hm àz x e s l 3 ou o 73a l 3o s 7 3 ts iivRu N7 m e nl Pn n Hne l ci l 7 Ml s 3u 7itM 3 99P 77 s bvl o 7Ni37 n 3a Hm ls Pnp ml e l ci l 3avi 3 3n u t3anN33a 3a ’ ms ii71 a ts 3a l Ns l 3n 3a 3avi 3 3avi 3tns o ns 3oni u 7 ns ts d o ii i 3tns 6 tMNo Hj I1 a s nol 3avi 3 3a ti nwns 3 73ts no o 3n 77 77 3a 73 3t73t i 7tMs t t s 3u l G1HU m 3no s Ns l t o s s l d3v d u ls mf 3avi 3 3o s 7 3tns 7 u o s 3a 3u n 7 l di 71 nno ts 3 7 n itb nl d o 1 n a o Ml s 3 o ts ss w 1 ii ms iP m lPs n pp c N7 3a s t s R 9 9T1 ii donit o 3tns r t3 6 I 6 n a I 3n 73N v 3a mt tit3v n 3a t7 ninotl 3ot onit o 3tns t3 l t3n ans ot s bvl no s M nino u 3 oB7niN i 7 i3 6 7 3a 3 o u t3a 3 ol ts 3a s Nl N7 7 HRUB t7B6HBl 3 3o bnitNl BTB o nw s tit 3 9 9) s 77 v no 3a s ns Bo tn 3tm hN s 3t t 3tns n ii donit o 3tns s mt tit3v1 s no o 3n ii ii7 3o s 7 t Ms n73t 7 nodno 3tns R d I1 o n mt i ii7R 3anwvBGBs t3onBTB7Ni nda s viIBH B s iv i 3n o N itmts M 3n nol ii7 a m 3tm b s Ru at a t7 s v 6 tMNo H4I1 49 Yh development of methods, such as incorporation of radioactively labeled 3H-thymidine into DNA or the use of 5-Bromo-2‘deoxyuridine (BrdU) as a substitute for radioactive thymidine to label DNA in living cells. The above methods have a number of disadvantages, including: use of radioactive materials and relatively complex 3 ot i7Thesuse of tetrazolium 3an 7 salts, such as MTT, commenced in the 1950s, is based on the fact that living cells reduce techniques. tetrazolium salts into colored formazan compounds. Vn X^iniZhi^c\ dVXi^kZVhhVn i^c\VcYk^VW^a^in d[XZaah EBH b^idX]dcYg^Va YZ]nYgd\ZcVhZ MIIiZigVoda^jb MII[dgbVoVc I]ZiZigVoda^jbhVaid[MII'!("7^h"'"bZi]dmn")"c^igd"*"hja[de]ZcnaR"'="iZigVoda^jb"*"XVgWdmnVc^a^YZhVai^hVc^ccZghVai!i]Vi^hXaZVkZY P Hm à9 x P i iipm H lPs n s ls l o l mhps iH i s me r n p ilf id[dgbVoVcWni]ZhjXX^cViZYZ]nYgd\ZcVhZhnhiZbd[i]Zb^idX]dcYg^VagZhe^gVidgnX]V^c#Dcana^k^c\XZaah!edhhZhh^c\Vc^ciVXi b^idX]dcYg^Va bZbWgVcZVcYVahdVc^ciVXiXZaabZbWgVcZ!Yd]VkZVXi^kZYZ]nYgd\ZcVhZ#6\Zcihi]ViY^hgjeii]ZbZbWgVcZhVcYYZhigdni]ZgZhe^gVidgn X]V^cl^aa^cVXi^kViZi]ZZconbZVcYi]ZgZ[dgZi]Z[dgbVi^dcd[i]ZhdajWaZdgVc\Z[dgbVoVcWngZYjXi^dcd[i]ZnZaadliZigVoda^jbhVai# I]ZgZVXi^dcgZfj^gZhi]ZegZhZcXZd[VcZaZXigdcXdjea^c\gZV\Zci!l]^X]^he]ZcVo^cZbZi]dhja[ViZ!hZgk^c\VhVc^ciZgbZY^ViZZaZXigdc a o no R 3a ns s 3o 3tns n 3a v t7 dondno3tns i 3n 3a s Nl o n VXXZeidg# l 3 nit iiv l s N a 77 v u 7 d o nol t7 MNi oiv s 3 o7d Noo s 3iv 3a 3 as ninMv no M s nl ano3 77n t 3 s nM s nN7 s Mts ots M 6 sN i 7 R 3 ot i I ts 3n it o 7ts Mi 781 a s atl iiR 3a 6 s s t7tRH) 9UI1 a M g anl ninMv 7 hN s 78 nl di wt7 o oNt3 3u s 3a ts 3a M s nl t M 7 hN s tl l 4H 78 I 6 tMNo H8I1 s ts 3tns n 3a 3o s 7B 3tm 3ts M u t3a 3a 7 ni ts Mdond o3t 7 n s o77 hN s s s 3a 78 o l n t t no d ol 7 o in 3 3a ts s s w 1 7 Bd tots M s 3 3n 3a e s3 1 a N7ts M 3aonNMa ns 3 oM 3 n3t 6 nN i I ts ts M n 3a 78 3n 3a M s nl t 3 oM 3 7 hN s o d to s s 3iv 78R3a M s nl t 3 oM 3 o 3 oM 3 7 hN s wdo 77 v 3a nl di l noo 3 on3n7d s N3 n3a 73o s 7 n 7 3a I 3o s 7 otd31 a M 77 Ni ts ts Mn t 3 iv niinu ts M 3a 78 nl di w in itb 7 3a 3a u ti B3vd 6 6M 3n 3a 3 oM 3 7 hN s 1 no 7N o 3u n t73ts 3 nl 6 3tm 3ts M s o 7 hN s l N73 i7n ns 3 ts 3a g t7 ot MNt 7 hN s M MNt 3o o dotl s ns N i 7 s s ns N i 7 Rts 3at7 M s nl t 3 oM 3 7 hN s t7oNd3 I vd B Nt ts 3n 7ts Mi 3o s 7 otd31 a s 3a M ts 3a d 376 RH) 9UI1 a o s ts 7 3a 3 oM 3ts M7d t t t3v n 3a 3a 3o o its onl t l n73 nl l ns iv N7 nl dns s 37 3n 3at7 7v73 l K MNt nl no ts M 3n 3a PlPn v iN73 o 7v73 l ii71 3No o07ts 73oN 3tns 71 ns e a 3tm 3o s 7n 3a 3 o r n 3u n M s o i o d to 3 ot i7 s d 3au v7K a ns B nl ninMnN7 s nl ninMv to 3 P Hm àq x e il mPn Pn e s pl s l a d to 6 nts ts M6 I nPpe s lPs nf pq o s Hi ’ ms H p pl PnPlP i p H n f ’l ms e s i 3n o l t7oNd3ts M3a nd s o o hNto 7 3a do 7 s t3a Niiv ndt 7 3a 7 hN s d t t s N i n3t u t3a 7at 37 s gno do l ts M o l n a sM 7 o d to d 3au v no 3a I d 3au v1 o d to d 3au v n 3 s o 7Ni37 ts ts 7 o37g 7t3 3a 3 3an 7 6 s H i plm n nnPpP| àI COf m t Pn l i 3tns 7 6 s i7I 3 3a 3No 73nd n ns 7R I n 3a 3 oM 3 Ms 1 a o d to 3 l di 3 Ru at a t7 N7 s ts 3on N ts 3n o d to 3 l di 3 1 n d o nol ts t 3tns 7n a s Ms 3No don3n ni d d o 6 s 1 N3 3 oM 3 7 hN s 3 oM 3 wd otl 3tm iv d 3au v 3n tw 3a n 3a o d to 3 l di 3 3n 3a | Ms s 37 u 1 v 3a N7 n niinu 3a RH) 9UI1 4U Materials and Methods DNA METHYLATION ANALYSIS Genomic DNA extraction Genomic DNA extractions were done using the PureLinkTM Genomic DNA Mini Kit (Invitrogen, Carlsbad, CA, USA), according to manufacturer’s instructions. DNA was eluted using elution buffer and quantified using the NanoDrop (Thermo Scientific, Rockford, IL, USA). Bisulfite treatment There are different methods to study DNA methylation at specific genomic loci (Laird, 2010; Lister & Ecker, 2009). They range from methylation-­‐sensitive restriction enzymes to Methylated DNA immunoprecipitation (MeDIP) (Down et al., 2008) and bisulfite modification of DNA (Frommer et al., 1992). Sodium bisulfite modification followed by sequencing is currently the gold standard in DNA methylation analysis as it provides single base resolution and the highest coverage (Lister & Ecker, 2009). Sodium bisulfite treatment deaminates unmethylated cytosines (C) to produce uracil (Figure 30A), while methylated cytosines (mC) remain unaltered. Uracils are read as thymines by DNA polymerase. In that way, umethylated cytosines will appear as thymines in sequencing of PCR amplicons obtained after sodium bisulfite treatment of DNA. Alternatively, methylated cytosines will be preserved as cytosines in the electropherogram (Figure 30B and 30C). By comparing the modified DNA with the original sequence, the methylation state of the original DNA can be inferred. Bisulfite conversion was performed using the EZ DNA Methylation™ kit (ZymoResearch, Orange, CA, USA), using 250 ng of DNA as starting material and eluting in 50 µl of elution buffer. 84 3 ot i7 s 3an 7 A B 5’- CATTCTAGCGATCTCGAATCGC -3’ ! 5’- UATTUTAGCGATUTUGAATCGU -3’ ! 5’- TATTTTAGCGATTTTGAATCGT -3’ ! C G G G CG TTTG CGG TTG G CG CGT CG TTG! G G G TG TTTG TGG TTG G TG TGT TG TTG! P Hm OI x U e Pn lPs n s U s PHe PpHi Pl lm np s me e l ci l cls pPn p , Pn iH s n Pp Hiic e l ci l n l l cls pPn i Pn ls m Pi HmPn l ps PHe PpHi Pl lm le nlf lPs n| Hne l ci l cls pPn p ,Pn m U m s nu ml ls Hm Pip o Pi U m e Pn Hn l f U i lms ’ ms m e s lo s p e ’ i p| l H’ ’ m is o ms n PpHne l ci l f PpHi Pl p H n Pn t7Ni t3 3o 3l s 3 t7 a ol Ni 3n s o 7Ni37 ts atMaiv o Ml s 3 Rt3 ts 3on N 7 m otnN7 7ts Mi B73o s 1 3a 7 73o s s o r7 l ns 73o 3 4T Materials and Methods that this degradation affects between 84–96% of the total DNA (Grunau et al., 2001). Because of the poor quality of the DNA recovered from bisulfite treatment, nested PCRs were performed to improve the performance. Two µl of bisulfite converted DNA were used in the first PCR (external). The second PCR (internal) was performed using one µl of a dilution of the first one. Dilution ranged from 1:1 to 1:20. Bisulfite primers are listed in Annex II. Infinium 450K methylation arrays To obtain a genome-­‐wide profile of DNA methylation in HCT116 control cells and treated with 5-­‐AzadC, we performed 450K Infinium methylation array, which has a good coverage of the whole genome, specially CpG islands (97% are covered) and other interesting regions, such as shore CpGi islands and promoters. One µg of DNA was quantified using the Qubit® 2.0 Fluorometer (Invitrogen, Carlsbad, CA, USA), and transformed using the EZ DNA Methylation ™ kit (ZymoResearch, Orange, CA, USA). Biological duplicates of each experiment were performed. Methylation probes used in this retinoic acid pathway experiments are listed in the Annex VI. RNA EXPRESSION ANALYSIS RNA extraction Total RNA extractions were done using TRIzol® (Invitrogen, Carlsbad, CA, USA), according to manufacturer’s instructions and following the single-­‐step RNA isolation method (Chomczynski & Sacchi, 2006). All processes were carried out on ice and centrifugations steps at 4ºC in order to preserve RNA integrity. Cultured cells were trypsinized and washed with cold PBS 1X twice before RNA extraction. Then cells were resuspended using one ml of TRIzol® per 2.106 cells. In the case of tissue samples, mechanical homogenization with the razor blade was crucial to obtain high recovery yields. At that point samples could be stored at -­‐80ºC for at least one year. During the extraction protocol, we applied a recombinant DNAse I treatment (Applied Biosystems, Foster City, CA, USA) to 86 Materials and Methods avoid DNA contamination mainly from those samples coming from transfection experiments. RNAs were quantified in the NanoDrop (Thermo Scientific, Rockford, IL, USA) and were run in a 1% agarose gel with ethidium bromide staining in order to assess the integrity of the RNA. We also performed RNA expression microarrays and RNA-­‐seq of HCT116 control cells and treated with 5-­‐AzadC. Each experiment was performed in biological duplicates. For these experiments, total RNA was extracted with the miRNeasy® Mini kit (Qiagen, Venlo, Netherlands) which allows the recovery of all sizes RNA. The quality of these RNAs was checked using Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and a minimum score of 9 was required to be included in the experiment. Two µg of RNA were used for each RNA-­‐seq experiment. For RNA expression microarray analysis, we used Agilent SurePrint G3 8x60K array (Agilent Technologies, Santa Clara, CA, USA) and the data obtained were normalized and analyzed statistically using Limma (R package) (Smyth et al., 2005). Reverse transcriptase PCR For each reaction we used 500 ng per sample that were reverse transcribed by M-­‐MLV (Invitrogen, Carlsbad, CA, USA), in the presence of pd(N)6 Random Hexamers (GE Healthcare, Piscataway, NJ, USA) and RNasin® ribonuclease inhibitor (Promega, Madison, WI, USA). The reaction was performed according to manufacturer’s recommendations in a final volume of 25 µl. Two negative controls were added, one without the M-­‐MLV enzyme and the other without the RNA. Quantitative Real-­Time PCR The expression levels were analyzed using the quantitative Real-­‐Time PCR technique in the LightCycler® 480 (Roche Diagnostics Corporation, IN, Indiana, USA) platform with Fast Start DNA Master SYBR®Green I mix (Roche Diagnostics Corporation, IN, Indiana, USA) in a final volume of 10 µl. Samples were diluted 4 to 20 fold (except for 18S control that was diluted 1000 fold), depending on the expression levels of each gene. Every sample was 87 Materials and Methods analyzed in triplicate. When possible, forward and reverse primers were designed in different exons to avoid genomic DNA interference. Amplified products were run in an agarose 2% gel and sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). We used 3 to 6 housekeeping genes (PUM1, MRPL19, PSMC4, 18S, B2M (β2-­‐ microglobulin) and PPIA) in order to normalize the expression levels. Efficiency was calculated for each PCR reaction as described (Schefe et al., 2006). Standard deviation was calculated on PCR triplicates. Expression primers are listed in Annex III. CHIP AND CHIP-­‐SEQ EXPERIMENTS We used chromatin immunoprecipitation (ChIP) against some post-­‐translational histone modifications, histone variants and transcription factors (TF) (summarized in Table 11), in order to characterize the epigenetic landscape of the genes of interest. In this study we used two different applications of ChIP: the locus specific ChIP (analyzed by quantitative PCR, ChIP-­‐qPCR) and the genome-­‐wide ChIP (analyzed by next generation sequencing, ChIP-­‐seq). Both applications were performed using the Millipore EZ-­‐Magna ChIPTM A/G kit (Billerica, Massachusets, USA) according to the manufacturer’s instructions. First we collected cells by trypsinization (as explained previously). Then we proceeded to the cross-­‐linking step (1% formaldehyde, 37ºC, 15 min) followed by a 5 min inactivation step with 125mM glycine. 20x106 cells in 1mL of cell lysis buffer were sonicated using Bioruptor sonicator (Diagenode, Liège, Belgium) with 60 s ‘on’ and 60 s ‘off’ for 34 min. Fragmented chromatin was aliquoted in 50 µl (106 cells), which is the recommended starting material for the EZ-­‐Magna ChIPTM A/G kit. In this study we carried out whole genome ChIP-­‐seq in HCT116 control cells and HCT116 treated with 5-­‐AzadC (as described previously). Besides, ChIP-­‐qPCR was performed for specific regions in different cell lines and also to validate ChIP-­‐seq data. 88 3 ot i7 s no a Bh Ru N7 3 l di 3 no 3a h s nol itb 3a ns 1 wd otl 7 n in N7 7d t t Fi n a aonl i7n N7 ns s 31 m ov h 3ts tl l Ns ndo tdt3 3tns Fi n ts dN3 7 u 7 d o nol in ts 3otdit 3 R s a B7 h wd otl 7 ts M ns 3oni 3n a R3a tl l Ns ndo tdt3 3tns u 7 d o nol 3otdit 3 7Ru at a u 7 s n3 dn77t i ts 3a 3an 7 ts 3a ts tninMt i s 3 N 3n 3a atMa n73n 3a 3 as thN 1 Antibody Source Catalogue ID Ab/IP H3 abcam ab1791 5 !g/IP H3K4me3 Millipore NG171579 0.6 !g/IP H3K4me Millipore 07-436 3 !g/IP H3K27me3 Millipore 07-449 5 !g/IP H3K27ac Millipore 05-1334 3 !g/IP H3K9me3 Diagenode pAB-060-050 1 !g/IP H3K9me2 Diagenode pAB-056-050 3 !g/IP H3K36me3 abcam ab9050 5 !g/IP H4K20me3 abcam ab9051 5 !g/IP H2A.Z abcam ab4174 5 !g/IP mH2A Dr. Marcus Buschbeck lab 5 !g/IP RNApol II Millipore 05-623 1 !g/IP RNApol III Santa Cruz sc-21754 2 !g/IP CTCF Millipore 17-10044 5 !g/IP IgG Jackson Immunoresearch 011-000-120 5 !g/IP ChIP-seq Control cells 1 1 3 1 2 1 1 1 5 2 4 3 5 2 i CC x He e mc s l nlP s P pHp Pn h n hp nHe ms P m nl pn ls m l Càn m HPm s ml s n PlPs np| s nlms i CC8 iip n CC8 lm l o Pl Mh r f s 3a 7 n a B7 hRu 3a 9H s Ms u 7 s nol itb 3n n 3a 3n M 3a o a B7 h s iv7t7 6 RH) ) 4x n otMN b t o s 3 s Nl 7 3n o a i 99I1 a B7 h wd otl s3 7u o d o nol 3n 7 3 3a inu o itl t37 6 otMni RH) ) 4I1 a ChIP-seq Treated cells2 1 1 2 1 2 1 1 1 9 5 4 4 9 5 d’ mPe nlpf C b à m mls l hp d’ mPe nlp Pn s l o n N7ts M3a ts dN31 n7t3tm s s M 3tm ns 3oni7 no l n t t 3tns u o N7 1h s 1 l dit t 3tns dotl a at73ns RH) ) Px n otMN b o7 o it73 ts ss w ts 3otdit 3 1 48 Materials and Methods PROTEIN ANALYSIS Western blot Tissues were snap-­‐frozen in liquid nitrogen, then smashed and homogenized in lysis buffer, containing 10 mM Tris-­‐HCl (pH 7.5), 1 mM MgCl2, 1 mM EGTA, 10% glycerol, 0.5% 3-­‐[(3-­‐cholamidopropyl) dimethylammonio]-­‐1-­‐propanesul-­‐fonate, 1 mM β -­‐mercaptoethanol, and 0.1 mM phenylmethyl sulfonyl fluoride. Extracts were vortexed for 30 minutes at 4°C and, after centrifuging for 20 minutes at 15,000 g, the supernatants were stored at -­‐20°C. Before doing the western blot experiment, extracts were boiled for 5 minutes in Laemmli sample buffer and equal amounts of protein (20-­‐30 µg) were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-­‐PAGE) and transferred electrophoretically to a immobilon-­‐P membrane (Millipore, Billerica, Massachusets, USA). The membrane was blocked in TBS 0.5% plus 5% nonfat dried milk for 90 minutes at room temperature and probed with a primary antibody AKR1B1 (1:3000; Dr. Jaume Farrés Lab) or AKR1B10 (1:3000; Sigma-­‐ Aldrich) at 4°C overnight. The membrane was washed thrice for 10 minutes in TBS 0.5% and incubated with anti-­‐rabbit secondary antibody (1:3000; Dako, Agilent Technologies, Santa Clara, CA, USA) for 90 minutes at 4ºC. Targeted proteins were visualized using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific, Rockford, Illinois, USA). We used GAPDH (Abcam, Cambridge, Massachusetts, USA) as a loading control. Immunohistochemistry A tissue microarray with 196 tumors from patients diagnosed of advanced colorectal cancer and homogenously treated with combinations of 5-­‐FU and irinotecan was constructed. Sections were stained using a fully automated staining system for immunohistochemistry (Ventana Medical Systems, Tucson, Arizona, USA). The primary antibody used was anti-­‐AKR1B10 (Sigma-­‐Aldrich) and anti-­‐AKR1B1 (Dr. Jaume Farrés Lab) at dilution 1/100. Immunostaining of HepG2, HCT116 and SW480 cell lines were used as a controls. The staining was semiquantitative evaluated as diffuse positive, focal and negative. 90 3 ot i7 s Nots M3a d 73 u v o7 s u 3 as thN 7 a m 3n 3 3 dav7t i aonl 3 as thN 7 u o 3u n 7d t t s l 3n t s 3t v s 7 hN s 7 otm 3 7 6G R T m ind u at a iinu N7 3ts ts 3 o 3tns 7 n Noots M u t3ats 3a s N i N71 a 7 7tMs N a s iv7 7 o s 3an 7 73a 3 o hN s 3t v 7d t t itM 3tns don N 37 n in7 iv in itb ns aonl n7nl s tB I1 ns nol a ts 3a s N i N7 3tns 1 d3No 6U I 6 tMNo U9I 3 as thN a 7 7nl 7d t t t3v 3a 3 r 7t3l no no i 777Nt3 i no t o s 3 ddon a 71 s 3at7 73N v u N7 3a U 3 as thN 6 r r oR H) ) PI u at a t s 3t t 3tns n dav7t i ts 3 o 3tns 7 3u s do mtnN7iv 7 i 3 7 Ml s 371U 3 as ninMv t7 d o3t Ni oiv N7 Ni 3n t s 3t v aonl nol ts M s nl t o Mtns 7o s Mts M onl Cross-linking! aonl 3ts 3ts ts 3 o 3tns 7 u r 7Nd 3n 7 m o i aNs o 7n r 71 Digestion! PCR specific! amplification! iinu 7 3a Ligation! Reverse cross-linking! 3C library! P Hm OC x ms e lPn s nl lp m ms pphiPnt o Pl s me i c | l mo m p l ms e lPn Pp P pl o Pl m plmP lPs n nrce n iP l o Pl . iP p f ’ HmPP iP lPs n ’ ms H lp mPu ms e l O iP m mc m ’ m p nl ii ’ s ppP i ms e lPn Pnl m lPs npf s nu nlPs n i n icpPp s O iP m mP p Pnus iu p Pn PuP H i e ’ iPP lPs n s O iP lPs n aHn lPs np c p e Ph H nlPl lPu n ms p i l lPs nf a to73 73 d ts s v 3a nm i s 3 its r its r ts tM 73 aonl 3u 3 as thN t7 nol s ts 3 o 3ts M aonl 3ts t7 7niN titb u 7 3a ns i N7 s tM 73 av on77Bits r ts MRu at a don N 7 3ts 7 Ml s 37 u t3ats 3a u t3a ii1 on77B 7Nt3 i o 73ot 3tns s bvl ts 3at7 73N v1 3 o dNot t 3tns R on77Bits r R s o Ml s 37 o itM 3 1 a o 7Ni3ts M 7 l di t7 3a U it o ovRu at a ts iN 7 i oM s nl di wo do 7 s 3 3tns n 3a aonl 3ts ts 3 o 3tns 71 a 89 Materials and Methods ligation product is the result of a unique interaction, the quantification and comparison of different interactions was done by quantitative PCR using specific primers for the given interaction. The quantification of these ligation products in a given population of cells leads to relative frequency maps where physical interactions can be inferred. The specific primers used in the AKR1B1 locus are described in the Annex VIII table. BIOINFORMATICS The Cancer Genome Atlas project Most of the genomic data used in this project were downloaded from The Cancer Genome Atlas (TCGA) project. This huge project attempts to get a better knowledge about the most common cancers (17 cancers in the last update, 09/10/2013), by applying genome-­‐wide techniques that provide information on gene expression, DNA sequence and DNA methylation to large series of cases. We have used the TCGA database to investigate DNA methylation, gene expression and gene mutation in the regions or genes of interest, using publicly available bioinformatic tools or developing our own scripts. TCGA: Gene expression Colon cancers expression array data was downloaded from The Cancer Genome Atlas database (tcga-­‐data.nci.nih.gov). Gene expression data from the Agilent G4502A microarray (Agilent Technologies, Santa Clara, CA, USA) was available for 155 colon cancer patient samples. There were 12 tumor-­‐matched normal tissues and 7 normal unmatched tissues available that were also included in the analysis. Expression results were obtained using the TCGA dataset on Oncomine database (www.oncomine.com) and using in-­‐house made R scripts. TCGA scripts were constructed with R (http://www.r-­‐project.org/) using the Bioconductor open source R package (http://www.bioconductor.org) (Gentleman et al., 2004). Expression probes are depicted in Annex IX. 92 3 ot i7 s v 3an 7 e l ci lPs n nino 3 i a s no a s o o GT) s nl s 3t77N 67Nl l s ts tNl l 3i 7 3 ou a otb 3avi 3tns oo v nu s in onl 71 t o s 3 s Nl ts 3 u o o n 3Nl no7 s 3a 77n t 3 s nol i i 9HI1 Cancer Type Code Normal Samples Tumor samples Bladder Urothelial Carcinoma Brain Lower Grade Glioma Breast invasive carcinoma Colon adenocarcinoma Glioblastoma multiforme Kidnery renal papillary cell carcinoma Kidney renal clear cell carcinoma Liver hepatocellular carcinoma Lung adenocarcinoma Lung squamous cell carcinoma Pancreatic adenocarcinoma Prostate adenocarcinoma Rectum adenocarcinoma Stomach adenocarcinoma Thyroid carcinoma Uterine Corpus Endometrioid Carcinoma BLCA LGG BRCA COAD GBM KIRC KIRP LIHC LUAD LUSC PAAD PRAD READ STAD THCA UCEC 78 2 91 38 1 160 44 49 3 40 6 49 7 2 28 25 13 140 548 254 112 283 81 98 220 149 24 153 95 69 230 334 i Cà x He e mc s l n lHe s mp e ’ i p s m m ind P m nl n mf n mlc’ p u Pi 7 otd3 3n s ivb w l di n 3a nN3dN3R niNl s 7K ns 3oniRs nol i Pn l s mt7N itb 3a a Mo da o do 7 s 37 s ts tmt N i don l 3avi 3tns m iN 7 n s nol 3a l 3avi 3tns m iN 7 n 3a 3Nl no 7 l di 71 3Nl no 7 l di 7 onl 3a 7 l d to n don l i 3t77N 7 s 3avi 3tns 73 3N7R3a 3avi 3 don ts 3 s 7t3t 7 n 3a l 3avi 3 s l s Ns l Ns l 3avi 3 71 n 3 R3u n l 3 3an s u t iv N7 i niNl s t7 o oo 3n 3a otMa3 niNl s tiiN73o 3 7 3a 7a its 3n l Noo s 3iv o nl l iiNl ts ts 7 d to s nol iB don ns 3a l I 3n l 7No s dondn7 7No 3a 3n l d ts 3 s 7t3t 7 7No 3a 3 Bm iN Ro s Mts M onl ) 3n 9R 7No 3a d o s 3 M n s 77 v N3titb 7 ii i 7 3 3a ts 3 oonM 3 7 ii s ts tNl 3avi 3 3an 7 a m 3avi 3tns i m i1 a to73 ns t7 u at a a 7 t73a l s 3avi 3tns i m i t7 3a s 73tl n 3at7 d to n don R ns 3 ts ts MU d 3t s 31 76 l 7t3 1 a l ms ns me i i s 3Nl no1 Rl t 3 3a nHe 3 1 s tMNo UH 3a o t7 s 3 niNl s t7 s ts 3 os i ns 3oni n 3a n 73tl n l v iiNl ts 6 t tr nm l 3avi 3tns 1 at7 RH) ) PI1 8U Materials and Methods Figure 32 | Example of the output generated by the script developed to visualize DNA methylation data from the TCGA. The second method is the log2 ratio of the intensities of methylated probe versus unmethylated probe (Irizarry et al., 2008). We have used the beta value to represent DNA methylation data as it offers a biological meaningful information. For DKO DNA methylation we used already published data from Dr. Peter Jones, stored at Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo), under the code GSM896399 (De Carvalho et al., 2012). TCGA: Gene mutation and copy number alterations We also used the TCGA data to investigate genetic alterations in our genes of interest. We used genetic TCGA data through the cBioportal webtool (http://www.cbioportal.org) (Gao et al., 2013). Other bioinformatic tools We have used DAVID (http://david.abcc.ncifcrf.gov) webtool for Gene ontology (GO) and KEGG pathways analysis (Kyoto Encyclopedia of Genes and Genomes) (Huang et al., 2009). In order to define the RA pathway genes expression in normal colon mucosa we used 94 the Refexa standarized database (http://sbmdb.genome.rcast.u-­‐ Materials and Methods tokyo.ac.jp/refexa). High and moderate expression was assessed using RefExa criteria. For the composition of the survival test, we used 4 gene expression datasets of human colorectal cancers (GEO: GSE14333, GSE12945, GSE17536, GSE17537)(Bailey et al., 2012; Jorissen et al., 2009; Staub et al., 2009) with follow-­‐up information available to analyze the survival rate depending on gene expression. Using PrognoScan algorithm (Mizuno et al., 2009) patients were divided into two groups depending on gene expression levels. High or low expression groups were made using the minimum p-­‐value approach. Survival curves were constructed using the Kaplan-­‐Meier method. 95 Results DNA METHYLATION PROFILE OF AKR1B GENES IN COLORECTAL CANCER DNA methylation of AKR1B1 by bisulfite sequencing Silencing of multiple cancer-­‐related genes is associated with de novo DNA methylation of promoter CpG islands. In this study we have focused on AKR1B1 gene, which has a CpG island (CpGi) associated to its promoter (Figure 33A). We analyzed the DNA methylation status of AKR1B1 CpGi island in a panel of 7 cancer cell lines and in 25 colon tumor samples, as well as in their associated normal mucosa by bisulfite sequencing (see materials and methods for more detail). To cover the 93 CpG dinucleotides that comprise the CpG island, we needed to perform 3 independent bisulfite PCRs, named A, B and C (Figure 33A). The results obtained from the three amplicons within the AKR1B1 CpG island have provided an overview of the methylation landscape of this gene in colorectal cancer (Figure 33). All 25 normal colon mucosa samples displayed a fully unmethylated pattern all along the CpG island (Figure 33B). On the contrary, almost all tumors analyzed (24 out of 25) exhibited hypermethylation. It is important to note that hypermethylation is more prone to occur in the C segment of the CpG island (Figure 33C), where the AKR1B1 transcription start site (TSS) is located (Figure 33A). Clonal analysis of tumor samples with partial DNA methylation showed the coexistence of densely methylated with poorly methylated molecules in all cases, confirming the presence of cell populations with heterogeneous DNA methylation profiles. Most of the colorectal cancer cell lines presented a high grade of DNA methylation in the AKR1B1 CpG island (HCT116, CaCo2, HT29, DLD1 and SkCo1), except for DKO (deficient for DNA methylation) (Rhee et al., 2002) which exhibited a fully unmethylated pattern. Hepatocellular carcinoma cell line HepG2 was also fully unmethylated. In the cell lines analyzed, there was no enrichment in hypermethylation regarding the C amplicon. In most cases the whole CpG island displayed a homogeneous DNA methylation profile. 99 colgc Scale chr7: A AKR1B1 10 kb hg19 134,130,000 134,135,000 134,140,000 134,145,000 UCSC Genes (RefSeq, UniProt, CCDS, Rfam, tRNAs & Comparative Genomics) RefSeq Genes AKR1B1 CpG Islands (Islands < 300 Bases are Light Green) CpG: 93 Repeating Elements by RepeatMasker SINE LINE LTR DNA Simple Low Complexity Satellite RNA Other Unknown Scale chr7: AKR1B1 CpG: 93 134,143,100 134,143,200 134,143,300 500 bases hg19 134,143,400 134,143,500 134,143,600 134,143,700 134,143,800 134,143,900 UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) 134,144,000 134,144,100 134,144,200 CpG Islands (Islands < 300 Bases are Light Green) Human mRNAs from GenBank Transcription Factor Binding Sites by ChIP-seq from ENCODE/HAIB B C H1-hESC CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH H1-hESC CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH K562 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH K562 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH A549 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH A549 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH HeLa-S3 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH HeLa-S3 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH HEPG2 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH HEPG2 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH D IMR90 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH IMR90 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH RNA-seq from ENCODE/Caltech Classified Translation Initiation Sites miRcode Predicted MicroRNA Target Sites, Highly Conserved Families Colonic_Mucosa.Donor_32 Chromatin State Segmentation by HMM from Roadmap Adult_Liver Chromatin State Segmentation by HMM from Roadmap Duodenum_Mucosa.Donor_61 Chromatin State Segmentation by HMM from Roadmap Gastric Chromatin State Segmentation by HMM from Roadmap Rectal_Mucosa.Donor_29 Chromatin State Segmentation by HMM from Roadmap Rectal_Mucosa.Donor_31 Chromatin State Segmentation by HMM from Roadmap ah GG g 3 C C A Dm l mA A Stomach_Mucosa e yDChromatin A StateyaD l byNHMMeD mAyb 3 C C e yD A Segmentation from Roadmap N l f D l mA yl lay A p2 AmhN D mDmA N a my y 3 l N l laN mh y N eD b 3 N l f D l mA Chromatin State Segmentation by HMM from Roadmap m C C A e A Dm A h hESC_Derived_CD184+_Endoderm_Cultured_Cells DDDA yb hESC_Derived_CD56+_Mesoderm_Cultured_Cells Chromatin State Segmentation by HMM from Roadmap iPS-20b_Cell_Line Chromatin State Segmentation by HMM from Roadmap (, , iPS_DF_19.11_Cell_Line Chromatin State Segmentation by HMM from Roadmap iPS_DF_6.9_Cell_Line Chromatin State Segmentation by HMM from Roadmap Results DNA methylation of AKR1B10 by bisulfite sequencing The DNA methylation level of the promoter region of the AKR1B10 gene was analyzed although it did not have an associated CpG island. The analyzed amplicon was composed by seven CpG dinucleotides (depicted in Figure 34A). We have studied AKR1B10 promoter DNA methylation in the 25 colorectal tumors and in the associated normal mucosa. Seven cancer cell lines were also analyzed. The DNA methylation pattern of AKR1B10 was heterogeneous among the different normal samples. For example, samples N.09.817 and N.CR017 were almost unmethylated, whereas N.09.437 was heavily methylated. In contrast to AKR1B1 promoter, AKR1B10 promoter tended to be methylated in normal colorectal tissue (Figure 34B). DNA methylation of AKR1B10 in colorectal tumor samples showed a great variability among the different samples. Some of them were almost unmethylated such as T.CR010, while T.09.454 and T.09.530 were almost fully methylated (Figure 34C). As it occurred in normal colon mucosa, AKR1B10 promoter tended to be methylated in colorectal tumor samples, but slightly less methylated than in the normal tissue. Regarding cell lines methylation, HT29, DKO and HepG2 displayed a completely unmethylated profile, while SKCo1, DLD1, CaCo2 and HCT116 presented different degrees of DNA methylation (Figure 34D). 101 colgc Scale chr7: 10 kb 134,215,000 A 134,210,000 hg19 134,220,000 RefSeq Genes AKR1B10 134,225,000 134,230,000 CpG Islands (Islands < 300 Bases are Light Green) Human mRNAs from GenBank Repeating Elements by RepeatMasker Basic Gene Annotation Set from ENCODE/GENCODE Version 7 Your Sequence from Blat Search UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) Restriction Enzymes from REBASE Scale chr7: HepG2 CEBPB v041610.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB 500Raw bases HepG2 CEBPB v041610.1 ChIP-seq Signal Rep 1 from ENCODE/HAIB 134,212,200 134,212,300 134,212,400 134,212,500 134,212,600 AKR1B10 134,212,700 hg1 134,212,800 134,212,900 134,213,000 134,213,100 134,213,200 134,213,300 UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) HepG2 CEBPB v041610.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB Your Sequence from Blat Search HepG2 CEBPB v041610.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB Basic Gene Annotation Set from ENCODE/GENCODE Version 7 HepG2 CEBPD v041610.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB B RefSeq Genes Repeating Elements by RepeatMasker CpG Islands (Islands < 300 Bases are Light Green) Human mRNAs from GenBank C HepG2 CREB1 v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB Restriction Enzymes from REBASE HepG2 CEBPB v041610.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HepG2 CEBPB v041610.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 CEBPB v041610.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB CEBPB v041610.1 HCT-116 CEBPB v042211.1 ChIP-seq Raw Signal RepHepG2 2 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Peaks Rep 1 from ENCODE/HAIB HepG2 CEBPD v041610.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Peaks Rep 2 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Peaks Rep 1 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Peaks Rep 2 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB D HCT-116 SP1 v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB ah G. g 3 C Cd A Dm l mA A l mhh yemA A yaD l N eD mA yla 3 C Cd N l f D l mA yl lay A p2 AmhN D mDmA N a my y A A 3 l N l laN mh y N eD b 3 N l f D l mA m C Cd A e A Dm A h DDDA yb N l f D l mA m R ( ( C C2 f t ela R c n9m e gR l cg a nch 9gR e Rot gR uc g9 gR e ge e ge9 9 e (, ) ( ( W ( ( WR c 9 S ecl hm 9 gR W S yaD l y t a A A v l e e g9 f lo g gR e o l 9ge c 9 gR Sn9t 9g nv e on FW KA t 9oc h h) , ( ( KA t gRal ge9 colgc Scale chr7: A 134,230,000 AKR1B10 20 kb 134,240,000 134,235,000 hg19 134,245,000 134,250,000 134,255,000 UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) AKR1B15 134,260,000 134,265,000 134,270,000 134,275,000 Your Sequence from Blat Search Basic Gene Annotation Set from ENCODE/GENCODE Version 7 RefSeq Genes Repeating Elements by RepeatMasker CpG Islands (Islands < 300 Bases are Light Green) Human mRNAs from GenBank Scale chr7: 134,233,600 134,233,700 134,233,800 134,233,900 AKR1B15 500 bases Restriction Enzymes from REBASE 134,234,000 134,234,200 134,234,300 134,234,400 134,234,500 134,234,600 HepG2 CEBPB134,234,100 v041610.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HepG2 CEBPB v041610.1 ChIP-seq Raw Signal Rep 1 Genes from ENCODE/HAIB UCSC (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) Gene HepG2 CEBPB v041610.1 ChIP-seq Peaks Rep 2 from Basic ENCODE/HAIB Your Sequence from Blat Search Annotation Set from ENCODE/GENCODE Version 7 HepG2 CEBPB v041610.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HepG2 CEBPD v041610.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB B C RefSeq Genes Repeating Elements by RepeatMasker CpG Islands (Islands < 300 Bases are Light Green) Human mRNAs from GenBank HepG2 CREB1 v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB Restriction Enzymes from REBASE CEBPB v041610.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Peaks Rep 2 HepG2 from ENCODE/HAIB HepG2 v041610.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Raw Signal Rep 2 from CEBPB ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 CEBPB v041610.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HepG2 CEBPB v041610.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HepG2 CEBPD v041610.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Peaks Rep 1 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Peaks Rep 2 HepG2 from ENCODE/HAIB CREB1 v042211.1 HepG2 SP1 PCR1x ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Raw Signal Rep HepG2 1 from ENCODE/HAIB CREB1 v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HepG2 CREB1 v042211.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HCT-116 CEBPB v042211.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Peaks Rep 1 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB D HepG2 SP1 PCR1x ChIP-seq Peaks Rep 2 from ENCODE/HAIB HepG2 SP1 PCR1x ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Peaks Rep 1 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Raw Signal Rep 1 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Peaks Rep 2 from ENCODE/HAIB HCT-116 SP1 v042211.1 ChIP-seq Raw Signal Rep 2 from ENCODE/HAIB ah G2 g 3 C C2 A Dm l mA A l mhh yemA A yaD l N eD mA yla b 3 C C2 N l f D l mA yl lay A p2 AmhN D mDmA N a my y A A 3l N l laN mhy N eD yb 3 N l f D l mA m C C2 A e A Dm A h DDDA yb c eg ec cR9m e t gRal g e on FW h e 9nt l 9l9 c t Sl c ( ( W Sn9t 9g n g c g9 ecSl ac got 9nc t Sl chcet el nla g9 mR gR SS n e gR o t gRal g h mRel n 9) h enRaS9t gRal ge9 e 9l9 e ll le c S lh S ) h u 9( h Re Rla ( ( , Sn9t 9g nA )5 y( m n 9t Sl g la ( ( z m n f ne la t gRal g A (, F hg19 134,234 colgc C C N l f D l mA ay A l 9n ng9 9 ent 9onSn f e9oc 9 c nf ge9 chm oc 9l9n g l n 9 n e 9t 9t gl c v S ge gc v K vt g ne lc ) W3 9l9 got 9n c t Sl c cgo e gR K F2 t g R 9l9 t gRal ge9 e S t gRal ge9 g 9R9ng9 g c g n9t t gR9 cKA R 9R9ng 9 cecgc 9 9nt l 9l9 t o 9c cA g oce R c neSg vc R f t g ne lc t gR9 cKA lar gR t gRal ge9 e gR Sn9t 9g nh gR c t 9f n a ( ( Sn9 S ecl n e9 Sn f e9ocla cgo e c e gR llot e 3W, cc9 e g megR gR a ecol eg t gRal ge9 ( ( A Rec n e9 ec nn ac v e on FzKA "# Methylation status for region (AKR1B1): 7:134143116−134144063 Number of probes: 11 | Number of samples: 373 0.8 1.0 Methylation levels (Control Analyte) beta.value 0.6 ! 