Regard critique face à un test

publicité
Formation sur les tests génétiques
Dossier réalisé par :
Association Tous Chercheurs
Inmed
Parc scientifique de Luminy
13273 Marseille cedex 09
(présidente : Constance HAMMOND)
Rédaction : Marion Mathieu et David Karlin avec l'aide de Jean Thimonier
1
Sommaire
INTRODUCTION ................................................................................................................... 5
BASES INDISPENSABLES DE BIOLOGIE ................................................................................ 5
[1. CELLULE, CHROMOSOME, ADN, GENE] .............................................................................................................................. 5
1.1. Cellule ................................................................................................................................................................... 5
1.2. Chromosomes et caryotype ............................................................................................................................... 6
1.3. ADN ........................................................................................................................................................................ 6
1.4. Le gène, l'unité de base d'information génétique ......................................................................................... 7
1.5. Le code génétique .............................................................................................................................................. 8
[2. MUTATION, ALLELE, POLYMORPHISME] .............................................................................................................................. 8
2.1. Les modifications génétiques ........................................................................................................................... 8
2.2. Allèles d'un gène : Allèle dominant ou récessif ........................................................................................... 11
2.3. Polymorphisme .................................................................................................................................................. 12
2.4 Causes et transmission des mutations ............................................................................................................ 13
[3. MALADIES MONOGENIQUES ET MALADIES MULTIFACTORIELLES] ............................................................................................ 14
3.1. Définitions : Maladie familiale, héréditaire, congénitale, génétique ..................................................... 14
3.2. Maladies (génétiques) monogéniques ............................................................................................................ 14
3.3. Maladies multifactorielles ............................................................................................................................... 19
[4. COMMENT SONT IDENTIFIES DES GENES DE SUSCEPTIBILITE] ................................................................................................ 20
4.1. Identification d'une composante génétique ................................................................................................. 20
4.2. Identification de gènes de susceptibilité ...................................................................................................... 21
4.3. Difficultés des études de gènes de susceptibilité ....................................................................................... 22
PRINCIPE, APPLICATIONS ET LIMITES DES TESTS GENETIQUES ...................................... 25
[1. INTRODUCTION] ............................................................................................................................................................. 25
[2. DEFINITION ET PRINCIPE D'UN TEST GENETIQUE] ............................................................................................................... 25
2.1. Définition............................................................................................................................................................ 25
2.2. Détection de modifications constitutives ou acquises à l’âge adulte ..................................................... 26
[3. DIVERSITE D’APPLICATIONS] ........................................................................................................................................... 26
3.1. Test de diagnostic ............................................................................................................................................. 26
3.2. Test pré-symptomatique ................................................................................................................................. 26
3.3. Test de diagnostic prénatal (DPN) ou préimplantatoire (DPI) .................................................................. 27
3.4. Test de susceptibilité – Test de prédisposition............................................................................................ 27
3.5. Test du statut de « porteur sain » ................................................................................................................. 28
3.6. Dépistage d’une population (test systématique) ........................................................................................ 28
3.7. Tests pharmacogénétiques .............................................................................................................................. 29
[4. DES TESTS EVOLUTIFS ET COMPLEXES].............................................................................................................................. 29
4.1. Une complexité variable en fonction des pathologies associées .............................................................. 29
4.2. Pourquoi un délai plus long pour tester le 1er individu d’une famille ? ................................................. 30
4.3. Différence entre un test de recherche et un test en routine ................................................................... 31
VALIDITE, VALEUR INFORMATIVE ET USAGE DES TESTS GENETIQUES ........................... 32
[1. VALIDITE DU TEST] ......................................................................................................................................................... 32
[2. MIEUX COMPRENDRE LE RISQUE POTENTIEL INDIQUE PAR UN TEST] ..................................................................................... 32
2.1. Notions de prévalence, risque absolu et risque relatif, risque standard, facteur de risque, facteur
protecteur .................................................................................................................................................................. 32
2.2. Notions de sensibilité et de spécificité ......................................................................................................... 33
2.3. Règles pratiques pour évaluer le risque posé par un test.......................................................................... 34
2
[3. VALEUR AJOUTEE DU TEST]............................................................................................................................................. 35
3.1. Confirmer et affiner un diagnostic ................................................................................................................ 35
3.2. Proposer un diagnostic plus simple ou moins cher ...................................................................................... 35
3.3. Orienter vers un traitement préventif .......................................................................................................... 36
3.4. Orienter vers une hygiène de vie appropriée .............................................................................................. 36
3.5. Améliorer la surveillance de la maladie ....................................................................................................... 37
3.6. Orienter vers un traitement mieux approprié (une fois la maladie déclarée) ....................................... 37
3.7. Proposer un diagnostic prénatal ..................................................................................................................... 37
3.7. Faciliter la reconnaissance d'une maladie professionnelle ou environnementale ................................. 37
[4. RISQUES A L'ANNONCE D'UN TEST POSITIF]........................................................................................................................ 38
4.1. Risques de discrimination ................................................................................................................................ 38
4.2. Risques psychologiques .................................................................................................................................... 38
[5. CAS PARTICULIER D'UN DEPISTAGE GENETIQUE]................................................................................................................. 38
ENCADREMENT JURIDIQUE DES TESTS GENETIQUES ....................................................... 40
[1. DOMAINE COUVERT PAR LA REGLEMENTATION].................................................................................................................. 40
[2. CONDITIONS DE PRESCRIPTION ET DE REALISATION] ........................................................................................................... 40
2.1. Consentement ................................................................................................................................................... 40
2.2. Prescription ........................................................................................................................................................ 41
2.3. Agrément et autorisation à la pratique des analyses de biologie médicale nécessaires à l'examen
des caractéristiques génétiques ............................................................................................................................. 41
2.4. Communication des résultats .......................................................................................................................... 41
2.5. Cas du diagnostic prénatal .............................................................................................................................. 42
2.6. Rôle du conseiller en génétique ..................................................................................................................... 42
MESSAGES PRINCIPAUX ET CONCLUSION ......................................................................... 44
BIBLIOGRAPHIE.................................................................................................................. 45
3
Le but de cette formation est de permettre aux stagiaires membres d'associations de malades de :