0.4 # $ " ' # $ $ & & # ' 0.0 0.2 & " " ! # ! & " $ # $ & $ " & # ! % ' # ! # ' " $ ' # ' % ' ! " # # % ' ' # % ! & $ ah G5 g ml G CC DDaN A . 2d N l f D l mA ehm y Dm l Al yaD l N eD mAy r R A 3 y Dym e l b 9 ent e 9on Sn f e9oc 9 c nf ge9 ch ( ( C C e S ecl yD A b Dm l mA m c 9t Sl g la o t gRal g v e on F7KA 0.0 0.2 0.4 0.6 0.8 1.0 0.0 0.2 0.4 0.6 0.8 1.0 Genomic Position (, 3 e 9nt l 9l9 llc RaS nt gRal g e 9l9n g l n e 9t colgc Methylation for probe cg13801416 CONTROL NORMAL 0.2 1.0 0.6 0.4 0.2 1.0 0.8 0.4 Methylation for probe cg06864853 1.0 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) 0.4 0.4 0.4 0.0 beta.value 0.6 0.8 1.0 1.0 Methylationfor forprobe probe cg02215070 cg13801416 Methylation 0.8 0.8 beta.value beta.value 0.6 beta.value NORMAL 0.0 0.0 0.0 0.2 CONTROL 0.2 0.2 0.4 0.2 TUMOR NORMAL NORMAL TUMOR TUMOR CONTROL NORMAL TUMOR SAMPLES SAMPLES SAMPLES Methylation for probe cg10795359 Methylation for probe cg14629509 1.0 0.8 beta.value 0.0 0.8 0.2 0.4 0.6 beta.value 0.4 0.2 0.0 NORMAL CONTROL TUMOR NORMAL TUMOR CONTROL NORMAL SAMPLES SAMPLES N l f D l mA h yaDly mh l Am h AmN l y lb TUMOR SAMPLES CC ehm y mAl A Al C C e yD A Al 9n 9f n m m n l g9 f ne a gR S ecl A n9 0.4 e gR beta.value 0.6 ah G0 g mDmA Methylation for probe cg09957386 0.6 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) 1.0 0.8 0.6 beta.value 0.4 0.2 0.0 CONTROL CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) 0.8 1.0 SAMPLES Methylation for probe cg09957386 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) ) Khm n RaS nt gRal g c l9 g ( ( K c Sn f e9ocla 9 c nf e N l f D l mA ay A c 9 ( (, 9 gR e S ecl t Sle 9 v( h vFh3hWhzh v e on F7KA l hgR n m n socg gm9 t gRal ge9 Sn9 CONTROL gR Sn9t 9g nA R cego ge9 9 gR gm9 Sn9 e t Sle 9 a ecol eg 0.0 C Cd e n ge l RaS nt gRal ge9 S gg n c gR g og l cc gR gR 9 c Sl 0.2 NORMAL 0.2 NORMAL SAMPLES 0.6 0.6 0.8 1.0 CONTROL TUMOR CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) CONTROL CONTROL TUMOR CONTROL 0.0 0.0 NORMAL SAMPLES NORMAL NORMAL 0.6 0.8 0.6 0.2 0.4 0.4 CONTROL 0.0 CONTROL CONTROL beta.value 0.6 0.0 TUMOR Methylation for probe cg21079345 n Sn c g TUMOR CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) 1.0 0.6 0.8 1.0 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) 0.2 0.4 beta.value 0.6 beta.value 0.4 0.2 0.0 NORMAL CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) gR NORMAL SAMPLES Methylation for probe cg10795359 SAMPLES 1.0 CONTROL TUMOR SAMPLES Methylation for probe cg16132520 CONTROL 7h2h5h( , 0.0 0.0 0.0 TUMOR CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) g99u Sl 0.8 1.0 0.6 0.4 0.2 0.8 0.2 0.4 beta.value beta.value 0.6 0.6 beta.value 0.4 0.2 0.0 NORMAL SAMPLES Methylation for probe cg18416881 0.8 1.0 CONTROL CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) 0.8 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) 0.8 1.0 1.0 Methylation for probe cg24059115 0.8 1.0 Methylation for probe cg13056495 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) c c Sl NORMAL gR e e ge9 9 gRSAMPLES e n e on F2 A (, W colgc 0.6 0.8 1.0 Methylation status for region (AKR1B10) 7:134212304−134212575 Number of probes: 2 | Number of samples: 373 Methylation for probe cg25171118 0.8 1.0 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) 0.6 beta.value 0.4 0.2 0.0 0.0 0.2 0.2 0.4 beta.value 0.6 0.4 0.8 beta.value 1.0 Methylation for probe cg12001930 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) CONTROL NORMAL TUMOR CONTROL NORMAL 0.0 SAMPLES TUMOR SAMPLES ah G4 g 3 lo m DDaN A . 2d N l f D l mA ehm y Dm l Al C Cd ehmN ml hb 3 mDmA Am h AmN N l f D l mA h yaDly mh l lo mehm y mAl A Al C Cd ehmN ml hb Sample ce gR t gRal ge9 g m 9 c nf c t Sl c v) , yW, b t gRal ge9 K cSeg gRec R g n9 ega m t gRal ge9 one gR me f ne ge9 e 9nt l f t 9n e got 9n c t Sl c v e on F2 KA 9ol 9g 9 c nf n9oc Sn9 ccA R c l n g a e g t g R megR 9on Sn f e9oc ecol eg n colgcA C C2 N l f D l mA ay A R n m n gm9 t gRal ge9 Sn9 l c megRe gR Sn9pet l Sn9t 9g n 9 gR ( ( W A R cego ge9 9 gR gm9 Sn9 Se g e 9l9 t o 9c c t Sl c ecSl a 9 gR c t Sl (, z gR e e ge9 9 gR n e on F5 A ( ( WSn9t 9g n pRe eg 9nt l c Re R 9nt 9 v S e n g f lo c 9 9 gR Sn9 t gRal ge9 e gR 9 ce n Kh mRel t gRal ge9 gR g m c t 9n 9n l cc c f n Sn9 v e on F5 KA got 9n S e colgc 0.6 0.8 1.0 Methylation status for region (B15promoterlong) 7:134233618−134234063 Number of probes: 2 | Number of samples: 373 ! Methylation for probe cg09322278 1.0 0.8 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) 0.6 beta.value 0.4 0.2 0.0 0.0 0.2 0.2 0.4 beta.value 0.6 0.4 0.8 beta.value 1.0 ! Methylation for probe cg03515829 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) CONTROL NORMAL TUMOR CONTROL NORMAL TUMOR SAMPLES 0.0 SAMPLES ah GT g 3 lo m DDaN A . 2d N l f D l mA ehm y Dm l Al C C2 ehmN ml hb 3 mDmA Am h AmN N l f D l mA h yaDly mh l lo mehm y mAl A Al C C2 ehmN ml hb Sample C C N l f D l mA A ylmmDy t gRal ge9 e9t nu nc 9n 9 ye f cef Sn onc9nl ce9 c R f e ne gR oc n t gRal ge9 9 gR megR gR t g R ll gR cg99lc n9t lar A gR S g ne lc ecl 9 9nc lar e t gR9 cKA ( ( n i o g pRe eg S S n9t gR cg99l m n l A olla o t gRal g g gR g m R f 9g 9 c nf a 9 gR 9nt l 9l9 t o 9c c t Sl c c 9 e l t t g9na 9m l ec c c t Sl chm t gRal ge9 h c egR SS gR c t g megRe gR gR g ecSl ac t 9n S gg n v e on 3, KA Rec 9e e c megR gR t gRal ge9 9 gRec f lo g got 9ngecco mR egm c f el R lgRa oc c m e 9cge t nu n 9n 9l9n g l RaS nt gRal ge9 v e on FF KA R n colgc 9 g e 9t S n m a ( 3F cg99l c t Sl c vc gRec ec gR 9 n le e l Sn ge h lgR9o R 9 cg lecR A ( ( S ecl 9R9ng 9t S9c lar ecl onn g Sn9g9 9lc e e9t nu nc R f t gRal ge9 9 gR pg cef la cgo e A e n gS lc R f gg t Sg g9 et Sn9f e eg e 9cec 9 9l9n g l e 9g9 c nf megR R lgRa 9 9nc v e on 3, KA (, 7 colgc A Scale chr7: 134,143,100 134,143,200 AKR1B1 134,143,300 500 bases hg19 134,143,400 134,143,500 134,143,600 134,143,700 134,143,800 134,143,900 UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) 134,144,000 134,144,100 CpG Islands (Islands < 300 Bases are Light Green) CpG: 93 Human mRNAs from GenBank Human mRNAs Transcription Factor Binding Sites by ChIP-seq from ENCODE/HAIB B Normal 58 H1-hESC CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH Normal 1 H1-hESC CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH K562 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH K562 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH C A549 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH A549 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH HeLa-S3 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH HeLa-S3 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH HEPG2 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH HEPG2 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH IMR90 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH IMR90 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH RNA-seq from ENCODE/Caltech ah . d g 3 AmN Dm l mA m l N eD mA o l A l C C e yD A b 3 N l f D l mA h yaDly m 24 ylmmD y N eD y hmNClassified Translation Dl f Initiation mAmSites hyb 3 N l f D l mA h yaDly m i miRcode Predicted MicroRNA Target Sites, Highly Conserved Families ylmmDy N eD y hmN A D N N lmhf mo Colonic_Mucosa.Donor_32 D y y r Chromatin 3e State l Segmentation Alyb by HMM from Roadmap n e cg99l c t Sl c n9tAdult_LiverS Chromatin ge StategcSegmentation megRby HMM from Roadmap 9t hm 9ol g g t gRal ge9 e ( F 9og 9 FWc Duodenum_Mucosa.Donor_61 t Sl chmReChromatin R nStateSn c gc g ge9 n g 9 F7A( 3 Segmentation by HMM from Roadmap Gastric Chromating State b v e on 3( KhmRe R ec cet el n g9 mR mSegmentation 9o by HMM from e Roadmap gR cg99l n e 9t S ge gcN( z 9og 9 3W c t Sl chmRe R n Sn c gc FWAWWb Rectal_Mucosa.Donor_29 Chromatin State Segmentation by HMM from Roadmap n g v e on 3( KA Rectal_Mucosa.Donor_31 Chromatin State Segmentation by HMM from Roadmap Stomach_Mucosa Chromatin State Segmentation by HMM from Roadmap hESC_Derived_CD184+_Endoderm_Cultured_Cells Chromatin State Segmentation by HMM from Roadmap hESC_Derived_CD56+_Mesoderm_Cultured_Cells Chromatin State Segmentation by HMM from Roadmap iPS-20b_Cell_Line Chromatin State Segmentation by HMM from Roadmap iPS_DF_19.11_Cell_Line Chromatin State Segmentation by HMM from Roadmap (, 2 iPS_DF_6.9_Cell_Line Chromatin State Segmentation by HMM from Roadmap c t Sl c 9 g ge9 134,144,200 colgc A Scale chr7: AKR1B1 CpG: 93 Human mRNAs 134,143,100 134,143,200 134,143,300 500 bases hg19 134,143,400 134,143,500 134,143,600 134,143,700 134,143,800 134,143,900 UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) 134,144,000 134,144,100 134,144,200 CpG Islands (Islands < 300 Bases are Light Green) Human mRNAs from GenBank Transcription Factor Binding Sites by ChIP-seq from ENCODE/HAIB B H1-hESC CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH H1-hESC CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH C K562 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH K562 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH A549 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH A549 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH HeLa-S3 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH HeLa-S3 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH HEPG2 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH HEPG2 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH IMR90 CEBPB IgG-rab ChIP-seq Peaks from ENCODE/SYDH IMR90 CEBPB IgG-rab ChIP-seq Signal from ENCODE/SYDH RNA-seq from ENCODE/Caltech Classified Translation Initiation Sites miRcode Predicted MicroRNA Target Sites, Highly Conserved Families Colonic_Mucosa.Donor_32 Chromatin State Segmentation by HMM from Roadmap Adult_Liver Chromatin State Segmentation by HMM from Roadmap Duodenum_Mucosa.Donor_61 Chromatin State Segmentation by HMM from Roadmap Gastric Chromatin State Segmentation by HMM from Roadmap Rectal_Mucosa.Donor_29 Chromatin State Segmentation by HMM from Roadmap Rectal_Mucosa.Donor_31 Chromatin State Segmentation by HMM from Roadmap Stomach_Mucosa Chromatin State Segmentation by HMM from Roadmap hESC_Derived_CD184+_Endoderm_Cultured_Cells Chromatin State Segmentation by HMM from Roadmap ah . C g 3 AmN Dm l mA m l N eD mA o l A l C C e yD A b 3 State Segmentation by HMM from Roadmap N l f D l mA h yaDly m G2 ylmmDy N eD iPS-20b_Cell_Line y hmN Chromatin Am N e l Alyb 3 N l f D l mA h yaDly m . 2 ylmmDy N eD y hmN h AmN e l Alyb hESC_Derived_CD56+_Mesoderm_Cultured_Cells Chromatin State Segmentation by HMM from Roadmap iPS_DF_19.11_Cell_Line Chromatin State Segmentation by HMM from Roadmap iPS_DF_6.9_Cell_Line Chromatin State Segmentation by HMM from Roadmap (, 5 colgc lc9 R u c t Sl c S en c t Sl chgR gR t gRal ge9 cg goc 9 7 gecco megR gR 9nn cS9 e t gR 3( KA gR 9gR n gm9 t gRal ge9 e gR cg99lc cSeg gR n e 9t v e on 3) KA W 9og 9 7 t gRal ge9 cg goc 9 gR cg99lc vS ge gc ) 7h) 2h) 5hF2 FF cg99lc 9l9n g l c cm n e 9t gR g9 gR gecco 9ol 9g g g m c t gRal g vS ge gc F3KA ah . p g N l f D l mA A Df y y m ylmmD y N eD y A e h SSle e 9cge t nu n e ge9 megR 9gR nch ongR n cgo e c t ocg S n 9nt g9 olla cc cc gR e 9nt gef cc 9 gRec C C e 9 ce ne 9t yD A N l f D l mA A ml gR g Snet na got 9nc n9t h t gRal ge9 S gg n c 9o n Sn9 o e 9gR n Sn9 el c e g9g l 9 ( z got 9ngaS c f el ((, t gRal ge9 c g nt e ge9 A A hy l9c la n l g 9t t 9 t 9l ol n ce gon c v o R nl S ge d gR g gR ( ( l yya b lgR9o R gR c n colgc coSS9nggR 9n e elega 9 h AmN e n gaS cA R n 9n m gecco c g g9 cR n R l nh ) , ( ) Kh m S9cgol g 9l9 lar l gRn9o R gR n 9ol gR cet el nla t gRal ge9 S9ng lA colgc D CG g h Al m aN A A hb m y yo l f e hN l f D l mA A l h 9g9 la 9l9 h og lc9 n got RaS nt gRal ge9 9 nc 9 gR C C e cg9t yD A h Al lf e y R got 9nc Sn c gRe R n g c 9 ( ( hmRe R S9e gc 9oggR n l f e cgef gn gv A C5 9 gRec lg n ge9 e l ( FKA N l f D l mA A N R ecgne oge9 S nge lla 9 c nf gRn l9 ge9 9 ( gm Rot c mRel e t e gR n S ecl 9t c 9 Rot chgR n n 9onA cSeg gRec e n cS e ch c n cet el nla 9ne g g h t ela megRe gR t 9oc A gR 9 cet el nege cNgR l9 oc 9 g e c socg 9 gR c t hgR n n n Sl ga e gR mR9l n e9 e f t 9n hgR e R 9ne ec 9gR c n v e on 3FKA ah . G g AmN yt a h yb Dm l mA m C A y A aN A A N may b e yD A y h h eh y Al y ((( colgc oc 9 gR 9 c nf ge9 9 gRec n e9 gRn9o R f 9loge9 hm m9 RaS nt gRal ge9 SR 9t 9 m9ol e g9 lar v t gRal ge9 9 gR t Sle 9 cgo e ecol eg Snet nc c i o A e gR lc9 9 on e t 9oc A 9 f lo g eg m S ecl ( ( t 9oc 9ngR9l9 K e 9nt l 9l9 h t e c t Sl cA R 33A gR n 9t cc9 e g a ecol eg c i o e ec c n n l g p A e gR Se g megR n e 9t e e on mm10 34,300,000 NAs & Comparative Genomics) 34,305,000 34,310,000 34,315,000 Akr1b3 Bases are Light Green) y RepeatMasker enes m GenBank efSeq, GenBank, tRNAs & Comparative Genomics) nds (Islands < 300 Bases are Light Green) epeating Elements by RepeatMasker RefSeq Genes Mouse mRNAs from GenBank B Restriction Enzymes from REBASE C Non-Mouse RefSeq Genes ne Predictions - archive Ensembl 70 - jan2013 Mammal Basewise Conservation by PhyloP Multiz Alignments of 60 Vertebrates D from REBASE Seq Genes hive Ensembl 70 - jan2013 Conservation by PhyloP 60 Vertebrates ah . . g 3 ah A A Dm l mA A l mhh yemA A N eD mAy yla f yaD l y ta A A b 3 N l f D l mA yl lay A . AmhN D mDmA N a my y1 3 2 AmN y N eD y A A 3. h AmN y N eD y A l p5 DDDA rN may mDmA A h DDDA 3b lar 9on 9nt l 9l9 c t Sl ch ef t Sl c m n Sn9f e (() a gR l 9n g9na 9 9t c o n gll v 9on n e 9t cA h n l9 K Results brief description of the characteristics of the samples is presented in Table 14 in the materials and methods chapter. As occured in humans, the CpG island was not methylated in normal colon samples (Figure 44B). There was also a complete unmethylated pattern in the adenomas studied (Figure 44C), unlike the human counterpart that were frequently hypermethylated (Figure 33). In the case of the CT26 carcinoma cell line and “carcinoma4” sample, we could not detect any DNA methylation in the region analyzed; whereas in “carcinoma1” and “carcinoma3” we detected partial methylation of a few CpG sites; and finally “carcinoma2” was fully methylated (Figure 44D). These results confirm that the hypermethylation of AKR1B1 CpG island in colorectal cancer is also observed in its murine ortholog Akr1b3, however it seems to occur less frequently than in human, at least in regard to the murine cancer model used. 113 colgc S ecl Sn9t 9g n cc9 e g megR RaS nt gRal ge9 ec cel e A 9 RaS nt gRal ge9 e ( i ( (h y lacec 9 c c lar Snet nc oc N 9n g9 gR c m S n 9nt e gRec cgo a SS n gR ( (, ne gR p 9t t 9 la ( ( S ecl pSl9n g9na g n gy en g ( ( We gR ) W 9nt lI got 9n t gRal ge9 v e on c FFh F3 neh yy mA m c p t e g nt e SR 9t 9 FWKA R pSn cce9 A C C A mDmh l D A hy N eD y 9 ce n I ec Re R n9nl9m ngR ( oSn ol g 9n 9m n ol g mR gR l9 ) y( hn cS gef laA A B " " " " ah . 2 g neh yy mA m C C A l 2d e h y N eD y A Df K b 3 h D l i neh yy mA h e o h AmhN D mDmA y N eD y h mDmh A D l h A A laN mh y N eD y A h b 3 m p rc 3R o h A l i i Da y N A mo Ah aD l mA A emy l i mA y aeh aD l mA m l neh yy mA A laN mh mN e h o l l AmhN D mDmA l yya b N l f D l mA i Da y h l i h m l o mD e yD A N l f D l mAb ((3 colgc ue gRec gRn cR9l e g9 v33b KS ge gc 9o gh oSn ol g ( ( m c 9m n ol g e F 9og 9 ) Wv( ) b KS ge gcA c n colgc 9 ent gR g gR c t Sl c gR g ecSl a Re R n lc9 gR 9 c gR g n t 9n c t Sl c n R n l gef 3W A Rel n la pSn cce9 f lo c 9 e e on 3W gR 9nt lI got 9nn ge9 N 9n f oSn ol g ( ( 9n n Sn c g gm S en mR9l hgR c t gRal ge9 f lo c n 9m n ol g N9 gR g e ( ( 9og 9 ) W 9 gn nahS99nla t gRal g v , ( F S ge gK v e on 3WKA R c t Sl f lo c n Se g 9nn cS9 e g9 gR e on l9 ) c t Sl cA neh yy mA A Df y y m C Cd A C C2 A mDmh l D A h y N eD y 9 gn cg megR t 9n Sla ( ( hgR g v) F 9og 9 ) WK pRe eg one pSn cce9 9 gR ( (, ( ( W c m c n9oc Sn9 ccA5) b S n 9m n ol ge9 9 3b v( 9og9 ) WK9 gR t m n oSn ol g ( (, v e on 3z A B C D g 9 gR c c pSn cce9 hmR n c socg KA E " " " " ah . 5 g N neh yy mA m C Cd A C C2 A l p2 e h y N eD y A Df K b A 3 h Dl i neh yy mA h e o h AmhN D mDmA y N eD y h mDmh A D l h A A laN mhy N eD y A h b A 3 m p r c 3R o h A l i i Da y N A mo Ah aD l mA A emy l i mA y aeh aD l mA m l neh yy mA A laN mh mN e h o l l AmhN D mDmA l yya b yaN N h K y l e yD A C C N l f D l mA yl lay mh y N eD b ((W Results The scenario is very similar for AKR1B15, which was downregulated in 88% of the samples (22 out of 25) and there is just 1 case out of 25 where the gene was upregulated (Figure 46B and D). The behavior of AKR1B10 and AKR1B15 was almost identical in all samples analyzed, which may indicate a co-­‐regulation of both genes. As we have previously reported, promoter DNA methylation of AKR1B10 and AKR1B15 is almost unaltered during cancer development despite both genes display a dramatic downregulation. However, we could observe a link between the DNA methylation of AKR1B1 CpG island and the expression of AKR1B10 and AKR1B15 (Figure 46E): hypermethylation of AKR1B1 CpG island was associated with strong downregulation of both genes (Figure 46C and D). An exception is CR010 patient, in which, despite the low expression of both genes in the tumor tissue, there was an apparent upregulation explained by the lack of expression of AKR1B10 and AKR1B15 in the normal colon. mRNA expression of AKR1B family in a second set of samples Next, we extended our study by applying microarray expression analysis to a cohort of 100 patients from the Institut Català d’Oncologia (ICO, Barcelona), with the corresponding normal and tumor sample for each patient. Additionally, to discard possible sample cross-­‐contamination and in order to identify possible disease-­‐related features in the normal tissues of patients, this analysis included the colonic tissues from a control cohort comprising 100 healthy individuals. We then analyzed the expression of AKR1B1, AKR1B10 and AKR1B15 in the expression microarrays. Although AKR1B1 displayed a modest tendency to be downregulated in colorectal cancer, this was not a general fact and many tumors did not change the expression levels and in some of them were even upregulated (Figure 47). On the contrary, AKR1B10 and AKR1B15 showed high expression values in normal colon that suffered a dramatic downregulation in almost all tumor samples analyzed (Figure 47). 116 colgc ah . 0 g C CR C Cd A h ABAmhN D Dl f N a my hmN laN mh A A h B mDmA laN mhy N eD b g ec m9ngR g9 9g gR g e ( ( W pRe eg t o 9c hc9t C C2 A neh yy mA A G h Al y ly m y N eD yb A Dl f mAmhyR Da BAmhN D mDmA N a my yym l lml ll c t Sl c n9t R lgRa Re R l f lc 9 t c t Sl c ln a ecSl a 9 9nch ( (, pSn cce9 mR n c e 9nt l t g R l9m pSn cce9 l f lc e gR n 9 got 9ngecco cA ((7 colgc N neh yy mA m C N Df A 9 cgn gR 9on 9 loce9 chm ( (, ( ( We t ge9 y N eD y e g9 lar gR pSn cce9 9 gRen c g 9 c t Sl c 9nn cS9 e ( (h g9 gR ln a Sn9s gv e on 32KA AKR1B1 Rectum Colon Cec.Ad Col.Ad Normal tissue Col.Mu Rec.Ad Rec.Mu AKR1B10 Rectum Colon Rec.Sg Col.Ad Cec.Ad Normal tissue Cancerous tissue Col.Mu Rec.Ad Rec.Sg Rec.Mu Cancerous tissue AKR1B15 Normal colon (19) Normal rectum (3) Cec.Ad: Cecum adenocarcinoma (22) Col.Ad: Colon adenocarcinoma (101) Col.Mu: Colon mucinous adenocarcinoma (22) Rec.Ad: Rectal adenocarcinoma (60) Rec.Mu: Rectal mucinous adenocarcinoma (6) Rec.Sg: Rectosigmoid adenocarcinoma (3) Rectum Colon Col.Ad Cec.Ad Normal tissue l ah . 4 g neh yy mA m l y 3b aN C A N Df A hy A e h Al y y A c Sn f e9ocla 9 c nf h n e 9t c mR n c t 9cg 9l9n g l ( ( Wm n n c t Sl c v e on 32KA R n n e ( ( n cle Rgla t 9n pSn cc e gR l n le hn got got 9nc R f e gR ot ((2 n e ct ll co c g 9 Sla 9m n ol g e n cA 9n p t Sl e g cge 9gR got 9nc v e on 32KA lgR9o R gR n pSn cce9 9m n ol g e 9nt l gecco n gR c t c n c9t R n9oSA c e ( (, e pSn cce9 ( (W n gR n gR e gR n got A e gla l cc pSn cc e n got 9n l9 ge9 heg ec et S9ng g g9 g u e g9 n9 c t Sl c 9n Rec.Sg Rec.Mu Rec.Ad h Al AmhN D A mDmh l DlaN mh l yya y r hmN l l AaN hm y N eD y e h hmaeb ( ( m c ( (, Col.Mu Cancerous tissue gR 9l9 ( ( c e 9o g gR ecS nega colgc ce A AKR1B10 gR gm9 e S pSn cce9 g cgo e c v cS n h ) , , 2D unraS r u m e ge e ( (, v e on e 9l9n g l Colorectal adenoma (45) 9og gR et S9ng 9 n f l9St gA Colorectal carcinoma (36) C Cd A neh yy mA A AmhN DR h AmN mDmA l yya b el bRpdd41 hKfe K bRpdCdb neh yy mA m C N Df R pg cg S m c g9 lar gR t e Rg 9l9n g l v 9 gRec lg n ge9 ( ( , e gR got 9n SS AKR1B10 N 9t c 35Kh mRe R e e g c gR S9e gc ah . T g AmN A hmN ye h 9 Colorectal adenoma(56) B Colon mucosa (24) h ) , ( , Kh 9m n ol ge9 nla e e Colon mucosa(22) g 9 n A y A A h DDDA y pSn cce9 9 ll le c 9 a 9 c nf e ( c e R S g9 llol n n e 9t S l 9 ll le S ) KA et el nla g9 mR g m ln cR9m R g n9 9oc pSn cce9 9m f n gR c ne9 R mRe R ec t 9 pSn cc e gR 9gR n 9l9n g l l f lc n c mR m g lu e ll le cA S ) R S g9 n e 9t c v e on W, K nch 9l9n g l n e S ) c S9cegef ll le c W, KA S99nla 9n 9g t Sle e g g gR ll le A S ) pSn cc m c g u n ( ( , v e on W, Kh ( ( W ec f na l g socg ( ( v e on 9og ) 5h Re Rla e ll le c v e on W, KD go llahm ( ( We ( n g la pSn cc a i e pSn cce9 9 Re R l f lc 9 9 gn9l 9n ll ( (, pSn cce9 e ongR n pS net gcA ((5 colgc A B # # %(" ##' C # $) # $ # #" $ %(" D # #& ##' # $) # $ m g A yA cel e ge 9l9n g l pSn cce9 h mRe R n e R 9n cn l g e e 9l9n g l 9t Sl g la nA ##' # $) # $ $ A y A e A Dm 9 a9n ( l9 c ec l9 oc n Se ge 9t t 9 SR 9t 9 h ) , , 5KA 9 n cc gRec t gRal ge9 9 9og ( ) W FW 3 zWu ch n cS gef lah v e on W( KA FW 3 n mRel c g e ch l9 g e on W( hgR 9l9n g l 9 c i o h ) , , zD gR ( $ C C2 r 3 c e gR n e9 hmRe R ec n v ne 9l n cg $ 9m n ol ge9 9 9 gn nah eg ec lar # C Dm ay t olgeSl i o cge9 m n9t gR C Cd r 3 A g9 lo e g mR gR n gR cS e e 9nh 9 gR e h $) $ ah 2d g N neh yy mA m C C r 3R aN A mDmh l D A h DDDA y A A e pb neh yy mA m # # %(" %(" ##' pSn cce9 9 pSn cce9 ecSl a n t e FW 3 m c 9g lg n e g oSn ol ge9 e o lg n A t gRal ge9 9gR Sn9t 9g nc egR n e 9nt l m c n9oc gecco v e on W( KA 9 loce9 hgR gR ( S 9m n ol ge9 9 c l9 och ( (, ( ( Wec 9 e oc gR n ec 9g 9m n ol ge9 9 gR e R 9ne c 9n RaS nt gRal ge9 A Rec et Sle c gR g 9m n ol ge9 9 ec cS e e (), 9g g9 9 c i o 9 l9 n Se ge cel e A ( c colgc SLC35B4 1.0 0.6 0.4 0.2 NORMAL TUMOR CONTROL NORMAL TUMOR 0.8 0.6 0.4 0.0 0.2 0.0 0.2 0.4 beta.value 0.4 0.2 0.0 TUMOR CONTROL NORMAL SAMPLES NORMAL SAMPLES SLC35B4 1.0 TUMOR TUMOR SAMPLES C CONTROL beta.value 0.6 0.6 0.8 0.8 1.0 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) CONTROL NORMAL TUMOR Methylation for probe cg25920630 Methylation probe cg25920630 CONTROL (N=81) NORMAL (N=38) TUMOR PAIRED (N=38) TUMOR UNPAIRED (N=216) 1.0 NORMAL SAMPLES Methylation probe cg23601994 Methylation for probe cg23601994 Methylation for probe cg00033643 BPGM CONTROL 1.0 B 0.0 0.0 0.2 0.4 beta.value 0.6 0.8 A 0.8 1.0 Methylation for probe cg01627553 BPGM Expression 0.0 0.2 0.4 0.6 0.8 Expression NORMAL TUMOR CONTROL NORMAL TUMOR ah 2C g 3 AmN Dm l mA A G2 . b yt a h y A l e N l f D l mA l m G2 . A r h A3R mDmh l DlaN mhrh 3 A l m neh yy mA m C A y 9m egec l ngR ggR t e la g t ge yl A y m C Dm ay A l A mh A y A yD A yym l lm ehmN ml hyb 3 mDmh l D A yb 3 neh yy mA l m ml A y A Dl f mAmhy uAmhN DqN a my yym l r Da 3b nn g 9m n ol ge9 9 onne ( (, cet olg 9ocla 9gR R ect 9n 9gR ( ( Wh og m m9 cA 9 g c S9ng l vc 9 gR ( , , got 9nc lar ( ( W ecSl a v, A5F2K n ol ge9 9 9nn l g megR pSn cce9 t g ne lc g gR A c Cc v, A5FzK gm9 e g 9 g e e gR S gR pSn cce9 g e on W) h ( (, lt 9cg e ge l f lo che ( ( WA g ec m9ngR g9 9g gR g g n9t g v e on W) KA R c n colgc co ( ( , egR n nec 9t t 9 n ol g9na t gR9 cK Se g e gRec cel e n cc gR g i o cge9 m oc f na Re R 9nn l ge9 h ( (, 9l9n g l n chmR g m9ol e e g 9l9n g l c gc 9 c t Sl ch gR 9t e e cg 9gR 9y ( ( m c 9g ( ( Wh mRe R 9 ent c e S g ()( colgc n ol ge9 9 ( ( f ncoc ( (, ( ( W e 9nt l got 9n 9l9n g l gecco A A B C ah 2p g mhh D l mA m neh yy mA D i Dy lo A C Cd r 3 A C C2 r 3 o l A y A Da Al mDmh l D neh yy mA l br 3 msh aD l mA m C Cd A C C2 ay A l y lyR A mDmA N a my hmN Dl f mAmhyR A AmhN DN a my hmN mDmh l De l Aly A Al N l laN mhb ()) colgc neh yy mA m c c ne C S ecl t 9oc A ( ( pSn cce9 9 gR c t Sl chS9laSc l9 oc ec S nge lla 9 c nf n 9ngR9l9 c 9gR R f c e c 9 e n g t 9oc 9nt l 9l9 gR n m c lt 9cg 9 R g9 mR g9 onn S gm gR pSn cce9 9 gR gla 9 gR t gRal ge9 cg goc v e on WFKhcet el nla e gR Rot e 9gt ( (, A n e 9t A e n g c t Sl che n e9 ( mR n c gR n ec 9 t 9oc 9ngR9l9 u 9m 9n Rot gR gR mDmA Sn f e9oclah gR cgno gon 9 gm Rot lar N Df A N may ( ( mR n t gRal ge9 9 gR Sn9t 9g n cel e A ! ! " " " " ah 2G g h Dl i neh yy mA A h Al N may y N eD yb h mDmh A N l f D l mA yl lay m l e yD A b D 6 aDDf N l f D l R h f 6 e hl DDf N l f D l aAN l f D l A Da 6 aA l hN A b ec Re Rla 9m n ol g cel e pSn cc e f e 9nt l n e 9t ch e e n c l yl Ro l 6 og gecco ch R9m f n eg ec cle Rgla 9 gn cg megR S9laSc mR n gR n ec 9 pSn cce9 e c t Sl c F5) F5F v e on W3 KA n e 9m n ol ge9 e t gRal ge9 cg goc 9 9 h pSn cce9 h pRe eg nh cS e lla 9n S ecl t 9 v e on W3 9 c 9g SS n g9 cg g a 9 KA R ggR pSn cce9 A ()F colgc A B C ah 2. g A h Dl i neh yy mA A h Al N may y N eD yb h mDmh A l yl N l f D l mA yl lay m l e yD A b D 6 aDDf N l f D l R h f 6 e hl DDf N l f D l Ro l 6 aAN l f D l A Da 6 aA l hN A b e 9 loce9 ht 9oc 9l9 ()3 c ecSl a e n g nh c eg 9 onc e Rot cA 9m f nhgR S ecl t ela ( 9 c 9g cR9m e gR t 9oc A n c9 9m n ol ge9 t gRal ge9 cg goc 9 l n cc9 e ge9 megR gR pSn cce9 9 gR colgc neh yy mA m C C A 9n n g9 9 ent gR 9l9n g l C Cd l l pSn cce9 lg n ge9 c 9 c nf n S ge gch m S n 9nt c t Sl c 9nt lI got 9nA lar ehml A D i D m cg n e ( c e l9g cc ac 9 ( ) S en ( ( ( ( , Sn9g e pSn cce9 e cep S enc 9 9nt lygot 9ngecco c t Sl c v e on WWKA A B ah 22 g yl hA Dml A Df y y m C Cr 3 A AmhN DclaN mhb y ay y may s e A A b cg n n t ge l9g o 9m n ol g ue 9m n ol g pSn cce9 v7h 2h ( , h ( ( lacech g9 gR n gR c n colgc m ec cle Rgla 9m n ol g e DDDA y A Cp e hy S9e g ( ) K v e on WW KA n e 9 9n g megR gR Sn9g e e t 9cg9 gR A y A. ( ( , hmRe R ec l nla 9m n ol g e c t Sl ( v e on WW KA l f lc m n WW KA t 9m n ol ge9 9 z c t Sl c lar t nSe C Cd r 3 9l9n g l 9 ent gR 9og gR e W9og9 ( ( m c l nla ll le c lar pSn cce9 9 c nf gR g hgR v e on ( ( , ec n t ge lla nc t Sl c lar hmRel ( ( m Sn9S9nge9 9 gR t A C Cd A mDmh l D A hl yya N hm hh f y pg m e f cge g oce gR S9cce l gecco t e n9 nn ac v o ge9 9 S ) c S9cegef c Sn9 9cge t nu nh cKe ( 5z 9l9n g l got 9ncA 9n n g9 c g oS gR 9 ege9 c 9ngR et t o 9Recg9 R t ecgnahm oc ( (, 9 gn9l 9 ( ( z c pSn cce9 v e on WzK gef 9 gn9l gR R t g9pale y ()W colgc 9ce cg e e e 9n n g9 R u gR i o lega 9 gR c t Sl vc t g ne lc t gR9 cKA ah 25 g A 3 l y h eh y Al 3 l N lmnf DA A my A yl A A r N N aAm ylm N ylhf o l e on W7 m 9 c nf 9nt l 9l9 t o 9c ge 9 aA c Sn f e9ocla 9 c nf ecSl a ce Re R 9n 9t Sl g la R9t 9 9oc pSn cce9 9 ( (, gef FAzb Sn c g gR ne R f ot cel n 9 ll gR c gef ( (, 9 gn9lc m n pSn cce9 v e on W2 K ( ( , v e on W2 KA gR 9l9 got 9nc lar pSn cce9 9 got 9nc Sn lo e f cge g 9nn l ge9 c megR n l f g le e l ()z e oc 9 ent gR g5zA3b 9 gR 9n cgn9 la 9m n ol g ( ( , A 9 gn nah z) AWb 9 gR got 9nc m n pSn cce9 9 megR gR l i Df b ( (, A v e on W2 KhFFA5b R g m a gR g ll 9nt l 9l9 t o 9c pSn cce9 A gR S9cegef CC5Rh ye a 9gR n t gR9 chgR 9nt l 9l9 t o 9c gRec g R 9l9 ahm 9 c nf S9cegef 3m e p A C Cd Al m f b c gA ( ( , A R Re R a cg gecge l lacec g9 colgc A! B! ah 20 g mhN D mDmA N a my A yl A A A A 3 f o l l B ah 24 g n N eD y m l hl h mDDmo lm ymhl l yl A A b 3A l i y N eD o l ymN AmhN D mDmA l yya yl A A b 3emy l i laN mhb Al m f Al C Cdb C Al h Al mDmA laN mhy mh C Cd mllmN m l h N Alb 3 ay ()7 colgc C C A mDmh l D A hl yya N hm hh f y ce gR c t 9ll ge9 9 ( ( A gRec c m oc m32, c R u c pS g h n e S9cegef ((z c yl A A mh CC5 C C Al m f b 9n gR pSn cce9 9 ( ( m c pSn cc gR n colgchm 9 c nf 9n pSn cce9 9 ( ( S9cegef gR Sn9g e pSn cce9 9 9 gn9l 9n pSn cce9 A o . 4dR h ye l i Df b 3 A ag9Sl ct 9 9nt l 9l9 gR g ll 9nt l 9l9 t o 9c pSn cce9 A gR 3 y l ( ( e gR 9nt l 9l9 v e on z, KA e gR ( ( v e on z( K ( ( v e on z( KA ()2 lc9 R u gef v e on W5KA ah 2T g 3 A 3 N N aAm ylm N ylhf o l pghm chm llcA 9 gn9lc m n c 9 gR got 9nch 52b n g e socg ) b 9 gR t l9cg gR gR pSn cce9 9 colgc A! ah 5d g 3 mhN D mDmA N a my B! yl A A A! ah 5C g n N eD y m l h l h mDDmo 3emy l i laN mhb 3A l i laN mhb 3 f o l l Al m f Al C Cb B! lmymhl l h Al mDmA laN mhy mh C C yl A A b ()5 Medias y medianas del tiempo de supervivencia Mediana Intervalo de confianza al 95% AKR1B1_DEF Límite inferior Límite superior colgc ,00 1,00 2,00 Global ,000 7,742 7,763 7,875 11,047 9,495 9,540 9,164 cSeg gR l9m ot n 9 9l9n g l ce e e glaComparaciones cc9 eglobales g megR n m9nc 9f n ll Chi-cuadrado gl Sig. Log Rank (Mantel-Cox) 12,151 2 ,002 Prueba de igualdad de distribuciones de supervivencia para diferentes niveles de AKR1B1_DEF. ec c y n conf ef l megR Sy , A, , , ( hn cS gef la v e on z) KA Free survival Time (months) ah 5p g h neh yy mAb ( ( 9m n ol ge9 m c Overall survival f lo 9 , A, ) c ch Time (months) A mi h DDyahi i D A mDmh l D A Kaplan-Meier: he l Aly Associació e A A mAOS agrupant C C ehm 0l+ 1Avs 2 [Conjunto_de_datos1] /Users/Eva/Documents/docs TTD/CPT.ES1.604/PROJECTE TUMORS/CPT.ES1.604 TUMORS DEFINITIVA.sav Resumen del procesamiento de los casos Censurado AKR1B1 low vs high Nº total Nº de eventos Nº Porcentaje 1,00 115 78 37 32,2% 2,00 54 33 21 38,9% Global 169 111 58 34,3% ( F, colgc N C 9 A y N l f D l mA A neh yy mA e e ce Rgc e g9 R9m 9n 9 ( R n g ner t 9 e e ge9 c v S n 9nt lh lN Al t gRal ge9 m9ol l9 ochm gn g R h m l h2s K ((z gR llc megR gR n e9 a g gR n ol ge9 t gRal ge lare Recg9 g Wy r A S9cggn cl ge9 l K a Rn9t ge et t o 9Sn eSeg ge9 v R KA 9n 9f nhm pSn cce9 t gRal ge9 pS net gc 9 gR ( l9 ocA R n colgc S9e g l9 gR ( mRel 9og gR g gR l9 ocA ( (, t gRal ge ( ( S g 9 Wy r ecl ecSl a ( ( W Sn9t 9g nc t t 9 ec 9g o e 9nt cg lt 9cg olla t gRal ge9 h t gRal g g ngR gn gt gv e on zFKA A. AKR1B1 CpG island B. AKR1B10 promoter C. AKR1B15 promoter ah 5G g hmN ml h o l 2s K b g nt c 9 gn gt gh N l f D l mA yl lay m l pSn cce9 h lgR9o R gR ( ( pSn cce9 n t e coSS9ngc 9on Sn f e9oc 9 loce9 gR g 9g t s9n ( ( Wco z3 ge n ol ge n Sn9t 9g n C A y A S ecl o lg n ec l cc t gRal g t gRal ge9 9 g n gR v e on z3 KA Rec n colg ( ( pSn cce9 A gR t gRal ge9 CC5 mAlhmD A lh l ( ( Sn9t 9g n ec 9 gn nah gR a m n n y pSn cc ( (, v e on KA ( F( colgc A B C D ah 5. g C CR o l 2s K b C Cd A C C2 h D l i hmN l A ehm D m l ecg9 lar e e R n colgc S9e g Sn9t 9g n e vt g ne lc 9og S9l h ) ( ( zA gn g t nu e gR cR9m ((z ne Rt g 9 llc m 9t e n e9 e lo e l f lc m n t 9 A et el nlah m nc gn gt g l nla e o n e9 c n gef g ucA R l9 l 9ol 9g l9 gR gef l9 oc cS e l n l f n g la ne R gen n e9 A Rec ((z ( ( e 9 gR t nu g g F 3t ( llch lgR9o R oS9 gR gn gt gh n t gc 3 Sn9t 9g nA Rec n colg R c R ( ( , Sn9t 9g nhmRe R ec 9 cecg gmegR g n gn gt gh ll gef ge9 9 gR ((z F 3t F e gR 9ol 9 c nf gR ne Rt g 9n F 3t ( S e Km n t gR9 cKv e on zWKA ct ll gR n y pSn cce9 9 gR cel g ( F) Sn9g e c v a Rn9t ge et t o 9Sn eSeg ge9 v R K e megR Wy r n CC5 mAlhmD A lh l C Dm ay 9gR n gn g m c neh yy mA A t 9 e e ge9 c v F 3t ( h F 3t Fh F ) 7 h F ) 7t FKh Recg9 f ne g ) A e gR A l9 ec occ e gR ( cS e lla e gR F )7 ( ( megR gR l g nA R n c F ) 7t F l9 oc e e 9 gRec Recg9 g m c Sn f e9ocla 9 c nf megR Wy r n t nu oc eg ec cc9 e g eg mell l R z ((z llchWy r t 9 e e ge9 e gR l gn gt gv 9 ne o r n9cc gR e 9gR n cel g h) , , 2KA colgc 7p21.3 chr7 (q33) 21.1 15.3 $ 7p14.3 p14.1 13 11.21 11.22 11.23 7q21.11 ($ &$ q21.3 q22.1 7q33 7q34 7q35 36.1 ,$ *$ % % 7q31.1 %$$ %&$ % %$ % %) % & F.3 % ( ) - %$ * , + " # $ " % ! '! ' &+ # $ " % $ " " ! ' ( '! ! ! ' ( ! ' &+ ! ! ! $ " ! ! $ " # $ " % $ # " ! ! % " $ # ! % " $ # # $ " % ! & $ " % ! # $ " % ! ! ! $ ! % " $ # % " $ # " ! &! $ " $ " ! $ " ah 52 g hm D y m emD R p b R pR A . ylmA N h y p p0N GR p p0 R G .N G A G p0 A mAlhmD A 2s K lh l CC5 DDyb i Da y h eh y Al l A l i mAlhmDb hmN l A N N aAmeh e l l mA i Da y h y mo A y l Ah N Al h l mA mi h Aealb hhmh hy A l yl A h i l mAb ( FF colgc S9 gn gt gh gR n m c ( ( ) v n t g ) K S9l n t ge l9cc 9 ce l e n t g 2 v ( ( W Sn9t 9g nK no gn gt gh gn c neSge9 l n m n 9t S e ) hmR n gR S S a gR l9cc 9 e n t g F e gn g e g cegaA g n cge lah gef ge9 9 l9 gR I e A 9n ( (, ( (W gen l9 och p Sg 9n n t g u ec lt 9cgo lg n A lc9 lar ( ( e t 9cg 9 gR n e9 h p Sg ( ( WSn9t 9g nhmR n gR n m c ) A h gR n m c llch mRel oS9 l9cc 9 gR ecl e e e 9 y ( ( zh y1 gn c neSge9 ( ( z gn g g9nc g9 gR megR Wy r S ) v e on zzKA K ah 55 g A R e e s A e pb c s| ehm D A l 9 9gR ( ( , h c eg mell e e 9 9gR g9 gR ( ( , A S ) pSn cc A 2s K A AmhN Dl yya y A 9on R yc i cn l g a t e c 9 gR e e o gn g gef R o l 2s pSn cce9 9 gR g gR c e n c R gR gR Re R nf lo c 9 S eA lh l So le la f el l n Recg9 Wy r e on z7 hgR n ec S socge gR9c gecco c mR n ( F3 g CC5 lh l n m 9 c nf megR Wy r ( (, G p0 9nt l gecco c CC5R ec no e l 9n gR mR m gn g 9 gR g el gR A cR9m e pg pS net gcA e e h cS e lla e gR ne Rgce oc yD A ( ( S ecl m c e n c pSn cce9 9 C C e u9 CC5 R yc i t nu gn g F )7 ( ( , ec pSn cc N 9l9 DDDA g g9 lar e F )7 ((z e gR A h e e n g llcA ( ( S ecl ct ll e g cge A ( $ * & "' ( $ * ( $ * & "' ( $ * & colgc & A + + + Scale chr7: ! " Pol2A Pol2C k27me3A k27me3C k9me3A k9me3C CTCFA CTCFC H3K4me3A ! # H3K4me3C * RNAseqA1 . ** +*** ! RNAseqA2 +. ** , *** " RNAseqC1 RNAseqC2 k36me3A B k36me3C + + AKR1B1 UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) + CpG Islands (Islands < 300 Bases are Light Green) ! " k27acA + +. ++/ . ' $ + +* + + k27acC * ++/ *&, *&- *&/ ! *&0 + " Basic Gene Annotation Set from ENCODE/GENCODE Version 19 AKR1B1 AKR1B1 k4me1A ah 50 g 3 D i Dy m G p0 h e l A h Al AmhN D l yya y rD l e A D3 A l neh yy mA m C C A C Cd A l my l yya y rh l e A D3b 3 G p0 A mAlhmD CC5 mDmh l D A h DD DA A lh l o l 2s K rD l e A D3b A neh yy mA m C CR C Cd A C C2 A mAlhmD A CC5 2s K lh l DDy rh l e A D3b k4me1C t 9 cgn g ((z v e on 9l9n g l F )7 pSn cce9 9 R c n colgc l Sn9t 9g nn e9 9 t nu e gR Methylation450K Methylation450K n ll le z7KA g n cge lah gR gn gt gmR gl gR l9cc 9 gR 9t S n F )7 S g9 gR n y pSn cce9 9 ( ( SS nc g9 oc g9 RaS9gR cer ( (, o Sog gef oce megR gR 9nt l 9l9 t o 9c u ec n 9f n ( (, g R g n Wy r ( ( WA a gR n Se ge gef ega 9 gR 9 gn cgh R cA ( ( ( ( W c n ol ge9 A gR nt nuc m n lc9 lar ( ( Sn9t 9g n n e9 e R yc i g v p KA ( FW colgc D 9n n g9 lo e g gR 9 9nt ge9 l cgno gon 9 gR megRe gR o l och m pS net gc vc c t g ne lc ( ( , ec gR t S n 9nt Rn9t 9c9t 9 9nt ge9 gR g R c egc pSn cce9 t 9n m c g gR 9 cg g Snet n 9 egc Sn9t 9g nA m9 ( (, ( ( , Km n lar n i o a t S 9 encg l 9gR ( ( z n a gR g co cg R m c pSn cc S ) vcR9me S ) e gR 9ol 9 c nf lahgR nn9m S z2KA R c hm n t ge llah gRec c e Rn9t ge 9n 9gA 9n gRec n c9 h ll le c ( ( z vmegR oll Re R gn c neSge9 l f lc 9 pSn cce9 9 e g n ge9 9 g g t ela l9 ocA gR g gR S gg n c m n u 9 9 g gec l9 g cgn9 ( lt 9cg gR c t e ( ( , m c 9t Sl g la e n gA n9o gR gm gR S ecl v e on ( ( , Sn9t 9g n ( ( S ecl A ah 54 g G l ml C C Dm ay A CC5 A e p DDDA yb Dm Cd h t a A f m l Al h l mAy o h y l ny yl yl A m eh N hRDm l Al C Cd ehmN ml hb ( Fz t ela Sgon vF K a gR F g R ei o A e on z2 n Sn c gc gR ll le c f gR9o R gR t nu K n c9t S e g 9 mR gR n gR co cgno gon 9 t gR9 cKA oc gRe u gR g egc Sn9t 9g n 9ol cel e ( ( n y h eh y Aly l emAl lml mAyl Al colgc e on z5 m 9 c nf l9c R f n Sn c g A R t 9cge g n cge g9 gR ( ( e g n ge9 megR gR S R h Al h t a A f mAl pSn cce9 e S t R ect nl g ( (, gla 9 gR ge ge c l emAly o l A l co lt 9cg gR c t cgc gR g gR c 9 I 9 cmeg RA c 9 onne e gR S ecl ( ( , Sn9t 9g nhn e 9n e gR S ecl g9 m9nu c R ( (, e g n ge9 S gla 9 gR ec t e g e gR g gR n t ocg 9gR n R ect ec ( ( S eA g S9e g gR 9og gR e RaS9gR cer gR g gRec t ongR nt 9n hgR F en g C C Dm ayb pSn cce9 cg g h e e ge g9 Se ge R ecg l n ol g9n 9 f na 9yn ol g A 9 9nt ge9 m c 9 n i o a S9e gc ecl h c gRec n colg ec 9 cecg g megR S e gR g 9ol g gR g gR e n g c9ngc 9 9noc m c gR Re R n i o a S9e gc l9 g ( W pSn cce9 hmRe R n ah 5T g gR l9c n l ge9 cReS nh c Sn9S9c gm ( ( f t 9n gR leu la n9l 9 9f A ( F7 colgc A A hDa 9 cgo a gR e gR hy R n g9 oc gR S o l o e nc R 9 gR t 9 gn c gef ega 9 gR 3A) F f ( ( g9n vc S e t g ne lc S9ng n egA 9og ( u v e on 7, KA yy f y encg c l g l9 g 9 t gR9 cKh 9t e S ) ((z e megR F n t gc v ( h ) FK pg g9 gR 9gR n e gR R n t g m c en ge9 lla co g e R 9n n e9 ch m n l9 e g9 S 9t 3A) F f g9n ll le cA A UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) AKR1B1 CpG Islands (Islands < 300 Bases are Light Green) CpG: 93 B F3 F2 F1 Empty 0 0.5 1 1.5 2 2.5 3 3.5 5 6 C F3 F2 F1 Empty 0 A 1 2 ah 0d g 3 AmN Dm l mA m l h N Aly A Df K Al A h yy f h yaDly A e p A 3 A CC5 DDDA y mN e h R )IS 3A) F f g9ncR9m vS f lo q, A, ( K e 9gR v e on 7, KA gR cR9m egR n 9 9 ege9 c e 9gR ( ( S e 9ol ( F2 9n 4 A A h Da o l N elf i h y yy f b 3 lmhb ce e e gl f l 9 gn c neSge9 l oSn ol ge9 ll le cN S ) vT) AW 9l K 9 gn nah f g9nc (IS le e l l f lc 9 n S9ng n ll le c v e on 7, g c 3 R ne S ) ( ( z vT3AW 9l K 3A) F gef ega o FI S 3A) F n e ge l g cg KA R c n colgc 9 ent gR g ((z ll le cA colgc ongR nt 9n h m n cS9 ce l ef e 9ngR gR cge m g R S ecl gR c g9 n lo e g mRe R Sn9g e elega 9 ( ( S ecl A ongR nt 9n hm encg e gm9 S ngch t n t gc ) A( n t gc megR lo e n c R nA pgm c l g gn c neSge9 ( ( S ecl N g cg I 9n cS e e t 9 c9t R n gR g n t g ) h gef gR n t g ) h og cgell l nla ceg c Sn e g9nch g9 y n gR gR mR9l gR n t g) AFhmRe R m c lar g9nc e e 9 gR t m n c l g ) AF v e on 7( KA cc a v e on 7( Kh m n ler n t g ) AF ec f t 9n S9m n ol c R R9m f n n t g ) A( m c l cc 9n Sn9g e c m n oce ge c e n g e g chgm9 gef ega megRe gR y1A A Scale chr7: 134,143,200 134,143,300 500 bases 134,143,400 AKR1B1 134,143,500 134,143,600 134,143,700 134,143,800 UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) hg19 134,143,900 134,144,000 134,144,100 CpG Islands (Islands < 300 Bases are Light Green) CpG: 93 B " #! " #" " #! " # " ! " $ ! !$ " "$ !!% m ah 0C g A A h l i lf m h Al h N Aly o l A C C e yD A b 3 AmN emy l mA i Da l h N Alb 3 D l i A A h l i lf mN e h o l l N elf mAylha lb y I S nge eS ge9 m gR mRe R gR y1 e f lo g v ) AFA( Kh p lo e e e ceg 9 g9 9f nl SSe gR R gR n c i o c g9 9 ent gR en gef ega 9 cR9ng n n t gc e lo e v ) AFA) K h e llah 9gR n 9 cgno g e y I y1 m c t og g g9 n t 9f gR n 9 ege9 t 9ge v ) AFA( t ogKv e on 7( KA ( F5 colgc ll 9 cgno gc e lo e gef egahmRel gR e g g R n A hDa g nm n ch m m g gef ega 9 ( ( m S n 9nt n c R n 9 gR c gm9 ( ( S ecl A hy S eh c 9on yy f y t gRal ge9 o t gRal g vc g gR R n g e got 9nc e e g co R l9c n l ge9 cReSA t gRal ge9 m gn c R e 9og gR et S9ng g9 R u R9m 9 f lo g gR n9l 9 cc ac S9e g gef ega 9 gR l f D l mAs A t gRal g gR Re R cg l f lc 9 lo e n c l ge9 9n t og ge9 9 gR ceg n colg gef ega v e on 7( KA R c 9ngR cR9m t g ne l nlo e n c g f g9n ) I S t gR9 cK e 3A) Fh 9gR ((z ll le cc aA F2 Unmethylated F2 Methylated 0 ah 0p g A mn3b A h yy f y h yaDly lh Ay t gRal g )IS 3A) F f ( ( S e ( 3, p aAN l f D l ro 1 l 3A) F ce e e gla oSn ol g pSn cce9 9 gR lo e n c )IS lA 0.5 9og FAW 9l c 9t S n g9n v e on 7) KA R c g coSS9ng gR t 9 cgn g egc t 9 ol ge9 a 1.5 2 2.5 3 3.5 mn3 A N l f D l 4 r D vS f lo q, A, ( K gR megR gR t gRal g R t gRal ge9 A n gef ega 9 colgc A l 9n n g9 g cg gR ( ( t gR9 cKA R S encg 9 c ecl hm 9 cecg 9 lo e n c ecl A I y I y1 e e lar gR t Sga f g9n t o R l cc e ge9 9 gR ( ( , gR gR pS net g m c i o cgn9ac gR e e t g ne lc gef ega 9 gR n9m c i o g ( v e on 7FKA g n cge lah 9 gn9l S ) A ongR n R I cS e e c i o c n l9 g e p A S ll le h mRe R Re Rla S ) gn c C Cd neh yy mA mA C C e y e l gef ega 9 l9 c y1 e e m lg n ge9 e A 9ngo g lah l9 y ah 0G g s| A l n l9 c gR g 9 g e n c 9 ATTGGTTG! n 9gR Sn9g e ch mRe R R S ) g9 9 ent gR TFBS:! 9 no e l 9n gR ( ( , e gR S ) R pS net gc vc pS net g oce l ge9 gR g pSn cce9 9 y1 e gR gm9 gR t e 9n n g9 l99u 9n gR9c ( v ( K Sn c g c f l9S pS net gc n gRec ( ( , A g n gR c i o y e gR gno S n 9nt pSn cc gR gR n9l 9 ot n v e on 7FKA megR gR S ) ( pSn cc pS net gc n g9 gR c i o A ATT*****! e p N elf A e p Cb aA hl hyb yl h y y A l l Dl mh s y yb A ( 3( colgc A s A c 9 f ne a gR et S9ng Re f u 9 u9og9 9 l9 c gR gno c 9 ge9 9 gR C d neh yy mA A og e 9g nSe I y1 cS e e c i o y1h m oc 9n cS e e g R ei o g9 c m e 9g g9 lg n ge9 chm socg e p N lef R e e pSn cce9 9 g9 gR c i o e e p A s gR e p 9m n ol ge9 ( ( h lgR9o R gR v e on 73KA mR gm 9 c nf oce pS net gc n c n l9 g e p g9nc Sn9 o 9 gR c Sn9g e c ec no e l 9n gR S ecl A ongR n R ( 3) ggR n colgc e e I 9gR gn c neSge9 c ec e gR Sn9t 9g n 9 gRec gR g gR A C C A ( (, o y 9gR Sn9g e c S nc S n g A gRec g n cge lahgR l9cc 9 9gR A y oc m m n 9g l99ue ah 0. g s| b 9 s| 9 pS net gc gR lo e n c R 9 cgno gcD n n9l 9 gR g9 9 ent gR R e e c pS net gA ( ( 9 y colgc A S ec e Re eg9n 9 9la 9t n t 9f t ) Sn ccef 9t Sl p ) v p R gR t FK ) KA cc9 e g ((z llchmR n R h ) , , 2D et 9 d gR g gRec cel e ( (, 9t Sl p c 9nt c v F ) 7t h c g9 gR n e9 v 9 gef ge9 9 gR 9 g cg eg m gn g ) g lage co o eg 9 gR t nu a gR t gRal g RaS9gR cer 9n gR e ) e Re eg9nv F )7 ggn g e cg9 h ) , , 5KA n cS9 ce l ) Sn9g e h mRe R ec gR t n e R ect ec gR 9l9n g l ( ( , ec 9g pSn cc nA hmegR SKv e on 7WKA ! ! ! ! # "% " !% ! % ) # ( # ' # & # % # $ # # # " # ! # * !!& ah 02 g !!& C C A C Cd neh yy mA A Df y y m g n cge lahm 9 c nf mR g 9ol e e g gR g gR n Sn cce9 t R R !!& R nm c R ect A gR 9gR n R h gR F )7 DDy lh l co cg ge l e n c e gR g n gR gn gt gA ongR n R c e CC5 e e gef g !!& o l eb pSn cce9 9 o g9 gR l9cc 9 pSn cce9 9 pS net gc n ( ( ( (, ) e 9g g9 cc cc gR g ngR gn gt gA ( 3F colgc N hmD h l mA yy f 9n n g9 l ne a gR 9l9n g l o ge9 9 gR cel nh m e ) 5 9l9n g l t gR9 cKA n gR g nc gn c g e c S n g la ll le c oce ll le c m n Sn9le n ge9 n g c vc R9onc g t g ne lc c i o l ot 9gR ( (, c e l gef en l f ( ( We ( ( zh m32, g9nc vc t g ne lc cg lecR h m Sn9 t gR9 cK a n9 g9 ll 9o ge 9 gn9lh t Sgah g nt e g) 3h32 ( ( , 9n 7) ( (W llcA "& $ & $ " ' & % $ # " ! & $ " " "& " % $ "& % "& # # ' "# " !# ! # # # " "& % ' # ah 05 g hmD h l mA yy f A CC5R DDyR N elf A A l o l C Cd A c cR9m e R t S n m32, e on 7zh gn c pT mDmh l D A h ge9 9 llol n Sn9le n ge9 e llc gR . 4d A C C2b ( (, ( ( z )5 DDDA y A mAlhmDy cS e lla ll le cA n c e Sn9le n ge9 m c 9 la 9 c nf ( (W ( ( z g n7) RA yy f lc9 S n 9nt nl g ( 33 cc achmRe R e e g gR megR Sn9le n ge9 vc t g ne lc llol n t gR9 cKA gef ega gR gec en gla S n 9nt colgc cc ac g ) 3h32 megR gR 7) Rhe ( (, h ( ( zh m32, ( ( W9n t Sga f ) 5 mel gaS g9n c ''" # (& # & %(& ''" g %)" $ %(& e 9 gn9lA ##' $ $& # $& # " (& " & " $& " $% %) ##' $""" # )" " # '" " # %" " # $" " # """ " )" " " '" " " %" " " $" " " """ ($ # #" $% # #& %) %)" ($ # #" # #& %(& ''" $* $""" # )" " # '" " # %" " # $" " # """ " )" " " '" " " %" " " $" " " """ $% %) %)" ah 00 g lh Ay l A ($ # #" yy f A C Cd A # #& CC5R o . 4d A C C2b et el nla g9 mR g 9 onn t 9 cgn g gn c g l9m n le c pghm m g cc a g ) 3h 32 9t e gR cS e lla e llol n ge l m9ol megR ll gR c Sn9le n ge9 ( (, t 9n l nmR m ( ( W e 9l9n g l ) 5 mel t Sga f g9 n ge 9l a Sla n ge l g9 gR t g hco cg 9 gn9l ( ( Wh n llcA e 9g Sn9le n g D lt 9cg o one gaS g9n c ( (, g llc m n gR t gR9 cKmegR ( ( Wm n 9g ef e e cc ac gef egaK e llc mR n ge l m c geSn9le n gef n9l e 9l9n g l ( ( , 9n cc a ( ( Wv e on 77KA ( ( W 9n gR R9m f nh g , AWB I t l 9 n ge lh 9 gn9l g llol n ( ( zh m32, llc m n mAlhmDy A cc ah gR l cc gef ega 9 gR n o g n ge l 9c c 9 ) B I t l ll gn c DDDA yRo l n ge l gn gt gvt g ne l ( (, h mRe R ec u 9m g9 R f Sn9le n ge9 ve e ge 7) R9onc e megR gR v e on 72KA g9 R u gR eot A g c9n ( (, g9 gR t gn c e pT mDmh l D A h g llc gR gn gt gA geygot 9n nh f ngR l cc gRec og gef ega 9 g ec t o R eot A ( 3W colgc ah 04 g C C2b ( 3z l A Dlh lN Al A CC5R o . 4d A pTRlh Ay l h Al mA Alh l mAy m h l A Dr) cN D3o h l yl Al mhAml o l h Al C Cd A DDDA yb colgc neh yy mA ehm DA l hma m l h l Am AmN lD y A A h R e gn ot llol n 9 n 9 rat c e f 9lf g e n g cg n cS9 ce l n e gR g c 9n e gl c v gR pSn cce9 e S gRm a v Retinoloxidizing ADH1A ADH1B ADH1C ADH4 ADH5 ADH6 ADH7 DHRS3 DHRS4 RDH5 RDH8 RDH10 RDH11 RDH12 RDH13 RDH14 mDmh l D l yya y y 9 gn9ll n ge 9e ll a gR e9ca gR cec e pSn cce9 g nt e p K vRggSNI I c t g c gcA R c megR gR c 9l9n g l gecco h m oc n A 9t An cgAoy encg cg S Sog gef R I Kh S gRm a e 9nt l 9l9 h 9n gRec SonS9c m 9l9 gecco 9 W, S gRm aKA e n g gaS c 9 y g A eA eRA 9f I g lacec v 9t e Cc gef ege c 9 e S gRm a v e n ge ge9 A 9 K vRggScNI I g g9ua9A AsSI K e ge ae l A rat c f na n gla t 9 c 9 9n n ge 9e 9t n gn ge9 c 9 n ge 9e c n t S9ng glahgR l f lc 9 gR c llc e l o f 9 cecg lar gR n9l e gR n ge 9e Retinalreducing AKR1B1 AKR1B10 AKR1C1 AKR1C2 AKR1C3 AKR1C4 SDR16C5 HSD17B6 9 R n g ner gR n le l Sn9 9l9 v Retinaloxidizing ALDH1A1 ALDH1A2 ALDH1A3 ALDH8A1 c e f 9lf RA-oxidizing Nuclear TF CYP26A1 CYP26B1 CYP2E1 RARA RARB RARG RXRA RXRB RXRG n o e 9pe ere e gR n ge 9e c vS f lo q , A, WK gecco A R ( h e l ( 3KA Other functions ABCG5 ABCG8 AWAT1 AWAT2 BCO2 BCMO1 CRABP1 CRABP2 DGAT1 DGAT2 LRAT RBP1 RBP4 RBP7 RETSAT SULT1A1 D C. g A y Ai mDi A l h l Am e l o f A mDmAb D l A y h neh yy AmhN D mDmAb A f DDmo h l my Df neh yy A A h f l my N m h l Df neh yy A AmhN D mDmh l Dl yya b oc e ( h c v rat c v rat c Wh 9 ce n Fh ( (h ( (h gR 2 n ge 9ly9pe ere (, h ( (h ( ) Kh ) 9l9 hm p e g cega f lo c e Rot e lo 3h ( (, h e ca gR cec e gR A ((h ( )h y9pe ere c ( ) Kh W n ge ly ( FKh ) n ge ly rat c v )z (h ( 37 colgc ) z ( Kh3 o l n gn c neSge9 9gR n c e f 9lf ( ( KA gef Dl h e gR h S gRm a v c n Re Rle Rg neh yy mA m g9nc v A y Ai mDi e (h h h K (h W l ( 3A A h l Am e l o f y yym l o l yahi i D A mDmh l D A he l Aly 9 g e ce Rgc e g9 gR 9l9n g l )z nhm c e f 9lf 9l9n g l e n le e l et Sle ge9 c 9 lar lg n ge9 c e gR cg gecge l cc9 e ge9 c 9 S gRm a e g c g gR g e lo 9l9 A S gRm a e pSn cce9 l f lc 9 gR g m n 9 g e ( 5 9nt l 9l9 n9t gR ( WW 9l9n g l got 9nc t Sl cA ah 0T g A neh yy mA D i Dy m l h l Am e l o f A y y A AlDf Dl h mDmh l D A hbCT AmhN D mDmA y N eD y r A h f 3 A C22 mDmA laN mhy r A h 3o h ay b ( 32 A colgc on n colgc l nla cR9m S gRm a m c lg n ) zK m n one 9l9n g l got 9ne cecA g9g l 9 ( W c v9og 9 lg n Dt 9cg 9 gR t v( FK m n ( Fh ( (h )z (h K pSn cce9 Sn9 9 gR g gR 9f n ll gn c neSge9 l Sn9 el 9 gR (h gm9 oSn ol g c oc e g c gc 9 Rot gR c g m S gRm a 9l9n g l 9o e n gR g e lo lar 9 gR (h pSn cce9 9ol g pSn cce9 conf ef l e 9nt ge9 A egR e n conf ef l onf c 9n R lg n t gR9 cKA ec c lg n n conf ef l m c pSn cce9 S gg n 9n c v e on 2, KA 0.059672 0.017763 0.018734 0.029271 0.010574 0.049359 0.003597 0.012905 eD As h yahi i D ahi y mh e l o f A yo l mn e i Da I dbd2 r n el mh h hy lm neh yy mA A Da lmDmo neh yy mAb ml DA y h D l l mA A ( (, h gR g pRe eg Sn9 cch h A F e n g gR g 9f n ll conf ef l 9n 0.014312 ah 4d g C Cd3b Al hi Db ( (, h h p ce e e gla l9m ne gR9c S ge gc gR g ecSl a c9t ( (h ( ) Kv e on 75KA lg n nhm v h (, Sl y t g ne lc g n cge lah m v e S gRm a 9l9n g l 9 cgno g vc 3h e gRec lacec n lecg n cc mR gR n n ge 9e conf ef l 9og 9t 9m n ol g ( )h )z (h pSn cce9 l9m l f lc 9 gR c v e on 2, KA gR 9 gn nah (h 3h h 9m n ol ge9 one c n ( , ec cc9 e g gR megR n 9l9n g l c n m9nc conf ef l n g gR g g c g9 oSn ol g e ( 35 colgc 9l9n g l nh e gRec c h gR oSn ol ge9 ec en gla le u conf ef l v e on 2, KA R c n colgc e e g gR g gR c ec l9c la n l g c9t u a S ge gc megR 9l9n g l hmN ml h lg n ge9 9 megR gR conf ef l 9 gR S ge g c t a R f SSle ge9 c g9 S99n Sn9 9cge gR S gRm a n ol ge9 9 g9n 9 S99n conf ef l 9n ncA N l f D l mA ehm DA m l e l o f A AmhN D A mDmh l DlaN mhl yya R n c t 9cg 9 gR nhgR n ec 9 l n t t gRal ge9 e gR cel e t gRal ge9 9 gR 9l9 h 9t S n Color Key and Histogram megR gR 400 Count 600 t gRal ge9 h ( ( )z (h c v (h h ( (h h 9l9n g l lar cA g e 9nt l 9nt l ( (h gR e cg got 9n ( )h )z (h COX meth genes ( Km n RaS nt gRal g e 9l9 1000 200 0 0 3000 2000 nv e on 2( KAgenes T RAP 0.2 0.6 Color Value A. RAKey pathway and Histogram 1000 3000 Count ( Fh Color Key and Histogram Color Key and Histogram e e S gRm a 9l9 got 9n gecco A 9t S ne COX meth genes n m 9l9 t gRal ge9 4000 gR 9 gR n ge 9e 3000 lar 9m n ol g 9og R9m eg 9 oncA 2000 n9l 9 R ect c n Count S gRm a u a 0.2 0.6 Value in colon tumor samples! B. RA pathway in normal colon samples! RAP genes T TCGA−AA−3713−01A−21D−1721−05 TCGA−D5−5537−01A−21D−1926−05 TCGA−A6−6649−01A−11D−1772−05 TCGA−D5−6932−01A−11D−1926−05 TCGA−CM−6168−01A−11D−1651−05 TCGA−CA−6717−01A−11D−1837−05 TCGA−G4−6297−01A−11D−1721−05 TCGA−D5−5539−01A−01D−1651−05 TCGA−A6−2671−01A−01D−1407−05 TCGA−AA−3496−01A−21D−1837−05 TCGA−G4−6298−01A−11D−1721−05 TCGA−AA−3495−01A−01D−1407−05 TCGA−CK−4947−01B−11D−1651−05 TCGA−AA−3660−01A−01D−1721−05 TCGA−D5−6926−01A−11D−1926−05 TCGA−G4−6627−01A−11D−1772−05 TCGA−AZ−5407−01A−01D−1721−05 TCGA−AD−6899−01A−11D−1926−05 TCGA−DM−A1DB−01A−11D−A153−05 TCGA−CM−5864−01A−01D−1651−05 TCGA−A6−2680−01A−01D−1407−05 TCGA−A6−6654−01A−21D−1837−05 TCGA−CK−6747−01A−11D−1837−05 TCGA−D5−6541−01A−11D−1721−05 TCGA−D5−6535−01A−11D−1721−05 TCGA−AY−6197−01A−11D−1721−05 TCGA−AZ−4616−01A−21D−1837−05 TCGA−D5−6530−01A−11D−1721−05 TCGA−A6−5657−01A−01D−1651−05 TCGA−AZ−6605−01A−11D−1837−05 TCGA−A6−2681−01A−01D−1407−05 TCGA−AD−6901−01A−11D−1926−05 TCGA−AA−3506−01A−01D−1407−05 TCGA−A6−6138−01A−11D−1772−05 TCGA−G4−6306−01A−11D−1772−05 TCGA−D5−6529−01A−11D−1772−05 TCGA−AD−6965−01A−11D−1926−05 TCGA−AZ−6607−01A−11D−1837−05 TCGA−AD−6964−01A−11D−1926−05 TCGA−G4−6294−01A−11D−1772−05 TCGA−AA−3488−01A−01D−1407−05 TCGA−AM−5820−01A−01D−1651−05 TCGA−A6−5659−01A−01D−1651−05 TCGA−D5−6532−01A−11D−1721−05 TCGA−DM−A288−01A−11D−A16X−05 TCGA−D5−6923−01A−11D−1926−05 TCGA−AD−6548−01A−11D−1837−05 TCGA−G4−6303−01A−11D−1772−05 TCGA−G4−6302−01A−11D−1721−05 TCGA−D5−6898−01A−11D−1926−05 TCGA−AY−5543−01A−01D−1651−05 TCGA−CM−5344−01A−21D−1721−05 TCGA−CM−6169−01A−11D−1651−05 TCGA−DM−A1D6−01A−21D−A153−05 TCGA−F4−6807−01A−11D−1837−05 TCGA−CA−5256−01A−01D−1407−05 TCGA−AD−6895−01A−11D−1926−05 TCGA−D5−6533−01A−11D−1721−05 TCGA−CM−5348−01A−21D−1721−05 TCGA−F4−6855−01A−11D−1926−05 TCGA−CM−6164−01A−11D−1651−05 TCGA−A6−5656−01A−21D−1837−05 TCGA−DM−A1D7−01A−11D−A153−05 TCGA−G4−6315−01A−11D−1721−05 TCGA−AA−3655−01A−02D−1721−05 TCGA−DM−A28K−01A−21D−A16X−05 TCGA−CM−6166−01A−11D−1651−05 TCGA−CM−6163−01A−11D−1651−05 TCGA−CM−5341−01A−01D−1407−05 TCGA−A6−6780−01A−11D−1837−05 TCGA−CM−6172−01A−11D−1651−05 TCGA−A6−5666−01A−01D−1651−05 TCGA−D5−6537−01A−11D−1721−05 TCGA−CA−5796−01A−01D−1651−05 TCGA−DM−A0XF−01A−11D−A153−05 TCGA−CM−5349−01A−21D−1721−05 TCGA−CM−4746−01A−01D−1407−05 TCGA−CM−4747−01A−01D−1407−05 TCGA−DM−A28A−01A−21D−A16X−05 TCGA−DM−A1HA−01A−11D−A153−05 TCGA−CK−5914−01A−11D−1651−05 TCGA−D5−5540−01A−01D−1651−05 TCGA−DM−A1D9−01A−11D−A153−05 TCGA−A6−2682−01A−01D−1407−05 TCGA−AA−3509−01A−01D−1407−05 TCGA−F4−6805−01A−11D−1837−05 TCGA−AZ−4315−01A−01D−1407−05 TCGA−G4−6310−01A−11D−1721−05 TCGA−AZ−4682−01B−01D−1407−05 TCGA−AZ−6603−01A−11D−1837−05 TCGA−G4−6295−01A−11D−1721−05 TCGA−G4−6307−01A−11D−1721−05 TCGA−AA−3494−01A−01D−1407−05 TCGA−F4−6569−01A−11D−1772−05 TCGA−F4−6704−01A−11D−1837−05 TCGA−CM−6678−01A−11D−1837−05 TCGA−CM−6679−01A−11D−1837−05 TCGA−A6−6782−01A−11D−1837−05 TCGA−A6−5667−01A−21D−1721−05 TCGA−DM−A28F−01A−11D−A16X−05 TCGA−G4−6311−01A−11D−1721−05 TCGA−CM−6680−01A−11D−1837−05 TCGA−D5−5538−01A−01D−1651−05 TCGA−D5−6929−01A−31D−1926−05 TCGA−AZ−6600−01A−11D−1772−05 TCGA−CM−5862−01A−01D−1651−05 TCGA−CM−4752−01A−01D−1407−05 TCGA−D5−6922−01A−11D−1926−05 TCGA−AA−3662−01A−01D−1721−05 TCGA−CM−5868−01A−01D−1651−05 TCGA−AZ−4308−01A−01D−1407−05 TCGA−F4−6703−01A−11D−1837−05 TCGA−CM−6162−01A−11D−1651−05 TCGA−G4−6304−01A−11D−1926−05 TCGA−F4−6854−01A−11D−1926−05 TCGA−F4−6808−01A−11D−1837−05 TCGA−G4−6625−01A−21D−1772−05 TCGA−AA−3697−01A−01D−1721−05 TCGA−A6−2685−01A−01D−1407−05 TCGA−AZ−4681−01A−01D−1407−05 TCGA−G4−6309−01A−21D−1837−05 TCGA−CK−5912−01A−11D−1651−05 TCGA−AZ−5403−01A−01D−1651−05 TCGA−A6−6648−01A−11D−1772−05 TCGA−A6−6140−01A−11D−1772−05 TCGA−DM−A1D0−01A−11D−A153−05 TCGA−DM−A28E−01A−11D−A16X−05 TCGA−A6−5662−01A−01D−1651−05 TCGA−D5−6536−01A−11D−1721−05 TCGA−D5−6924−01A−11D−1926−05 TCGA−AZ−4313−01A−01D−1407−05 TCGA−AZ−6608−01A−11D−1837−05 TCGA−D5−6928−01A−11D−1926−05 TCGA−D5−6534−01A−21D−1926−05 TCGA−D5−5541−01A−01D−1651−05 TCGA−AA−3712−01A−21D−1721−05 TCGA−F4−6459−01A−11D−1772−05 TCGA−G4−6317−01A−11D−1721−05 TCGA−CM−6170−01A−11D−1651−05 TCGA−A6−2684−01A−01D−1407−05 TCGA−A6−6141−01A−11D−1772−05 TCGA−G4−6626−01A−11D−1772−05 TCGA−G4−6314−01A−11D−1721−05 TCGA−AD−6888−01A−11D−1926−05 TCGA−A6−6142−01A−11D−1772−05 TCGA−CM−6674−01A−11D−1837−05 TCGA−AD−6963−01A−11D−1926−05 TCGA−CM−4748−01A−01D−1407−05 TCGA−CA−5255−01A−11D−1837−05 TCGA−AD−6889−01A−11D−1926−05 TCGA−AZ−4323−01A−21D−1837−05 TCGA−F4−6809−01A−11D−1837−05 TCGA−F4−6856−01A−11D−1926−05 TCGA−CM−6165−01A−11D−1651−05 TCGA−A6−6652−01A−11D−1772−05 TCGA−D5−6930−01A−11D−1926−05 TCGA−F4−6460−01A−11D−1772−05 TCGA−CM−5863−01A−21D−1837−05 TCGA−DM−A280−01A−12D−A16X−05 TCGA−CM−6167−01A−11D−1651−05 TCGA−AZ−4684−01A−01D−1407−05 TCGA−CA−5797−01A−01D−1651−05 TCGA−D5−6539−01A−11D−1721−05 TCGA−AY−6196−01A−11D−1721−05 TCGA−AA−3511−01A−21D−1837−05 TCGA−AA−3510−01A−01D−1407−05 TCGA−CK−6748−01A−11D−1837−05 TCGA−CA−6715−01A−21D−1837−05 TCGA−A6−6651−01A−21D−1837−05 TCGA−AU−3779−01A−01D−1721−05 TCGA−A6−6137−01A−11D−1772−05 TCGA−AA−3489−01A−21D−1837−05 TCGA−CK−4948−01B−11D−1651−05 TCGA−A6−2675−01A−02D−1721−05 TCGA−A6−6650−01A−11D−1772−05 TCGA−CM−6676−01A−11D−1837−05 TCGA−DM−A28C−01A−11D−A16X−05 TCGA−AD−6890−01A−11D−1926−05 TCGA−G4−6321−01A−11D−1721−05 TCGA−DM−A285−01A−11D−A16X−05 TCGA−CM−4750−01A−01D−1407−05 TCGA−CM−4751−01A−02D−1837−05 TCGA−DM−A0XD−01A−12D−A153−05 TCGA−AM−5821−01A−01D−1651−05 TCGA−G4−6323−01A−11D−1721−05 TCGA−D5−7000−01A−11D−1926−05 TCGA−F4−6806−01A−11D−1837−05 TCGA−G4−6299−01A−11D−1772−05 TCGA−G4−6586−01A−11D−1772−05 TCGA−CA−6719−01A−11D−1837−05 TCGA−A6−4107−01A−02D−1407−05 TCGA−CM−6171−01A−11D−1651−05 TCGA−A6−4105−01A−02D−1772−05 TCGA−AZ−4614−01A−01D−1407−05 TCGA−CA−5254−01A−21D−1837−05 TCGA−CM−6675−01A−11D−1837−05 TCGA−DM−A0X9−01A−11D−A153−05 TCGA−D5−6531−01A−11D−1721−05 TCGA−D5−6540−01A−11D−1721−05 TCGA−CK−4952−01A−01D−1721−05 TCGA−A6−6653−01A−11D−1772−05 TCGA−AZ−6598−01A−11D−1772−05 TCGA−DM−A1HB−01A−22D−A17Z−05 TCGA−DM−A1DA−01A−11D−A153−05 TCGA−AZ−6606−01A−11D−1837−05 TCGA−AA−3492−01A−01D−1407−05 TCGA−CM−5861−01A−01D−1651−05 TCGA−A6−5661−01A−01D−1651−05 TCGA−G4−6588−01A−11D−1772−05 TCGA−CM−4744−01A−01D−1407−05 TCGA−G4−6320−01A−11D−1721−05 TCGA−CA−6718−01A−11D−1837−05 TCGA−F4−6570−01A−11D−1772−05 TCGA−AZ−4615−01A−01D−1407−05 TCGA−CM−4743−01A−01D−1721−05 TCGA−F4−6461−01A−11D−1772−05 TCGA−CK−5916−01A−11D−1651−05 TCGA−G4−6628−01A−11D−1837−05 TCGA−A6−5665−01A−01D−1651−05 TCGA−DM−A1D8−01A−11D−A153−05 TCGA−AD−5900−01A−11D−1651−05 TCGA−CK−6746−01A−11D−1837−05 TCGA−AA−3663−01A−01D−1721−05 TCGA−D5−6920−01A−11D−1926−05 TCGA−CA−6716−01A−11D−1837−05 TCGA−A6−5664−01A−21D−1837−05 TCGA−F4−6463−01A−11D−1721−05 TCGA−AZ−6601−01A−11D−1772−05 TCGA−G4−6293−01A−11D−1721−05 TCGA−CM−6677−01A−11D−1837−05 TCGA−CK−4950−01A−01D−1721−05 TCGA−A6−6781−01A−22D−1926−05 TCGA−AU−6004−01A−11D−1721−05 TCGA−CM−6161−01A−11D−1651−05 TCGA−DM−A1D4−01A−21D−A153−05 TCGA−DM−A28M−01A−12D−A16X−05 TCGA−CK−4951−01A−01D−1407−05 TCGA−AZ−6599−01A−11D−1772−05 TCGA−A6−2679−01A−02D−1407−05 TCGA−AY−6386−01A−21D−1721−05 TCGA−DM−A28G−01A−11D−A16X−05 TCGA−DM−A282−01A−12D−A16X−05 TCGA−CK−6751−01A−11D−1837−05 TCGA−CK−5913−01A−11D−1651−05 TCGA−DM−A28H−01A−11D−A16X−05 TCGA−CM−5860−01A−01D−1651−05 TCGA−CK−5915−01A−11D−1651−05 TCGA−A6−5660−01A−01D−1651−05 TCGA−D5−6538−01A−11D−1721−05 TCGA−D5−6931−01A−11D−1926−05 TCGA−AA−3502−01A−01D−1407−05 TCGA−D5−6927−01A−21D−1926−05 TCGA−A6−2686−01A−01D−1407−05 TCGA−G4−6322−01A−11D−1721−05 TCGA−AA−3713−11A−01D−1721−05 0 2000 TCGA−AZ−6600−11A−01D−1772−05 0.2 1000 Count TCGA−A6−4107−11A−01D−1551−05 TCGA−AA−3502−11A−01D−1407−05 0.6 TCGA−AA−3510−11A−01D−1407−05 Value TCGA−AA−3494−11A−01D−1407−05 0.6 ADH1C Aldh1a1 AKR1B1 Aldh1a2 DHRS4 RDH13 Sult1a1 Adh5 Rxrb Dhrs3 RxRa AKR1C1 Rbp1 RaRb AKR1C3 RaRg ADH1B AKR1C2 CYP26B1 RDH11 Retsat RaRa Crabp1 CYP16A1 RxRg RDH10 AKR1B10 LRAT ALDH1A1 AKR1B1 RDH11 ALDH1A2 DHRS4 SULT1A1 RXRB DHRS3 RXRA AKR1C1 RBP1 AKR1B10 RARB AKR1C3 DGAT1 ADH1B ADH1C RETSAT AKR1C2 CYP26B1 RDH10 RDH12 CYP26A1 ADH5 LRAT RARA Value ALDH1A1 AKR1B1 RDH11 ALDH1A2 DHRS4 SULT1A1 RXRB DHRS3 RXRA AKR1C1 RBP1 AKR1B10 RARB AKR1C3 DGAT1 ADH1B ADH1C RETSAT AKR1C2 CYP26B1 RDH10 RDH12 CYP26A1 ADH5 LRAT RARA 0 TCGA−AA−3660−11A−01D−1721−05 0.2 TCGA−A6−4107−01A−02D−1407−05 TCGA−CM−4744−01A−01D−1407−05 TCGA−CM−6171−01A−11D−1651−05 TCGA−CK−6746−01A−11D−1837−05 TCGA−CK−4952−01A−01D−1721−05 TCGA−D5−6920−01A−11D−1926−05 TCGA−AZ−6598−11A−01D−1772−05 TCGA−G4−6320−01A−11D−1721−05 TCGA−A6−5665−01A−01D−1651−05 TCGA−DM−A1HB−01A−22D−A17Z−05 TCGA−AZ−6606−01A−11D−1837−05 TCGA−A6−6653−01A−11D−1772−05 TCGA−AZ−6598−01A−11D−1772−05 TCGA−DM−A1DA−01A−11D−A153−05 TCGA−G4−6625−11A−01D−1772−05 TCGA−CK−5915−01A−11D−1651−05 TCGA−CA−6716−01A−11D−1837−05 TCGA−DM−A28M−01A−12D−A16X−05 TCGA−F4−6806−01A−11D−1837−05 TCGA−DM−A1D8−01A−11D−A153−05 TCGA−AA−3663−01A−01D−1721−05 TCGA−CM−4746−01A−01D−1407−05 TCGA−AZ−6601−11A−01D−1772−05 TCGA−A6−5660−01A−01D−1651−05 TCGA−CK−4951−01A−01D−1407−05 TCGA−DM−A1D4−01A−21D−A153−05 TCGA−AD−6890−01A−11D−1926−05 TCGA−G4−6321−01A−11D−1721−05 TCGA−AM−5821−01A−01D−1651−05 TCGA−CM−4751−01A−02D−1837−05 TCGA−CA−6719−01A−11D−1837−05 TCGA−AA−3506−11A−01D−1407−05 TCGA−G4−6299−01A−11D−1772−05 TCGA−G4−6586−01A−11D−1772−05 TCGA−G4−6588−01A−11D−1772−05 TCGA−D5−6540−01A−11D−1721−05 TCGA−CK−6751−01A−11D−1837−05 TCGA−CK−5913−01A−11D−1651−05 TCGA−A6−5661−01A−01D−1651−05 TCGA−AA−3488−11A−01D−1407−05 TCGA−A6−4105−01A−02D−1772−05 TCGA−CA−5254−01A−21D−1837−05 TCGA−AZ−4614−01A−01D−1407−05 TCGA−A6−4107−01A−02D−1407−05 TCGA−AA−3492−01A−01D−1407−05 TCGA−CM−4744−01A−01D−1407−05 TCGA−CM−5861−01A−01D−1651−05 TCGA−CM−6171−01A−11D−1651−05 TCGA−D5−6531−01A−11D−1721−05 TCGA−CK−6746−01A−11D−1837−05 TCGA−DM−A0X9−01A−11D−A153−05 TCGA−CK−4952−01A−01D−1721−05 TCGA−AA−3495−11A−01D−1407−05 TCGA−CM−6675−01A−11D−1837−05 TCGA−D5−6920−01A−11D−1926−05 TCGA−AU−6004−01A−11D−1721−05 TCGA−G4−6320−01A−11D−1721−05 TCGA−G4−6323−01A−11D−1721−05 TCGA−A6−5665−01A−01D−1651−05 TCGA−D5−7000−01A−11D−1926−05 TCGA−DM−A1HB−01A−22D−A17Z−05 TCGA−G4−6628−01A−11D−1837−05 TCGA−AZ−6606−01A−11D−1837−05 TCGA−A6−6781−01A−22D−1926−05 TCGA−A6−6653−01A−11D−1772−05 TCGA−CK−4950−01A−01D−1721−05 TCGA−AZ−6598−01A−11D−1772−05 TCGA−AA−3697−11A−01D−1721−05 TCGA−CM−6161−01A−11D−1651−05 TCGA−DM−A1DA−01A−11D−A153−05 TCGA−CM−4743−01A−01D−1721−05 TCGA−CK−5915−01A−11D−1651−05 TCGA−AD−6548−01A−11D−1837−05 TCGA−CA−6716−01A−11D−1837−05 TCGA−D5−6923−01A−11D−1926−05 TCGA−DM−A28M−01A−12D−A16X−05 TCGA−CM−6677−01A−11D−1837−05 TCGA−F4−6806−01A−11D−1837−05 TCGA−G4−6293−01A−11D−1721−05 TCGA−DM−A1D8−01A−11D−A153−05 TCGA−DM−A285−01A−11D−A16X−05 TCGA−AA−3663−01A−01D−1721−05 TCGA−AZ−4615−01A−01D−1407−05 TCGA−CM−4746−01A−01D−1407−05 TCGA−AA−3712−11A−01D−1721−05 TCGA−CM−6166−01A−11D−1651−05 TCGA−A6−5660−01A−01D−1651−05 TCGA−DM−A0XD−01A−12D−A153−05 TCGA−CK−4951−01A−01D−1407−05 TCGA−CM−4750−01A−01D−1407−05 TCGA−DM−A1D4−01A−21D−A153−05 TCGA−F4−6570−01A−11D−1772−05 TCGA−AD−6890−01A−11D−1926−05 TCGA−CK−5916−01A−11D−1651−05 TCGA−G4−6321−01A−11D−1721−05 TCGA−CA−6718−01A−11D−1837−05 TCGA−AM−5821−01A−01D−1651−05 TCGA−F4−6461−01A−11D−1772−05 TCGA−CM−4751−01A−02D−1837−05 TCGA−G4−6297−11A−01D−1721−05 TCGA−A6−2686−01A−01D−1407−05 TCGA−CA−6719−01A−11D−1837−05 TCGA−AD−5900−01A−11D−1651−05 TCGA−G4−6299−01A−11D−1772−05 TCGA−G4−6322−01A−11D−1721−05 TCGA−G4−6586−01A−11D−1772−05 TCGA−CK−5914−01A−11D−1651−05 TCGA−G4−6588−01A−11D−1772−05 TCGA−CM−6163−01A−11D−1651−05 TCGA−D5−6540−01A−11D−1721−05 TCGA−CM−5341−01A−01D−1407−05 TCGA−CK−6751−01A−11D−1837−05 TCGA−A6−5666−01A−01D−1651−05 TCGA−CK−5913−01A−11D−1651−05 TCGA−AA−3663−11A−01D−1721−05 TCGA−D5−6537−01A−11D−1721−05 TCGA−A6−5661−01A−01D−1651−05 TCGA−CM−6172−01A−11D−1651−05 TCGA−A6−4105−01A−02D−1772−05 TCGA−DM−A1D7−01A−11D−A153−05 TCGA−CA−5254−01A−21D−1837−05 TCGA−G4−6315−01A−11D−1721−05 TCGA−AZ−4614−01A−01D−1407−05 TCGA−AA−3655−01A−02D−1721−05 TCGA−AA−3492−01A−01D−1407−05 TCGA−DM−A28K−01A−21D−A16X−05 TCGA−CM−5861−01A−01D−1651−05 TCGA−AY−6386−01A−21D−1721−05 TCGA−D5−6531−01A−11D−1721−05 TCGA−A6−2679−01A−02D−1407−05 TCGA−DM−A0X9−01A−11D−A153−05 TCGA−AA−3509−11A−01D−1407−05 TCGA−AZ−6599−01A−11D−1772−05 TCGA−CM−6675−01A−11D−1837−05 TCGA−DM−A28H−01A−11D−A16X−05 TCGA−AU−6004−01A−11D−1721−05 TCGA−D5−6927−01A−21D−1926−05 TCGA−G4−6323−01A−11D−1721−05 TCGA−AA−3502−01A−01D−1407−05 TCGA−D5−7000−01A−11D−1926−05 TCGA−D5−6538−01A−11D−1721−05 TCGA−G4−6628−01A−11D−1837−05 TCGA−D5−6931−01A−11D−1926−05 TCGA−A6−6781−01A−22D−1926−05 TCGA−AZ−4616−01A−21D−1837−05 TCGA−CK−4950−01A−01D−1721−05 TCGA−AA−3655−11A−01D−1721−05 TCGA−D5−6541−01A−11D−1721−05 TCGA−CM−6161−01A−11D−1651−05 TCGA−CM−5860−01A−01D−1651−05 TCGA−CM−4743−01A−01D−1721−05 TCGA−AY−6197−01A−11D−1721−05 TCGA−AD−6548−01A−11D−1837−05 TCGA−D5−6535−01A−11D−1721−05 TCGA−D5−6923−01A−11D−1926−05 TCGA−AZ−5407−01A−01D−1721−05 TCGA−CM−6677−01A−11D−1837−05 TCGA−AZ−6600−01A−11D−1772−05 TCGA−G4−6293−01A−11D−1721−05 TCGA−DM−A288−01A−11D−A16X−05 TCGA−DM−A285−01A−11D−A16X−05 TCGA−A6−2675−11A−01D−1721−05 TCGA−A6−5659−01A−01D−1651−05 TCGA−AZ−4615−01A−01D−1407−05 TCGA−D5−6532−01A−11D−1721−05 TCGA−CM−6166−01A−11D−1651−05 TCGA−AA−3495−01A−01D−1407−05 TCGA−DM−A0XD−01A−12D−A153−05 TCGA−CK−4947−01B−11D−1651−05 TCGA−CM−4750−01A−01D−1407−05 TCGA−AA−3496−01A−21D−1837−05 TCGA−F4−6570−01A−11D−1772−05 TCGA−A6−2671−01A−01D−1407−05 TCGA−CK−5916−01A−11D−1651−05 TCGA−DM−A28A−01A−21D−A16X−05 TCGA−CA−6718−01A−11D−1837−05 TCGA−CM−5864−01A−01D−1651−05 TCGA−F4−6461−01A−11D−1772−05 TCGA−G4−6320−11A−01D−1721−05 TCGA−A6−2680−01A−01D−1407−05 TCGA−A6−2686−01A−01D−1407−05 TCGA−DM−A1HA−01A−11D−A153−05 TCGA−AD−5900−01A−11D−1651−05 TCGA−CM−6679−01A−11D−1837−05 TCGA−G4−6322−01A−11D−1721−05 TCGA−AZ−4315−01A−01D−1407−05 TCGA−CK−5914−01A−11D−1651−05 TCGA−A6−6782−01A−11D−1837−05 TCGA−CM−6163−01A−11D−1651−05 TCGA−F4−6805−01A−11D−1837−05 TCGA−CM−5341−01A−01D−1407−05 TCGA−CM−6169−01A−11D−1651−05 TCGA−A6−5666−01A−01D−1651−05 TCGA−A6−2682−11A−01D−1551−05 TCGA−AZ−4684−01A−01D−1407−05 TCGA−D5−6537−01A−11D−1721−05 TCGA−DM−A280−01A−12D−A16X−05 TCGA−CM−6172−01A−11D−1651−05 TCGA−A6−2682−01A−01D−1407−05 TCGA−DM−A1D7−01A−11D−A153−05 TCGA−G4−6295−01A−11D−1721−05 TCGA−G4−6315−01A−11D−1721−05 TCGA−DM−A1D9−01A−11D−A153−05 TCGA−AA−3655−01A−02D−1721−05 TCGA−AZ−4682−01B−01D−1407−05 TCGA−DM−A28K−01A−21D−A16X−05 TCGA−D5−6929−01A−31D−1926−05 TCGA−AY−6386−01A−21D−1721−05 TCGA−G4−6314−11A−01D−1721−05 TCGA−AA−3509−01A−01D−1407−05 TCGA−A6−2679−01A−02D−1407−05 TCGA−G4−6307−01A−11D−1721−05 TCGA−AZ−6599−01A−11D−1772−05 TCGA−F4−6569−01A−11D−1772−05 TCGA−DM−A28H−01A−11D−A16X−05 TCGA−G4−6311−01A−11D−1721−05 TCGA−D5−6927−01A−21D−1926−05 TCGA−F4−6704−01A−11D−1837−05 TCGA−AA−3502−01A−01D−1407−05 TCGA−CM−6678−01A−11D−1837−05 TCGA−D5−6538−01A−11D−1721−05 TCGA−DM−A28F−01A−11D−A16X−05 TCGA−D5−6931−01A−11D−1926−05 TCGA−CM−6680−01A−11D−1837−05 TCGA−AZ−4616−01A−21D−1837−05 TCGA−A6−2686−11A−01D−1551−05 TCGA−CM−4752−01A−01D−1407−05 TCGA−D5−6541−01A−11D−1721−05 TCGA−CM−5862−01A−01D−1651−05 TCGA−CM−5860−01A−01D−1651−05 TCGA−D5−6922−01A−11D−1926−05 TCGA−AY−6197−01A−11D−1721−05 TCGA−CM−6165−01A−11D−1651−05 TCGA−D5−6535−01A−11D−1721−05 TCGA−AA−3660−01A−01D−1721−05 TCGA−AZ−5407−01A−01D−1721−05 TCGA−A6−6652−01A−11D−1772−05 TCGA−AZ−6600−01A−11D−1772−05 TCGA−AD−6889−01A−11D−1926−05 TCGA−DM−A288−01A−11D−A16X−05 TCGA−AA−3492−11A−01D−1407−05 TCGA−AZ−4323−01A−21D−1837−05 TCGA−A6−5659−01A−01D−1651−05 TCGA−D5−6930−01A−11D−1926−05 TCGA−D5−6532−01A−11D−1721−05 TCGA−F4−6460−01A−11D−1772−05 TCGA−AA−3495−01A−01D−1407−05 TCGA−G4−6627−01A−11D−1772−05 TCGA−CK−4947−01B−11D−1651−05 TCGA−A6−5657−01A−01D−1651−05 TCGA−AA−3496−01A−21D−1837−05 TCGA−AD−6901−01A−11D−1926−05 TCGA−A6−2671−01A−01D−1407−05 TCGA−D5−6530−01A−11D−1721−05 TCGA−DM−A28A−01A−21D−A16X−05 TCGA−A6−2671−11A−01D−1551−05 TCGA−G4−6303−01A−11D−1772−05 TCGA−CM−5864−01A−01D−1651−05 TCGA−AA−3506−01A−01D−1407−05 TCGA−A6−2680−01A−01D−1407−05 TCGA−CM−6168−01A−11D−1651−05 TCGA−DM−A1HA−01A−11D−A153−05 TCGA−AY−6196−01A−11D−1721−05 TCGA−CM−6679−01A−11D−1837−05 TCGA−D5−6926−01A−11D−1926−05 TCGA−AZ−4315−01A−01D−1407−05 TCGA−AZ−6605−01A−11D−1837−05 TCGA−A6−6782−01A−11D−1837−05 TCGA−A6−2681−01A−01D−1407−05 TCGA−F4−6805−01A−11D−1837−05 TCGA−G4−6311−11A−01D−1721−05 TCGA−D5−6898−01A−11D−1926−05 TCGA−CM−6169−01A−11D−1651−05 TCGA−D5−6932−01A−11D−1926−05 TCGA−AZ−4684−01A−01D−1407−05 TCGA−CM−5863−01A−21D−1837−05 TCGA−DM−A280−01A−12D−A16X−05 TCGA−CA−6717−01A−11D−1837−05 TCGA−A6−2682−01A−01D−1407−05 TCGA−AD−6965−01A−11D−1926−05 TCGA−G4−6295−01A−11D−1721−05 TCGA−AZ−6607−01A−11D−1837−05 TCGA−DM−A1D9−01A−11D−A153−05 TCGA−A6−6649−01A−11D−1772−05 TCGA−AZ−4682−01B−01D−1407−05 TCGA−AA−3713−01A−21D−1721−05 TCGA−D5−6929−01A−31D−1926−05 TCGA−A6−5667−11A−01D−1721−05 TCGA−A6−5664−01A−21D−1837−05 TCGA−AA−3509−01A−01D−1407−05 TCGA−A6−6654−01A−21D−1837−05 TCGA−G4−6307−01A−11D−1721−05 TCGA−A6−6651−01A−21D−1837−05 TCGA−F4−6569−01A−11D−1772−05 TCGA−CM−5348−01A−21D−1721−05 TCGA−G4−6311−01A−11D−1721−05 TCGA−G4−6302−01A−11D−1721−05 TCGA−F4−6704−01A−11D−1837−05 TCGA−D5−5541−01A−01D−1651−05 TCGA−CM−6678−01A−11D−1837−05 TCGA−AA−3712−01A−21D−1721−05 TCGA−DM−A28F−01A−11D−A16X−05 TCGA−A6−2681−11A−01D−1551−05 TCGA−AZ−6608−01A−11D−1837−05 TCGA−CM−6680−01A−11D−1837−05 TCGA−F4−6808−01A−11D−1837−05 TCGA−CM−4752−01A−01D−1407−05 TCGA−F4−6854−01A−11D−1926−05 TCGA−CM−5862−01A−01D−1651−05 TCGA−CK−5912−01A−11D−1651−05 TCGA−D5−6922−01A−11D−1926−05 TCGA−A6−6648−01A−11D−1772−05 TCGA−CM−6165−01A−11D−1651−05 TCGA−AA−3697−01A−01D−1721−05 TCGA−AA−3660−01A−01D−1721−05 TCGA−A6−6140−01A−11D−1772−05 TCGA−A6−6652−01A−11D−1772−05 TCGA−AZ−6599−11A−01D−1772−05 TCGA−DM−A1D0−01A−11D−A153−05 TCGA−AD−6889−01A−11D−1926−05 TCGA−AA−3494−01A−01D−1407−05 TCGA−AZ−4323−01A−21D−1837−05 TCGA−G4−6309−01A−21D−1837−05 TCGA−D5−6930−01A−11D−1926−05 TCGA−AZ−4681−01A−01D−1407−05 TCGA−F4−6460−01A−11D−1772−05 TCGA−DM−A28E−01A−11D−A16X−05 TCGA−G4−6627−01A−11D−1772−05 TCGA−D5−6928−01A−11D−1926−05 TCGA−A6−5657−01A−01D−1651−05 TCGA−AZ−4313−01A−01D−1407−05 TCGA−AD−6901−01A−11D−1926−05 TCGA−CA−5797−01A−01D−1651−05 TCGA−D5−6530−01A−11D−1721−05 TCGA−G4−6322−11A−01D−1721−05 TCGA−D5−6534−01A−21D−1926−05 TCGA−G4−6303−01A−11D−1772−05 TCGA−AZ−4308−01A−01D−1407−05 TCGA−AA−3506−01A−01D−1407−05 TCGA−G4−6304−01A−11D−1926−05 TCGA−CM−6168−01A−11D−1651−05 TCGA−CM−6162−01A−11D−1651−05 TCGA−AY−6196−01A−11D−1721−05 TCGA−AZ−5403−01A−01D−1651−05 TCGA−D5−6926−01A−11D−1926−05 TCGA−A6−2685−01A−01D−1407−05 TCGA−AZ−6605−01A−11D−1837−05 TCGA−F4−6703−01A−11D−1837−05 TCGA−A6−2681−01A−01D−1407−05 TCGA−A6−2685−11A−01D−1551−05 TCGA−D5−6924−01A−11D−1926−05 TCGA−D5−6898−01A−11D−1926−05 TCGA−AA−3489−01A−21D−1837−05 TCGA−D5−6932−01A−11D−1926−05 TCGA−CM−6674−01A−11D−1837−05 TCGA−CM−5863−01A−21D−1837−05 TCGA−CK−4948−01B−11D−1651−05 TCGA−CA−6717−01A−11D−1837−05 TCGA−G4−6625−01A−21D−1772−05 TCGA−AD−6965−01A−11D−1926−05 TCGA−A6−6142−01A−11D−1772−05 TCGA−AZ−6607−01A−11D−1837−05 TCGA−CA−6715−01A−21D−1837−05 TCGA−A6−6649−01A−11D−1772−05 TCGA−A6−2684−11A−01D−1551−05 TCGA−AA−3511−01A−21D−1837−05 TCGA−AA−3713−01A−21D−1721−05 TCGA−A6−2675−01A−02D−1721−05 TCGA−A6−5664−01A−21D−1837−05 TCGA−AD−6963−01A−11D−1926−05 TCGA−A6−6654−01A−21D−1837−05 TCGA−CM−4748−01A−01D−1407−05 TCGA−A6−6651−01A−21D−1837−05 TCGA−CA−5255−01A−11D−1837−05 TCGA−CM−5348−01A−21D−1721−05 TCGA−A6−6141−01A−11D−1772−05 TCGA−G4−6302−01A−11D−1721−05 TCGA−A6−2684−01A−01D−1407−05 TCGA−D5−5541−01A−01D−1651−05 TCGA−G4−6626−01A−11D−1772−05 TCGA−AA−3712−01A−21D−1721−05 TCGA−G4−6295−11A−01D−1721−05 TCGA−D5−6536−01A−11D−1721−05 TCGA−AZ−6608−01A−11D−1837−05 TCGA−A6−5662−01A−01D−1651−05 TCGA−F4−6808−01A−11D−1837−05 TCGA−CM−6676−01A−11D−1837−05 TCGA−F4−6854−01A−11D−1926−05 TCGA−F4−6459−01A−11D−1772−05 TCGA−CK−5912−01A−11D−1651−05 TCGA−G4−6297−01A−11D−1721−05 TCGA−A6−6648−01A−11D−1772−05 TCGA−D5−5539−01A−01D−1651−05 TCGA−AA−3697−01A−01D−1721−05 TCGA−D5−5537−01A−21D−1926−05 TCGA−A6−6140−01A−11D−1772−05 TCGA−A6−2679−11A−01D−1551−05 TCGA−G4−6298−01A−11D−1721−05 TCGA−DM−A1D0−01A−11D−A153−05 TCGA−AD−6895−01A−11D−1926−05 TCGA−AA−3494−01A−01D−1407−05 TCGA−D5−6539−01A−11D−1721−05 TCGA−G4−6309−01A−21D−1837−05 TCGA−CA−5796−01A−01D−1651−05 TCGA−AZ−4681−01A−01D−1407−05 TCGA−CM−4747−01A−01D−1407−05 TCGA−DM−A28E−01A−11D−A16X−05 TCGA−CM−5349−01A−21D−1721−05 TCGA−D5−6928−01A−11D−1926−05 TCGA−DM−A0XF−01A−11D−A153−05 TCGA−AZ−4313−01A−01D−1407−05 TCGA−A6−2680−11A−01D−1551−05 TCGA−CM−6167−01A−11D−1651−05 TCGA−CA−5797−01A−01D−1651−05 TCGA−G4−6314−01A−11D−1721−05 TCGA−D5−6534−01A−21D−1926−05 TCGA−AD−6888−01A−11D−1926−05 TCGA−AZ−4308−01A−01D−1407−05 TCGA−AZ−6601−01A−11D−1772−05 TCGA−G4−6304−01A−11D−1926−05 TCGA−F4−6463−01A−11D−1721−05 TCGA−CM−6162−01A−11D−1651−05 TCGA−F4−6809−01A−11D−1837−05 TCGA−AZ−5403−01A−01D−1651−05 TCGA−F4−6856−01A−11D−1926−05 TCGA−A6−2685−01A−01D−1407−05 TCGA−AD−6899−01A−11D−1926−05 TCGA−G4−6302−11A−01D−1721−05 TCGA−F4−6703−01A−11D−1837−05 TCGA−AA−3662−01A−01D−1721−05 TCGA−D5−6924−01A−11D−1926−05 TCGA−DM−A1DB−01A−11D−A153−05 TCGA−AA−3489−01A−21D−1837−05 TCGA−CM−5868−01A−01D−1651−05 TCGA−CM−6674−01A−11D−1837−05 TCGA−AZ−6603−01A−11D−1837−05 TCGA−CK−4948−01B−11D−1651−05 TCGA−D5−5540−01A−01D−1651−05 TCGA−G4−6625−01A−21D−1772−05 TCGA−D5−6533−01A−11D−1721−05 TCGA−A6−6142−01A−11D−1772−05 TCGA−AU−3779−01A−01D−1721−05 TCGA−CA−6715−01A−21D−1837−05 TCGA−G4−6298−11A−01D−1721−05 TCGA−A6−6137−01A−11D−1772−05 TCGA−AA−3511−01A−21D−1837−05 TCGA−CK−6748−01A−11D−1837−05 TCGA−A6−2675−01A−02D−1721−05 TCGA−AY−5543−01A−01D−1651−05 TCGA−AD−6963−01A−11D−1926−05 TCGA−CM−5344−01A−21D−1721−05 TCGA−CM−4748−01A−01D−1407−05 TCGA−DM−A1D6−01A−21D−A153−05 TCGA−CA−5255−01A−11D−1837−05 TCGA−DM−A28C−01A−11D−A16X−05 TCGA−A6−6141−01A−11D−1772−05 TCGA−AM−5820−01A−01D−1651−05 TCGA−A6−2684−01A−01D−1407−05 TCGA−AA−3488−01A−01D−1407−05 TCGA−G4−6626−01A−11D−1772−05 