Comprendre en quoi consiste un test génétique, et savoir l'expliquer

Etre capable d'indiquer dans les grandes lignes les champs d'application, les possibilités et les
limites de tels tests

Pouvoir évaluer de façon critique les informations concernant les tests génétiques

Vous pouvez considérer que les notions de biologie et les applications des tests génétiques
mentionnées dans ce fascicule resteront valables pour les 5 ans à venir. Cependant, comme dans
tous les domaines des sciences elles sont amenées à changer en fonction de l'évolution des
technologies, des connaissances, et de la société.
Symboles utilisés dans ce fascicule
Nous avons utilisé les symboles suivants pour faciliter la lecture de ce fascicule :



Attention, confusion ou erreur à ne pas commettre
Point(s) à retenir
Complément d'information
4
Introduction
L'ADN et par conséquent la génétique tiennent aujourd'hui une part importante dans notre
quotidien. On parle de « carte d'identité » ou de « patrimoine » génétique, de « terrain » ou de
« prédisposition » génétique … Les tests génétiques ne sont pas confinés à la médecine mais
envahissent la sphère juridique (tests d'identification judiciaire), sociale (tests de paternité) …
Il est vrai que les tests génétiques constituent une avancée fondamentalement différente des tests
antérieurs (biochimiques, morphologiques …) puisqu'ils ouvrent des perspectives bien plus vastes,
et notamment la possibilité de prédire, avec plus ou moins de fiabilité, la survenue de certaines
maladies. Néanmoins, il faut considérer les tests qu'ils soient biochimiques, génétiques ou
morphologiques en fonction de leur finalité et non de la technique sous-jacente.
Les tests génétiques sont des tests basés sur l’analyse de notre matériel génétique (analyse de
chromosomes, de l’ADN, d’un gène spécifique ou de son produit) pour mettre en évidence des
modifications génétiques. Ils peuvent faire appel à un large panel de techniques. Pour mieux
comprendre le principe et l’intérêt de tels tests, il est important de revoir certaines notions de bases
de génétique. C’est le thème du 1er chapitre.
Bases indispensables de biologie
[1. CELLULE, CHROMOSOME, ADN, GENE]
1.1. Cellule
La cellule est la plus petite unité capable de vivre de façon autonome. Notre organisme est composé
de l’ordre de 50 000 milliards de cellules qui communiquent entre elles et sont associées de manière
très structurée pour former un individu. Chacune de ces cellules est issue de la division d'une cellule
unique, la cellule oeuf, qui s'est divisée en 2, puis en 4, puis en 8 …
Il existe environ deux cents types de cellules chez l’homme, chacune assurant une fonction plus ou
moins spécialisée : les globules rouges transportent l’oxygène dans le sang, les lymphocytes ou
globules blancs interviennent dans la défense immunitaire (fabrication d'anticorps, destruction de
microbes), les follicules pilaires produisent des poils, etc.
La cellule est organisée comme une vraie usine miniature avec des systèmes de stockage, de
transport, de communication … dont beaucoup sont assurés par des protéines spécialisées. Les
protéines, composées d'acides aminés, jouent de multiples rôles dans la cellule. Certaines ont un
rôle architectural (par exemple la tubuline forme des câbles en forme de tube), d'autres forment des