TCGA−G4−6294−01A−11D−1772−05 TCGA−D5−6536−01A−11D−1721−05 TCGA−AA−3510−01A−01D−1407−05 TCGA−A6−5662−01A−01D−1651−05 TCGA−A6−6650−01A−11D−1772−05 TCGA−CM−6676−01A−11D−1837−05 TCGA−F4−6807−01A−11D−1837−05 TCGA−F4−6459−01A−11D−1772−05 TCGA−CA−5256−01A−01D−1407−05 TCGA−G4−6297−01A−11D−1721−05 TCGA−D5−5538−01A−01D−1651−05 TCGA−D5−5539−01A−01D−1651−05 TCGA−G4−6310−01A−11D−1721−05 TCGA−D5−5537−01A−21D−1926−05 TCGA−CK−6747−01A−11D−1837−05 TCGA−G4−6298−01A−11D−1721−05 TCGA−A6−6138−01A−11D−1772−05 TCGA−AD−6895−01A−11D−1926−05 TCGA−G4−6306−01A−11D−1772−05 TCGA−D5−6539−01A−11D−1721−05 TCGA−D5−6529−01A−11D−1772−05 TCGA−CA−5796−01A−01D−1651−05 TCGA−AD−6964−01A−11D−1926−05 TCGA−CM−4747−01A−01D−1407−05 TCGA−A6−5667−01A−21D−1721−05 TCGA−CM−5349−01A−21D−1721−05 TCGA−CM−6164−01A−11D−1651−05 TCGA−DM−A0XF−01A−11D−A153−05 TCGA−F4−6855−01A−11D−1926−05 TCGA−CM−6167−01A−11D−1651−05 TCGA−A6−6780−01A−11D−1837−05 TCGA−G4−6314−01A−11D−1721−05 TCGA−A6−5656−01A−21D−1837−05 TCGA−AD−6888−01A−11D−1926−05 TCGA−DM−A28G−01A−11D−A16X−05 TCGA−AZ−6601−01A−11D−1772−05 TCGA−DM−A282−01A−12D−A16X−05 TCGA−F4−6463−01A−11D−1721−05 TCGA−CM−6170−01A−11D−1651−05 TCGA−F4−6809−01A−11D−1837−05 TCGA−G4−6317−01A−11D−1721−05 TCGA−F4−6856−01A−11D−1926−05 TCGA−AD−6899−01A−11D−1926−05 TCGA−AA−3662−01A−01D−1721−05 TCGA−DM−A1DB−01A−11D−A153−05 TCGA−CM−5868−01A−01D−1651−05 TCGA−AZ−6603−01A−11D−1837−05 TCGA−D5−5540−01A−01D−1651−05 TCGA−D5−6533−01A−11D−1721−05 TCGA−AU−3779−01A−01D−1721−05 TCGA−A6−6137−01A−11D−1772−05 TCGA−CK−6748−01A−11D−1837−05 TCGA−AY−5543−01A−01D−1651−05 TCGA−CM−5344−01A−21D−1721−05 TCGA−DM−A1D6−01A−21D−A153−05 TCGA−DM−A28C−01A−11D−A16X−05 TCGA−AM−5820−01A−01D−1651−05 TCGA−AA−3488−01A−01D−1407−05 TCGA−G4−6294−01A−11D−1772−05 TCGA−AA−3510−01A−01D−1407−05 TCGA−A6−6650−01A−11D−1772−05 TCGA−F4−6807−01A−11D−1837−05 TCGA−CA−5256−01A−01D−1407−05 TCGA−D5−5538−01A−01D−1651−05 TCGA−G4−6310−01A−11D−1721−05 TCGA−CK−6747−01A−11D−1837−05 TCGA−A6−6138−01A−11D−1772−05 TCGA−G4−6306−01A−11D−1772−05 TCGA−D5−6529−01A−11D−1772−05 TCGA−AD−6964−01A−11D−1926−05 TCGA−A6−5667−01A−21D−1721−05 TCGA−CM−6164−01A−11D−1651−05 TCGA−F4−6855−01A−11D−1926−05 TCGA−A6−6780−01A−11D−1837−05 TCGA−A6−5656−01A−21D−1837−05 TCGA−DM−A28G−01A−11D−A16X−05 TCGA−DM−A282−01A−12D−A16X−05 TCGA−CM−6170−01A−11D−1651−05 TCGA−G4−6317−01A−11D−1721−05 ADH1C Aldh1a1 AKR1B1 Aldh1a2 DHRS4 RDH13 Sult1a1 Adh5 Rxrb Dhrs3 RxRa AKR1C1 Rbp1 RaRb AKR1C3 RaRg ADH1B AKR1C2 CYP26B1 RDH11 Retsat RaRa Crabp1 CYP16A1 RxRg RDH10 AKR1B10 LRAT ah 4C g N l f D l mA l N ey m e l o f A y A mDmh l D A hb l o h ml A mhN l l y b l f D l mA ehm D y m AmhN D mDmA y N eD y r 3 A laN mh y N eD y r 3o l f e hN l f D l A y D l b 9n t 9cg 9 gR t hgRec ec gR h ( W, encg cgo a n S9nge nA g n cge lah 9 e n m c 9 c nf e egc RaS nt gRal ge9 e t gRal ge9 9t S ne cg v g 9g cR9m KhmR g Re Rle Rgc gR Sn f l 9l9 c h 9 colgc gRec lg n ge9 e Sn9 c oc c c ne 75K nla cg c 9 got 9ne cecA llot e e gRec lacec n e p 9f hgR n m n ( F 2 9 gR t c 9m n ol g vz( AWFb K 9nt l 9l9 gR9c lc9 Hypermethylation cases (%) D C2 g l l yl l yya b e pRe eg S gRm a v e on ce e e g Sn9t 9g n l ( W e on 2( KA c ce e e gla RaS nt gRal g S f lo q, A, WK9n Norm mean Norm sd Tum mean Tum sd Wilcoxon pval adj pval t gRal ge9 A RaS nt gRal ge9 e gR got 9n c t Sl v c RaS nt gRal g 3W, ge 9 ce n v 9t S n t 9n gR ) Wb 9 gR megR c cA ALDH1A1 0.290 0.063 0.420 0.150 3.17E-08 2.06E-07 AKR1B1 0.019 0.019 0.397 0.234 7.91E-15 2.06E-13 ALDH1A2 0.080 0.025 0.343 0.230 4.37E-09 3.78E-08 RBP1 0.094 0.045 0.385 0.257 2.30E-07 9.96E-07 RARB 0.036 0.013 0.188 0.211 0.130 0.198 AKR1C3 0.084 0.041 0.069 0.092 7.64E-08 3.97E-07 DGAT1 0.014 0.002 0.081 0.137 8.33E-06 2.71E-05 CYP26B1 0.091 0.133 0.323 0.270 9.63E-07 3.58E-06 CYP26A1 0.128 0.042 0.359 0.249 0.000 0.000 LRAT 0.060 0.048 0.330 0.299 0.002 0.005 RARA 0.052 0.021 0.084 0.106 0.363 0.429 45.669 79.921 71.654 66.142 45.669 7.480 39.370 57.874 61.811 55.512 27.559 DyaN N hf m l y mi hf m A o h Al DDf N l f D l A y h Dl o l l A y A AmhN D A laN mh mDmA e l o f f A Df y y m gR e n g N l f D l mA msh aD l mA pgh m 9 ce n 9n pSl9n t gRal ge9 R n A gR c Re Rle Rg 9yt gRal g c n 9nn l ge9 e t 9 ot c n9 cgo e c gR g 9y pSn cc o ge9 lla n l g SRace lla e gR o l oc cgno gon v uol u9 d S nR Sc e g n ge lt ch) , ( FD 9og f h ) , , ) D n c nd e ut 9n h) , , 7KA m9 n S gRm a mRe R 9gR n 9t SlecR egh m S gRm a vRggSNI I e gR lar m n fe A v a9g9 a l9S g n cge lahe llot e lar 9gR ne Rt g 9 n ge 9e 9t t 9 S gRm a 9n e9l9 e l 9yt gRal ge9 9 e 9l9n g l R 9 9 gR ( ( n megR gR n cg 9 c 3W, nn a vt g ne lc t gR9 cKA 9yt gRal g megR gR 9g ge9 A e n A 9f I Kh 9n e 9 megR gR RaS nt gRal g gRn9o R gR c RaS nt gRal ge9 Sn9 cc cA 9n n c RaS nt gRal g n Sn c g c 9yt gRal g c g9 lo e g mR gR ngR n ec o ge9 cS e e lla lg n g9 c n c v g99l g9l9 aK S gRm a 9t cK lacecA o ge9 l e nl g o ge9 l S gRm a lacec m 9 c nf o ge9 chco R c on9 l e g n ge9 ch e n ge ge9 h ll t e n ge9 f l9St g l Sn9 cc ch n ge 9e e ( W( colgc f eg t e ce le S gRm ac v e on 2) KA 9 gR nhgR c Sn9 cc 9 9yt gRal ge9 e f 9lf e e n gn ge 9e A. KEGG pathway analysis! & g coSS9ng cS e e e nl g cA B. GO functional analysis! " # ! # ! # ! # # " ! # & ! # )%(( &() )%(( &(- )%(( &(0 )%(( &)+ )%(( &). ah 4p g msN l f D l mA A Df y y m l y A Al msN l f D l ehm y o h y D l N l f D l mA m l A e l o f y e hl DDf h ylmh t 9 cgn g a gn ge h) , ( , KA 9 cel e gR g llc megR gR 9 gR n ge 9e ( ( zh )%(( &*- Df Dl h e S gRm ah m ( (h ( (h oS9 ( (h pSn cce9 Wy r cc9 e g 9 9g R f ( )h 3W, K Sn9 el c e llc vu 9 u 9og 9n t gRal ge9 A ( ) t e et l R megR gR l9cc 9 gm ) z ( Kh mRe R m n c S nge lla llc cR9m ll le v c 9n 9 ) z ( K ecSl a S n e n c 9 t gRal ge9 v e on 2FKA t gRal ge9 S e cc9 e g ((z S gRm a Sn9t 9g nc v e on 2FKA 9on 9 gR RaS nt gRal g c ec 9g l nA c megR e g nt gR S n g l v Ro pSn cce9 v el g ((z gn gt gA ( Fh 9 cc9 e ge9 pRe eg R f a t gRal ge9 v g f lo T, AWKe ef t gRal ge9 9 gR c t cR9m lar t gRal ge9 e gR t gRal ge9 v llot e megR Wy r ( Fh t gRal g c g Wy r F KhmRe R R f f na l9m l f lc 9 ( ( z ecSl a c v t gRal ge 9og gR n9l 9 nn aK ( ( z gn g ( ( W) l gR g Se ge lla cel gg n Se gon on ne g F 2pz, )%(( &)/ l Am e l o f f e hN l f D l A yb lme h mhN r 3 A r 3 A Df y yb h l Am l nla gef g v )%(( &)) neh yy mA gR c n )%(( &(, pSn cce9 h og gRec gR n9l 9 t gRal ge9 e gR9c ue e g 9n l9m l f lc 9 )z (h g ll e (h h pSn cce9 A ( ( 9 t gRal ge9 e h ( K colgc ah 4G g mN e h ymA m AmhN DK neh yy mA l i y N l f D l mA | Fi Da mh ml f e hN l f D l A y o l A h l Am e l o f A A l l h N l f D l mA N m DyB CC5 r Da h mN ay3R CC5 lh l o l 2s K rh yt a h y3 A DDDA y r h A lh A D y3b AmN 9 m ehm DA m l e l o f A mDmh l D A h ge ce Rgc e g9 gR e f 9lf t g9 gR ongR n e g nn9 g n i o e c ge 9e gR 9Sa ot vgRn9o R n lg n ge9 v e S gRm a ec S99nla c n f l c e 9l9n g l e9S9ng l m n g99lK 9n t og ge9 Ke 9l9n g l got 9nc v e on 23KA g a S gRm a t og ge9 ec l9mhn Sn c ge 9 gR S gRm a 9t e lg n ge9 cA R 9f n ll 3A( b v) 3 9og 9 W2WK9 gR c cD 9 Re R n i o a 9 t og ge9 c v e on 23 KA 9cg 9 gR t n t ecc c t og ge9 c v g 9gcR9m KA gR 9gR n R h e c pRe eg SS l9cc c lg n ge9 c nec oS g9 7A5b v3z 9og 9 W2WKhmegR 9gR S e n i o g 9Sa ot 9 gR n v e on 23 KA g n cge lah e c nc g9 pSl e gR oSn ol ge9 9 c nf f e gR (, t Sle e ge9 c v) A5b Kh gR g pSn cce9 lacec v e on 23 KA ( WF colgc A. Mutation analysis! B. CNA analysis! C. RDH10 expression vs CNA! ah 4. g h Al e l o f A A Dl h l mAb ( W3 m N al l mAy r 3 A mef AaN h Dl h l mAy r 3 lA mDmh l D A h y N eD yb 3 Cd neh yy mA i y l Dl h mef AaN h Discussion EPIGENETIC REGULATION OF AKR1B1 GENE FAMILY IN COLORECTAL CANCER Epigenetic regulation of AKR1B1 The DNA methylation pattern in the genome is basically bimodal, with the large majority of CpG sites methylated at high levels (>85%) and CpG islands largely unmethylated (<10%) (Bergman & Cedar, 2013). This apparently stable DNA methylation scenario is modified in a number of diseases and it has been extensively studied in cancer. DNA methylation alterations in cancer are mainly due to global hypomethylation and focal hypermethylation (Bergman & Cedar, 2013). Many gene promoter hypermethylations have been described in cancers, and in most of them a clear association with a decrease in gene expression has been reported (Table 16). We started with the observation that AKR1B1 promoter CpG island was hypermethylated in 24 out of 25 cases of colorectal cancer patients. The high incidence of this alteration was confirmed using the TCGA database, where we detected hypermethylation in about 85% of the colorectal cancer cases analyzed (Figures 33 and 37). The interesting fact is that AKR1B1 changes in DNA methylation do not appear to affect its expression, at least in a consistent manner. On one hand, we know that the gene promoter is highly hypermethylated in cancer, but we observed a very faint downregulation (2% of the cases) in the expression of AKR1B1 in colorectal cancer, at both mRNA (results from three different sources: our own data, TCGA and ICO data) and protein level (western blot and TMAs performed in our laboratory). On the other hand, we have checked the expression of this gene after the 5-­‐AzadC treatment and, despite that the CpG island is hypomethylated, gene expression does not change at all. Gathering all these data we could confirm that the expression of AKR1B1 gene is not affected by the DNA methylation status of its promoter. 159 sh Nhhs1 REVIEWS Table 1 | Representative genes commonly methylated and silenced in CRC Gene Protein Function* Effect of loss of function APC Adenomatous polyposis coli Wnt signaling pathway inhibition Increased Wnt/β-catenin signaling MLH1 MutL homolog 1 DNA mismatch repair Microsatellite instability MGMT O-6-methylguanine-DNA methyltransferase Repair of alkylation DNA damage Increased G>A mutation frequency RASSF1A Ras association domain family 1 (isoform A) Negative RAS effector, proapoptotic, microtubule stabilization Increased RAS/RAF/MAP kinase signaling, death-receptor-dependent apoptosis SLC5A8 Sodium solute symporter family 5 member 8 Sodium and short chain fatty acid transporter, suppresses colony formation Not known RUNX3 Runt-related transcription factor 3 Transcription factor Decreased TGF-β/BMP signaling MINT1‡ Methylated in tumor locus 1 NA NA Methylated in tumor locus 31 NA NA SFRP1 Secreted frizzled-related protein 1 Wnt antagonist Increased Wnt/β-catenin signaling SFRP2 Secreted frizzled-related protein 2 Wnt antagonist Increased Wnt/β-catenin signaling CDH1 E-cadherin Calcium dependent cell–cell adhesion glycoprotein Loss of cell adhesion, possible increased Wnt/β-catenin signaling CDH13 Cadherin 13 Selective cell recognition and adhesion, antiapoptotic Increased PI3K/Akt/mTOR signaling, MAPK signaling CRABP1 Retinol-binding protein 1 Carrier protein for transport of retinol, promotes apoptosis Not known CDKN2A/p16 Cyclin-dependent kinase inhibitor 2A Regulates cell cycle G1 progression Increased cell proliferation HLTF Helicase-like transcription factor dsDNA translocase, fork remodeling activity, ubiquitin ligase Impaired DNA repair CDKN2A (P14, ARF) p14(ARF) Inhibits E3 ubiquitin ligase Decreased p53 stabilization and activation MINT31 ‡ ESR1 Estrogen receptor 1 Ligand-activated transcription factor Loss of estrogen receptor signaling TIMP3 Tissue inhibitor of metalloproteinase 3 Inhibition of MMPs and ADAMs Increased EGFR signaling, TNF signaling CXCL12 Chemokine (CXC motif) ligand 12 Alpha chemokine Increased tumor cell metastases ID4 Inhibitor of DNA binding 4 Transcription factor Not known IRF8 Interferon regulatory factor 8 Transcription factor Interferon signaling THBS1/TSP1 Thrombospondin 1 Cell-to-cell and cell-to-matrix adhesive glycoprotein Decreased TGF-β1 signaling DAPK Death associated protein kinase Induction of cell death Interferon gamma signaling, TNF alpha signaling, Fas/APO1 signaling VIM Vimentin Stablizing cytoskeleton No known biological effect SEPT9 Septin 9 GTPase, formation of filaments Impaired cytokinesis and loss of cell cycle control *Many of these gene products have multiple functions. The listed function in this table is the one most commonly cited as the one responsible for CRC formation. ‡MINTs are ‘methylated in tumor’ loci, and are not specific genes. Abbreviations: ADAM, A Disintegrin and Metalloproteinase; CRC, colorectal cancer; EGFR, epidermal growth factor receptor; MAPK, mitogen-active protein kinase; MMP, matrix metalloproteinase; TNF, tumor necrosis factor. B| A E p i ie p c i c i p l E g E r E cuT1BBl progression sequence.128 The proportion of neoplasms methylated genes have in the initiation and progression of the polyp→cancer sequence continues to evolve as that carry methylated genes is not markedly different T emethylated heN y i genes h hi are 1m ei e (Figure 2). D h msei between 5 Tn shhsA 1e Tand hi adenocarcinomas, 1m 1 e additional identified advanced5T1n adenomas As might be expected given the detection of methylbut the frequency of methylation of specific genes does D11 1TT o es1 n eiatyo es1 he vary e 1between i early adenomas, T T Ds1 advanced h > T adenomas w ated genes in the normalmsei mucosaeiof people increased and risk of CRC, methylated genes can be detected in adenocarcinomas.128,129 LINE-1 DNA hypomethylation 0) <B8wcrypt i shfoci sh and 1eadenomas ei h well 1 as in adeno< <b h sehpolyp→cancer 5T1n 1e Tsequence 5 sho a similar 1 h pattern 1e aberrant as in the shares carcinomas.123 Examples of genes methylated early in the with local promoter hypermethylation in that there is 55 T e1 s sequence sei include T ITGA4, esAMGMT, 1T 5 a Tn shhsA difference he e w in the levels b mof LINE-1 i A hypoe1 substantial adenoma→carcinoma 123–128 methylation and local hypermethylation occurring at the SLC5A8, SFRP2 and MINT1. Notably, the most i substantial y51ei hsl ei e ei n s 5sD es n i polyp shnto adenoma 1 T DNo es1 1 < < n sDi e step of the sequence, but no difference increase in gene methylation is seen in the between levels at the adenoma to cancer step.130 There is normal mucosa to adenoma step of the polyp→cancer 1e s ei 5 sho w NATURE REVIEWS | GASTROENTEROLOGY & HEPATOLOGY <3) VOLUME 8 | DECEMBER 2011 | 693 sh Nhhs1 h s i Nn bei 5T1n 1e T 5 sho 1o1 eshhN b i 1m A T m h n 5o h oyl N oe T 1No e e w h5se ei sh > sDNT 2B8w 1Nehs sh 1n 5o e oy N n ei yo e i y5 Tn ei yo es1 s h1n ebei e ei T1n ei 1 t 5T hhs1 1 T DNo e1Ty T Ds1 1 5 sho w ei m1Tu 1 1Ne W< n 1 No es D 1e i A Nh ei s u ei e < < D t 5T hhs1 n c1T T1o s ei 1e 1TT o e msei ei D n 1 heT e hh1 s e 5 sho n soy, < < s ei i T1n 1h1n s 1Tn o 1o1 e Tn h 1 n sh5o y s T h 1 T 0 sh sn 51Te 1 ei sh T h51 hs o 1T 1 h 5 sho 1 h h hw B B6 em i y5 Tn ei yo es1 1 < <bm s A hesD e < <2 D hbmi s i . 9BBw ei sh T n es 1ei T n n T oh1 o1 e Th 1 ei t e e1 h b 1ei D h T i sDi oy t 5T hh 1m T DNo es1 s < <2 T Tw i sh shbs ei h em1 D h 1T 1A Tb 5T1n 1e T 5 sho 5T1e s o A ow NT5Tshs Doyb s h5se < <) ei < <b h m i A i y51ei hsl ei o u 1 1TT o es1 < <) y < < mi i y5 Tn ei yo es1 1 ei hh y t 5T hhs1 5 Ti 5h ei B B1 m i A 5T1n 1e Th 1 oh1 1 h TA 1m T DNo es1 s n 1he1 ei E g i < hN n 1 heT e x28w s s D hse h T ei T DNo es1 1 1A w i sh msoo t 5o s mi y ei i > sDNT < < T0 sho 1 ei sh T Ds1 1T 1A T t 5T hh w i T T Ds1 n 5 oN s T h t 5T hhs1 i e ic T1n ei ei T 0w i y sn 51Te i E h Ts j shi sn NT b 0) ) 28w E sh 1 e s h B s s D hse h 1Tei i 8 1Ne 1 i sh T Ds1 gE v6 A E T B Bl < < > < < t 5T hhs1 b > shi s u r yB T on 1he 1T mi s i sh o1 e T n s shi s u u y T Ds1 ei y 1 ei s 1o1T e o T s h A T hso s Db ei s eoy i y51n ei yo e 5T1n 1e T n ei yo es1 s 1o1T e o 1 h 1e n e i <3< sh Nhhs1 sei Tmsei ei t 5T hhs1 we sh m1Tei e1 n es1 ei e T 1j t 5T hh s 1Tn o gE v| A i E i ig E p i c i p eTsus Doybei T sh os u ei 1m T DNo es1 1 i y5 Tn ei yo es1 1m T DNo es1 i y51ei hsl t 5T hhs1 1 <30 ei 1 B B i c i p t Rl K p KE em ei < <) ei 1 < < < <) i c i E p i n i B ic p t E pp tR n ei yo es1 1 ei < < D < <2 D hw n 1he 5 sho < <2w 1TT o e h msei < <2 > sDNT 51hhs o T DNo e1Ty T1o 1 < <) < <2 eNn 1TeshhN w in p < <) < < h h ei hN he es o x38w i T 1T 5 l E i sho s m ei Discussion ENHANCER ACTIVITY OF AKR1B1 CpG ISLAND Chromatin conformation in the AKR1B locus Due to the clear evidences that pointed out a relationship between AKR1B1 CpG island and the regulation of the expression in AKR1B10 and AKR1B15, we decided to investigate the chromatin conformation of AKR1B genes. It is known that enhancers need a close contact with the promoter in order to regulate gene expression (Carter et al.,2002; Tolhuis et al., 2014), for this reason we decided to analyzed the structural conformation between AKR1B1 CpG island and AKR1B10, which is more downregulated than AKR1B15. The Chromosome Conformation Capture (3C) results revealed a close contact between AKR1B1 CpG island surroundings and the AKR1B10 promoter in two cell lines that highly express and do not express AKR1B10 (HepG2 and HCT116, respectively). At that time we wondered if the chromatin interactions of the AKR1B genes promoters would change in carcinogenesis and if this alteration could lead to the observed silencing of AKR1B10 and AKR1B15 genes. Surprisingly, although the expression of AKR1B10 was very different between HepG2 and HCT116 cell lines, the chromatin conformation of the area was almost identical, what suggested that the silencing of AKR1B10 and AKR1B15 is produced by deregulating the enhancer function of AKR1B1 CpG island without altering the chromatin structure. This result suggests that DNA methylation, and perhaps other epigenetic mechanisms, are the main factors that regulate the expression of AKR1B10 and AKR1B15. A distant enhancer regulates the expression of AKR1B10 and AKR1B15 To get more insights about the role of AKR1B1 CpG island as distal regulator we decided to use enhancer luciferase approach. The results indicated that whole CpG island already had enhancer activity, however we reduced the size of the fragment to elucidate the TFs responsible for the expression of AKR1B10 and AKR1B15 genes. Finally, we found a single transcription factor binding site (TFBS), used by NF-­‐Y and C/EBP-­‐β, which was associated with an important increase of the luciferase signal. It is worth to mention that within the island, 163 Discussion other fragments also present enhancer activity (F2.1 or F2.3.2), but the mentioned binding site was the one that produced more luciferase signal. Luciferase experiments provide important clues about the activity of the region, but it is also a limited approach, as the genomic context (nucleosome occupancy, histone marks, DNA methylation, distal interactions and more) is not maintained in this assay. For these reasons we decided to manipulate the original NF-­‐Y and C/EBP-­‐β TFBS, using CRISPR technique (materials and methods) to alter the binding site and study the consequences in the expression of AKR1B10. Finally, we obtained a clone from HepG2 cell line that had a deletion in the TFBS resulting in a downregulation of AKR1B10 gene compared with the control cells. This is a direct evidence that the TFBS identified by enhancer luciferase experiments indeed plays a role in the regulation of AKR1B10 and AKR1B15. Next step was to find which TF is the responsible for the enhancer activity: NF-­‐y or C/EBP-­‐β. To answer this question we performed CRISPR experiments to truncate both TF separately. Unexpectedly, the truncation of both TF produces the downregulation of AKR1B10. This means that both proteins are required to activate the expression of AKR1B10 and AKR1B15. Intriguingly, AKR1B1 did not display changes in gene expression, although the two TFs bind to their promoter region. Gathering all the data we could confirm that AKR1B1 CpGi works as an enhancer of AKR1B10 and AKR1B15. Furthermore, the activator role of the enhancer is due to both NF-­‐Y and C/EBP-­‐β binding. These results are in agreement with a recent study showing that in cancer cell lines, a large number of genes are regulated by DNA methylation changes in enhancer regions rather than in its promoter (Aran et al., 2013). H3K27ac and PRC2 dynamics in the activation/silencing of AKR1B10 and AKR1B15 Back to 2012, Dr. Batool Akhtar-­‐Zaidi et al. analyzed the enhancer histone marks H3K4me1 and H3K27ac to determine gain and loss of enhancer activity at genome-­‐wide level in primary colon cancer cell lines relative to normal colon crypts. They identified thousands of variant enhancer loci (VEL) that comprise a signature that is robustly predictive of the in vivo colon cancer transcriptome. 164 sh Nhhs1 i i jh 9 oyhsh 1 ei 0) <) 8bT A o ei e Tw ei Ty5eh e e 0) &. o1he g Ts i i E B 0. s 1o1T e o 1T B 0. s 1Tn o w Nei 1Th h 1n n 1 e1 sA 1T n 1T oo os hb i B 0. b s h 1n n 1 e1 hst 1Tn 1T p E Nei 1Th s eseyb T os hw E iE pi n 1 heT e ei eo1he i T n 1T jTshu e ei D s i 1 1T e hei D s Tw ui e T mi 1o jD 1n 1Tn o 1o1 m 1 h TA i T 1A Ty 1 B 0. T j t 5T hhs1 1 s ei Th s B B1 E h> ui e Tj 1n 5 s h ei < <) < < 5 sho B 0. 1 b0) <08w s 1NT T Ds1 w sThe s ei esho1hes <<3 T eT e < <2 e Tei s eNn 1T Ty5e n 1T T1 Nheoy hh1 s e s s esA es1 1 ei Ti A h ey5s y 1o1 1 h TA es1 h m T T 5T1 N 5 u1 1o1T e o Thw 1he T1hh eNn 1Th e T hes Doybei sh 5 u sh T 1A T B 0. h T > T yDi e1 9NsT e e o o A oh 1 03) & D s DT e T N es1 o ei h B 0. El 1T 1A Tbei msei esA n Tu 1Ne &) 6 1 D s hi 1m AsTeN ooy 1 gE vs A E i T 1ei T hse b. ) 6 1 o1he h5 s s ooy i i <<3 msei 2j l wi Tbmi s i t5 o s h eT en ew i ooh n sDi e T oohw T n 1A h 1 y ei <32 sh Nhhs1 1oy 1n 5T hhsA eyo h h > ei 1n 5o t 8e1 ei s T h s o1 De Tn s 08w 0 m1No T Ds1 h mi e m1No 5T1 N B 0. n 5T1 hh m1No s oN 0 > n Tu y oh1 ei esA es1 1 ei 0> ei eeT e i she1 T hs D1 B0 . 0 hN N se8w i sh hso s D n ei yoeT h T h h ei e m1No T hNoe s ei i T> sDNT x. 8w " # " ! gE vv A ie i i B B1 i sh i y51ei hsh sh N ooos B 0. E i E 6a T5s y 1NT i sh heT1 Doy i y5 Tn ei yo e 5 u s ei B 0. 5 u T hNoehw sh5o yh B 0. n B < <) y ei il <<3 1o1T e o 0 s ei < < 5 ooh msei 2j l T 0 s ei T Ds1 sho b m 1 h TA < <2b mi s i sh N e1 ei T n 1A o 1 < < 5 sho b 1 h 1ei A > sDNT 328w 1m A Tb mi m eT e ei t 5T hhs1 1 iE i Tj T 1 heseNes1 1 ei 1 h TA n ei yo es1 > sDNT xx8w A n 1T bmi 1 h TA ei <<3 ooh m T eT e T j t 5T hhs1 1 msei 5> 0 s i s se1T8bm < <) b Ne 1 i D s < < t 5T hhs1 > sDNT . 28w ei Ts D oo ei 1 sTn ei e ei < < 5 sho <33 5sD es t 5T hhs1 e 1 5sD es he e b h5 s ooy ei sh u y s s s D ei < <) N osey esAsey he e 1 ei < <2bm B 0. i ( 0b 1 Tw ei Discussion contrary, the epigenetic state of AKR1B10 and AKR1B15 promoters does not seem to play an important role in the regulation of the genes. Gene regulation by enhancer hypermethylation in cancer The DNA methylation status of the enhancer has important consequences in gene expression. Dr. Dvir Aran et al. analyzed DNA methylation and gene expression data in 58 cell types and developed a machine-­‐learning algorithm for methylation-­‐expression relationships in gene promoters and enhancers. They mapped numerous sites at which DNA methylation was associated with expression of distal genes. Strikingly, some of these identified sites were drastically altered in cancers: hypomethylated enhancer sites associated with upregulation of cancer-­‐related genes and hypermethylated sites with downregulation (Aran et al., 2013). Moreover, changes in the DNA methylation state of the enhancer were better predictors of gene expression than changes in the promoter. Additionally, there was much more hypermethylation in enhancers than in promoters . Methylation of distal regulatory sites is closely related to gene expression levels across the genome. Single enhancers may modulate ranges of cell-­‐specific transcription levels, from constantly open promoters (Aran & Hellman, 2013). DNA methylation itself does not produce gene silencing; there are two proposed mechanisms by which DNA methylation hampers gene expression: by avoiding the binding of TFs to its targets or by recruiting DNA methylation binding domain proteins (MBD) that in general do not activate gene expression. Our observations showing an increase of C/EBP-­‐β binding in the AKR1B1 CpG island once demethylated by treatment with 5-­‐AzadC are concordant with Aran et al. data showing a depletion of TF in methylated enhancers. We also tested the importance of DNA methylation in the activity of the AKR1B10 enhancer. Using luciferase enhancer assay, we transfected the CpG island methylated and unmethylated, the result was that when the CpGi was unmethylated has an increased enhancer activity compared with the methylated construct. Our results are explained by two distinct mechanisms, the first one is based on H3K27ac. This mark is the responsible for the activation of the enhancer and is 167 Discussion fundamental for AKR1B10 and AKR1B15 expression. In those cases where there is no H3K27ac, the enhancer activity is completely lost. Secondly, the enhancer needs to attach some TF to be active. According to our results, NF-­‐Y and C/EBP-­‐β are the most important TFs, but as mentioned before, there are other regions and perhaps other TF that also contribute to express AKR1B10 and AKR1B15. Probably, DNA methylation plays a role in silencing the enhancer hampering the binding of TFs. Although we just describe H3K27ac and DNA methylation mechanisms separately, they are in fact steps of the same silencing process and it is difficult to elucidate the specific contribution of each one, as we always found H3K27ac loss and DNA hypermethylation of the enhancer to occur concomitantly in colorectal cancer. 168 Discussion FUNCTION OF AKR1B10 IN CANCER, LOCATION, LOCATION AND LOCATION The literature is plenty of studies reporting deregulation of AKR1B genes in cancer. According to previous works, AKR1B10 is most prominently upregulated in liver and lung cancer among others (Fukumoto et al., 2005; Heringlake et al., 2010; Kang et al., 2011; Schmitz et al., 2011; Woenckhaus et al., 2006). AKR1B1 over-­‐expression is more common amongst different tumor types than that of AKR1B10 (Laffin & Petrash, 2012). Alternatively, few studies have reported AKR1B1 and AKR1B10 under-­‐expression in human cancers. Regarding AKR1B15, there is not much literature of this gene and nothing about its alterations in cancer to date. In many papers, it has been described the advantages of AKR1B10 upregulation (Figure 23). However, AKR1B10 is deeply downregulated in colorectal cancer. Then, what makes colorectal cancer cells downregulate AKR1B10 while other cancers pursuit its upregulation? One possible explanation would be the one recently proposed by Ohashi et al.; they identified AKR1B10 as a direct transcriptional target of the tumor suppressor TF p53. Ohashi et al treated HCT116, LoVo and RKO colon cancer cell lines with adriamycin, which activates endogenous p53 protein by inducing DNA damage. As a response to the treatment, they observed an increase in the expression of AKR1B10 protein together with p53 in a dose-­‐dependent manner (Ohashi et al., 2013). Authors claim that p53 activates AKR1B10 by binding to a p53 response element (p53 RE) near the promoter (it is worth to mention that there are also p53 RE in the AKR1B1 CpG island). They proposed that the inactivating mutations of p53 in colorectal cancer could be the responsible for the AKR1B10 downregulation. However, the mechanisms must be more complex, because AKR1B10 is downregulated in most of the colorectal cancers cases, whereas the rate of p53 mutation in colorectal cancer is about 40% (Petitjean et al., 2007). We have also analyzed the relationship between the downregulation of AKR1B10 together with the mutation of p53 using tissue microarrays approach, and we could not observe any significant relationship (Annex XI). Moreover, AKR1B10 was not expressed when they used p53-­‐induced 169 Discussion transactivation directly (Ohashi et al., 2013). Moreover, what it is should be noted is that adriamycin is a substrate of AKR1B10 (Loeffler-­‐Ragg et al., 2009). For this reason, we think that adriamycin triggers AKR1B10 expression as a response of a cellular mechanism that pursuits the inactivation of the harmful agent. Activation of AKR1B10 upon adriamycin treatment needs to be very quick in order to protect the cell against DNA damage. We have seen that adriamycin activates more than 100 fold the expression of AKR1B10 in 24 hours and it is restored to normal levels in about 8 days (data not shown). This prompt activation may differ from the mechanism that regulates the expression of AKR1B10 in normal colon and does not explain the silencing produced in cancer; further experiments are needed to better understand how adriamycin induces the expression of AKR1B10. Consequences of AKR1B10 and AKR1B15 loss of function in colorectal cancer In contrast to the ubiquitously expressed AKR1B1, AKR1B10 is mainly expressed in normal small intestine and colon, which suggests that the physiological function of AKR1B10 is specifically required in intestinal tissues (Cao, 1998). Interestingly, AKR1B10 deregulation in cancer shows an inverted pattern to its condition in normal tissue: silencing in colorectal cancer (where the normal tissue expresses it), and upregulation in but cancers where AKR1B10 is lowly or not expressed in the normal tissue (i.e. pancreas) (Chung et al., 2012; Ma et al., 2012). Actually, AKR1B10 is more than just another tissue-­‐specific gene. Related to this, Dr. Batlle’s group described, in mouse and human, the genes responsible for the differentiation of intestinal stem cells (ISC) to well-­‐differentiated colonocytes (Merlos-­‐Suárez et al., 2011). ISCs are selected by high expression of two genes: the ISC marker EphB2 (Merlos-­‐Suárez et al., 2011) and the classical ISC marker Lgr5 (Barker et al., 2007). Both genes become gradually silenced when ISC differentiate. Using the gradient expression of both genes, they identified the panel of genes activated specifically at each point of differentiation: ISC, transient amplifying cells, late terminal amplifying cells and terminal differentiation. Terminal amplifying cells (TA) result from the expansion of ISC (through several 170 Discussion rounds of mitosis) while they migrate upwards along the crypt axis. Close to the intestinal lumen, TA cells undergo cell-­‐cycle arrest and become terminal differentiated cells. Among all these colon differentiation steps, AKR1B10 appeared in the panel of genes defining the signature for the late-­‐TA step (supplementary table 5 in Merlos-­‐Suárez et al., 2011 paper). However, due to the impact of AKR1B10 silencing in colorectal cancer, our hypothesis is that this gene is acting as a tumor suppressor gene, hampering the development of the tumor. A recent paper underpinned this hypothesis; Dr. Yao et al. described that AKR1B10 is downregulated in gastric cancer and observed that the expression of AKR1B10 was inversely correlated with tumor size, lymph node metastasis, distant metastasis and TNM stage. They concluded that the presence of AKR1B10 in the tumor is a good prognostic indicator in gastric cancer patients (Yao et al., 2013). AKR1B10 is expressed in gastric, colon and rectum normal tissues and in the cancers of these tissues is frequently downregulated. At this point, a question arises: what makes gastric, colon and rectum tissues different from others like pancreas, liver, lung, blood or breast, where this gene is upregulated in cancer? AKR1B10 is a metabolic enzyme that catalyzes the reduction of a wide range of substrates; the cellular implications of expressing AKR1B10 could vary depending on the available substrate. In other words, each tissue has different accessibility to different compounds, and the reduction of these distinct compounds could be beneficial or detrimental for the cancer cell growth. This may be why AKR1B10 is upregulated in some cancer cells and downregulated in others. At that moment, we realized that those cancers where AKR1B10 is downregulated (gastric, colon and rectum) are tissues that are in direct contact with the diet. Among all nutrients in the diet, we can find vitamin A ester form, also known as retinal. This compound is efficiently reduced by AKR1B10 to retinol (but not by AKR1B1), which is described as an inhibitor of the cellular growth in colorectal cancer cell lines, through an independent retinoic acid pathway (Dillard & Lane, 2007; Park et al., 2005; Park et al., 2008). Almost all the retinal coming from the diet is converted to retinol in the lumen of the gastrointestinal tissue, specially in the intestines (Fidge et al., 1968). Retinol is 171 Discussion then specifically conjugated to different proteins, distributed across the body and stored in the liver. To summarize, gastrointestinal tissues are distinctively exposed to high amounts of free retinal and retinol. Our hypothesis is that gastrointestinal cancers specifically silence the activity of AKR1B10 and AKR1B15 to avoid the reduction of the dietary retinal into retinol, which inhibits the growth of the tumor. The inhibition of AKR1B10 is an early alteration already present in adenoma, which would allow uncontrolled growth of tumor cells. In the line of this hypothesis, normal ISC do not express AKR1B10 until the last state of differentiation, when cells do not need to divide anymore. AKR1B10 (and perhaps AKR1B15) is expressed to perform its own functions but also to maintain the non-­‐dividing state of differentiated cells. Actually, this hypothesis is underpinned by our retinal treatment results. When we performed proliferation assays with colon cancer cell lines transfected with AKR1B10 or AKR1B15 and control, we observed a slight decrease in the proliferation of AKR1B10 and AKR1B15 transfected cells. However, when we do the same experiment adding retinal to the medium, cells that are transfected with AKR1B10 or AKR1B15 are deeply affected and are less proliferative compared with the controls cells. This effect is due to the increased amount of retinol that was produced by retinal treatment in the AKR1B10 and AKR1B15 transfected cells. The increased amount of retinol produced by AKR1B10 and AKR1B15 transfected cells was confirmed by studies performed in Jaume Farrés lab (UAB) (data not shown). These experiments pointed out the crucial antiproliferative role of AKR1B10 and AKR1B15 per se but also, and more important, in combination with retinal. Non-­‐gastrointestinal tissues, which are not exposed to free retinal, tend to overexpress AKR1B10 to acquire the pro-­‐tumor activities described in the literature, without the risk of growth inhibition by retinol production. 