canaux ou des pores (par exemple l'aquaporine laisse entrer ou non l'eau dans la cellule), d'autres
servent de messager (par exemple l'insuline qui régule le taux de sucre dans le sang), ou
transportent des substances (par exemple l'hémoglobine transporte l'oxygène), ... Les instructions
pour fabriquer ces protéines sont inscrites dans l’ADN.
5
1.2. Chromosomes et caryotype
Chromosomes
Toutes les cellules de notre organisme (exceptées les globules
rouges et les cellules sexuelles) possèdent la même
information génétique, située dans un compartiment de la
cellule appelé le noyau. Cette information est contenue dans
des petites structures visibles au microscope, les
chromosomes. Nous en possédons 23 paires (soit 46
chromosomes par cellule).
Pourquoi ces paires ?… Simplement parce que nous devons initialement notre existence à la
rencontre d'un spermatozoïde et d'un ovule. Le premier provient de notre père qui nous a légué la
moitié de son patrimoine génétique, sous forme d'un lot de 23 chromosomes. Le second vient de
notre mère et contenait lui aussi 23 chromosomes. Nous avons donc chacun 23 paires de
chromosomes. Parmi celles-ci, 22 sont communes aux 2 sexes et sont appelés autosomes. La vingttroisième paire est la paire de chromosomes sexuels et intervient notamment dans la détermination
du sexe de l’individu (XX chez la femme et XY chez l’homme).
Caryotype
La cartographie complète des chromosomes du
noyau d'une cellule s'appelle un caryotype.
Il permet notamment de mettre en évidence des
anomalies :
- de nombre de chromosomes, comme dans la
trisomie 21 où il y a, dans chaque cellule, 3
chromosomes 21 au lieu de 2
- de structure des chromosomes, notamment des
remaniements chromosomiques
Caryotype masculin normal (46 chromosomes dont la
paire de chromosomes sexuels XY)
1.3. ADN
Les chromosomes sont composés d'un long « fil » d’ADN (Acide
désoxyribonucléique) empaqueté sous forme très compacte : un noyau
de cellule humaine, dont le diamètre est de quelques millièmes de
millimètre, renferme près de 2 mètres d'ADN !
L'ADN adopte une structure en double hélice. Si on la « déroule »
(figure ci-dessous), elle ressemble à une échelle.
Les « montants » de l’échelle sont composés de sucres (le désoxyribose) et de phosphate, ils servent
à donner une certaine rigidité à la molécule d’ADN. Les « barreaux » de l'échelle contiennent
l'information génétique. Ils sont composés de 4 substances chimiques appelées bases : l'adénine (A),
la thymine (T), la cytosine (C) et la guanine (G). Le « langage » ADN est ainsi écrit à l’aide de 4
« lettres », qui sont les bases A, T, G et C. Ces bases s'associent toujours par paire de la même
façon : la cytosine avec la guanine (C-G) et la thymine avec l'adénine (A-T). Chaque brin est donc
complémentaire de l'autre. De façon grossière, on peut dire que chaque brin est l'image en miroir de
l'autre brin. Dans chacune de nos cellules, notre ADN est composé d’environ 3 milliards de paires
de bases !
6

L’ADN ressemble à une échelle dont les montants sont composés de sucre (le désoxyribose) et d'acide phosphorique
(d'où le nom de l'ADN ; le mot « nucléique » faisant référence au fait qu'on le trouve dans le noyau de la cellule). Les
barreaux sont faits de 4 types de bases (A, T, G et C).

En résumé, toutes nos cellules, sauf les cellules sexuelles, contiennent la même information
génétique, contenue dans notre ADN. Cet ADN est empaqueté sous forme très compacte, formant
des chromosomes. Les êtres humains en possèdent 23 paires dans chacune des cellules de
l’organisme (autres que sexuelles).
1.4. Le gène, l'unité de base d'information génétique
On définit un gène comme l’ensemble des séquences d’ADN (régions régulatrices et codantes)
permettant la synthèse, c'est-à-dire fabrication, d’une protéine donnée. Il est situé à un certain
endroit (appelé locus) d'un chromosome. Par exemple, le gène de la kératine est la portion d'ADN
nécessaire et suffisante pour produire la kératine, qui est la protéine constituant le cheveu (voir
illustration ci-dessous).
bras court
(appelé p)
Chromosome 12
bras long
(appelé q)
double hélice
d'ADN
brin
d'ADN
Séquence partielle
du gène de la kératine 1
ATGAGTCGACAGTTTAGTTCCAGGTCTGGGTACCGAAGTGGAGGGGGCT
TCAGCTCTGGCTCTGCTGGGATCATCAACTACCAGCGCAGGACCACCAG
CAGCTCCACACGCCGCAGTGGAGGAGGTGGTGGGAGATTTTCAAGCTGT
GGTGGTGGTGGTGGTAGCTTTGGTGCTGGTGGTGGATTTGGAAGTCGGA
GTCTTGTTAACCTTGGTGGCAGTAAAAGCATCTCCATAAGTGTGGCTAG
AGGAGGTGGACGTGGTAGTGGCTTTGGTGGTGGTTATGGTGGTGGTGGC
TTTGGTGGTGGTGGCTTTGGTGGTGGTGGCTTTGGTGGAGGTGGCATTG
GGGGTGGTGGCTTTGGTGGTTTTGGCAGTGGTGGTGGTGGCTTTGGTGG
AGGTGGTTTTGGGGGTGGTGGATATGGGGGTGGTTATGGTCCTGTCTGC
CCTCCTGGTGGCATACAAGAAGTCACTATCAACCAGAGCCTTCTTCAGC
CCCTCAATGT … …
(ici 500 pb)
Du chromosome au gène. A gauche, le chromosome tel qu'on le voit au microscope. Au centre, zoom sur une portion
du chromosome montrant la double hélice d'ADN qui le compose. Seule la séquence d'un brin de cette double hélice (à
droite) est représentée, la séquence de l'autre brin s'en déduisant automatiquement grâce aux règles de complémentarité
de l'ADN (A est toujours associé à T et C à G).
7
Le génome d'un individu est l'ensemble de ses gènes. Le génome spécifie donc l'ensemble des
caractères d'un individu (visibles et non visibles). On estime à environ 20 000 le nombre de gènes
chez les humains.
Attention ! Seule une petite partie de notre ADN, de l’ordre de 5%, correspond à des gènes (on
parle de « partie codante de l’ADN ») ! Le reste de l’ADN (région non codante) contient entre
autres des régions régulatrices de l’activité des gènes ou des portions d’ADN dont on ne connaît pas
encore la fonction.

Vous pouvez entendre l'expression, « gène de la phénylcétonurie », « gène de la mucoviscidose »,
… Attention, ce n'est pas un gène qui cause une maladie ! Au contraire, c'est l'absence ou des
modifications de ce gène (voir chapitre suivant) qui provoque la maladie, ou y prédispose.
1.5. Le code génétique
Le code génétique, découvert dans les années soixante, est la façon dont la cellule déchiffre la
séquence d'ADN pour fabriquer la protéine correspondante.

Sans rentrer dans les détails, on comprend assez bien aujourd'hui la « grammaire » de l'ADN qui est
relativement simple. Par exemple, en français, le début d'une phrase est signalé par une majuscule,
et la fin, par un point. De la même façon, l'instruction de début de fabrication d'une protéine est
codée par un groupe de 3 bases ou « codon » (ATG), et l'instruction de fin de fabrication d'une
protéine est codée au choix par l'un des triplets suivants : TGA, TAA, TAG. Enfin, comme en
français, c'est l'ordre des lettres (ici, l'enchaînement des bases) qui donne son sens au message.
Notez qu'en français, on peut faire un nombre quasi infini de phrases à partir de seulement 26
lettres. De même, l'ADN humain contient environ 20 000 gènes à partir de seulement 4 « lettres ».
La différence, bien sûr, c'est qu'à cause de ce très faibles nombres de lettres les instructions de
l'ADN (les « gènes ») sont beaucoup plus longues (en moyenne des milliers de bases).
[2. MUTATION, ALLELE, POLYMORPHISME]
2.1. Les modifications génétiques