172 Discussion DEREGULATION OF THE RETINOIC ACID PATHWAY IN COLORECTAL CANCER As we have discussed above, gene silencing is a well-­‐known cellular process that commonly occurs in cancer (Khare & Verma, 2012; Nephew & Huang, 2003). The literature is plenty of examples of specific genes silenced in a given cancer type; however, in most of the studies the gene is analyzed overlooking its role in the pathway. Understanding the impact of one single gene alteration in the whole pathway is extremely important, because other genes could easily overcome the function of one silenced gene within the whole pathway. In the present study, we have screened for aberrant gene expression in genes directly involved in the retinoic acid pathway in normal colon, and we have focused our attention on the production of the key metabolites responsible for the adequate function of the pathway (Retinol, All-­‐trans RA and All-­‐trans 4 oxo-­‐ RA). Previous investigations have reported epigenetic silencing of several genes of the retinoic acid pathway. The most well studied is the promoter hypermethylation of RARβ gene, which affects several cancer types (Hayashi et al., 2001). Many other members of the pathway have also been described to undergo silencing through DNA hypermethylation of the promoter (Chim et al., 2005; Chou et al., 2012; Okudela et al., 2013; Tsunoda et al., 2009; Wang et al., 2003). Despite these works, there is not a comprehensive study of the retinoic acid pathway deregulation in cancer. Here we report a deep screening of the genetic and epigenetic alterations of the retinoic acid pathway genes in human colorectal cancer. We show that 13 genes of the RA pathway were downregulated in colorectal cancer (AKR1B1, AKR1B10, AKR1C3, ALDH1A1, CYP26B1, DGAT1, DHRS4, LRAT, RARA, RARB, RBP1, RETSAT and RXRA) and among them, nine displayed promoter DNA hypermethylation (AKR1B1, AKR1C3, ALDH1A1, CYP26B1, DGAT1, LRAT, RARA, RARB and RBP1) during the cancerous process. We have checked for the importance of promoter DNA methylation and expression on RA pathway genes and, in most cases, the results showed a strict correlation between methylation levels and changes in expression. Taken together, these 173 sh Nhhs1 e n 1 heT e ei e n ei yo es1 sh 5o ys D n c1TT1o s ei hso s D1 5 ei m y D hw 1T 1A TbD es n Ne es1 h 1ei A h5 s oT o A <) s oe T T 1 ei hso 1o1T e o o1 u D hd1 ei Tsh n s oy N e1 D D h s ei mi 1o 5 ei m ybm s 1o1T e o e sTheDo bm 1o1T e o o1 u ALDH1A1 i n c n E g i i p s T 1No 1 h TA ei eT es 1s Tw i < < 5e1Th, 5 1 s o T es 1s 5T1 N es1 1 ei 03 <w b e n T h > 1n n 1 oy T n 5os s es1 8 511Toy N 0) <) 8bmi s i n 1e 5T1 N < h T es o8 y ei e1 s i s se ei o T s i s ses1 1 T es 1s The11 T es 1s s b 0) ) . d T 5e1T Tu b 1T T es 1o 5T1 N es1 b sei T oojeT h T es o i y 1A T t 5T hh sT eoy 1 e s b T o1 u DT1mei 1 ei 1ei b T es yo he Th T es 1ob Nh 1 ei 1TT es yo he Th l yn h s <) > y D s e > i 1 1hs1N t 51h ooj b e1 ei n b Ne cNhe T es 1o eNn 1Tw 1Tei sh T h1 ei oojeT h T es o i y s i s ses1 1 ei < <b y e1 oojeT h T es o i y y ei h ei e 1o1T e oeNn 1Th T n 1 heT e s 5 ei m y sh 1m T DNo es1 1 ei 1 T es 1o > soo T r es1 h T h51 hs o p p o <0w e sh m1Tei e1 1e ei e T es 1obT es yo he Th eT h T es o i y o y ei Tw 1T 1A TbT es 1osh T 5s oy 5Nn 5 TT p i w 1t s sl s D T es yo he Th 1T T N s D 1o1T e o E i i E s1 esA n e 1ose > oojeT h 1 bei T sh i shn 0) ) 2b 0) ) x8w i <. & E i ig El E i EEg i EE n p ci i E i pl s 5 ei m y sh o Toy N esA es1 1 ei 1n ei s D hsn so T 1 NTh e1 ei > l ei sT 51o T n e 1ose h8 sh i n 5 T l yn h sh N RARA RARB RXRA CYP26B1 e em1 o A ohw sThebei sh 1Neei 5 ei h ei e T> sDNT xM8w gE vmA i E i p E p i E i i p cg E g i u E i p i E EE n pi p E s n 5os s es1 w y T 5T h es D AKR1B1 AKR1B10 AKR1C3 DHRS4 DGAT1 LRAT s T oe T es1 h 1 1 eT TybN5T DNo es1 1 1No D e s RDH10 RDH12 i i 15y Nn 5 ei m y 1n 51N h T h51 hs o < <) b < B l yn h & Discussion for all-­‐trans retinaldehyde). Even more, if some retinol is produced or absorbed by the tumor through the diet, it would rapidly become All-­‐trans retinaldehyde because of the upregulation of the responsible enzymes (RDH10 and RDH12). In summary, we demonstrate the inhibition of the biosynthesis of active metabolites of the retinoic acid pathway in colorectal cancer, which results in the impairment of canonical and non-­‐canonical anti-­‐tumorigenic effects of these signals. Moreover, at the genome scale, other genes are also co-­‐methylated with genes of the retinol acid pathway. A deeper study of these events revealed that processes such as embryo development, neuronal differentiation or cell migration are “co-­‐ silenced” with retinoic acid pathway genes. Interestingly these processes are known to be driven by retinoic acid. These results indicate that the production of bioactive metabolites from the retinoic acid pathway is prevented in colorectal cancer cells. 175 sh Nhhs1 B B p i c i T s bm T 51Te ei h1n D h 1 ei T es 1s < < 5 sho >x26 1 i sDi 5T A o sh o Toy ei 11T s e 1n h E E pi p i y5 Tn ei yo es1 s on 1he oo 1o1T e o n 1he i y5 Tn ei yo e ei e ei sh i y5 Tn ei yo es1 sh 305 1 a e pe s 5 ei m y s oo 1o1T e oeNn 1Th8 1n 5 T oTumor T Biol. y 5T h e s (2012) 33:297ñ p T s 1n hw o1 Nh s ei msei 1Tn o 1o1 w i A 5 ei m y oh1 hi 1m Toy A e NTs DeNn 1NTsD hshb se sh 9N ooy 5T h e s ei s T e Nh se sh T s 1n 301 he D h> e 1ehi 1m 8w Table 3 Diagnostic stool markers Gene Name Sensitivity/specificity Method Reference CRC (75%, 15/20)/AD (68%, 17/25)/SP (90%, 3/30) MSP [49] [45] APC, ATM, Misc. hMLH1, SFRP2, HLTF, MGMT, GSTP1 CDKN2A, MGMT Misc. or hMLH1 EN1 Homeobox protein engrailed-1 HP (55%, 16/29), SP (63%, 7/19) MSP CRC (27%, 8/30)/SP (97%, 1/30) GATA4 HIC1 Transcription factor GATA-4 Hypermethylated in cancer 1 protein CRC (59%, 44/75)/SP (88%, 9/75) CRC (42%, 11/26)/AD (31%, 4/13)/SP (100%, 0/32) Melting curve [54] analysis qMSP [24] MSP [44] ITGA4 NDRG4 Integrin alpha-4 N-Myc downstream-regulated gene 4 HP (69%, 9/13)/SP (78%, 6/28) CRC (56%, 42/75)/SP (96%, 3/75) qMSP qMSP [58] [57] OSMR RASSF2 CRC (38%, 26/69)/AD (13%, 2/16)/SP (95%, 4/81) CRC (45%, 38/84)/AD (13%, 7/56)/SP (95%, 6/113) qMSP COBRA [59] [52] SFRP1 SFRP2 Oncostatin M receptor-β Ras association domain-containing protein 2 Secreted frizzled-related protein 1 Secreted frizzled-related protein 2 CRC (84%, 16/19)/AD (100%, 7/7)/SP (86%, 2/14) CRC (83%, 19/23)/SP (77%, 6/26) MSP MethyLight [53] [43] SFRP2 SFRP2 SFRP2 SFRP2 Secreted Secreted Secreted Secreted MSP MSP MSP MSP [48] [50] [51] [37] SFRP2 TFPI2 TFPI2 Secreted frizzled-related protein 2 Tissue factor pathway inhibitor 2 Tissue factor pathway inhibitor 2 CRC (94%, 49/52)/AD (52%, 11/21)/SP (96%, 1/24) CRC (60%, 18/30)/AD (44%, 11/25) SP (97%, 1/31) CRC (87%, 60/69)/AD (62%, 21/34)/SP (93%, 2/30) CRC (84%, 142/169)/AD (46%, 29/63)/SP (93%, 2/30) CRC (63%, 53/84)/AD (32%, 18/56)/SP (92%, 9/113) CRC (81%, 59/73)/AD (21%, 4/19)/SP (85%, 11/75) CRC (68%, 41/60)/AD (55%, 11/20)/SP (100%, 0/30) COBRA qMSP qMSP [52] [55] [56] TMEFF2 (HPP1/TPEF) Vim Vim Transmembrane protein with EGF-like CRC (71%, 37/52)/AD (57%, 12/21)/SP (100%, 0/24) MSP and two follistatin-like domains Vimentin CRC (46%, 43/94)/SP (89%, 20/178) MSP Vimentin CRC (41%, 9/22)/AD (45%, 9/20)/SP (95%, 2/38) MethylBEAMing Vimentin CRC (78%, 9/40)/SP (84%, 19/122) MSP Vim frizzled-related frizzled-related frizzled-related frizzled-related protein protein protein protein 2 2 2 2 [48] [46] [39] [47] Sensitivities in hyperplastic polyps (HP), adenomas (AD), and colorectal carcinomas (CRC) and the specificity (SP) Bs A was pi pi in almost E Eplall primary i Eadenoma E pi r marker pu T1BTl methylation detected [58]. To identify new methylation markers, three samples, the detection rate of methylated TFPI2 in fecal colon cancer cell lines were treated with the demethylation h was 1 only ei 21%. h In ea second b m study, i A detection A oN rates e for ei reagent, e es1 5-aza-2′-deoxycytidine, 1 < < 5 sho and differentially DNA methylated TFPI2 DNA in stool samples of patients with expressed genes identified by microarray analysis. From a n colorectal ei yo es1 1 lower js A(sensitivity, hsA h n68%), 5o hb i h list he11o h candidate b 1genes, 1o1T e al. o chose the T gene Oncoscancers were buthN speciof 52 Kim et tatin M receptor-β (OSM) for further analysis and were able ficity of this assay was higher (100%) [56]. GATA4 repre5 sents es another eh tumor s isuppressor oei y gene 1 eT1o hwtranscription y yo es1 s1n of TutheThOSM i A gene in 26 out of 69 whose is n toeidetect methylation reduced in colorectal carcinomas versus normal colon tispatients with colorectal cancers (sensitivity, 38%) and in 4 5T151h s ei o hey Th msei h1n 1 ei n 55 Ts D h A Ty 5T1n shs D N e1 out 81 healthy controls (specificity, 95%) [59]. sue. Analysis of GATA4 DNA methylation in fecal DNA showed an overall detection rate of 59% and a specificity of The number of publications focusing on the prognostic 88% [24]. Similar results were published by the same group value of DNA hypermethylation in stool is limited: Tang et al. published data that detection of methylated SFRP2 DNA for the N-Myc downstream-regulated gene 4 (NDRG4), a <.novel 3 tumor suppressor [57]. With a sensitivity of 56% and in stool samples is associated with a reduced survival of a specificity of 96%, NDRG4 has similar qualities a bioaffected patients (P00.0219). However, detection of methmarker for asymptomatic patients with colorectal cancers as ylated SFRP2 DNA in stool samples has no prognostic sh Nhhs1 ei i sDi e es1 T e 0) <Bd oo T u Th b0) ) Md s e y1T D11 h5 s s sey > l N T ei b0) ) Md Dhu b0) ) M8> o <. 8w 1n . 26 1 T s 1n Ch e es1 msei M) 6 1 i ei s o hesoo e i s9N Nh n ei yo es1 h5 s s seyb e1 s1n Tu T 1No b0) <08> h e1 i Nc b0) <Bd sn heTs e T s e Tn h 1 e e n ei yo es1 b 5 s D 1 ei > 1h i b T her s1n Tu Th T 1oosDhb0) <0d 1 Dr Tn 1 b0) ) Md h5 s s seyw 1m A Tbei b0) <) d Nh s h1n 5 oh 1 1i 1Te heN y h h ei hn sh5o y sn 51Te eA Ts es1 h s h hsesAsey h e 1 h n 5o h oyl ei e i s9N h Nh o <. 8w A B C i p gE m1 A R E pig pl ic B B p p i e ic R B B B B E n i 1n 5 Ts D 1e ei he 1 < < 5 > sDNT M) 8w i heT1 D he 51s e 1 sho sh N n ei yo e Th ei e es1 T e n ei 1 1o1Ds h> i o9Nshe 1n Ep E Ep E 1T 1n 5o n e ei b0) ) ) d D1T R T s 1n hsh < < s e h o u 1 s <) ) 6 1 ei < < n ei yo es1 p p e es1 b < < sh ei i sDi he h5 s s sey s ei T hNoeh s s e ei e 55T1 i ei e E E p sh n 1T h hsesA ei 1ei T 5T151h oei y 5 15o b mi e 1 hs o u E n i E n i i E E Epl i E > sDNT M) 8b Ne T D T s D > sDNT M) 8w 1m A Tb ei i i < < msei 1ei T s1n Tu Thbseh 5 T 1Tn h T ooy m oo 51hsesA h, E op i op p p i e ic i E E p oh he11oh T1n h n 5o h oyl e es1 n y NTT e s D 1hes h T s D b0) ) B8w <. . Discussion AKR1B10 protein downregulation in colorectal cancer Tissue microarray experiments revealed loss of AKR1B10 protein (downregulation or complete absence) in the cancer tissue of 96.4% of the tumors analyzed (162 out of 168). Due to its almost universal occurrence, it is unlikely that the identification of this alteration could have prognostic utility. Nevertheless, it remains to be investigated whether this analysis could be applied to distinguish between a benign lesion and cancer in cases where there is a lesion in the epithelium but it is difficult to determine its malignancy by other methods. Further experiments are required until this application could be used, and different types of lesions including adenomas and bowel disease samples are required to have a complete profile of AKR1B10 in the different possible scenarios involving the intestinal tissue. 178 Discussion RETINOIC ACID PATHWAY GENES AS PROGNOSTIC MARKERS The discovery of new biomarkers is crucial for the future of medicine. Biomarkers could be related with the tumor biology and be essential for the election of the treatment. Biomarkers could also predict the outcome of the disease and help to improve the management of the disease. In this work we described some gene expression alterations of retinoic acid pathway genes that could also provide several confident prognosis markers. The alteration (downregulation or upregulation) of the normal gene expression of ALDH1A2, CYP26B1, DGAT1, DHRS4, LRAT, RARA, RDH10 and RXRA, in colorectal cancer is significantly related with worse overall survival. These results suggest that alterations in RA pathway genes expression could be used for prognostic prediction in colorectal cancers. Regarding AKR1B1 protein expression, we obtain some interesting results with the tissue microarrays analysis, the few cases that have no expression of AKR1B1 display a worse overall and disease free survival than the cases where it is not altered. This result is very motivating but we need to validate it with an independent cohort. In summary, we have shown that transcriptional disruption of the retinoic acid pathway (partly due to epigenetic alterations) is an important feature of most colorectal cancers, and its analysis might have important applications in the clinical management of patients. 179 Conclusions CONCLUSIONS 1. AKR1B1 CpG island is deeply and frequently hypermethylated in colorectal cancer, but with minimal or no effect on the expression of the associated gene. 2. Hypermethylation of AKR1B1 CpG island is strongly associated with downregulation of AKR1B10 and AKR1B15, which promoter region is 60Kb upstream of the CpG island. 3. AKR1B1 CpG island presents enhancer properties in regard to AKR1B10 and AKR1B15 genes, which explains the functional association. 4. AKR1B10 and AKR1B15 are tumor suppressor genes in colorectal cancer, especially in the presence of retinal, a form of vitamin A and precursor of retinoic acid. 5. Akr1b enzymes are also dowregulated in a murine colorectal cancer, suggesting that the impairment of its function in colorectal cancer is not an epiphenomenon. 6. The retinoic acid pathway is deregulated in most colorectal cancers by epigenetic mechanisms resulting in an overall decrease of the antitumor compounds of the retinoic acid pathway. 7. Detection of AKR1B1 CpG island hypermethylation (resulting in downregulation of AKR1B10) in stools DNA is a non-­‐invasive, sensitive and specific marker of colorectal adenomas and carcinomas, rendering it as a proper candidate for colorectal cancer screenings. 8. Low expression levels of AKR1B1, AKR1B10, ALDH1A2, CYP26B1, DGAT1, DHRS4, LRAT, RARA and RXRA; and high expression levels of RDH10 are associated with tumor aggressiveness, which might be useful as a prognostic factor. 183 Bibliography BIBLIOGRAPHY Ahlquist, D. A., Skoletsky, J. E., Boynton, K. A., Harrington, J. J., Mahoney, D. W., Pierceall, W. E., … Shuber, A. P. (2000). Colorectal cancer screening by detection of altered human DNA in stool: Feasibility of a multitarget assay panel. Gastroenterology,(119) 1219-­1227. Akhtar-­‐Zaidi, B., Cowper-­‐Sal-­‐lari, R., Corradin, O., Saiakhova, A., Bartels, C. F., Balasubramanian, D., … Scacheri, P. C. (2012). Epigenomic enhancer profiling defines a signature of colon cancer. Science, (336) 736–739. Akulenko, R., & Helms, V. (2013). DNA co-­‐methylation analysis suggests novel functional associations between gene pairs in breast cancer samples. Human Molecular Genetics, (22) 3016–3022. Albanes, D., Heinonen, O. P., Taylor, P. R., Virtamo, J., Edwards, B. K., Rautalahti, M., … Huttunen, J. K. (1996). Alpha-­‐Tocopherol and beta-­‐carotene supplements and lung cancer incidence in the alpha-­‐tocopherol, beta-­‐ carotene cancer prevention study: effects of base-­‐line characteristics and study compliance. Journal of the National Cancer Institute, (88) 1560–1570. Aldini, G., Dalle-­‐Donne, I., Facino, R. M., Milzani, A., & Carini, M. (2007). Intervention strategies to inhibit protein carbonylation by lipoxidation-­‐ derived reactive carbonyls. Medicinal Research Reviews, (27) 817–868. Ando, Y., Saka, H., Ando, M., Sawa, T., Muro, K., Ueoka, H., … Hasegawa, Y. (2000). Polymorphisms of UDP-­‐glucuronosyltransferase gene and irinotecan toxicity: a pharmacogenetic analysis. Cancer Research, (60) 6921–6926. Antequera, F., & Bird, a. (1993). Number of CpG islands and genes in human and mouse. Proceedings of the National Academy of Sciences of the United States of America, (90), 11995–11999. Aran, D., & Hellman, A. (2013). DNA methylation of transcriptional enhancers and cancer predisposition. Cell, (154) 11-­‐13. Aran, D., Sabato, S., & Hellman, A. (2013). DNA methylation of distal regulatory sites characterizes dysregulation of cancer genes. Genome Biology, (14), R21. Azuara, D., Rodriguez-­‐Moranta, F., de Oca, J., Soriano-­‐Izquierdo, A., Mora, J., Guardiola, J., … Capellá, G. (2010). Novel methylation panel for the early detection of colorectal tumors in stool DNA. Clinical Colorectal Cancer, (9), 168–76. Baba, S. P., Barski, O. A., Ahmed, Y., O’Toole, T. E., Conklin, D. J., Bhatnagar, A., & Srivastava, S. (2009). Reductive Metabolism of AGE Precursors: A Metabolic Route for Preventing AGE Accumulation in Cardiovascular Tissue. Diabetes, (58). Bailey, C. E., Eschrich, S., Kis, C., Levy, S., & Kay, M. (2012). Predicts Recurrence and Death in Patients With Colon Cancer, (138), 958–968. Bannister, A. J., & Kouzarides, T. (2011). Regulation of chromatin by histone modifications. Cell Research, (21) 381–95. Barker, N., van Es, J. H., Kuipers, J., Kujala, P., van den Born, M., Cozijnsen, M., … Clevers, H. (2007). Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature, (449) 1003–1007. Baron, J. M., Heise, R., Blaner, W. S., Neis, M., Joussen, S., Dreuw, A., … Jugert, F. K. (2005). Retinoic acid and its 4-­‐oxo metabolites are functionally active in 187 Bibliography human skin cells in vitro. The Journal of Investigative Dermatology, (125), 143–53. Barski, O. A., Tipparaju, S. M., & Bhatnagar, A. (2008). The Aldo-­‐Keto Reductase Superfamily and its Role in Drug Metabolism and Detoxification. Drug Metabolism Reviews, (40) 553–624. Bastide, N. M., Pierre, F. H. F., & Corpet, D. E. (2011). Heme iron from meat and risk of colorectal cancer: a meta-­‐analysis and a review of the mechanisms involved. Cancer Prevention Research. (4) 177–184. Bavinck, J. N., Tieben, L. M., Van der Woude, F. J., Tegzess, A. M., Hermans, J., ter Schegget, J., & Vermeer, B. J. (1995). Prevention of skin cancer and reduction of keratotic skin lesions during acitretin therapy in renal transplant recipients: a double-­‐blind, placebo-­‐controlled study. Journal of Clinical Oncology, (13) 1933–1938. Baxter, N., & Goldwasser, M. (2009). Association of Colonoscopy and Death From Colorectal Cancer. Annals of Internal medicine,(150) 1–9. Bell, O., Tiwari, V. K., Thomä, N. H., & Schübeler, D. (2011). Determinants and dynamics of genome accessibility. Nature Reviews. Genetics, (12) 554–564. Benelli, R., Monteghirfo, S., Venè, R., Tosetti, F., & Ferrari, N. (2010). The chemopreventive retinoid 4HPR impairs prostate cancer cell migration and invasion by interfering with FAK/AKT/GSK3beta pathway and beta-­‐catenin stability. Molecular Cancer, (9) 142. Berg, V., & Kinzler, K. W. (1997). Gatekeepers and caretakers. Nature, (386) 761-­ 763. Bergman, Y., & Cedar, H. (2013). DNA methylation dynamics in health and disease. Nature Structural & Molecular Biology, (20) 274–281. Bettington, M., Walker, N., Clouston, A., Brown, I., Leggett, B., & Whitehall, V. (2013). The serrated pathway to colorectal carcinoma: current concepts and challenges. Histopathology, (62), 367–386. Bibikova, M., Lin, Z., Zhou, L., Chudin, E., Garcia, E. W., Wu, B., … Fan, J.-­‐B. (2006). High-­‐throughput DNA methylation profiling using universal bead arrays. Genome Research, (16), 383–393. Bird, A. (2002). DNA methylation patterns and epigenetic memory. Genes & Development, (16) 6–21. Bollag, W. (1972). Prophylaxis of chemically induced benign and malignant epithelial tumors by vitamin A acid (retinoic acid). European Journal of Cancer, (8) 689–693. Bosch, L. J. W., Mongera, S., Terhaar Sive Droste, J. S., Oort, F. a, van Turenhout, S. T., Penning, M. T., … Meijer, G. a. (2012). Analytical sensitivity and stability of DNA methylation testing in stool samples for colorectal cancer detection. Cellular Oncology (Dordrecht), (35) 309–315. Boutanaev, A. M., Kalmykova, A. I., Shevelyov, Y. Y., & Nurminsky, D. I. (2002). Large clusters of co-­‐expressed genes in the Drosophila genome. Nature, (420) 666–669. Boyle, P., & Langman, J. (2000). ABC of colorectal cancer Epidemiology. BMJ: British Medical Journal, (321) 805–808. Boyle, P., & Leon, M. E. (2002). Epidemiology of colorectal cancer. British Medical Bulletin, (64) 1–25. Bozic, I., Antal, T., Ohtsuki, H., Carter, H., Kim, D., Chen, S., … Nowak, M. a. (2010). Accumulation of driver and passenger mutations during tumor progression. 188 Bibliography Proceedings of the National Academy of Sciences of the United States of America, (107), 18545–50. Bray, G. A. (2002). The Underlying Basis for Obesity: Relationship to Cancer. The Journal of Nutrition, (132) 3451–3455. Brock, H. W., & van Lohuizen, M. (2001). The Polycomb group — no longer an exclusive club? Current Opinion in Genetics & Development, (11) 175–181. Brown, C. J., Hendrich, B. D., Rupert, J. L., Lafrenière, R. G., Xing, Y., Lawrence, J., & Willard, H. F. (1992). The human XIST gene: Analysis of a 17 kb inactive X-­‐ specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell (71) 527-­542. Brown, J. C., Winters-­‐Stone, K., Lee, A., & Schmitz, K. H. (2012). Cancer, Physical Activity, and Exercise. Comprehensive Physiology, (4) 2775-­27809. Bushue, N., & Wan, Y.-­‐J. Y. (2010). Retinoid pathway and cancer therapeutics. Advanced Drug Delivery Reviews, (62) 1285–1298. Campanero, M. R., Armstrong, M. I., & Flemington, E. K. (2000). CpG methylation as a mechanism for the regulation of E2F activity. Proceedings of the National Academy of Sciences , (97) 6481–6486. Campos, E. I., & Reinberg, D. (2009). Histones: annotating chromatin. Annual Review of Genetics, (43) 559–99. Cao, D. (1998). Identification and Characterization of a Novel Human Aldose Reductase-­‐like Gene. Journal of Biological Chemistry, (273) 11429–11435. Carmona, F. J., Azuara, D., Berenguer-­‐Llergo, A., Fernández, A. F., Biondo, S., de Oca, J., … Moreno, V. (2013). DNA methylation biomarkers for noninvasive diagnosis of colorectal cancer. Cancer Prevention Research, (6) 656–665. Carter, D., Chakalova, L., Osborne, C. S., Dai, Y., & Fraser, P. (2002). Long-­‐range chromatin regulatory interactions in vivo. Nature Genetics, (32) 623–626. Casey, P. J. (1994). Lipid modifications of G proteins. Current Opinion in Cell Biology, (6) 219–225. Cedar, H., & Bergman, Y. (2009). Linking DNA methylation and histone modification: patterns and paradigms. Nature Reviews. Genetics, (10) 295– 304. Chan, A. T., & Giovannucci, E. L. (2010). Primary prevention of colorectal cancer. Gastroenterology, (136) 2029–2043 Chen, J., Guo, L., Zhang, L., Wu, H., Yang, J., Liu, H., … Pei, D. (2013). Vitamin C modulates TET1 function during somatic cell reprogramming. Nature Genetics, (45) 1504–1509. Chia, W. K., Ali, R., & Toh, H. C. (2012). Aspirin as adjuvant therapy for colorectal cancer-­‐-­‐reinterpreting paradigms. Nature Reviews. Clinical Oncology, (9) 561–570. Chim, C.-­‐S., Wong, S.-­‐Y., Pang, A., Chu, P., Lau, J. S., Wong, K.-­‐F., & Kwong, Y.-­‐L. (2005). Aberrant promoter methylation of the retinoic acid receptor alpha gene in acute promyelocytic leukemia. Leukemia, (19) 2241–2246. Chomczynski, P., & Sacchi, N. (2006). The single-­‐step method of RNA isolation by acid guanidinium thiocyanate-­‐phenol-­‐chloroform extraction: twenty-­‐ something years on. Nature Protocols, (1) 581–585. Chou, A. P., Chowdhury, R., Li, S., Chen, W., Kim, A. J., Piccioni, D. E., … Lai, A. (2012). Identification of retinol binding protein 1 promoter hypermethylation in isocitrate dehydrogenase 1 and 2 mutant gliomas. Journal of the National Cancer Institute, (104) 1458–1469. 189 Bibliography Chuang, J. C., Warner, S. L., Vollmer, D., Vankayalapati, H., Redkar, S., Bearss, D. J., … Jones, P. a. (2010). S110, a 5-­‐Aza-­‐2’-­‐deoxycytidine-­‐containing dinucleotide, is an effective DNA methylation inhibitor in vivo and can reduce tumor growth. Molecular Cancer Therapeutics, (9) 1443–1450. Chung, Y. T., Matkowskyj, K. a, Li, H., Bai, H., Zhang, W., Tsao, M.-­‐S., … Yang, G.-­‐Y. (2012). Overexpression and oncogenic function of aldo-­‐keto reductase family 1B10 (AKR1B10) in pancreatic carcinoma. Modern Pathology : An Official Journal of the United States and Canadian Academy of Pathology, (25) 758–766. Comb, M., & Goodman, H. M. (1990). CpG methylation inhibits proenkephalin gene expression and binding of the transcription factor AP-­‐2. Nucleic Acids Research , (13), 3975–3982. Cremer, T., & Cremer, M. (2010). Chromosome territories. Cold Spring Harbor Perspectives in Biology, (3). Creyghton, M. P., Cheng, A. W., Welstead, G. G., Kooistra, T., Carey, B. W., Steine, E. J., … Jaenisch, R. (2010). Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proceedings of the National Academy of Sciences of the United States of America, (107) 21931–21936. Cunningham, D., Atkin, W., Lenz, H.-­‐J., Lynch, H. T., Minsky, B., Nordlinger, B., & Starling, N. (2010). Colorectal cancer. The Lancet, (375) 1030–1047. Dawson, M. a, & Kouzarides, T. (2012). Cancer epigenetics: from mechanism to therapy. Cell, (150) 12–27. De Carvalho, D. D., Sharma, S., You, J. S., Su, S.-­‐F., Taberlay, P. C., Kelly, T. K., … Jones, P. A. (2012). DNA Methylation Screening Identifies Driver Epigenetic Events of Cancer Cell Survival. Cancer Cell, (21) 655–667. Dekker, J. (2006). The three “ C ” s of chromosome conformation capture : controls , controls , controls, (3) 17–21. Dekker, J., Marti-­‐Renom, M. a, & Mirny, L. a. (2013). Exploring the three-­‐ dimensional organization of genomes: interpreting chromatin interaction data. Nature Reviews. Genetics, (14) 390–403. Deng, G., Chen, A., Pong, E., & Kim, Y. S. (2001). Methylation in hMLH1 promoter interferes with its binding to transcription factor CBF and inhibits gene expression. Oncogene, (48) 7120–7127. Di Ruscio, A., Ebralidze, A. K., Benoukraf, T., Amabile, G., Goff, L. a, Terragni, J., … Tenen, D. G. (2013). DNMT1-­‐interacting RNAs block gene-­‐specific DNA methylation. Nature, (503) 371-­‐376. Dillard, A., & Lane, M. (2007). Retinol Decreases β-­‐Catenin Protein Levels in Retinoic Acid-­‐Resistant Colon Cancer Cell Lines. Molecular Carcinogenesis, (329), 315–329. Dixon, J. R., Selvaraj, S., Yue, F., Kim, A., Li, Y., Shen, Y., … Ren, B. (2012). Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature, (485) 1–5. Djebali, S., Davis, C. a, Merkel, A., Dobin, A., Lassmann, T., Mortazavi, A., … Gingeras, T. R. (2012). Landscape of transcription in human cells. Nature, (489) 101–108. Down, T. a, Rakyan, V. K., Turner, D. J., Flicek, P., Li, H., Kulesha, E., … Beck, S. (2008). A Bayesian deconvolution strategy for immunoprecipitation-­‐based DNA methylome analysis. Nature Biotechnology, (26) 779–785. 190 Bibliography Eden, A., Gaudet, F., Waghmare, A., & Jaenisch, R. (2003). Chromosomal instability and tumors promoted by DNA hypomethylation. Science, (300) 405. Ehrlich, M., Woods, C. B., Yu, M. C., Dubeau, L., Yang, F., Campan, M., … Laird, P. W. (2006). Quantitative analysis of associations between DNA hypermethylation, hypomethylation, and DNMT RNA levels in ovarian tumors. Oncogene, (18) 2636–2645. Ernst, J., Kheradpour, P., Mikkelsen, T. S., Shoresh, N., Ward, L. D., Epstein, C. B., … Bernstein, B. E. (2011). Mapping and analysis of chromatin state dynamics in nine human cell types. Nature, (473) 43–49. Esteller, M. (2011). Non-­‐coding RNAs in human disease. Nature Reviews. Genetics, (12), 861–74. Fairley, T. L., Cardinez, C. J., Martin, J., Alley, L., Friedman, C., Edwards, B., & Jamison, P. (2006). Colorectal cancer in U.S. adults younger than 50 years of age, 1998–2001. Cancer, (107) 1153–1161. Faivre, J., Dancourt, V., Lejeune, C., Tazi, M. a., Lamour, J., Gerard, D., … Bonithon-­‐ Kopp, C. (2004). Reduction in colorectal cancer mortality by fecal occult blood screening in a French controlled study1. Gastroenterology, (126) 1674–1680. Fearon, E. R., & Vogelstein, B. (1990). A genetic model for colorectal tumorigenesis. Cell, (61) 759–767. Fedirko, V., Tramacere, I., Bagnardi, V., Rota, M., Scotti, L., Islami, F., … Jenab, M. (2011). Alcohol drinking and colorectal cancer risk: an overall and dose-­‐ response meta-­‐analysis of published studies. Annals of Oncology : Official Journal of the European Society for Medical Oncology, (22) 1958–1972. Feinberg, A. P., & Vogelstein, B. (1983). Hypomethylation distinguishes genes of some human cancers from their normal counterparts. Nature, (301) 89–92. Ferrari, K. J., Scelfo, A., Jammula, S., Cuomo, A., Barozzi, I., Stützer, A., … Pasini, D. (2014). Polycomb-­‐dependent H3K27me1 and H3K27me2 regulate active transcription and enhancer fidelity. Molecular Cell (53) 49–62. Fidge, N. H., Shiratori, T., Ganguly, J., & Goodman, D. S. (1968). Pathways of absorption of retinal and retinoic acid in the rat. Journal of Lipid Research, (9) 103–109. Fijten, G. H., Starmans, R., Muris, J. W. M., Schouten, H. J. A., Blijham, G. H., & Knottnerus, J. A. (1995). Predictive value of signs and symptoms for colorectal cancer in patients with rectal bleeding in general practice. Family Practice, (12) 279–286. Fraga, M. F., Ballestar, E., Villar-­‐Garea, A., Boix-­‐Chornet, M., Espada, J., Schotta, G., … Esteller, M. (2005). Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nature Genetics, (37) 391–400. Fraser, P., & Bickmore, W. (2007). Nuclear organization of the genome and the potential for gene regulation. Nature, (447) 413–417. Friedl, W., Caspari, R., Sengteller, M., Uhlhaas, S., Lamberti, C., Jungck, M., … Propping, P. (2001). Can APC mutation analysis contribute to therapeutic decisions in familial adenomatous polyposis. Experience from 680 FAP families. Gut , (48) 515–521. Frigola, J., Song, J., Stirzaker, C., Hinshelwood, R. a, Peinado, M. a, & Clark, S. J. (2006). Epigenetic remodeling in colorectal cancer results in coordinate 191 Bibliography gene suppression across an entire chromosome band. Nature Genetics, (38) 540–539. Frommer, M., McDonald, L. E., Millar, D. S., Collis, C. M., Watt, F., Grigg, G. W., … Paul, C. L. (1992). A genomic sequencing protocol that yields a positive display of 5-­‐methylcytosine residues in individual DNA strands. Proceedings of the National Academy of Sciences of the United States of America, (89) 1827–1831. Fu, Z., Shrubsole, M. J., Li, G., Smalley, W. E., Hein, D. W., Cai, Q., … Zheng, W. (2013). Interaction of cigarette smoking and carcinogen-­‐metabolizing polymorphisms in the risk of colorectal polyps. Carcinogenesis, (34) 779– 786. Fujii, Y., Watanabe, K., Hayashi, H., Urade, Y., Kuramitsu, S., Kagamiyama, H., & Hayaishi, O. (1990). Purification and characterization of rho-­‐crystallin from Japanese common bullfrog lens. Journal of Biological Chemistry, (265) 9914– 9923. Fukumoto, S., Yamauchi, N., Moriguchi, H., Hironaka, M., Ishikawa, Y., Kodama, T., & Nishimura, M. (2005). Overexpression of the Aldo-­‐Keto Reductase Family Protein AKR1B10 Is Highly Correlated with Smokers ’ Non − Small Cell Lung Carcinomas Overexpression of the Aldo-­‐Keto Reductase Family Protein AKR1B10 Is Highly Correlated with Smokers ’ Non – Small Cell Lung. Clinical Cancer Research, (11) 1776–1785. Gabbay, K. (2004). Aldose reductase inhibition in the treatment of diabetic neuropathy: Where are we in 2004? Current Diabetes Reports, (6) 405–408. Galiatsatos, P., & Foulkes, W. (2006). Familial adenomatous polyposis. The American Journal of Gastroenterology, (18) 7–30. Gama-­‐Sosa, M., & Slagel, V. (1983). The 5-­‐methylcytosine content of DNA from human tumors. Nucleic Acids Research, (19) 6883–6894. Gao, J., Aksoy, B. a., Dogrusoz, U., Dresdner, G., Gross, B., Sumer, S. O., … Schultz, N. (2013). Integrative Analysis of Complex Cancer Genomics and Clinical Profiles Using the cBioPortal. Science Signaling, (269) pl1. Garinis, G. a, Patrinos, G. P., Spanakis, N. E., & Menounos, P. G. (2002). DNA hypermethylation: when tumour suppressor genes go silent. Human Genetics, (111) 115–127. Gaspar, C., Cardoso, J., Franken, P., Molenaar, L., Morreau, H., Möslein, G., … Fodde, R. (2008). Cross-­‐species comparison of human and mouse intestinal polyps reveals conserved mechanisms in adenomatous polyposis coli (APC)-­‐ driven tumorigenesis. The American Journal of Pathology, (172) 1363–1380. Gaudet, F., Hodgson, J. G., Eden, A., Jackson-­‐Grusby, L., Dausman, J., Gray, J. W., … Jaenisch, R. (2003). Induction of tumors in mice by genomic hypomethylation. Science, (300) 489–492. Gentleman, R. C., Carey, V. J., Bates, D. M., Bolstad, B., Dettling, M., Dudoit, S., … Zhang, J. (2004). Bioconductor: open software development for computational biology and bioinformatics. Genome Biology, (5) R80. Gervin, K., Hammero, M., Akselsen, H. E., Moe, R., Nygard, H., Brandt, I., … Lyle, R. (2011). Extensive variation and low heritability of DNA methylation identified in a twin study. Genome Research, (11) 1813–1821. Gibbs, J., Kohl, N., Koblan, K., Omer, C., Sepp-­‐Lorenzino, L., Rosen, N., … Oliff, A. (1996). Farnesyltransferase inhibitors and anti-­‐Ras therapy. Breast Cancer Research and Treatment, (38) 75–83. 192 Bibliography Giovannucci, E. (2001). An Updated Review of the Epidemiological Evidence that Cigarette Smoking Increases Risk of Colorectal Cancer. Cancer Epidemiology, Biomarkers & Prevention, (7) 725–731. Globisch, D., Münzel, M., Müller, M., Michalakis, S., Wagner, M., Koch, S., … Carell, T. (2010). Tissue Distribution of 5-­‐Hydroxymethylcytosine and Search for Active Demethylation Intermediates. PLoS ONE, (12) e15367. Grady, W. M., Parkin, R. K., Mitchell, P. S., Lee, J. H., Kim, Y.-­‐H., Tsuchiya, K. D., … Tewari, M. (2008). Epigenetic silencing of the intronic microRNA hsa-­‐miR-­‐ 342 and its host gene EVL in colorectal cancer. Oncogene, (27) 3880–3888. Greer, E. L., & Shi, Y. (2012). Histone methylation: a dynamic mark in health, disease and inheritance. Nature Reviews Genetics, (13) 343-­‐357. Grölund, M.-­‐M., Lehtonen, O.-­‐P., Eerola, E., & Kero, P. (1999). Fecal microflora in healthy infants born by different methods of delivery: permanent changes in intestinal flora after cesarean delivery. Journal of Pediatric Gastroenterology and Nutrition, (28) 19-­‐25. Grunau, C., Clark, S. J., & Rosenthal, A. (2001). Bisulfite genomic sequencing: systematic investigation of critical experimental parameters. Nucleic Acids Research, (29) E65–5. Guarner, F., & Malagelada, J.-­‐R. (2003). Gut flora in health and disease. Lancet, (361) 512–519. Guo, J. U., Su, Y., Zhong, C., Ming, G., & Song, H. (2011, April 29). Hydroxylation of 5-­‐methylcytosine by TET1 promotes active DNA demethylation in the adult brain. Cell, (145) 423-­‐434. Haggar, F., & Boushey, R. (2009). Colorectal cancer epidemiology: incidence, mortality, survival, and risk factors. Clinics in Colon and Rectal Surgery, (212) 191–197. Halpern, A. C., Schuchter, L. M., Elder, D. E., Guerry, D., Elenitsas, R., Trock, B., & Matozzo, I. (1994). Effects of topical tretinoin on dysplastic nevi. Journal of Clinical Oncology , (5) 1028–1035. Hanahan, D., & Weinberg, R. a. (2011). Hallmarks of cancer: the next generation. Cell, (144) 646–674. Hanahan, D., & Weinberg, R. A. (2000). The Hallmarks of Cancer. Cell, (100) 57– 70. Hardin, J., & Mydlarski, P. R. (2010). Systemic retinoids: chemoprevention of skin cancer in transplant recipients. Skin Therapy Letter, (15) 1–4. Harisiadis, L., Miller, R. C., Hall, E. J., & Borek, C. (1978). A vitamin A analogue inhibits radiation-­‐induced oncogenic transformation. Nature, (274) 486– 487. Harrow, J., Nagy, A., Reymond, A., Alioto, T., Patthy, L., Antonarakis, S. E., & Guigó, R. (2009). Identifying protein-­‐coding genes in genomic sequences. Genome Biology, (10) 201. Hayashi, K., Yokozaki, H., Goodison, S., Oue, N., Suzuki, T., Lotan, R., … Tahara, E. (2001). Inactivation of retinoic acid receptor beta by promoter CpG hypermethylation in gastric cancer. Differentiation; Research in Biological Diversity, (68) 13–21. He, J., & Efron, J. E. (2011). Screening for Colorectal Cancer. Advances in Surgery. Mosby Year Book. 193 Bibliography He, Y.