En général, le terme de mutation s'accompagne d'un préjugé négatif. Il évoque en premier lieu
quelque chose d'anormal se traduisant par des malformations ou une maladie. Il faut dire que la
science-fiction avec son lot de mutants en tout genre a largement contribué à l'ancrage de ce
préjugé. Pourtant, nous sommes tous des mutants, comme nous allons le voir ci-dessous !
Définitions
Les modifications génétiques peuvent intervenir à deux échelles :
- anomalies de nombre ou de structure des chromosomes. On parle dans ce cas d'anomalies
chromosomiques. Elles sont généralement visibles au microscope. Exemple : Trisomie 21 (3
chromosomes 21 au lieu de 2)
8
Caryotype d'une fille atteinte de trisomie 21
-
anomalies touchant des régions bien plus petites de l'ADN. On parle dans ce cas de mutations
(génétiques). Nous nous concentrerons sur ce type de mutations dans le paragraphe suivant.
Mutations génétiques
Une mutation est une modification de la séquence de l'ADN. Il en existe différents types :

Substitution ou mutation ponctuelle (une paire de bases est remplacée par une autre) :
La mutation est dite :
- neutre si elle ne modifie pas la séquence en acides aminés de la protéine
- faux-sens si elle entraîne la modification de la séquence en acides aminés de la protéine
- non sens si elle entraîne l'apparition d'un signal « stop » qui interrompt la fabrication de la
protéine.
L’exemple ci-dessous illustre l'effet d'une mutation ponctuelle non-sens dans le gène de la -globine
(un des gènes servant à la fabrication de l’hémoglobine). Le remplacement d'une seule base, C par
un T au niveau du codon 39 du gène de la béta-globine provoque l'incorporation d'un signal stop à
la place de la glutamine, et donc l’arrêt de synthèse de la protéine. Ceci aboutit à une maladie, la
thalassémie, caractérisée par un défaut de fabrication de l’hémoglobine.
Portion du gène
de la -globine :
… C CAG …
… C TAG …
│ │││
│ │││
… G GTC …
… G ATC …
Séquence de la
protéine -globine … glutamine …
correspondante :
… stop
 Insertion : une (ou plusieurs) base est ajoutée à la séquence d'ADN. Le reste du message est
alors décalé, et donc en général perturbé.
ATGCGGTATGT
│││││││││││
ATGCGATGTATGT
→
│││││││││││││
TACGCCATACA

TACGCTACATACA
Délétion : une (ou plusieurs) base est supprimée de la séquence d'ADN. De même le reste du
message est décalé et la protéine perd, dans la plupart des cas, sa fonctionnalité.
ATGCGGTATGT
│││││││││││
TACGCCATACA
ATGCTATGT
→
│││││││││
TACGATACA
9

Ce sont toutes ces anomalies de l'ADN que l'on cherche à mettre en évidence dans le cas d'un test
génétique.

Les mutations peuvent être soit neutres (sans effet), soit bénéfiques, soit nocives.
Cette notion de mutation « bénéfique » ou « nocive » peut varier en fonction de l'environnement ou
d'autres paramètres. Par exemple, dans le cas de la couleur de la peau, une peau foncée protège du
soleil sous les tropiques (risque plus faible de développer un cancer de la peau). Au contraire, dans
l'hémisphère Nord, elle favorise le développement du rachitisme et nécessite chez l'enfant une
prévention alimentaire par la vitamine D.

Vous comprenez maintenant que l'ADN n'est important qu'en tant que support de l'information
génétique ; ce qui détermine l'effet néfaste ou non d'une mutation dans un gène, c'est son impact sur
la protéine codée par ce gène, et ceci, dans un contexte environnemental donné.
D’autre part, il n'existe PAS de règle toute faite permettant de prédire la gravité d'une mutation quel
qu’en soit le type.
10