-­‐F., Li, B.-­‐Z., Li, Z., Liu, P., Wang, Y., Tang, Q., … Xu, G.-­‐L. (2011). Tet-­‐mediated formation of 5-­‐carboxylcytosine and its excision by TDG in mammalian DNA. Science , (333) 1303–1307. Heibein, A. D., Guo, B., Sprowl, J. a, Maclean, D. a, & Parissenti, A. M. (2012). Role of aldo-­‐keto reductases and other doxorubicin pharmacokinetic genes in doxorubicin resistance, DNA binding, and subcellular localization. BMC Cancer, (12) 381. Hellebrekers, D. M. E. I., Lentjes, M. H. F. M., van den Bosch, S. M., Melotte, V., Wouters, K. a D., Daenen, K. L. J., … van Engeland, M. (2009). GATA4 and GATA5 are potential tumor suppressors and biomarkers in colorectal cancer. Clinical Cancer Research : An Official Journal of the American Association for Cancer Research, (15) 3990–3997. Henikoff, S., & Shilatifard, A. (2011). Histone modification: cause or cog? Trends in Genetics, (27) 389–396. Herbst, A., & Kolligs, F. T. (2012). Detection of DNA hypermethylation in remote media of patients with colorectal cancer: new biomarkers for colorectal carcinoma. Tumour Biology : The Journal of the International Society for Oncodevelopmental Biology and Medicine, (33) 297–305. Heringlake, S., Hofdmann, M., Fiebeler, A., Manns, M. P., Schmiegel, W., & Tannapfel, A. (2010). Identification and expression analysis of the aldo– ketoreductase1-­‐B10 gene in primary malignant liver tumours. Journal of Hepatology, (2) 220-­‐227. Hiraoka, S., Kato, J., Horii, J., Saito, S., Harada, K., Fujita, H., … Yamamoto, K. (2010, January 1). Methylation status of normal background mucosa is correlated with occurrence and development of neoplasia in the distal colon. Human Pathology, (1) 38-­‐47. Hol, L., van Leerdam, M. E., van Ballegooijen, M., van Vuuren, A. J., van Dekken, H., Reijerink, J. C. I. Y., … Kuipers, E. J. (2010). Screening for colorectal cancer: randomised trial comparing guaiac-­‐based and immunochemical faecal occult blood testing and flexible sigmoidoscopy. Gut, (59) 62–68. Holliday, R., & Pugh, J. E. (1975). DNA modification mechanisms and gene activity during development. Science, (187) 226–232. Hong, L., & Ahuja, N. (2013). DNA methylation biomarkers of stool and blood for early detection of colon cancer. Genetic Testing and Molecular Biomarkers, (17) 401–406. Hong, W. K., Endicott, J., Itri, L. M., Doos, W., Batsakis, J. G., Bell, R., … Strong, S. (1986). 13-­‐cis-­‐Retinoic Acid in the Treatment of Oral Leukoplakia. New England Journal of Medicine, (24) 1501–1505. Hong, W. K. I., Lippman, S. M., Itri, L. M., Karp, D. D., Lee, J. S., Byers, R. M., … Goepfert, H. (1990). Prevention of Second Primary Tumors with Isotretinoin in Squamous-­‐Cell Carcinoma of the Head and Neck. New England Journal of Medicine, (323) 795–801. Hotchkiss, R. (1948). The quantitative separation of purines, pyrimidiines, and nucleosides by paper chromatography. Journal of Biological Chemistry, (175) 315-­‐332. Hu, H., Krasinskas, A., & Willis, J. (2011). Perspectives on current tumor-­‐node-­‐ metastasis (TNM) staging of cancers of the colon and rectum. Seminars in Oncology, (38) 500–510. 194 Bibliography Huang, D. W., Sherman, B. T., & Lempicki, R. a. (2009). Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Research, (37) 1–13. Huang, D. W., Sherman, B. T., & Lempicki, R. A. (2008). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols, (4) 44–57. Huxley, R. R., Woodward, M., & Clifton, P. (2012). The Epidemiologic Evidence and Potential Biological Mechanisms for a Protective Effect of Dietary Fiber on the Risk of Colorectal Cancer. Current Nutrition Reports, (2) 63–70. Hyndman, D. J., & Flynn, T. G. (1998). Sequence and expression levels in human tissues of a new member of the aldo-­‐keto reductase family. Biochimica et Biophysica Acta (BBA) -­ Gene Structure and Expression (2–3), 198–202. Iida, N., Dzutsev, A., Stewart, C. a., Smith, L., Bouladoux, N., Weingarten, R. a., … Goldszmid, R. S. (2013). Commensal Bacteria Control Cancer Response to Therapy by Modulating the Tumor Microenvironment. Science, (342) 967– 970. Imperiale, T. F., Ransohoff, D. F., Itzkowitz, S. H., Turnbull, B. A., & Ross, M. E. (2004). Fecal DNA versus fecal occult blood for colorectal-­‐cancer screening in an average-­‐risk population. New England Journal of Medicine, (26) 2704– 2714. Innocenti, F., Undevia, S. D., Ramirez, J., Mani, S., Schilsky, R. L., Vogelzang, N. J., … Ratain, M. J. (2004). A phase I trial of pharmacologic modulation of irinotecan with cyclosporine and phenobarbital. Clin Pharmacol Ther, (76) 490–502. Irizarry, R. A., Ladd-­‐acosta, C., Carvalho, B., Wu, H., Brandenburg, S. A., Jeddeloh, J. A., … Feinberg, A. P. (2008). Comprehensive high-­‐throughput arrays for relative methylation (CHAR). Genome research, (18) 780–790. Issa, J.-­‐P. J., & Ahuja, N. (2000). Aging , methylation and cancer. Histology and Histopathology, (15) 835–842. Issa, J.-­‐P. J., Vertino, P. M., Wu, J., Sazawal, S., Celano, P., Nelkin, B. D., … Baylin, S. B. (1993). Increased Cytosine DNA-­‐Methyltransferase Activity During Colon Cancer Progression. Journal of the National Cancer Institute, (15) 1235– 1240. Ito, S., Shen, L., Dai, Q., Wu, S. C., Collins, L. B., Swenberg, J. A., … Zhang, Y. (2011). Tet Proteins Can Convert 5-­‐Methylcytosine to 5-­‐Formylcytosine and 5-­‐ Carboxylcytosine. Science , (333) 1300–1303. Iyer, L. M., Tahiliani, M., Rao, A., & Aravind, L. (2009). Prediction of novel families of enzymes involved in oxidative and other complex modifications of bases in nucleic acids. Cell Cycle, (11) 1698–1710. Jin, S.-­‐G., Cai Guo,& Pfeifer G.P. (2008). GADD45A does not promote DNA demethylation. PLoS Genetics, (3) p1. Jin, Y., & Penning, T. M. (2007). Aldo-­‐keto reductases and bioactivation/detoxication. Annual Review of Pharmacology and Toxicology, (47) 263–292. Johnson, I. T., & Lund, E. K. (2007). Review article: nutrition, obesity and colorectal cancer. Alimentary Pharmacology & Therapeutics, (26) 161–181. Jones, P. A. (1999). The DNA methylation paradox. Trends in Genetics, (15) 34–37. Jorissen, R. N., Gibbs, P., Christie, M., Prakash, S., Lipton, L., Desai, J., … Sieber, O. M. (2009). Metastasis-­‐Associated Gene Expression Changes Predict Poor 195 Bibliography Outcomes in Patients with Dukes Stage B and C Colorectal Cancer. Clinical Cancer Research : An Official Journal of the American Association for Cancer Research, (24) 7642–7651. Kaaij, L. T., van de Wetering, M., Fang, F., Decato, B., Molaro, A., van de Werken, H. J., … Ketting, R. F. (2013). DNA methylation dynamics during intestinal stem cell differentiation reveals enhancers driving gene expression in the villus. Genome Biology, (14) R50. Kamakaka, R. T., & Biggins, S. (2005). Histone variants: deviants? Genes & Development, (19) 295–310. Kang, M.-­‐W., Lee, E.-­‐S., Yoon, S. Y., Jo, J., Lee, J., Kim, H. K., … Kim, H. (2011). AKR1B10 is associated with smoking and smoking-­‐related non-­‐small-­‐cell lung cancer. The Journal of International Medical Research, (39) 78–85. Kelly, V., Sherratt, P., Crouch, D., & Hayes, J. (2002). Novel homodimeric and heterodimeric rat γ-­‐hydroxybutyrate synthases that associate with the Golgi apparatus define a distinct subclass of aldo-­‐keto reductase 7. Biochem. J., (366) 847-­‐861. Kennison, J. a. (1995). The Polycomb and trithorax group proteins of Drosophila: trans-­‐regulators of homeotic gene function. Annual Review of Genetics, (29) 289–303. Kershaw, E. E., & Flier, J. S. (2004). Adipose Tissue as an Endocrine Organ. The Journal of Clinical Endocrinology & Metabolism, (89) 2548–2556. Khare, S., & Verma, M. (2012). Cancer Epigenetics, (863) 177–185. Kim, H., Lapointe, J., Kaygusuz, G., Ong, D. E., Li, C., van de Rijn, M., … Pollack, J. R. (2005). The retinoic acid synthesis gene ALDH1a2 is a candidate tumor suppressor in prostate cancer. Cancer Research, (65) 8118–8124. Kim, M. S., Louwagie, J., Carvalho, B., Terhaar Sive Droste, J. S., Park, H. L., Chae, Y. K., … Sidransky, D. (2009). Promoter DNA methylation of oncostatin m receptor-­‐beta as a novel diagnostic and therapeutic marker in colon cancer. PloS One, (8) e6555. Kim, T.-­‐K., Hemberg, M., Gray, J. M., Costa, A. M., Bear, D. M., Wu, J., … Greenberg, M. E. (2010). Widespread transcription at neuronal activity-­‐regulated enhancers. Nature, (465) 182–187. Kim, Y.-­‐H., Petko, Z., Dzieciatkowski, S., Lin, L., Ghiassi, M., Stain, S., … Grady, W. M. (2006). CpG island methylation of genes accumulates during the adenoma progression step of the multistep pathogenesis of colorectal cancer. Genes, Chromosomes and Cancer, (45) 781–789. Kinzler, K. W., & Vogelstein, B. (1996). Lessons from hereditary colorectal cancer. Cell, (87) 159–170. Ko, C.-­‐Y., Hsu, H.-­‐C., Shen, M.-­‐R., Chang, W.-­‐C., & Wang, J.-­‐M. (2008). Epigenetic silencing of CCAAT/enhancer-­‐binding protein delta activity by YY1/polycomb group/DNA methyltransferase complex. The Journal of Biological Chemistry, (283) 30919–30932. Ko, M., Huang, Y., Jankowska, A. M., Pape, U. J., Tahiliani, M., Bandukwala, H. S., … Rao, A. (2010). Impaired hydroxylation of 5-­‐methylcytosine in myeloid cancers with mutant TET2. Nature, (468) 839–843. Kohli, R. M., & Zhang, Y. (2013). TET enzymes, TDG and the dynamics of DNA demethylation. Nature, (502) 472–479. Kota, S. K., & Feil, R. (2010). Epigenetic transitions in germ cell development and meiosis. Developmental Cell, (19) 675–86. 196 Bibliography Kouzarides, T. (2007). Chromatin modifications and their function. Cell (128) 693–705. Kozma, E., Brown, E., Ellis, E. M., & Lapthorn, A. J. (2002). The Crystal Structure of Rat Liver AKR7A1: a dimeric member of the aldo-­‐keto reductase superfamily. Journal of Biological Chemistry , (18) 16285–16293. Kriaucionis, S., & Heintz, N. (2009). The Nuclear DNA Base 5-­‐ Hydroxymethylcytosine Is Present in Purkinje Neurons and the Brain. Science, (324) 929–930. Krol, J., Loedige, I., & Filipowicz, W. (2010). The widespread regulation of microRNA biogenesis, function and decay. Nature Reviews. Genetics, (11) 597–610. Kucherlapati, R., & Wheeler, D. A. (2012). Comprehensive molecular characterization of human colon and rectal cancer. Nature (487) 330–337. Kurie, J. M., Lee, J. S., Khuri, F. R., Mao, L., Morice, R. C., Lee, J. J., … Hong, W. K. (2000). N-­‐(4-­‐Hydroxyphenyl) Retinamide in the Chemoprevention of Squamous Metaplasia and Dysplasia of the Bronchial Epithelium, (8) 2973– 2979. Laffin, B., & Petrash, J. M. (2012). Expression of the Aldo-­‐Ketoreductases AKR1B1 and AKR1B10 in Human Cancers. Frontiers in Pharmacology, (3) 104. Laird, P. W. (2010). Principles and challenges of genomewide DNA methylation analysis. Nature Reviews. Genetics, (11) 191–203. Laird, P. W., Jackson-­‐Grusby, L., Fazeli, A., Dickinson, S. L., Edward Jung, W., Li, E., … Jaenisch, R. (1995). Suppression of intestinal neoplasia by DNA hypomethylation. Cell, (81) 197-­‐205. Lao, V. V., & Grady, W. M. (2011). Epigenetics and colorectal cancer. Nature Reviews. Gastroenterology & Hepatology, (12) 686–700. Lasnitzki, I. (1955). The influence of A hypervitaminosis on the effect of 20-­‐ methylcholanthrene on mouse prostate glands grown in vitro. British Journal of Cancer, (3) 434–41. Law, J. a, & Jacobsen, S. E. (2010). Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nature Reviews. Genetics, (3) 204–220. Lee, J. T. (2012). Epigenetic Regulation by Long Noncoding RNAs. Science, (338) 1435–1439. Li, E., Bestor, T. H., & Jaenisch, R. (1992). Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell, (69) 915-­‐926 Lim, D. H. K., & Maher, E. R. (2010). Genomic Imprinting Syndromes and Cancer. Advances in Genetics, (70) 145–175. Limketkai, B. N., Lam-­‐Himlin, D., Arnold, M. a, & Arnold, C. a. (2013). The cutting edge of serrated polyps: a practical guide to approaching and managing serrated colon polyps. Gastrointestinal Endoscopy, (77) 360–375. Lister, R., & Ecker, J. R. (2009). Finding the fifth base: genome-­‐wide sequencing of cytosine methylation. Genome Research, (19) 959–66. Lister, R., Mukamel, E. a, Nery, J. R., Urich, M., Puddifoot, C. a, Johnson, N. D., … Ecker, J. R. (2013). Global epigenomic reconfiguration during mammalian brain development. Science, (341). Loeffler-­‐Ragg, J., Mueller, D., Gamerith, G., Auer, T., Skvortsov, S., Sarg, B., … Zwierzina, H. (2009). Proteomic identification of aldo-­‐keto reductase AKR1B10 induction after treatment of colorectal cancer cells with the 197 Bibliography proteasome inhibitor bortezomib. Molecular Cancer Therapeutics, (7) 1995– 2006. López-­‐Abente, G., Ardanaz, E., Torrella-­‐Ramos, a, Mateos, a, Delgado-­‐Sanz, C., & Chirlaque, M. D. (2010). Changes in colorectal cancer incidence and mortality trends in Spain. Annals of Oncology : Official Journal of the European Society for Medical Oncology, (21) iii76–82. Luger, K. (2006). Dynamic nucleosomes. Chromosome Research, (14) 5–16. Lynch, H. T., Lynch, P. M., Lanspa, S. J., Snyder, C. L., Lynch, J. F., & Boland, C. R. (2009). Review of the Lynch syndrome: history, molecular genetics, screening, differential diagnosis, and medicolegal ramifications. Clinical Genetics, (76) 1–18. Ma, J., & Cao, D. (2011). Human aldo-­‐keto reductases: structure, substrate specificity and roles in tumorigenesis. BioMolecular Concepts, (2) 115–126. Ma, J., Luo, D.-­‐X., Huang, C., Shen, Y., Bu, Y., Markwell, S., … Cao, D. (2012). AKR1B10 overexpression in breast cancer: association with tumor size, lymph node metastasis and patient survival and its potential as a novel serum marker. International Journal of Cancer. Journal International Du Cancer, (6). Majumdar, S. R., Fletcher, R. H., & Evans, A. T. (1999). How does colorectal cancer present[quest] symptoms, duration, and clues to location. Am J Gastroenterol, (10) 3039–3045. Mali, P., Yang, L., Esvelt, K., Aach, J., & Guell, M. (2013). RNA-­‐guided human genome engineering via Cas9. Science, (339) 823–826. Mann, I. K., Chatterjee, R., Zhao, J., He, X., Weirauch, M. T., Hughes, T. R., & Vinson, C. (2013). CG methylated microarrays identify a novel methylated sequence bound by the CEBPB|ATF4 heterodimer that is active in vivo. Genome, (23) 988-­‐997. Marcuello, E., Altes, A., Menoyo, A., del Rio, E., Gomez-­‐Pardo, M., & Baiget, M. (2004). UGT1A1 gene variations and irinotecan treatment in patients with metastatic colorectal cancer. Br J Cancer, (91) 678–682. Marx, V. (2012). Epigenetics: Reading the second genomic code. Nature, (491) 143–147. Mayor, R., Casadomé, L., Azuara, D., Moreno, V., Clark, S. J., Capellà, G. & Peinado, M. A. (2009). Long-­‐range epigenetic silencing at 2q14.2 affects most human colorectal cancers and may have application as a non-­‐invasive biomarker of disease. British Journal of Cancer, (100) 1534–1539. Maze, I., Noh, K.-­‐M., Soshnev, A. a., & Allis, C. D. (2014). Every amino acid matters: essential contributions of histone variants to mammalian development and disease. Nature Reviews Genetics, (15) 259-­‐271. McVicker, G., Geijn, B. van de, & Degner, J. (2013). Identification of genetic variants that affect histone modifications in human cells. Science, (342) 747– 749. Meinsma, R., Fernandez-­‐Salguero, P., Van Kuilenburg, a B., Van Gennip, a H., & Gonzalez, F. J. (1995). Human polymorphism in drug metabolism: mutation in the dihydropyrimidine dehydrogenase gene results in exon skipping and thymine uracilurea. DNA and Cell Biology, (14) 1–6. Ménard, S., Camerini, T., Mariani, L., Tomasic, G., Pilotti, S., Costa, A., … Veronesi, U. (2001). Re: Randomized Trial of Fenretinide to Prevent Second Breast 198 Bibliography Malignancy in Women With Early Breast Cancer. Journal of the National Cancer Institute , (93) 240–241. Merlos-­‐Suárez, A., Barriga, F. M., Jung, P., Iglesias, M., Céspedes, M. V., Rossell, D., … Batlle, E. (2011). The intestinal stem cell signature identifies colorectal cancer stem cells and predicts disease relapse. Cell Stem Cell, (8) 511–24. Milicic, A., Harrison, L.-­‐A., Goodlad, R. A., Hardy, R. G., Nicholson, A. M., Presz, M., … Jankowski, J. A. Z. (2008). Ectopic Expression of P-­‐Cadherin Correlates with Promoter Hypomethylation Early in Colorectal Carcinogenesis and Enhanced Intestinal Crypt Fission In vivo. Cancer Research, (68) 7760–7768. Mills, A. a. (2010). Throwing the cancer switch: reciprocal roles of polycomb and trithorax proteins. Nature Reviews. Cancer, (10), 669–82. Minucci, S., & Pelicci, P. G. (2006). Histone deacetylase inhibitors and the promise of epigenetic (and more) treatments for cancer. Nat Rev Cancer, (6) 38–51. Mizuno, H., Kitada, K., Nakai, K., & Sarai, A. (2009). PrognoScan: a new database for meta-­‐analysis of the prognostic value of genes. BMC Medical Genomics, (2) 18. Moise, A. R. (2010). Pharmacology of Retinoid Receptors. Mongan, N. P., & Gudas, L. J. (2007). Diverse actions of retinoid receptors in cancer prevention and treatment. Differentiation; Research in Biological Diversity, (75) 853–70. Muto, Y., Moriwaki, H., Ninomiya, M., Adachi, S., Saito, A., Takasaki, K. T., … Kojima, T. (1996). Prevention of Second Primary Tumors by an Acyclic Retinoid, Polyprenoic Acid, in Patients with Hepatocellular Carcinoma. New England Journal of Medicine, (334) 1561–1568. Nagano, T., Lubling, Y., Stevens, T. J., Schoenfelder, S., Yaffe, E., Dean, W., … Fraser, P. (2013). Single-­‐cell Hi-­‐C reveals cell-­‐to-­‐cell variability in chromosome structure. Nature, (502) 59–64. Nagaraj, N. S., Beckers, S., Mensah, J. K., Waigel, S., Vigneswaran, N., & Zacharias, W. (2006). Cigarette smoke condensate induces cytochromes P450 and aldo-­‐keto reductases in oral cancer cells. Toxicology Letters, (165) 182–194. Nagasaka, T., Tanaka, N., Cullings, H. M., Sun, D.-­‐S., Sasamoto, H., Uchida, T., … Goel, A. (2009). Analysis of fecal DNA methylation to detect gastrointestinal neoplasia. Journal of the National Cancer Institute, (101) 1244–1258. Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., … Trono, D. (1996). In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science, (272) 263–267. Narayan, G., Arias-­‐Pulido, H., & Koul, S. (2003). Frequent promoter methylation of CDH1, DAPK, RARB, and HIC1 genes in carcinoma of cervix uteri: its relationship to clinical outcome. Molecular Cancer, (12) 1–12. Nephew, K. P., & Huang, T. H.-­‐M. (2003). Epigenetic gene silencing in cancer initiation and progression. Cancer Letters, (190) 125–133. Newton, K. F., Newman, W., & Hill, J. (2012). Review of biomarkers in colorectal cancer. Colorectal Disease : The Official Journal of the Association of Coloproctology of Great Britain and Ireland, (14) 3–17. Niles, R. M. (2004). Signaling pathways in retinoid chemoprevention and treatment of cancer. Mutation Research, (555) 81–96. Nishinaka, T., & Yabe-­‐Nishimura, C. (2005). Transcription factor Nrf2 regulates promoter activity of mouse aldose reductase (AKR1B3) gene. Journal of Pharmacological Sciences, (51) 43–51. 199 Bibliography Nosho, K., Shima, K., Irahara, N., Kure, S., Baba, Y., Kirkner, G. J., … Ogino, S. (2009). DNMT3B Expression Might Contribute to CpG Island Methylator Phenotype in Colorectal Cancer. Clinical Cancer Research , (15) 3663–3671. Novak, P., Jensen, T. J., Garbe, J. C., Stampfer, M. R., & Futscher, B. W. (2009). Stepwise DNA methylation changes are linked to escape from defined proliferation barriers and mammary epithelial cell immortalization. Cancer Research, (69) 5251–5258. O’Keefe, S. J. D., Kidd, M., Espitalier-­‐Noel, G., & Owira, P. (1999). Rarity of colon cancer in Africans is associated with low animal product consumption, not fiber. Am J Gastroenterol, (94) 1373–1380. Ohashi, T., Idogawa, M., Sasaki, Y., Suzuki, H., & Tokino, T. (2013). AKR1B10, a transcriptional target of p53, is Downregulated in Colorectal Cancers associated with poor prognosis. Molecular Cancer Research, (11) 1554-­‐1563. Okano, M., Bell, D. W., Haber, D. A., & Li, E. (1999). DNA Methyltransferases Dnmt3a and Dnmt3b Are Essential for De Novo Methylation and Mammalian Development. Cell, (99) 247-­‐257. Okudela, K., Woo, T., Mitsui, H., Suzuki, T., Tajiri, M., Sakuma, Y., … Ohashi, K. (2013). Downregulation of ALDH1A1 expression in non-­‐small cell lung carcinomas-­‐-­‐its clinicopathologic and biological significance. International Journal of Clinical and Experimental Pathology, (6) 1–12. Olek, A., & Walter, J. (1997). The pre-­‐implantation ontogeny of the H19 methylation imprint. Nature Genetics, (17) 275-­‐276. Ong, C.-­‐T., & Corces, V. G. (2014). CTCF: an architectural protein bridging genome topology and function. Nature Reviews Genetics, (15) 234–246. Osanai, M., Sawada, N., & Lee, G.-­‐H. (2010). Oncogenic and cell survival properties of the retinoic acid metabolizing enzyme, CYP26A1. Oncogene, (29) 1135–1144. Oshima, M., Dinchuk, J. E., Kargman, S. L., Oshima, H., Hancock, B., Kwong, E., … Taketo, M. M. (1996). Suppression of intestinal polyposis in Apc delta716 knockout mice by inhibition of cyclooxygenase 2 (COX-­‐2). Cell, (87) 803– 809. Ozdağ, H., Teschendorff, A. E., Ahmed, A. A., Hyland, S. J., Blenkiron, C., Bobrow, L., … Caldas, C. (2006). Differential expression of selected histone modifier genes in human solid cancers. BMC Genomics, (7). Park, E. Y., Dillard, A., Williams, E. a, Wilder, E. T., Pepper, M. R., & Lane, M. a. (2005). Retinol inhibits the growth of all-­‐trans-­‐retinoic acid-­‐sensitive and all-­‐trans-­‐retinoic acid-­‐resistant colon cancer cells through a retinoic acid receptor-­‐independent mechanism. Cancer Research, (65) 9923–9933. Park, E. Y., Wilder, E. T., Chipuk, J. E., & Lane, M. a. (2008). Retinol decreases phosphatidylinositol 3-­‐kinase activity in colon cancer cells. Molecular Carcinogenesis, (47) 264–274. Pastel, E., Pointud, J.-­‐C., Volat, F., Martinez, A., & Lefrançois-­‐Martinez, A.-­‐M. (2012). Aldo-­‐Keto Reductases 1B in Endocrinology and Metabolism. Frontiers in Pharmacology, (3) 148. Pastor, W. a, Aravind, L., & Rao, A. (2013). TETonic shift: biological roles of TET proteins in DNA demethylation and transcription. Nature Reviews. Molecular Cell Biology, (14) 341–356. 200 Bibliography Pastorino, U., Infante, M., Maioli, M., Chiesa, G., Buyse, M., Firket, P., … Valente, M. (1993). Adjuvant treatment of stage I lung cancer with high-­‐dose vitamin A. Journal of Clinical Oncology , (11) 1216–1222. Pennacchio, L. a., Bickmore, W., Dean, A., Nobrega, M. a., & Bejerano, G. (2013). Enhancers: five essential questions. Nature Reviews Genetics, (14) 288–295. Penning, T. M., & Drury, J. E. (2007). Human aldo-­‐keto reductases: Function, gene regulation, and single nucleotide polymorphisms. Archives of Biochemistry and Biophysics, (464) 241–250. Pennisi, E. (2011). Does a Gene’s Location in the Nucleus Matter? Science, (334) 1050–1051. Pennisi, E. (2013). The CRISPR craze. Science, (341) 833–836. Peric-­‐Hupkes, D., Meuleman, W., Pagie, L., Bruggeman, S. W. M., Solovei, I., Brugman, W., … van Steensel, B. (2010). Molecular maps of the reorganization of genome-­‐nuclear lamina interactions during differentiation. Molecular Cell, (38) 603–613. Petitjean, A., Mathe, E., Kato, S., Ishioka, C., Tavtigian, S. V, Hainaut, P., & Olivier, M. (2007). Impact of mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: lessons from recent developments in the IARC TP53 database. Human Mutation, (28) 622–629. Plebuch, M., Soldan, M., Hungerer, C., Koch, L., & Maser, E. (2007). Increased resistance of tumor cells to daunorubicin after transfection of cDNAs coding for anthracycline inactivating enzymes. Cancer Letters, (255) 49–56. Pox, C. (2011). Colon cancer screening: which non-­‐invasive filter tests? Digestive Diseases (29), 56–59. Quinn, A., Harvey, R., & Penning, T. (2008). Oxidation of PAH trans-­‐dihydrodiols by human aldo-­‐keto reductase AKR1B10. Chemical Research in Toxicology, (21) 2207–2215. Ramana, K. V, Bhatnagar, A., Srivastava, S., Yadav, U. C., Awasthi, S., Awasthi, Y. C., & Srivastava, S. K. (2006). Mitogenic Responses of Vascular Smooth Muscle Cells to Lipid Peroxidation-­‐derived Aldehyde 4-­‐Hydroxy-­‐trans-­‐2-­‐nonenal (HNE): Role of aldose reductase-­‐catalized reduction of the HNE-­‐glutathione conjugates in regulation cell growth. Journal of Biological Chemistry , (281) 17652–17660. Ramana, K. V, Fadl, A. a, Tammali, R., Reddy, A. B. M., Chopra, A. K., & Srivastava, S. K. (2006). Aldose reductase mediates the lipopolysaccharide-­‐induced release of inflammatory mediators in RAW264.7 murine macrophages. The Journal of Biological Chemistry, (281) 33019–33029. Ramírez, N., Bandrés, E., Navarro, A., Pons, A., Jansa, S., Moreno, I., … García-­‐ Foncillas, J. (2008). Epigenetic events in normal colonic mucosa surrounding colorectal cancer lesions. European Journal of Cancer, (26) 2689-­‐2695. Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. a, & Zhang, F. (2013). Genome engineering using the CRISPR-­‐Cas9 system. Nature Protocols, (8) 2281–2308. Rashid, A., Shen, L., Morris, J. S., Issa, J.-­‐P. J., & Hamilton, S. R. (2001). CpG Island Methylation in Colorectal Adenomas. The American Journal of Pathology. American Society for Investigative Pathology. Ravindranath, T. M., Mong, P. Y., Ananthakrishnan, R., Li, Q., Quadri, N., Schmidt, A. M., … Wang, Q. (2009). Novel role for aldose reductase in mediating acute 201 Bibliography inflammatory responses in the lung. Journal of Immunology, (183) 8128– 8137. Reik, W. (2007). Stability and flexibility of epigenetic gene regulation in mammalian development. Nature, (447) 425–432. Renehan, A. G., O’Connell, J., O’Halloran, D., Shanahan, F., Potten, C. S., O’Dwyer, S. T., & Shalet, S. M. (2003). Acromegaly and Colorectal Cancer: A Comprehensive Review of Epidemiology, Biological Mechanisms, and Clinical Implications. Horm Metab Res, (35) 712–725. Rhee, I., Bachman, K. E., Park, B. H., Jair, K.-­‐W., Yen, R.-­‐W. C., Schuebel, K. E., … Vogelstein, B. (2002). DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. Nature, (416) 552–556. Rideout, W. M., Coetzee, G. A., Olumi, A. F., & Jones, P. A. (1990). 5-­‐Methylcytosine as an endogenous mutagen in the human LDL receptor and p53 genes. Science, (249) 1288–1290. Ries, L. A. G., Melbert, D., Krapcho, M., Stinchcomb, D. G., Howlader, N., Horner, M. J., … Edwards, B. K. (2008). SEER cancer statistics review, 1975-­‐2005 . Bethesda, MD : U.S. National Institutes of Health, National Cancer Institute . Riggs, A. (1975). X inactivation, differentiation, and DNA methylation. Cytogenetic and Genome Research, (14) 9-­‐25. Rishi, V., Bhattacharya, P., Chatterjee, R., Rozenberg, J., Zhao, J., Glass, K., … Vinson, C. (2010). CpG methylation of half-­‐CRE sequences creates C/EBPalpha binding sites that activate some tissue-­‐specific genes. Proceedings of the National Academy of Sciences of the United States of America, (107) 20311–20316. Roberts, D. L., Dive, C., & Renehan, A. G. (2010). Biological mechanisms linking obesity and cancer risk: new perspectives. Annual Review of Medicine, (61) 301–316. Rodriguez, J., Muñoz, M., Vives, L., Frangou, C. G., Groudine, M., & Peinado, M. a. (2008). Bivalent domains enforce transcriptional memory of DNA methylated genes in cancer cells. Proceedings of the National Academy of Sciences of the United States of America, (105) 19809–19814. Rodriguez, J., Vives, L., Jordà, M., Morales, C., Muñoz, M., Vendrell, E., & Peinado, M. a. (2008). Genome-­‐wide tracking of unmethylated DNA Alu repeats in normal and cancer cells. Nucleic Acids Research, (36) 770–784. Rodríguez-­‐Paredes, M., & Esteller, M. (2011). Cancer epigenetics reaches mainstream oncology. Nature Medicine, (17) 330–339. Rose, D. P., Komninou, D., & Stephenson, G. D. (2004). Obesity , adipocytokines , and insulin resistance in breast cancer. Obesity Reviews, (7) 153–165. Rougier, N., Bourc’his, D., Gomes, D. M., Niveleau, a., Plachot, M., Paldi, a., & Viegas-­‐Pequignot, E. (1998). Chromosome methylation patterns during mammalian preimplantation development. Genes & Development, (12) 2108–2113. Rouits, E., Boisdron-­‐Celle, M., Dumont, A., Guérin, O., Morel, A., & Gamelin, E. (2004). Relevance of different UGT1A1 polymorphisms in Irinotecan-­‐ induced toxicity a molecular and clinical study of 75 patients. Clinical Cancer Research, (10) 5151–5159. Ruiz, F. X., Gallego, O., Ardèvol, A., Moro, A., Domínguez, M., Alvarez, S., … Farrés, J. (2009). Aldo-­‐keto reductases from the AKR1B subfamily: retinoid specificity 202 Bibliography and control of cellular retinoic acid levels. Chemico-­Biological Interactions, (178) 171–177. Ruiz, F. X., Porté, S., Parés, X., & Farrés, J. (2012). Biological role of aldo-­‐keto reductases in retinoic Acid biosynthesis and signaling. Frontiers in Pharmacology, (3) 58. Russo, V. E. A., Martienssen, R. A., & Riggs, A. D. (1997). Epigenetic Mechanisms of Gene Regulation. Edited. Genetics Research, (69) 159–162. Ruthenburg, A. J., Li, H., Patel, D. J., & Allis, C. D. (2007). Multivalent engagement of chromatin modifications by linked binding modules. Nature Reviews. Molecular Cell Biology, (8) 983–994. Salabei, J. K., Li, X.-­‐P., Petrash, J. M., Bhatnagar, A., & Barski, O. a. (2011). Functional expression of novel human and murine AKR1B genes. Chemico-­ Biological Interactions, (191) 177–184. Salabei, J., Li, X., & Petrash, J. (2011). Functional expression of novel human and murine AKR1B genes. Chemico Biological Interactions, (191) 177–184. Sales, K. J., Maldonado-­‐Pérez, D., Grant, V., Catalano, R. D., Wilson, M. R., Brown, P., … Jabbour, H. N. (2009). Prostaglandin F2α-­‐F-­‐prostanoid receptor regulates CXCL8 expression in endometrial adenocarcinoma cells via the calcium– calcineurin–NFAT pathway. Biochimica et Biophysica Acta (BBA) -­ Molecular Cell Research, (12) 1917–1928. Sandoval, J., & Esteller, M. (2012). Cancer epigenomics: beyond genomics. Current Opinion in Genetics & Development, (22) 50–55. Sanyal, A., Lajoie, B. R., Jain, G., & Dekker, J. (2012). The long-­‐range interaction landscape of gene promoters. Nature, (489) 109–113. Schefe, J. H., Lehmann, K. E., Buschmann, I. R., Unger, T., & Funke-­‐Kaiser, H. (2006). Quantitative real-­‐time RT-­‐PCR data analysis: current concepts and the novel “gene expression’s CT difference” formula. Journal of Molecular Medicine, (84) 901–910. Schmidl, C., Klug, M., Boeld, T. J., Andreesen, R., Hoffmann, P., Edinger, M., & Rehli, M. (2009). Lineage-­‐specific DNA methylation in T cells correlates with histone methylation and enhancer activity. Genome Research, (19) 1165– 1174. Schmidt, W. M., Sedivy, R., Forstner, B., Steger, G. G., Zöchbauer-­‐Müller, S., & Mader, R. M. (2007). Progressive up-­‐regulation of genes encoding DNA methyltransferases in the colorectal adenoma-­‐carcinoma sequence. Molecular Carcinogenesis, (46) 766–772. Schmitz, K. J., Sotiropoulos, G. C., Baba, H. a, Schmid, K. W., Müller, D., Paul, A., … Loeffler-­‐Ragg, J. (2011). AKR1B10 expression is associated with less aggressive hepatocellular carcinoma: a clinicopathological study of 168 cases. Liver International : Official Journal of the International Association for the Study of the Liver, (31) 810–816. Schübeler, D. (2012). Molecular biology. Epigenetic islands in a genetic ocean. Science, (338) 756–757. Schuettengruber, B., Martinez, A.-­‐M., Iovino, N., & Cavalli, G. (2011). Trithorax group proteins: switching genes on and keeping them active. Nature Reviews. Molecular Cell Biology, (12) 799–814. Scott, A. M., Wolchok, J. D., & Old, L. J. (2012). Antibody therapy of cancer. Nature Reviews. Cancer, (12) 278–87. 203 Bibliography Seligson, D. B., Horvath, S., Shi, T., Yu, H., Tze, S., Grunstein, M., & Kurdistani, S. K. (2005). Global histone modification patterns predict risk of prostate cancer recurrence. Nature, (435) 1262–1266. Shaib, W., Mahajan, R., & El-­‐Rayes, B. (2013). Markers of resistance to anti-­‐EGFR therapy in colorectal cancer. Journal of Gastrointestinal Oncology, (4) 308-­‐ 318. Sheikhnejad, G., Brank, a, Christman, J. K., Goddard, a, Alvarez, E., Ford, H., … Cheng, X. (1999). Mechanism of inhibition of DNA (cytosine C5)-­‐ methyltransferases by oligodeoxyribonucleotides containing 5,6-­‐dihydro-­‐5-­‐ azacytosine. Journal of Molecular Biology, (285) 2021–2034. Shen, L., Kondo, Y., Hamilton, S. R., Rashid, A., & Issa, J. J. (2003, March 1). p14 methylation in human colon cancer is associated with microsatellite instability and wild-­‐type p53. Gastroenterology, (124) 626-­‐633. Shen, L., Kondo, Y., Rosner, G. L., Xiao, L., Hernandez, N. S., Vilaythong, J., … Issa, J.-­‐ P. J. (2005). MGMT promoter methylation and field defect in sporadic colorectal cancer. Journal of the National Cancer Institute, (97) 1330–1338. Shlyueva, D., Stampfel, G., & Stark, A. (2014). Transcriptional enhancers: from properties to genome-­‐wide predictions. Nature Reviews Genetics (15), 272– 286. Shukla, S., Kavak, E., Gregory, M., Imashimizu, M., Shutinoski, B., Kashlev, M., … Oberdoerffer, S. (2011). CTCF-­‐promoted RNA polymerase II pausing links DNA methylation to splicing. Nature (479) 74-­‐79. Siegel, R. (2013). Cancer statistics, 2013. … Cancer Journal for Clinicians, (63) 11– 30. Simon, J. (1995). Locking in stable states of gene expression: transcriptional control during Drosophila development. Current Opinion in Cell Biology, (7) 376–385. Simon, J. a, & Kingston, R. E. (2009). Mechanisms of polycomb gene silencing: knowns and unknowns. Nature Reviews. Molecular Cell Biology, (10) 697– 708. Singh, H., Nugent, Z., Demers, A. a, Kliewer, E. V, Mahmud, S. M., & Bernstein, C. N. (2010). The reduction in colorectal cancer mortality after colonoscopy varies by site of the cancer. Gastroenterology, (139) 1128–1137. Skrzypczak, M., Goryca, K., Rubel, T., Paziewska, A., Mikula, M., Jarosz, D., … Ostrowsk, J. (2010). Modeling oncogenic signaling in colon tumors by multidirectional analyses of microarray data directed for maximization of analytical reliability. PloS One, (5). Smith, H. W. (1965). Observations on the flora of the alimentary tract of animals and factors affecting its composition. The Journal of Pathology and Bacteriology, (89) 95–122. Smith, Z. D., & Meissner, A. (2013). DNA methylation: roles in mammalian development. Nature Reviews. Genetics, (14) 204–220. Smyth, G. K., Michaud, J., & Scott, H. S. (2005). Use of within-­‐array replicate spots for assessing differential expression in microarray experiments. Bioinformatics, (21) 2067–2075. Srivastava, S., Spite, M., Trent, J. O., West, M. B., Ahmed, Y., & Bhatnagar, A. (2004). Aldose Reductase-­‐catalyzed Reduction of Aldehyde Phospholipids. Journal of Biological Chemistry , (279) 53395–53406. 204 Bibliography Stadler, M. B., Murr, R., Burger, L., Ivanek, R., Lienert, F., Schöler, A., … Schübeler, D. (2011). DNA-­‐binding factors shape the mouse methylome at distal regulatory regions. Nature (480) 490-­‐495. Staub, E., Groene, J., Heinze, M., Mennerich, D., Roepcke, S., Klaman, I., … Rosenthal, A. (2009). An expression module of WIPF1-­‐coexpressed genes identifies patients with favorable prognosis in three tumor types. Journal of Molecular Medicine (Berlin, Germany), (87) 633–644. Sun, S.-­‐Y., & Lotan, R. (2002). Retinoids and their receptors in cancer development and chemoprevention. Critical Reviews in Oncology/hematology, (41) 41–55. Suzuki, K., Suzuki, I., Leodolter, A., Alonso, S., Horiuchi, S., Yamashita, K., & Perucho, M. (2006). Global DNA demethylation in gastrointestinal cancer is age dependent and precedes genomic damage. Cancer Cell, (9) 199–207. Syngal, S., Stoffel, E., Chung, D., Willett, C., Schoetz, D., Schroy, P., … Ross, M. (2006). Detection of stool DNA mutations before and after treatment of colorectal neoplasia. Cancer, (106) 277–283. Szwagierczak, A., Bultmann, S., Schmidt, C. S., Spada, F., & Leonhardt, H. (2010). Sensitive enzymatic quantification of 5-­‐hydroxymethylcytosine in genomic DNA. Nucleic Acids Research, (38) e181. Tagore, K. S., Lawson, M. J., Yucaitis, J. A., Gage, R., Orr, T., Shuber, A. P., & Ross, M. E. (2003). Sensitivity and Specificity of a Stool DNA Multitarget Assay Panel for the Detection of Advanced Colorectal Neoplasia. Clinical Colorectal Cancer, (3) 47–53. Tahiliani, M., Koh, K. P., Shen, Y., Pastor, W. A., Bandukwala, H., Brudno, Y., … Rao, A. (2009). Conversion of 5-­‐Methylcytosine to 5-­‐Hydroxymethylcytosine in Mammalian DNA by MLL Partner TET1. Science, (324) 930–935. Talbert, P. B., & Henikoff, S. (2010). Histone variants-­‐-­‐ancient wrap artists of the epigenome. Nature Reviews. Molecular Cell Biology, (11) 264–275. Tammali, R., Ramana, K. V, Singhal, S. S., Awasthi, S., & Srivastava, S. K. (2006). Aldose Reductase Regulates Growth Factor-­‐Induced Cyclooxygenase-­‐2 Expression and Prostaglandin E2 Production in Human Colon Cancer Cells. Cancer Research , (66) 9705–9713. Tammali, R., Srivastava, S. K., & Ramana, K. V. (2011). Targeting aldose reductase for the treatment of cancer. Current Cancer Drug Targets, (11) 560–571. Tan, M., Luo, H., Lee, S., Jin, F., Yang, J. S., Montellier, E., … Zhao, Y. (2011). Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. Cell, (146) 1016–1028. Tang, X.-­‐H., & Gudas, L. J. (2011). Retinoids, retinoic acid receptors, and cancer. Annual Review of Pathology, (6) 345–364. Theodosiou, M., Laudet, V., & Schubert, M. (2010). From carrot to clinic: an overview of the retinoic acid signaling pathway. Cellular and Molecular Life Sciences, (67) 1423–1445. Thun, M. J., Jacobs, E. J., & Patrono, C. (2012). The role of aspirin in cancer prevention. Nature Reviews. Clinical Oncology, (9) 259–267. Tiscornia, G., Singer, O., & Verma, I. M. (2006). Production and purification of lentiviral vectors. Nature Protocols, (1) 241–245. Tolhuis, B., Palstra, R.-­‐J., Splinter, E., Grosveld, F., & de Laat, W. (2014). Looping and Interaction between Hypersensitive Sites in the Active β-­‐globin Locus. Molecular Cell, (10) 1453–1465. 205 Bibliography Tonus, C., Sellinger, M., Koss, K., & Neupert, G. (2012). Faecal pyruvate kinase isoenzyme type M2 for colorectal cancer screening: a meta-­‐analysis. World Journal of Gastroenterology, (18) 4004–4011. Triantafillidis, J. K., Nasioulas, G., & Kosmidis, P. a. (2009). Colorectal cancer and inflammatory bowel disease: epidemiology, risk factors, mechanisms of carcinogenesis and prevention strategies. Anticancer Research, (29) 2727– 2737. Tropberger, P., & Schneider, R. (2013). Scratching the (lateral) surface of chromatin regulation by histone modifications. Nature Structural & Molecular Biology, (20) 657–661. Tsai, H.-­‐C., & Baylin, S. B. (2011). Cancer epigenetics: linking basic biology to clinical medicine. Cell Research, (21) 502–517. Tsai, M.-­‐C., Manor, O., Wan, Y., Mosammaparast, N., Wang, J. K., Lan, F., … Chang, H. Y. (2010). Long Noncoding RNA as Modular Scaffold of Histone Modification Complexes. Science, (329) 689–693. Tsunoda, S., Smith, E., Young, N. J. D. E., Wang, X., Tian, Z., Liu, J., … Drew, P. A. (2009). TMEFF2 in esophageal squamous cell carcinoma, (21) 1067–1073. Van Engeland, M., Derks, S., Smits, K. M., Meijer, G. A., & Herman, J. G. (2011). Colorectal Cancer Epigenetics: Complex Simplicity. Journal of Clinical Oncology , (29) 1382–1391. Van Steensel, B. (2011). Chromatin: constructing the big picture. The EMBO Journal, (30) 1885–1895. Vanneman, M., & Dranoff, G. (2012). Combining immunotherapy and targeted therapies in cancer treatment. Nature Reviews. Cancer, (12) 237–251. Vermeulen, L., Morrissey, E., van der Heijden, M., Nicholson, a. M., Sottoriva, a., Buczacki, S., … Winton, D. J. (2013). Defining Stem Cell Dynamics in Models of Intestinal Tumor Initiation. Science, (342) 995–998. Viaud, S., Saccheri, F., Mignot, G., Yamazaki, T., Daillere, R., Hannani, D., … Zitvogel, L. (2013). The Intestinal Microbiota Modulates the Anticancer Immune Effects of Cyclophosphamide. Science, (342) 971–976. Vire, E., Brenner, C., Deplus, R., Blanchon, L., Fraga, M., Didelot, C., … Fuks, F. (2006). The Polycomb group protein EZH2 directly controls DNA methylation. Nature, (439) 871–874. Vogelstein, B., Papadopoulos, N., Velculescu, V. E., Zhou, S., Diaz, L. a, & Kinzler, K. W. (2013). Cancer genome landscapes. Science, (339) 1546–1558. Vona-­‐Davis, L., & Rose, D. P. (2007). Adipokines as endocrine, paracrine, and autocrine factors in breast cancer risk and progression. Endocrine-­Related Cancer, (14) 189–206. Wald, N., Idle, M., Boreham, J., & Bailey, A. (1980). Low serum-­‐vitamin-­‐A and subsequent risk of cancer: Preliminary results of a prospective study. The Lancet, (316) 813–815. Walker, J. M., & Trygve O.F. (2004). DNA Methylation. Protocols Epigenetics. Human Press. Wallis, Y. L., Morton, D. G., McKeown, C. M., & Macdonald, F. (1999). Molecular analysis of the APC gene in 205 families: extended genotype-­‐phenotype correlations in FAP and evidence for the role of APC amino acid changes in colorectal cancer predisposition. Journal of Medical Genetics , (36) 14–20. 206 Bibliography Wang, Y., Fang, M. Z., & Liao, J. (2003). Hypermethylation-­‐Associated Inactivation of Retinoic Acid Receptor β in Human Esophageal Squamous Cell Carcinoma, Clinical Cancer Research, (9) 5257–5263. Wei, P.-­‐L., Chang, Y.-­‐J., Ho, Y.-­‐S., Lee, C.-­‐H., Yang, Y.-­‐Y., An, J., & Lin, S.-­‐Y. (2009). Tobacco-­‐specific carcinogen enhances colon cancer cell migration through alpha7-­‐nicotinic acetylcholine receptor. Annals of Surgery, (249) 978–985. Weissman, S., Bellcross, C., Bittner, C., Freivogel, M., Haidle, J., Kaurah, P., … Daniels, M. (2011). Genetic Counseling Considerations in the Evaluation of Families for Lynch Syndrome—A Review. Journal of Genetic Counseling, (20) 5–19. Weng, J., Cao, Y., Moss, N., & Zhou, M. (2006). Modulation of Voltage-­‐dependent Shaker Family Potassium Channels by an Aldo-­‐Keto Reductase. Journal of Biological Chemistry, (281) 15194–15200. Widschwendter, M., Fiegl, H., Egle, D., Mueller-­‐Holzner, E., Spizzo, G., Marth, C., … Laird, P. W. (2007). Epigenetic stem cell signature in cancer. Nature Genetics, (39) 157–158. Winawer, S. J., Zauber, A. G., Gerdes, H., O’Brien, M. J., Gottlieb, L. S., Sternberg, S. S., … Bishop, D. T. (1996). Risk of Colorectal Cancer in the Families of Patients with Adenomatous Polyps. New England Journal of Medicine, (334) 82–87. Woenckhaus, M., Klein-­‐Hitpass, L., Grepmeier, U., Merk, J., Pfeifer, M., Wild, P. J., … Dietmaier, W. (2006). Smoking and cancer-­‐related gene expression in bronchial epithelium and non-­‐small-­‐cell lung cancers. The Journal of Pathology, (210) 192–204. Wolbach, S., & Howe, P. (1925). Tissue changes following deprivation of fat-­‐ soluble A vitamin. The Journal of Experimental Medicine (42) 753-­‐777. Wollowski, I., Rechkemmer, G., & Pool-­‐zobel, B. L. (2001). Protective role of probiotics and prebiotics in colon cancer. The American Journal of Clinical Nutrition, (73) 451S-­‐455S. Wu, S. C., & Zhang, Y. (2010). Active DNA demethylation: many roads lead to Rome. Nature Reviews. Molecular Cell Biology, (11) 607–20. Wutz, A. (2011). Gene silencing in X-­‐chromosome inactivation: advances in understanding facultative heterochromatin formation. Nat Rev Genet, (12) 542–553. Yadav, U. C. S., Ramana, K. V, Aguilera-­‐Aguirre, L., Boldogh, I., Boulares, H. a, & Srivastava, S. K. (2009). Inhibition of aldose reductase prevents experimental allergic airway inflammation in mice. PloS One, (4) e6535. Yao, H.-­‐B., Xu, Y., Chen, L.-­‐G., Guan, T.-­‐P., Ma, Y.-­‐Y., He, X.-­‐J., … Shao, Q.-­‐S. (2013). AKR1B10, a good prognostic indicator in gastric cancer. European Journal of Surgical Oncology, (40) 318-­‐324. Young, L., Sung, J., Stacey, G., & Masters, J. R. (2010). Detection of Mycoplasma in cell cultures. Nature Protocols, (5) 929–934. Yu, M., Hon, G. C., Szulwach, K. E., Song, C.-­‐X., Zhang, L., Kim, A., … He, C. (2012). Base-­‐resolution analysis of 5-­‐hydroxymethylcytosine in the mammalian genome. Cell, (149) 1368–1380. Zentner, G. E., & Henikoff, S. (2013). Regulation of nucleosome dynamics by histone modifications. Nature Structural & Molecular Biology, (20) 259–66. Zhang, F. L., & Casey, P. J. (1996). Protein Prenylation: Molecular Mechanisms and Functional Consequences. Annual Review of Biochemistry, (65) 241–269. 207 Bibliography 208 Vector Map pCMV-HA-C Catalog No(s). 635690 pCMV-HA-C Vector Information A B CMV promoter 1–602 multiple cloning site 651–715 3× FLAG tag 716–787 internal ribosome entry site 823–1397 hrGFP ORF 1407–2123 SV40 polyA 2188–2571 f1 origin 2709–3015 LoxP sequence 3178–3211 ampicillin resistance (bla) ORF 3256–4113 pUC origin 4260–4927 P CMV pUC ori MCS 3x FLAG IRES pIRES-hrGFP-1a 5.0 kb ampicillin hrGFP LoxP f1 ori SV40 pA pIRES-hrGFP-1a Multiple Cloning Site Region Appendix (sequence shown 651–727) ™ Sac I* ™ Map of pcDNA 3.1/Hygro (+) and pcDNA 3.1/Hygro (–) Vectors Sac II* Not I* Srf I Sma I/Xma I BamH I EcoR I GA GCT CCA CCG CGG TGG CGG CCG CTC TAG CCC GGG CGG ATC CGA ATT C ... STOP* Sph I Sal I Xho I start of FLAG tag ...GC ATG CGT CGA CTC GAG GAC TAC AAG GAT The fi ure below summarizes the features of the pcDNA™3.1/H ro (+) and Map of pcDNA™3.1/Hygro (–) vectors. The complete sequences for pcDNA™3.1/ pcDNA™3.1/Hygro (+) and pcDNA™3.1/Hygro (–) are available for Hygro (+/–) downloading our web site atsite. www.lifetechnologies.com or from pCMV-HA-C vector map andfrom multiple cloning K= !$# K= Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: [email protected] United States/Canada 800.662.2566 Last update: (121511) Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 !"#$N $%#$N &-0$N 560$N 5"4$N !41$N /,1O$N 234P$# /,1O$N /0%C$N &,-7@3$N .-+$N )*+F$NNN &'($NN $%#$N !"# !"#$N $%#$N &'($NN )*+F$NNN &,-7@3$N .-+$N /0%C$N /,1O$N 234P$# /,1O$N !41$N 5"4$N 560$N &-0$N $%#$N Technical Support (see page 13). To create a fusion of your protein of interest and the HA tag, insert your gene of interest in-frame with the HA coding sequence. C Japan D +81.(0)77.543.6116 !C IJ4 +/ B )2 Page 1 of 2 "* @ *@ 456*"# 5,@ FG " % ED / # + @ , @? ? @ !"#$%&'()*+,-. /'0123 % AA b u nA ) tys o I n d-­ it c BnI | a| +/ e E !"#$%&'(')*&+$,-.*.$/012345 67$%&'(')*&8%&9(9:;$.9)*+$,-.*.$345233/ +H ! "<=)9%=*$>=':9:;$.9)*+$,-.*.$31?2@0@0 ABC$&*D*&.*$%&9(9:;$.9)*+$,-.*.$@0//2@051 ABC$%'=E-F*:E=-)9':$.9;:-=+$,-.*.$@0/@2@/5? G@$'&9;9:+$,-.*.$@/132@7@@ H#I0$%&'(')*&$-:F$'&9;9:+$,-.*.$@7742/@00 CE;&'(E>9:$&*.9.)-:>*$;*:*+$,-.*.$/@@325@I@ H#I0$*-&=E$%'=E-F*:E=-)9':$.9;:-=+$,-.*.$5@?I25?/4 %J!$'&9;9:+$,-.*.$57342II?4$K>'(%=*(*:)-&E$.)&-:FL M(%9>9==9:$&*.9.)-:>*$;*:*+$,-.*.$I40@2?I4@$K>'(%=*(*:)-&E$.)&-:FL G DF Comments for pcDNA™3.1/Hygro (+): !"##$%&'()"*(+,-./0123456*"(789: 5597 nucleotides ((((;;<=(%>,?$"&@A$' A B | | Ba ov i e r N ie r I ry A i xee Primer name AKR1B1 CpGi C F1 AKR1B1 CpGi C R1 AKR1B1 CpGi C F2 AKR1B1 CpGi C R2 AKR1B1 CpG A F1 AKR1B1 CpG A R unique AKR1B1 CpG A F2 AKR1B1 CpGi B F1 AKR1B1 CpGi B R1 AKR1B1 CpGi B F2 AKR1B1 CpGi B R2 AKR1B10 F1 AKR1B10 R1 AKR1B10 F2 AKR1B10 R2 AKR1B15 F1 AKR1B15 R unique AKR1B15 F2 Mouse AKR1B3 CpGi F1 Mouse AKR1B3 CpGi R1 Mouse AKR1B3 CpGi F2 Mouse AKR1B3 CpGi R2 EN1 CpGi C F1 EN1 CpGi C R1 EN1 CpGi C F2 EN1 CpGi C R2 INHBB F1 INHBB R1 INHBB F2 INHBB R2 AA b xex u a Sequence GAGTATTTATTTTTTAGGTATT! TTTCCCACCAAATACAACA! AATTTTAGGATGGGTATTTTG! AACTAAAAAACTCCTTTCTAC! ATTACCTCACTTATAAATAATTAA TTTTTTGAATTATTAATTAGTTA ! GGGTGTTTAGATTTTTTTTTT! AGGGAAAGGAGGTTGGGTTT ! CCATCCTAAAATTAAATACCTAA! GGAAAGGAGGTTGGGTTTG ! ATTAAATACCTAAAAAATAAATACT ! TTATGTTGGTTAGGTTGGTTTT! CTTACTTTCCCTATAATAATTTCCT! ATTATAGGTGTGAGATATTATGTT ! CTTACTTTCCCTATAATAATTTCCT ! GGTTTATATTATTTTTAAGAGTTAT ! ACCTTATACCCAATTAAATATCCT ! TTGTAATATATATTGTGAAGGTTTATG! AGAGGATAGAGAAATAAGTTGG ! AAACCAAAACTTCTCCCCAATCTC ! TGGGTGTGTTTTTATTTGGGG ! TATCTCTAATCTACTAATTATTTTC ! AGAATAATAAAGATAAGAGAT! ACTATCCTACTTATAAACTC! GTTTTAGGGATTTAGAGTTT! CTACTTATAAACTCAACCAA! AAGTTTTGAGGTTTAGTGGTTTT! AAACCCTACCTCTATCCCAA! GGTTAGGTTTTTAGTGGTTATT! CCTCCCCAACCAACAAAAA! A A aI A |a B eI I|t ! Primer name AKR1B1 Fw AKR1B1 Rv AKR1B10 Fw AKR1B10 Rv AKR1B15 Fw AKR1B15 Rv EN1 Fw EN1 Rv INHBB Fw INHBB Rv CPLX2 Fw CPLX2 Rv 18S Fw 18S Rv PP1A Fw PP1A Rv Beta-2-Micro Fw Beta-2-Micro Rv PSMC4 Fw PSMC4 Rv PUM1 Fw PUM1 Rv MRPL19 Fw MRPL19 Rv Akr1b3 mice Fw Sequence CCGTCTCCTGCTCAACAAC! TACACATGGGCACAGTCGAT! GCTTCTCGATCTGGAAGTGG! GTAATGCCATCGGTGGAAAA! CCCTTTGACTGGCCTAAAGAG! AATGTGGCGATATTCTGCATCA! TGGGTGTACTGCACACGTTATTC! CTTGTCCTCCTTCTCGTTCTTCTT! CGCGTTTCCGAAATCATCA! GGACCACAAACAGGTTCTGGTT! GAGGCGGAGCGGGAGAAGGTC! GCCCGGGCAGGTATTTGAGCA! GCGAAAGCATTTGCCAAGAA! CATCACAGACCTGTTATTGC! CTCCTTTGAGCTGTTTGCAG! CACCACATGCTTGCCATCC! CCAGCAGAGAATGGAAAGTC! GATGCTGCTTACATGTCTCG! TGTTGGCAAAGGCGGTGGCA! TCTCTTGGTGGCGATGGCAT! CGGTCGTCCTGAGGATAAAA! CGTACGTGAGGCGTGAGTAA! CAGTTTCTGGGGATTTGCAT! TATTCAGGAAGGGCATCTCG! AGGCCGTGAAAGTTGCTATTG Akr1b3 mice Rv Akr1b8 mice Fw ATGCTCTTGTCATGGAACGTG TCTGATTCGGTTTCACATCCAG Akr1b8 mice Rv Akr1b10 mice Fw CCAGTTTCTGTTGAAGCTAAGGA CTAGTGCCAAACCAGAGGACC Akr1b10 mice Rv Akr1b7 mice Fw TCCTGTATTCGAGAAGGTGTCA AGGCTGGGAATGCGTTATTAC Akr1b7 mice Rv mGAPDH Fw GGGTGAGATAAGGGTGGCTCT TGCACCACCAACTGCTTAG mGAPDH Rv mB2M Fw GATGCAGGGATGATGTTC GCTATCCAGAAAACCCCTCAA mB2M Rv m18S Fw CATGTCTCGATCCCAGTAGACGGT TTGACGGAAGGGCACCACCAG m18S Rv GCACCACCACCCACGGAATCG AA b u beI | | nA eI Genome Human Human Human Human Human Human Human Human Human Human Human Human Mouse Mouse Mouse Mouse Mouse Mouse Mouse I|t xe2 Primer name Sequence GCGTTGCATCATGCTTAGAA ! TCTGGAACTCGGGAGAAAAA! GCGTTGCATCATGCTTAGAA ! TCTGGAACTCGGGAGAAAAA! CAACCCCAGTTTGATGCTCT! GCAACCTCCAAGTCAAGAGG! ATTTTTCTCCCGAGTTCCAGA! AATCCTGCGAGTGGGGTTTG! TTCGCTTTCCCACCAGATAC! CACGAGCACCTACCTTCCAG! CCAAGCTTTTCGCTTTCCCACCAGATAC! CCAAGCTTGGAGCCTTCTGATTGGTTGC! CCAAGCTTTTCGCTTTCCCACCAGATAC! CCAAGCTTGGGATGCTTCTTCCGCCT! CCAAGCTTTTCGCTTTCCCACCAGATAC! CCAAGCTTGGAGCCTTCTGAATCGTTGC! AA b u a I | eI I | NI A a I | be I AB| t xe1 Genome coordinates Amplicon size chr7:134142082+134143103 1022 bp Fw. Fragment 1 Luciferase Rv. Fragment 1 Luciferase Fw. Fragment 2 Luciferase chr7:134142082+134143103 1022 bp chr7:134144202+134145228 1027 bp chr7:134143083+134143531 449 bp chr7:134143736-134144109 374 bp chr7:134143927-134144117 191 bp chr7:134143985-134144117 133 bp chr7:134143927-134144117 191 bp Rv. Fragment 2 Luciferase Fw. Fragment 3 Luciferase Rv. Fragment 3 Luciferase Fw. Fragment 2.1 Luciferase Rv. Fragment 2.1 Luciferase Fw. Fragment 2.2 Luciferase Rv. Fragment 2.2 Luciferase Fw. Fragment 2.3.1 Luciferase Rv. Fragment 2.3.1 Luciferase Fw. Fragment 2.3.2 Luciferase Rv. Fragment 2.3.2 Luciferase Fw. Fragment 2.3.1 Mut Luciferase Rv. Fragment 2.3.1 Mut Luciferase Bc An nnI A B A e nA | D n I ABa| Primer name Sequence Rv.CRISPR_AKR1B1.CpGi.GUIDE A Rv.CRISPR_AKR1B1.CpGi.GUIDE A Fw.CRISPR_AKR1B1.CpGi.GUIDE B Rv.CRISPR_AKR1B1.CpGi.GUIDE B Fw.CRISPR_NF-Y.Gene.GUIDE A Rv.CRISPR_NF-Y.Gene.GUIDE B Fw.CRISPR_NF-Y.Gene.GUIDE B Rv.CRISPR_NF-Y.Gene.GUIDE B Fw.CRISPR_CEBPB.Gene.GUIDE A Rv.CRISPR_CEBPB.Gene.GUIDE A Fw.CRISPR_CEBPB.Gene.GUIDE B Rv.CRISPR_CEBPB.Gene.GUIDE B AA b u BI B| xa A | n CACCGAGCCTTCTGATTGGTTGCGCTGG! AAACCCAGCGCAACCAATCAGAAGGCTC! CACCGCCGCTGCGCGAAGGAGCCTTCTG! AAACCAGAAGGCTCCTTCGCGCAGCGGC! CACCGCCACTGACCTGCACCATTAATGG! AACCCATTAATGGTGCAGGTCAGTGGC! CACCGTGGCCAACCCATCATGGTCCAGG! AACCCTGGACCATGATGGGTTGGCCAC! CACCGTCGGCACCGCCTGGTAGCCGAGG! AACCCTCGGCTACCAGGCGGTGCCGAC! CACCGTCCTCCTCGTCCAGCCCGCCCGG! AACCCGGGCGGGCTGGACGAGGAGGAC! n| t xe3 Gene 450k Methylation Probe ABCG5&8 cg26706238 ADH1 cg23949936 ADH4 cg12011299 AKR1B1 cg02215070 AKR1B10 cg11693019 AKR1B15 cg27018005 AKR1C1 cg10568634 AKR1C2 cg18841653 AKR1C3 cg12530994 AKR1C4 cg09272256 ALDH1A1 cg01812894 ALDH1A2 cg02888131 ALDH1A3 cg21359747 AWAT1 cg20220865 AWAT2 cg23904115 BCDO2 cg10503334 BCMO1 cg01678878 CD36C cg06719671 CRABP1 cg22496102 CRABP2 cg03734660 CYP26A1 cg22536554 CYP26B1 cg20097440 CYP26E1 cg14250048 DHRS3 cg01083689 LPLC cg07964216 LRAT cg26084529 NPC1L1 cg06907626 RARA cg24957657 RARB cg12479047 RARG cg08104462 RBP1 cg11027570 RBP4 cg18585903 RBP7 cg18086187 RDH10 cg20179892 RDH11 cg02218134 RDH12 cg21238221 RDH5 cg02192520 RDH8 cg25661884 RETSAT cg02301651 RXRA cg14654324 RXRB cg08949668 RXRG cg22675486 SCARB1 cg00894440 SULT1A1 cg15812873 AA b xe4 u a A B o BnA eI n | a| AB A o| | n B I BAn e B k ot Primer name Sequence Fw.Fragment1.AKR1B1.ChIP GCTCTTTCTGCTCCATCACC! Rv.Fragment1.AKR1B1.ChIP TCCAGGAGGGAGCACTTTTA! Fw.Fragment2.AKR1B1.ChIP CGGCGCGTACCTTTAAATAG! Rv.Fragment2.AKR1B1.ChIP GAAAGAATCCGCTGCCACTA! Fw.Fragment3.AKR1B1.ChIP TCTACCGGCTTGAGATGCTT! Rv.Fragment3.AKR1B1.ChIP GGAAAGTGGGCTTCACAGAC! Fw.Fragment4.AKR1B1.ChIP TTAAGGGCCTGGTGTTTCAC! Rv.Fragment4.AKR1B1.ChIP AATGGAAGAATTGCCCACAC! Fw.Fragment5.AKR1B1.ChIP TTTTCTGAGCCCCAACAATC! Rv.Fragment5.AKR1B1.ChIP CCTTCACAAGAGGGAAGCAC! Fw.Fragment6.AKR1B1.ChIP CCTCCCTCCTCCAACTCTTC! Rv.Fragment6.AKR1B1.ChIP ATCCATTCCAGGCTTTTGTG! Fw.Fragment7.AKR1B1.ChIP TTGCTCGGTTACGACATTTG! Rv.Fragment7.AKR1B1.ChIP TTCCCCTCCAGAAGACAGTG! Fw.Fragment8.AKR1B1.ChIP CATGCTGCCATCTGTCAACT! Rv.Fragment8.AKR1B1.ChIP CCAACCCCTCCTGTGAGATT! Fw.Fragment9.AKR1B1.ChIP CCTGCCAGAATGAACCCTAA! Rv.Fragment9.AKR1B1.ChIP TGGAATTAAGCCTGCCAATC! Fw.Fragment10.AKR1B1.ChIPCATTCCCATTTCCAGGTTTG! Rv.Fragment10.AKR1B1.ChIP TGGGCTAGAAATCGTTGACC! TTCTTCTGGGGTTGTTCCGTAATC! THOC3 Fw ChIP CACACCCGCTAGCCCTTTTCAT! THOC3 Rv ChIP CCTCCAGACCCCCACCCCATCC! CPLX2 Fw ChIP AGGCTTCCCCGCGGCTTCTCAG! CPLX2 Rv ChIP TTGCAACCGGGAAGGAAA! GADPH Fw ChIP TAGCCTCCGTCCAGCTGACTT! GAPDH Rv ChIP CAGTTTGCCAGATAGTCTCTTT! 16CEN Fw ChIP GAGACATTTGGGAAGGTCACTGAAT! 16CEN Rv ChIP AA b u eI I|t xe5 Primer name Fw8.akr1b.3C Fw17.akr1b.3C Fw16.akr1b.3C Fw15.akr1b.3C Fw13.akr1b.3C Fw2.akr1b.3C Fw4.akr1b.3C Fw5.akr1b.3C Fw19.akr1b.3C Fw20.akr1b.3C Fw22.akr1b.3C Fw31.akr1b.3C Sequence CAGGGTCTCACTGTCTGTCG! CCATGATGCTGTGAATGGTT! GTAGGCTGCATGGACACGTA! TTGGGAGGCTGAGGTATGAG! TTGAGCCCAGGAATTGGA! GCCTGTAGTCCCAGCTACCC! TTTCCCAAGAGCTTGAAACTG! TCCTGGCACACATAGCAAGA! TCCTTCCAGTTTCCGTCTTAAA! GTAAAAGGCTTTGGGTTCCAC! AGAGGATGCAGAGCCAGAAG! AGAAACAAAGCCAACGCACT! AA b u I n n| n d n i |B A nI eI eI n nB I xe6 nA nI BnA I A | n B eBaI eI I | t k V AB y yh Gene Expression probe AKR1B1 A_23_P258190 AKR1B10 A_24_P129341 AKR1C3 A_23_P138541 ALDH1A1 A_23_P83098 ALDH1A2 A_24_P73577 CRABP1 A_33_P3326483 CYP26A1 A_23_P138655 CYP26B1 A_23_P210101 DGAT1 A_23_P112162 DHRS4 A_23_P14376 LRAT A_32_P113066 RARA A_32_P5251 RARB A_24_P3243 RBP1 A_23_P257649 RETSAT A_23_P209944 RXRA A_23_P423197 RXRG A_23_P23292 SULT1A1 A_24_P262201 AA b u AB pCh; beI | | nA eI n | t In II o xe7 Annex ANNEX X. CHIP-­‐SEQ DATA Scale chr7: 134,142,900 134,143,000 134,143,100 AKR1B1 53 _ CpG: 93 134,143,200 134,143,300 500 bases 134,143,400 hg19 134,143,500 134,143,600 134,143,700 134,143,800 134,143,900 UCSC Genes (RefSeq, GenBank, CCDS, Rfam, tRNAs & Comparative Genomics) 134,144,000 134,144,100 134,144,200 134,144,300 134,144,400 CpG Islands (Islands < 300 Bases are Light Green) CTCF_Control.profile CTCF_Control.sig 0_ 53 _ CTCF_Aza.profile 0_ 62 _ H2AZ_Control.profile CTCF_Aza.sig H2AZ_Control.sig 0-18 _ 62 _ H2AZ_Aza.profile H2AZ_Aza.sig 0-18 _ 38 _ H4K20me3_Control.profile H4K20me3_Control.sig 0-18 _ 38 _ H4K20me3_Aza.profile H4K20me3_Aza.sig 0-18 _ 95 _ H3K27me3_Control.profile H3K27me3_Control.sig 0-36 _ 95 _ H3K27me3_Aza.profile H3K27me3_Aza.sig 0-36 _ 260 _ H3K4me3_Control.profile H3K4me3_Control.sig -15 _ 260 _ H3K4me3_Aza.profile H3K4me3_Aza.sig -15 _ 62 _ H3K9me2_Control.profile H3K9me2_Control.sig 0- -35 _ 62 _ H3K9me2_Aza.profile H3K9me2_Aza.sig 0- -35 _ 33 _ H3K9me3_Control.profile H3K9me3_Control.sig 0- -23 _ 33 _ H3K9me3_Aza.profile H3K9me3_Aza.sig 0- -23 _ Annex X | ChIP-­seq data on HCT116 control and treated with 5-­AzadC. 220 A AA b C B u C) | B A A AB | A oD nI y yh A y y eI nB A beI | | nAt xxe Annex ANNEX XII. ARTICLE Regina Mayor, Mar Muñoz, Marcel W. Coolen, Joaquin Custodio, Manel Esteller, Susan J.Clark and Miguel A. Peinado. Dynamics of bivalent chromatin domains upon drug induced reactivation and resilencing in cancer cells. Epigenetics 2011, 9: 1138-­‐1148. 222 RESEARCH PAPER Epigenetics 6:9, 1138-1148; September 2011; © 2011 Landes Bioscience Dynamics of bivalent chromatin domains upon drug induced reactivation and resilencing in cancer cells Regina Mayor,1 Mar Muñoz,1 Marcel W. Coolen,2,3 Joaquin Custodio,1 Manel Esteller,4 Susan J. Clark2,5 and Miguel A. Peinado1,* Institut de Medicina Predictiva i Personalitzada del Càncer (IMPPC); Badalona; Barcelona, Spain; 2 Epigenetics Group, Cancer Program; Garvan Institute of Medical Research; Sydney, Australia; 3Department of Human Genetics; Nijmegen Centre for Molecular Life Sciences (NCMLS); Radboud University Nijmegen Medical Centre; Nijmegen, The Netherlands; 4Cancer Epigenetics and Biology Program (PEBC); Institut d’Investigació Biomèdica de Bellvitge (IDIBELL), L’Hospitalet; Barcelona, Spain; 5St. Vincent’s Clinical School; University of NSW; Sydney, New South Wales, Australia 1 Key words: chromatin remodeling, DNA methylation, epigenetic drugs, colorectal cancer, epigenetic silencing Epigenetic deregulation revealed by altered profiles of DNA methylation and histone modifications is a frequent event in cancer cells and results in abnormal patterns of gene expression. Cancer silenced genes constitute prime therapeutic targets and considerable progress has been made in the epigenetic characterization of the chromatin scenarios associated with their inactivation and drug induced reactivation. Despite these advances, the mechanisms involved in the maintenance or resetting of epigenetic states in both physiological and pharmacological situations are poorly known. To get insights into the dynamics of chromatin regulation upon drug-induced reactivation, we have investigated the epigenetic profiles of two chromosomal regions undergoing long range epigenetic silencing in colon cancer cells in time-course settings after exposure of cells to chromatin reactivating agents. The DNA methylation states and the balance between histone H3K4 methylation and H3K27 methylation marks clearly define groups of genes with alternative responses to therapy. We show that the expected epigenetic remodeling induced by the reactivating drugs, just achieves a transient disruption of the bivalent states, which overcome the treatment and restore the transcriptional silencing approximately four weeks after drug exposure. The interplay between DNA methylation and bivalent histone marks appears to configure a plastic but stable chromatin scenario that is fully restored in silenced genes after drug withdrawal. These data suggest that improvement of epigenetic therapies may be achieved by designing strategies with long lasting effects. ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. Introduction The combination of genetic and epigenetic lesions in cancer cells results in altered gene expression profiles. DNA methylation and different modifications on histone tails are the two principal forms of epigenetic regulation and both are largely disturbed in cancer cells.1,2 Many unmethylated CpG islands often become hypermethylated during cancer progression resulting in epigenetic inactivation of the associated gene. This appears to be a principal mechanism of tumor suppressor inactivation, but not all silenced genes are considered to have antitumor activities and heterogeneous profiles have been identified for different tumor types.1,2 Most CpG island hypermethylations appear as isolated and independent events, but the concurrent hypermethylation of neighboring CpG islands accompanied by global remodeling of the chromatin in large chromosomal regions may also occur.3,4 This is a phenomenon known as Long Range Epigenetic Silencing (LRES) and has been reported to affect multiple chromosomal regions in different tumor types, including colorectal, prostate and breast cancer.3-10 Histone modifications can lead to either activation or repression depending upon which residues are modified and the type of modification.11 For instance, in histone 3, dimethylaton and trimethylation of lysine 4 (H3K4me3) are associated with transcriptional activity, while trimethylation of lysine 27 (H3K27me3) is characteristic of silenced promoters. This later mark is driven by the presence of the polycomb repressor complex and is believed to direct de novo methylation in cancer-related silenced genes.12,13 Different studies have reported that in genes that become silenced in cancer cells, the repressive mark H3K27me3 co-exists with active marks (H3K4me3 and H3K4me2).6,14,15 These two opposite modifications participate in the mitotic inheritance of lineagespecific gene expression programs and have key developmental functions. Its co-localization is considered characteristic of stem cells and is believed to keep developmental regulator genes poised for induction.16-21 More recently, it has been shown that bivalent chromatin domains are also prone to DNA hypermethylation *Correspondence to: Miguel A. Peinado; Email: [email protected] Submitted: 04/18/11; Accepted: 07/15/11 DOI: 10.4161/epi.6.9.16066 1138 Epigenetics Volume 6 Issue 9 RESEARCH PAPER RESEARCH PAPER in aging, providing an epigenetic link between the processes of aging and cancer.22,23 Stem-cell like signatures are mimicked by cancer cells and contribute to define their properties.24-26 Resetting of epigenetic profiles appears as a novel and promising therapeutic strategy in cancer,1,27 but a better understanding of the mechanisms setting epigenetic memory and how the chromatin landscapes are either maintained or modified is required to make it a broad reality. This is especially important, since most of the critical genes in cell programming and targets of epigenetic therapies show bivalent chromatin signatures in both stem and cancer cells. Genome-scale approaches just illustrate the ubiquitous and complex reorganization of epigenomic profiles upon treatment with gene-reactivating drugs, as shown in a recent study.28 Due to the heterogeneity of chromatin landscapes before and after the treatment, insights into the regulatory mechanisms can be only obtained from a detailed analysis of specific loci. An interesting example is a recent investigation in which a clear picture of chromatin and gene expression dynamics has been achieved by analysis of green fluorescent protein expression under the control of a methylated cytomegalovirus promoter after treatment with 5-AzadC.29 This artificial setting illustrates the different epigenetic events associated with changes in gene activity, but it remains unsolved which mechanism or driving signal retains the “switch-off” memento and is able to reset the original state of the chromatin. Si et al. suggest that residual DNA methylation near the CMV-GFP locus could play a role. It is also unknown if the dynamics of chromatin remodeling and DNA methylation observed in this system apply to endogenous genes.29 Although important insights into the mechanisms of epigenetic control have been made, the interaction between different coexisting epigenetic marks and the dynamics of the events responsible for the repression/activation of chromatin are still poorly known.11 Here we have characterized the epigenetic profiles of two chromosomal regions undergoing long range epigenetic silencing in most colorectal cancers, how these profiles are affected by epigenetic drugs and how they are reset upon drug withdrawal and maintenance in in vitro culture. Our results illustrate the dominant nature of DNA methylation and bivalent histone marks, which endure drug-induced changes in transcriptional activity. chromosome maps and the molecular profiles of both regions are depicted in Figure 1 and Supplemental Figure 1. According to the expression levels and the epigenetic state of their promoter, the genes could be classified into three groups (Fig. 2). First group consists of silenced genes exhibiting methylated CpG island-promoter; this group includes EN1, SCTR and INHBB (2q14.2) and HRH2, CPLX2 and SNCB (5q35.2) that express at low levels in normal colon cells.3,6 A second group consisted of genes with unmethylated CpG island-promoter, and includes DDX18, INSIG2, PTPN4, RALB, TSN (2q14.2), SFXN1 and THOC3 (5q35.2). These genes tend to be downregulated in colorectal tumors (as compared with the normal colon cells) but still retain high expression levels.3,6 Finally, a third group includes MARCO (2q14.2) and PCLKC (5q35.2) genes that are low expressed and do not contain a CpG island in the promoter region (Fig. 1 and Sup. Fig. 1). Histone modification profiles were also analyzed by chromatin immunoprecipitation (ChIP) and each one of the groups exhibited characteristic profiles (Fig. 2). A good agreement between H3K4me2 and H3K4me3 profiles was observed (Sup. Fig. 2) and for simplification, H3K4me2 data have been represented in figures and Tables throughout the manuscript. The concurrent presence of repressive H3K27me3 and active H3K4me2/me3 chromatin marks was observed in genes of the first group containing a DNA hypermethylated promoter (Fig. 2). This is consistent with a bivalent state, as it has been reported previously for some of these genes6 and in other genes that become hypermethylated in cancer.14,15,31 Genes with these features (N1, SCTR and INHBB, HRH2, CPLX2 and SNCB) are referred as MBV (methylated and bivalent). Noteworthy, the same genes that showed higher levels of H3K4me2/me3 within this group, presented the highest levels of H3K27me3, as it is the case of CPLX2 and INHBB (Fig. 2). H3K9Ac was absent from MBV genes and some of them (i.e., EN1, SCTR) exhibited low levels of H3K9me2 (Sup. Fig. 3). The H3K27me3/H3K4me2 ratio was above 0.5 in all MBV genes. The activated state of genes of the second group was associated with high levels of H3K4me2/me3 (Fig. 2) and H3K9Ac marks (Sup. Fig. 3). However, there was no correlation between the gene expression levels and the amount of active marks when comparing genes among them. As expected, H3K27me3 mark was absent on the promoters of these genes. The H3K27me3/ H3K4me2 ratio was at least ten fold lower than the minimum value observed in MBV genes. Genes of this group are referred as ACTIVE, because they were expressed in all experimental situations, although the levels were not maintained. MARCO and PcLKC (also known as PCDH24) genes displayed histone modification profiles compatible with bivalent chromatin and accordingly their gene expression levels were very low. MARCO exhibited the highest levels of repressive marks H3K27me3 and H3K9me2 among all analyzed genes (Fig. 2 and Sup. Fig. 3). Genes of this group do not contain a CpG island in the promoter and are referred as NoCpGi. Dynamics of epigenetic profiles in LRES regions upon 5-AzadC/TSA treatment and drug withdrawal. It has been repeatedly shown that epigenetically silenced genes can be ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. Results DNA methylation, expression and histone patterns define three types of genes in long range epigenetic silencing (LRES) regions. In previous studies we have shown that LRES affects chromosomal regions 2q14.2 and 5q35.2 in most colorectal cancers.3,6,30 Although genetic activity is downregulated all along the LRES region, uneven epigenetic profiles are likely to define different chromatin domains. To better characterize the epigenetic regulation of the diverse chromatin domains in LRES we have investigated gene expression and epigenetic profiles in nine and six genes embedded in chromosomal regions 2q14.2 and 5q35.2, respectively, in HCT116 colon cancer cells. An overview of the www.landesbioscience.com Epigenetics 1139 ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. Figure 1. Scheme of the chromosomal regions analyzed at epigenetic level. Genes are depicted as arrowheads (indicating the transcription direction) and coded according to its epigenetic signature in HCT116 cells. Closed black arrowhead: DNA methylated and bivalent chromatin marks (MBV), Open arrowhead: Active genes, Grey arrowhead: No CpG island. reactivated by treating the cells with the demethylating agent 5-Aza-2'-deoxycytidine (5AzadC) and the inhibitor of histone deacetylases Trichostatin A (TSA).27,32 More recently it has also been shown that bivalent domains in silenced genes are not resolved in spite of the reactivation upon drug treatment.6 To get a better picture of the events associated with gene activation and silencing in these chromosomal regions we performed a time course experiment after treating the cells separately with 5AzadC or TSA, and with a combination of both. Cells were analyzed at days 1 (the same day the drugs were removed), 16, 22 and 29 after treatment. As expected, 5AzadC alone or in combination with TSA resulted in global demethylation of the seven hypermethylated genes as determined by direct bisulfite sequencing and melting curve analysis (data not shown). For a subset of genes (EN1, SCTR and INHBB), a quantitative determination was performed using the MassCLEAVETM DNA methylation assay system. A 60% of loss of methylation was observed just after the treatment (day 1) in 5AzadC treatment alone (data not shown) and after the co-treatment that affected most CpG sites (Fig. 3). Some CpG sites (SCTR 6_7 and SCTR 40) exhibiting lower methylation levels (about 50%) in untreated cells did not display changes upon treatment. 1140 Upon drug withdrawal, a remethylation to >90% was reached in 5AzadC treated cells after 16 days (data not shown), while the co-treatment appeared to delay the full remethylation, that was achieved two weeks later (day 29) (Fig. 3). TSA treatment alone did not affect DNA methylation (data not shown). 5AzadC treatment restored the expression of genes with a hypermethylated promoter (MBV group) (data not shown), although the co-treatment with TSA resulted in a more substantial reactivation, that was maintained for about two weeks but returned to original levels 4 weeks later (Fig. 4), consistent with the DNA methylation profiles. H3K4me2/3 and H3K27me3 marks were also increased in response to the drugs, which is suggestive of balanced dynamics. After drug withdrawal, the active chromatin mark H3K4me2/me3 exhibited a time dependent decrease that, after four weeks, reached levels similar to the untreated cells for genes of the chromosomal band 5q35.2 and even lower for those of the 2q14.2 region. On the other hand, the repressed chromatin mark H3K27me3 displayed a heterogeneous profile and in some genes retained higher levels all along the time course study (Fig. 4). This result could be interpreted as a partial disruption of the balance between active and inactive marks during the resilencing process. Nevertheless, the alternation of different cell populations with distinct chromatin signatures might also contribute Epigenetics Volume 6 Issue 9 ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. Figure 2. Gene expression and chromatin modification patterns of genes classified into three groups according to their epigenetic signatures in HCT116 cells. MBV corresponds to silenced genes exhibiting a DNA methylated promoter embedded in bivalent chromatin (presence of methylation in H3K27 and H3K4); ACTIVE corresponds to unmethylated and expressed genes; NoCpGi corresponds to genes without CpG island. Gene expression levels were normalized to 18S. H3K4me2 and H3K27me3 ChIP levels were normalized to input and the ratios between both marks are shown. All quantifications were performed by real-time PCR in triplicate. Error bars indicate standard deviation. Note that gene expression and H3K4me2 values are represented in a different scale for ACTIVE genes due to their high values as compared with the other two groups. The regional profiles of genes arranged by chromosomal position in shown in Supplemental Figure 1. to the observed changes. H3K4me2 and H3K4me3 active marks showed parallel changes in most of the experiments in which both www.landesbioscience.com were analyzed, although H3K4me2 changes appeared to occur at a slower pace than H3K4me3 (Sup. Fig. 2). Epigenetics 1141 ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. Figure 3. Relative methylation levels of the named CpG sites contained in the EN1, SCTR and INHBB amplicons as analyzed by MassCLEAVETM after 5AzadC/TSA co-treatment. A pool of three direct bisulfite PCR products was used for analysis. Represented values correspond to the ratio of treated versus untreated HCT116 cells (Y axis). The gradient scale represents the different time points corresponding to days 1, 16, 22 and 29 after treatment (from dark to light). Mean methylation values of all the CpG sites are represented in the right part. On the other hand, ACTIVE genes exhibited a completely different behavior in response to the various treatments. Most of them suffered a clear decrease in the transcription rates by day 1, either with 5AzadC or TSA alone (data not shown), or with the combination of both (Fig. 4). Reduction of expression was paralleled by an initial decrease in H3K4me2/me3 mark. The initial expression levels were recovered 16 days after the drug withdrawal as the H3K4me2/me3 mark did. H3K27me3 mark remained low or undetectable in these genes along the time course, although its sporadic presence could be detected in some genes (Fig. 4). Finally, MARCO and PcLKC gene expression was slightly induced by the treatment. This reactivated status was maintained over 16 days. Afterwards, transcription rates started to decrease to the low or undetectable levels of untreated cells (Fig. 4). Changes 1142 in chromatin modifications were also minor, with slight increases of H3K4me2/3 and H3K27me3 in PcLKC along the time course (Fig. 4). Notably, for all three groups of genes, an enrichment of H3K4me2/me3 levels was found after treating the cells with TSA alone (Sup. Fig. 2B and data not shown), but this effect had disappeared by day 16 for most of the genes, and was not reflected on the expression patterns. Regarding other histone modifications analyzed, H3K9Ac was increased in most genes after TSA or the combined treatment but not when treated with 5dAzaC alone as expected (data not shown). H3K9me2 and total H3 levels displayed small variations without a consistent pattern. Maintenance of chromatin states in DNA methylation deficient cells. Since DNA demethylation appeared to reactivate silenced genes but was not able to resolve bivalent chromatin, Epigenetics Volume 6 Issue 9 ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. Figure 4. Relative expression and histone mark (H3K4me2 and H3K27me3) levels in the three classes of genes after 5-AzadC and TSA co-treatment. Relative values were calculated as the log2 of the treated/untreated ratio. The gradient scale indicates the different time points corresponding to days 1, 16, 22 and 29 after treatment (from dark to light). we wondered if stable demethylation will be sufficient to override the epigenetic memory. We analyzed the DKO cells, a variant of HCT116 colon cancer cells which is deficient for DNA methyltransferases,33 although retaining some residual DNMT1 activity.34 As expected, hypermethylated genes (MBV) in the wild-type HCT116 were fully demethylated in DKO cells (data not shown), and their expression was restored to higher levels than in the parental cells, although two of the genes, EN1 and CPLX2, exhibited a limited reactivation (Fig. 5A). As in drug induced gene reactivation, DKO cells exhibited an overall increase of the H3K4me2/me3 and H3K27me3 marks in the demethylated MBV genes (Fig. 5A), which suggests a dynamic rebalancing of these two histone modifications enduring the retention of the bivalent states. These results are in agreement with previous observations in other genes.15 Genes with unmethylated CpG islands (ACTIVE group) in the HCT116 cells and those without CpG island (noCpGi group) exhibited null or minimal changes in gene expression and histone modification marks (Fig. 5A and data not shown). The treatment of DKO cells with TSA resulted in an increased expression of all the MBV genes (Fig. 5B) that was paralleled by a partial disruption of the balance between H3K4me2 Figure 5 (See opposite page). (A) Relative gene expression and histone modification profiles in DKO cells in regard to parental HCT116. Relative values were calculated as log2 of DKO/HCT116 ratio. Gene expression was normalized to 18S. ChIP results were normalized to the respective input fractions. Major differences are seen in the methylated bivalent genes (MBV) that exhibit DNA demethylation, higher expression and increased levels of histone marks H3K4me2 and H3K27me3. (B) Relative gene expression and modification profiles in DKO cells treated with TSA in regard to untreated DKO cells. Relative values were calculated as log2 of treated/untreated cells ratio. Gene expression was normalized to 18S. ChIP results were normalized to the respective input fractions. www.landesbioscience.com Epigenetics 1143 ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. Figure 5. For figure legend, see page 6. 1144 Epigenetics Volume 6 Issue 9 only a fraction of the cells and the fraction of cells exhibiting changes may be different for every assessed parameter. To determine whether drug induced DNA demethylation is directly associated with the changes detected in active and repressive histone modifications, we analyzed DNA methylation in H3K4me2 and H3K27me3 chromatin fractions in untreated HCT116 and DKO cells, 5-AzadC and 5-AzadC/ TSA treated HCT116 cells and TSA treated DKO cells. DNA methylation profiles of five MBV genes (EN1, SCTR, INHBB, CPLX2 and HRH2) were analyzed in the Input, H3K4me2 and H3K27me3 ChIP fractions by bisulfite sequencing and MassCLEAVETM. High levels of DNA methylation were observed in all chromatin fractions analyzed in HCT116 cells, suggesting that DNA methylation was homogeneous and ubiquitous in the five genes analyzed. Illustrative results of HRH2 and EN1 genes have been represented (Fig. 6A). Upon treatment (5AzadC alone or in combination with TSA), marked differences between H3K4me2/me3 and H3K27me3 fractions were appreciated. A dramatic decrease in DNA methylation was observed in the input and the H3K4me2/me3 fraction of treated cells (20–30% and 10–30% of that found in untreated cells), but the H3K27me3 fraction retained a higher level of DNA methylation (40 to 100% of that found in untreated cells). This discordance suggests that drug treatment ensues in at least two different cell populations. The responsive cell population would be characterized by the loss of DNA methylation, gene re-expression, increased levels of H3K4me2, and probably by loss of the H3K27me3 mark. A second population of resistant cells would retain DNA methylation and probably increased levels of H3K27me3. Next we wondered if cells retaining DNA methylation underwent replication. We analyzed the DNA methylation and histone marks in replicating and non-replicating cells after fluorescence assisted cell sorting (FACS) of cells cultured in medium containing bromodeoxyuridine (BrdU). All fractions exhibited DNA demethylation, although it was deeper in cells that have incorporated high levels of BrdU. After 1 week, the demethylation was maintained and the differences between BrdU positive and negative cells were still apparent (Fig. 6B). Combined analysis of histone modifications and DNA methylation was performed in cells labeled with propidium iodide. Cells were fractioned by FACS into two groups (G0 /G1 and S/G2). Both groups retained balanced levels of H3K27me3 and H3K4me3, although DNA demethylation tended to be deeper in H3K4me3 fractions and cells in S/G2 phases. Equivalent results were obtained 1 day and 7 days after treatment (data not shown). We do not know if gene reactivation of silenced genes takes place in all cells, but a deeper DNA demethylation is consistently associated with enrichment of the H3K4me2/me3 marks and, as expected, DNA replication. H3K27me3 mark was present in all cell fractions. DKO cells exhibited low methylation levels similar to drug treated cells and no differences among treatments and chromatin fractions. ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. Figure 6. DNA methylation analysis of cell fractions after 5AzadC/TSA treatment. (A) MassCLEAVETM DNA methylation analysis of input, H3K4me2 and H3K27me3 immunoprecipitated DNA fractions in EN1 and HRH2 gene CpG islands. Each bar represents the mean methylation (1.0 is full methylation) of all CpG sites contained in the amplicon analyzed in untreated HCT116, 5AzadC and 5AzadC/TSA treated cells and DKO and TSA DKO treated cells. (B) Direct bisulfite sequencing of CpG island regions corresponding to three MBV genes in HCT116 cells after BrdU labeling and FACS. and H3K27me3 marks (higher H3K4me2 levels but lower H3K27me3) (Fig. 5B). The rest of genes were not affected by TSA, with the exception of DDX18 and PcLKC, which were also upregulated. A global increase of H3K4me2 levels was also seen in most genes (Fig. 5B). These results suggest that retention of the bivalent nature of chromatin in the MBV genes is preserved even in the absence of an efficient DNA methylation system, although the balance between H3K4me2/me3 and H3K27me3 marks is partially disrupted after inhibition of histone deacetylases with TSA. Epigenetic profiles of different chromatin and cell fractions. In vitro treatments with epigenetic drugs clearly show that silenced genes can be reactivated but do not illustrate the direct associations among the different components of the epigenetic code and gene activity in response to the drug. This is because changes observed in response to drugs may be driven by www.landesbioscience.com Epigenetics 1145 Discussion Reactivation of tumor suppressor genes that have undergone epigenetic silencing appears as a promising therapeutic strategy.32,35 It has been shown that reactivated promoters are often slowly remethylated and the gene is resilenced after withdrawal of the DNA methylation inhibitor.36-40 Recent discoveries have revealed chromatin scenarios linking stem cell and cancer biology 6,12,14,15,25 and have underscored the impact of neighboring epigenetic states on the regulation of chromatin stability.3,6,9 To get insights into the dynamics of chromatin reactivation and resilencing in cancer cells submitted to epigenetic treatments, we have investigated the epigenetic profiles of two of these chromosome regions, 2q14.2 and 5q35.2, containing genes silenced in colorectal cancer. We have defined three different genetic compartments based on the epigenetic signatures of the genes. The first group is represented by six genes undergoing epigenetic silencing in cancer cells (as denoted by DNA hypermethylation) and the retention of bivalent chromatin epigenetic marks (MBV genes). It is of note the bivalent nature of these genes in murine colon cells, that has been demonstrated by co-immunoprecipitation of H3K4me3 and H3K27me3 (unpublished data). When reactivated, the expression of these genes is restored but at low levels, similar to those detected in non-tumorigenic cells,3,6 and histone modifications profiles are also changed to a more pronounced bivalent state (elevated H3K4me2/3 and H3K27me3 signals) as it has been previously reported in reference 6 and 40. Upon drug withdrawal, the bivalent marks are maintained, but the balance is partially disrupted by a predominance of the repressive mark H3K27me3, suggesting its contribution to the recovery of the silenced state. The overall data are consistent with a coordinated dynamics of bivalent chromatin signatures among the MBV genes Nevertheless, it should be noted that our analysis is limited to specific regions inside the CpG island. Regional profiles along and outside the promoter region may be also affected by the treatments and may exhibit different dynamics during the resilencing process. Future studies a genome scale should address this issue. The effects of the treatment are reversed at mid-term and a complete resilencing of the reactivated genes is accomplished three weeks after drug withdrawal, while the DNA remethylation is fully restored one week later for most of the CpG islands analyzed. The combined treatment resulted in an extended recovery period as compared with 5-AzadC alone. These results are consistent with a secondary nature of DNA methylation in regard to gene activity.39,41 The percentages of demethylation and the rate of remethylation were of the same order as previously described for other genes.36,38,39 While treatment with the histone deacetylases inhibitor agent TSA alone did neither induce DNA demethylation nor gene reactivation, it had a synergistic effect with 5-AzadC, in agreement with other studies.42,43 The use of cells deficient in DNA methyltransferase activity (DKO) has allowed us to contrast the results presented above in a more stable system. As it has been described before, most hypermethylated tumor suppressor genes in HCT116 cells, such as p16INK4a or TIMP3, are found demethylated and reexpressed in DKO cells as compared with the parental HCT116 cells.33,44 Most HCT116 hypermethylated genes are reexpressed and exhibit higher levels of H3K4me2 and H3K27me3 marks in the DKO cells (Fig. 5A). These results are similar to what we obtain when HCT116 cells are treated with 5-AzadC alone (our data and ref. 40). As expected, DKO cells treated with TSA exhibited increased expression of genes hypermethylated in HCT116. Interestingly, TSA had deep effects on DKO cells by disrupting the balance between bivalent marks (Fig. 5B). While H3K4me2 is increased in most genes, the repressive H3K27me3 mark is lost from most of the genes in which promoter hypermethylation was present (MBV). Our results suggest that DNA methylation also contributes to maintain the repressive histone code in genes poised for silencing and confirm the role of DNA methylation as the foremost player in preserving the inactivation of silenced genes.38 Besides that, retention of bivalent signatures probably acts as a memento and is likely to participate in the restoration of the silencing.6 Another interesting finding arises from the analysis of DNA methylation in different chromatin fractions and in various experimental conditions. At global level, all the MBV genes analyzed in HCT116 untreated cells show coexistence of histone marks H3K4me2 and H3K27me3 with fully methylated DNA (Fig. 6A). Nevertheless, upon DNA demethylation by treatment with 5AzaC, H3K27me3 chromatin fraction retains higher levels of DNA methylation, while the H3K4me2/me3 fractions are extensively DNA demethylated. This result could be interpreted as a partial disruption of bivalent domains that become active in a fraction of the cells (unmethylated DNA and H3K4me2), while reaching a new balance in “drug-resistant cells” (methylated DNA and bivalent marks). It remains to be elucidated if the recovery of the silenced state after drug removal is due to chromatin re-remodeling or to a cell population renewal in which a reservoir of cells resistant to the drug (denoted by the presence of high levels of methylation associated with the H3K27me3 chromatin fraction) become prevalent in the cell population. While it seems clear the homogeneity of the parental cells, it could be hypothesized that the treatment induces the presence of mixed cell populations with different chromatin landscapes (active, silenced, bivalent). We tried to resolve this conundrum by coimmunoprecipitation of both histone marks H3K4me2 and H3K27me3, but it did not work in our hands, although we have been able to do it in murine cells (data not shown). Our data indicate that the retention of repressive marks is unlikely to be driven by a resting cell population, since epigenetic profiles of bivalent chromatin domains are similarly affected in replicating and non-replicating cells. In agreement with previous studies,6,15 H3K27me3 is retained and even increased in the reactivated loci. Hence, this repressing histone modification could trigger the resilencing and the DNA remethylation in the affected regions. Additional studies using inhibitors of H3K27 methyltransferase, as the DZNep,45 may contribute to better understand the role of H3K27me3 mark in this process. Residual DNA methylation in the locus or near the locus is also likely to play a role.29 As we have shown, treated cells recover the original chromatin states after a few weeks of drug withdrawal. Moreover, they show ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. 1146 Epigenetics Volume 6 Issue 9 similar sensitivity and response to the drugs upon retreatment as never-treated cells (data not shown), suggesting that selection of drug-resistant cells is not sufficient to explain our results. Epigenetic drugs used here appear to induce plastic effects on chromatin. The transient disruption of the silenced states achieved by these treatments is overcome by a dominant repressive chromatin landscape determined by DNA methylation and bivalent chromatin marks. Design of new drugs with long lasting effects should improve the efficiency of epigenetic therapies. In summary, our work illustrates the complexity of the epigenetic changes occurring upon drug-induced activation of silenced genes. While DNA methylation appears to play a dominant role in long lasting silencing, other players, characterized here as bivalent histone marks, contribute to maintain the epigenetic memory of silenced genes. The histone modification H3K27me3 is likely to play an important role in maintaining the memory of silenced genes that are in a bivalent context. Novel epigenetic strategies in cancer should target this repressive mark in order to get a more efficient effect of current DNA demethylating therapies. Materials and Methods Cell culture and 5-Aza-2'-deoxycytidine and trichostatin A treatments. The HCT116 colorectal carcinoma cell line was obtained from the American Type Culture Collection (ATCC). Cell culture and treatment with 5-Aza-2'-deoxycytidine (5AzadC) and Trichostatin A (TSA) were performed as described in reference 3, with minor modifications. Briefly, 0.65 x 106 cells were seeded in 10-cm cell culture dishes and 24 h later treated with 0.5 μM 5-Aza-2'-deoxycytidine (5AzadC; Sigma) for 48 h. Cells were treated with Trichostatin A (TSA) (Sigma) at 0.3 μM for 16 h. For co-treatment of cells with 5AzadC and TSA, 0.8 x 106 cells were seeded and treated initially with 5AzadC for 48 h, afterwards the medium was removed and cells were treated with TSA for an additional 16 h; then, the medium was changed and cells were harvested at the indicated time points. For control samples, half a million cells were seeded and cultured at the same time in which the drugs were omitted. DKO cells (HCT116 deficient in both DNA methyltransferases),46 were cultured under the same conditions as wild type HCT116 cells. A complete new treatment of HCT116 cells with 5AzadC and TSA was done in parallel as control of drug efficiency. Fluorescence-activated cell sorting (FACS). Cell sorting of replicating and non-replicating cells was performed using a modification of the method described previously in reference 47. Briefly, untreated and treated (5AzadC + TSA) cells were incubated for 24 h with 30 μM BrdU (Sigma) immediately and 7 days after the treatment. Cells were fixed with 3.7% formaldehyde at room temperature for 10 min, washed 3 times with cold PBS. The blocking solution (15% goat serum in 0.1% TritonX100) was added to the cells and incubated for 30 minutes at room temperature. After removal of blocking solution, fixed cells were incubated for 1 h at room temperature with anti-BrdU mouse monoclonal antibody 1:250 (Becton Dickinson, Ref. 555627), washed 3 times with PBS, and incubated again with anti-mouse FITC-conjugated antibody 1:250 (Invitrogen, Ref. A10543) for 45 minutes at room temperature in a dark chamber. Cells were washed twice with PBS and Tween (0.02%) and 2 more times with PBS. Flow cytometry and sorting was performed on an Influx flow cytometer (BD FACSAriaTM II). Standard negative controls were used to set up the threshold and to fractionate cells positive and negative for BrdU. Cell cycle analysis. Cell cycle analysis using PI was performed in 5dAzadC+TSA treated cells 1 and 7 days after the treatment. Cells were resuspended in 0.9 ml PBS, permeabilized with 2.1 ml 100% ethanol and kept at -20°C for 30 min. Then, cells were washed twice to eliminate the ethanol and 1 ml of the analysis solution compound (Propidium iodide 500 μg/ml (Sigma), sodium citrate 38 mM and Ribonuclease A (Sigma) was added. Flow cytometry and sorting was performed as described above. Fractions for G0 /G1 and S/G2 were collected. Bisulfite sequencing and massCLEAVETM analysis. Genomic DNA was obtained using standard protocols. Bisulfite treatment was performed as previously described in reference 41, or using the EZ DNA methylation kitTM (Zymo Research). Three independent PCR reactions were carried out and products were pooled to ensure a representative methylation profile. The primers used for the bisulfite PCR amplifications are listed in Supplemental Table 1. MassCLEAVETM methylation analyses were performed as previously described in reference 48. Data was analyzed using the MassCLEAVETM technology as previously reported in reference 48. RNA extraction and quantitative real-time RT-PCR. RNA and the corresponding cDNA were obtained using standard protocols. Expression was quantified using the ABI PRISM 7900 HT sequence detection system (Applied Biosystems) or the Light Cycler 2.0 real time PCR system (Roche Diagnostics). The primers used for RT-PCR amplification are listed in Supplemental Table 2. The reactions were performed in triplicate. Gene expression levels were normalized using 18S determinations. Chromatin immunoprecipitation (ChIP) assays. ChIP assays were carried out using the Chromatin Immunoprecipitation Assay Kit (Upstate Biotechnology) according to the manufacturer’s instructions. The complexes were immunoprecipitated with antibodies specific for total histone H3 from Abcam (ab1791) and acetylation of histone H3 (Lys 9) (no. 07-352), dimethylhistone H3 (Lys 4) (no. 07-030), dimethyl-histone H3 (Lys 9) (no. 07-441), trimethyl-histone H3 (Lys 27) (no. 07-449) from Upstate Biotechnology. As negative control we used rabbit IgG serum (Jackson Immunoresearch). The amount of immunoprecipitated target was measured by real-time PCR as described above. Positive and negative controls for each histone modification were used to set the lower limits.3,6,49 Amplification primers for gene promoters are listed in Supplemental Table 3. PCRs were performed in triplicate. ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. www.landesbioscience.com Disclosure of Potential Conflicts of Interest No potential conflicts of interest were disclosed. Acknowledgments R.M. was supported by a FPI fellowship from the Spanish Ministry of Science and Innovation. This work was supported by grants from the Spanish Ministry of Science and Innovation Epigenetics 1147 (SAF2008/1409, CSD2006/49), National Health and Medical Research Council (NHMRC) and Cancer Institute NSW, Australia. M.W.C. is supported by the Netherlands Organization for Scientific Research NWO/ZonMW (916-10-108) and a Marie Curie grant (IRG: 248397). Note Supplemental materials can be found at: w w w.landesbioscience.com/journals / epigenetics/article/16066 References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. Esteller M. Cancer epigenomics: DNA methylomes and histone-modification maps. Nat Rev Genet 2007; 8:286-98. Jones PA, Baylin SB. The epigenomics of cancer. Cell 2007; 128:683-92. Frigola J, Song J, Stirzaker C, Hinshelwood RA, Peinado MA, Clark S. Epigenetic remodeling in colorectal cancer results in coordinate gene suppression across an entire chromosome band. Nat Genet 2006; 38:540-9. Clark SJ. Action at a distance: epigenetic silencing of large chromosomal regions in carcinogenesis. Hum Mol Genet 2007; 16:88-95. Hitchins MP, Lin VA, Buckle A, Cheong K, Halani N, Ku S, et al. Epigenetic inactivation of a cluster of genes flanking MLH1 in microsatellite-unstable colorectal cancer. Cancer Res 2007; 67:9107-16. Rodriguez J, Muñoz M, Vives L, Frangou CG, Groudine M, Peinado MA. Bivalent domains enforce transcriptional memory of DNA methylated genes in cancer cells. Proc Natl Acad Sci USA 2008; 105:19809-14. Novak P, Jensen T, Oshiro MM, Watts GS, Kim CJ, Futscher BW. Agglomerative epigenetic aberrations are a common event in human breast cancer. Cancer Res 2008; 68:8616-25. Dallosso AR, Hancock AL, Szemes M, Moorwood K, Chilukamarri L, Tsai HH, et al. Frequent long-range epigenetic silencing of protocadherin gene clusters on chromosome 5q31 in Wilms’ tumor. PLoS Genet 2009; 5:1000745. Coolen MW, Stirzaker C, Song JZ, Statham AL, Kassir Z, Moreno CS, et al. Consolidation of the cancer genome into domains of repressive chromatin by longrange epigenetic silencing (LRES) reduces transcriptional plasticity. Nat Cell Biol 2010; 12:235-46. Devaney J, Stirzaker C, Qu W, Song JZ, Statham AL, Patterson KI, et al. Epigenetic deregulation across 2q14.2 differentiates normal from prostate cancer and provides a regional part of novel DNA methylation cancer biomarkers. Cancer Epidemiol Biomarkers Prev 2010; 10.1158/055-9965.EPI-10-0719. Kouzarides T. Chromatin modifications and their function. Cell 2007; 128:693-705. Schlesinger Y, Straussman R, Keshet I, Farkash S, Hecht M, Zimmerman J, et al. Polycomb-mediated methylation on Lys27 of histone H3 pre-marks genes for de novo methylation in cancer. Nat Genet 2007; 39:232-6. Vire E, Brenner C, Deplus R, Blanchon L, Fraga M, Didelot C, et al. The Polycomb group protein EZH2 directly controls DNA methylation. Nature 2006; 439:871-4. Ohm JE, McGarvey KM, Yu X, Cheng L, Schuebel KE, Cope L, et al. A stem cell-like chromatin pattern may predispose tumor suppressor genes to DNA hypermethylation and heritable silencing. Nat Genet 2007; 39:237-42. 1148 15. McGarvey KM, Van Neste L, Cope L, Ohm JE, Herman JG, Van Criekinge W, et al. Defining a chromatin pattern that characterizes DNA-hypermethylated genes in colon cancer cells. Cancer Res 2008; 68:5753-9. 16. Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, et al. A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 2006; 125:315-26. 17. Mikkelsen TS, Ku M, Jaffe DB, Issac B, Lieberman E, Giannoukos G, et al. Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 2007; 448:553-60. 18. Pan G, Tian S, Nie J, Yang C, Ruotti V, Wei H, et al. Whole-genome analysis of histone H3 lysine 4 and lysine 27 methylation in human embryonic stem cells. Cell Stem Cell 2007; 1:299-312. 19. Zhao XD, Han X, Chew JL, Liu J, Chiu KP, Choo A, et al. Whole-genome mapping of histone H3 Lys4 and 27 trimethylations reveals distinct genomic compartments in human embryonic stem cells. Cell Stem Cell 2007; 1:286-98. 20. Barski A, Cuddapah S, Cui K, Roh TY, Schones DE, Wang Z, et al. High-resolution profiling of histone methylations in the human genome. Cell 2007; 129:823-37. 21. Ku M, Koche RP, Rheinbay E, Mendenhall EM, Endoh M, Mikkelsen TS, et al. Genomewide analysis of PRC1 and PRC2 occupancy identifies two classes of bivalent domains. PLoS Genet 2008; 4:1000242. 22. Rakyan VK, Down TA, Maslau S, Andrew T, Yang TP, Beyan H, et al. Human aging-associated DNA hypermethylation occurs preferentially at bivalent chromatin domains. Genome Res 2010; 20:434-9. 23. Teschendorff AE, Menon U, Gentry-Maharaj A, Ramus SJ, Weisenberger DJ, Shen H, et al. Agedependent DNA methylation of genes that are suppressed in stem cells is a hallmark of cancer. Genome Res 2010; 20:440-6. 24. Clarke MF, Fuller M. Stem cells and cancer: two faces of eve. Cell 2006; 124:1111-5. 25. Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, Regev A, et al. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet 2008; 40:499-507. 26. Spivakov M, Fisher AG. Epigenetic signatures of stemcell identity. Nat Rev Genet 2007; 8:263-71. 27. Sharma S, Kelly TK, Jones PA. Epigenetics in Cancer. Carcinogenesis 2010; 31:27-36. 28. Komashko VM, Farnham PJ. 5-azacytidine treatment reorganizes genomic histone modification patterns. Epigenetics 2010; 5:229-40. 29. Si J, Boumber YA, Shu J, Qin T, Ahmed S, He R, et al. Chromatin remodeling is required for gene reactivation after decitabine-mediated DNA hypomethylation. Cancer Res 2010; 70:6968-77. 30. Mayor R, Casadome L, Azuara D, Moreno V, Clark SJ, Capella G, et al. Long-range epigenetic silencing at 2q14.2 affects most human colorectal cancers and may have application as a non-invasive biomarker of disease. Br J Cancer 2009; 100:1534-9. 31. Widschwendter M, Fiegl H, Egle D, Mueller-Holzner E, Spizzo G, Marth C, et al. Epigenetic stem cell signature in cancer. Nat Genet 2007; 39:157-8. 32. Egger G, Liang G, Aparicio A, Jones PA. Epigenetics in human disease and prospects for epigenetic therapy. Nature 2004; 429:457-63. 33. Rhee I, Bachman KE, Park BH, Jair KW, Yen RW, Schuebel KE, et al. DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. Nature 2002; 416:552-6. 34. Egger G, Jeong S, Escobar SG, Cortez CC, Li TW, Saito Y, et al. Identification of DNMT1 (DNA methyltransferase 1) hypomorphs in somatic knockouts suggests an essential role for DNMT1 in cell survival. Proc Natl Acad Sci USA 2006; 103:14080-5. 35. Das PM, Singal R. DNA methylation and cancer. J Clin Oncol 2004; 22:4632-42. 36. Bender CM, Gonzalgo ML, Gonzales FA, Nguyen CT, Robertson KD, Jones PA. Roles of cell division and gene transcription in the methylation of CpG islands. Mol Cell Biol 1999; 19:6690-8. 37. Liang G, Gonzalgo ML, Salem C, Jones PA. Identification of DNA methylation differences during tumorigenesis by methylation-sensitive arbitrarily primed polymerase chain reaction. Methods 2002; 27:150-5. 38. Egger G, Aparicio AM, Escobar SG, Jones PA. Inhibition of histone deacetylation does not block resilencing of p16 after 5-aza-2'-deoxycytidine treatment. Cancer Res 2007; 67:346-53. 39. Kagey JD, Kapoor-Vazirani P, McCabe MT, Powell DR, Vertino PM. Long-term stability of demethylation after transient exposure to 5-aza-2'-deoxycytidine correlates with sustained RNA polymerase II occupancy. Mol Cancer Res 2010; 8:1048-59. 40. McGarvey KM, Fahrner JA, Greene E, Martens J, Jenuwein T, Baylin SB. Silenced tumor suppressor genes reactivated by DNA demethylation do not return to a fully euchromatic chromatin state. Cancer Res 2006; 66:3541-9. 41. Stirzaker C, Song JZ, Davidson B, Clark SJ. Transcriptional gene silencing promotes DNA hypermethylation through a sequential change in chromatin modifications in cancer cells. Cancer Res 2004; 64:3871-7. 42. Cameron EE, Bachman KE, Myohanen S, Herman JG, Baylin SB. Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nat Genet 1999; 21:103-7. 43. Zhu B, Benjamin D, Zheng Y, Angliker H, Thiry S, Siegmann M, et al. Overexpression of 5-methylcytosine DNA glycosylase in human embryonic kidney cells EcR293 demethylates the promoter of a hormoneregulated reporter gene. Proc Natl Acad Sci USA 2001; 98:5031-6. 44. Paz MF, Wei S, Cigudosa JC, Rodriguez-Perales S, Peinado MA, Huang TH, et al. Genetic unmasking of epigenetically silenced tumor suppressor genes in colon cancer cells deficient in DNA methyltransferases. Hum Mol Genet 2003; 12:2209-19. 45. Miranda TB, Cortez CC, Yoo CB, Liang G, Abe M, Kelly TK, et al. DZNep is a global histone methylation inhibitor that reactivates developmental genes not silenced by DNA methylation. Mol Cancer Ther 2009; 8:1579-88. 46. Rhee I, Jair KW, Yen RW, Lengauer C, Herman JG, Kinzler KW, et al. CpG methylation is maintained in human cancer cells lacking DNMT1. Nature 2000; 404:1003-7. 47. Ormerod MG. Analysis of cell proliferation using the bromodeoxyuridine/Hoechst-ethidium bromide method. Methods Mol Biol 1997; 75:357-65. 48. Coolen MW, Statham AL, Gardiner-Garden M, Clark SJ. Genomic profiling of CpG methylation and allelic specificity using quantitative high-throughput mass spectrometry: critical evaluation and improvements. Nucleic Acids Res 2007; 35:119. 49. Rodriguez J, Vives L, Jorda M, Morales C, Munoz M, Vendrell E, et al. Genome-wide tracking of unmethylated DNA Alu repeats in normal and cancer cells. Nucleic Acids Res 2008; 36:770-84. ©20 1 1L andesBi os c i enc e. Dono tdi s t r i but e. Epigenetics Volume 6 Issue 9