Pour garder l'analogie du « langage » de l'ADN, les mutations correspondent à des erreurs de
frappe. Prenons la phrase suivante en français « j'utilise de la colle ». Différentes mutations
possibles et leurs conséquences sont détaillées ci-dessous.
Phrase
J'utilise de la colle.
Type d'événement
-
J'utilise de lalcolle.
J'utilise deula colle.
J'uti sanglots de lise
J'utilise .. la colle.
J'uti...........olle.
Insertion d'un l
Insertion d'un u
Longue insertion
Délétion
Délétion
Changement de sens
Phrase compréhensible
Phrase incompréhensible
Phrase compréhensible
Phrase incompréhensible
Mutation neutre
Mutation faux-sens
Mutation faux-sens
Mutation non-sens
Sens inchangé
Phrase dure à comprendre
Phrase compréhensible
Phrase tronquée, illisible
J'utilise
J'utiliss
J'utilise
J'utilise
de la Colle.
de la colle.
de la kolle.
de.
Conséquence
-
On voit que, suivant le contexte, et par le fait du hasard, certaines modifications peuvent laisser la
phrase inchangée, changer son sens, la rendre dure à lire, la rendre incompréhensible ou tronquée
donc illisible. Il en va exactement de même pour l'effet des mutations dans l'ADN, les phrases
correspondant à des protéines. Les mutations peuvent laisser ces dernières inchangées, les rendre
moins actives ou inactives, leur conférer une fonction différente (potentiellement toxique), les
rendre totalement inactives, les tronquer ou empêcher leur production.
2.2. Allèles d'un gène : Allèle dominant ou récessif
Dans chacune de nos cellules (sauf les cellules sexuelles), chaque chromosome est en deux
exemplaires, non identiques, l'un hérité de notre père et l'autre de notre mère. Par suite, chaque
gène peut être présent en deux versions, chacune portée par un chromosome de chaque paire ; on
appelle ces différentes versions des allèles.
On distingue les allèles dominants (le caractère correspondant s'exprime toujours) des allèles
récessifs (muets lorsqu'ils sont associés à l'allèle dominant). Il existe parfois des allèles codominants : les caractères associés aux deux allèles en présence s'expriment. Autrement dit, un
allèle récessif ne s'exprime que lorsque la cellule possède cet allèle en double exemplaire. On dit
que la cellule est « homozygote » pour ce gène. Alors qu’un allèle dominant s’exprime même si la
cellule est hétérozygote pour ce gène (c’est-à-dire que le gène est trouvé sous forme de deux allèles
différents, un dominant et un récessif). Le génotype d'un individu est la description de ses allèles.
Pour illustrer la notion de récessif et dominant, prenons l’exemple des gènes codant pour le groupe
sanguin. De façon simplifiée, on peut dire que le gène codant pour le groupe sanguin ABO dicte la
synthèse de marqueurs spécifiques (protéines) à la surface des globules rouges (marqueurs A ou B).
Il existe 3 allèles pour ce gène : l’allèle A qui conduit à la synthèse du marqueur A, l’allèle B qui
conduit à la synthèse du marqueur B et l’allèle O qui conduit à l’absence de synthèse de marqueur.
Les allèles A et B sont co-dominants, l’allèle O est récessif. Une personne a un groupe sanguin O,
elle a forcément deux allèles « o » pour ce gène. Alors qu’une personne de groupe sanguin A peut
11
avoir soit deux allèles « A », soit les allèles « A » et « o ». Tous les cas possibles sont illustrés dans
la figure ci-après :
Caractère (co-)dominant ou récessif des allèles du gène impliqué dans le groupe sanguin ABO
Les bâtonnets jaunes représentent des chromosomes et la position du gène est indiqué par un trait horizontal sur le
chromosome. Ce gène peut exister sous la forme de 3 allèles :
1. A co-dominant
2. B co-dominant
3. o récessif
2.3. Polymorphisme
Les mutations génétiques peuvent avoir des conséquences +/- graves et conduire éventuellement à
une maladie, mais dans la plupart des cas, elles ne sont pas pathogènes, voire même n’ont pas de
conséquence détectable. On parlera alors de polymorphisme génétique (du grec poly-, plusieurs et morphos, forme : « qui peut prendre plusieurs formes »). Le polymorphisme génétique correspond
donc à des variations naturelles d'une séquence d'ADN au sein d'une population. Ces variations de
séquences sont dues à des mutations successives au cours de l’évolution et qui rendent compte
d’une certaine diversité entre les individus.
Le polymorphisme peut intervenir soit au niveau des séquences codantes des gènes mais sans
perturber leur expression correcte, soit dans les autres régions de l’ADN. Ce sont ces
polymorphismes génétiques qui sont détectés lors des tests de paternité ou lorsque la police
scientifique réalise des empreintes génétiques sur un suspect.

En jargon, on parle de mutation quand il s'agit d'une modification génétique nocive et de
polymorphisme quand ce n'est pas le cas. La question délicate, quand on repère une mutation dans
un gène, est bien sûr de savoir s'il s'agit d'une modification potentiellement toxique ou d'un
polymorphisme inoffensif. En pratique, les mutations qui provoquent des maladies monogéniques
sont toutes rares. Ainsi quand on trouve des modifications génétiques qui sont présentes chez plus
d’1% de la population, on dit qu'il s'agit de polymorphismes. Si ces modifications sont moins
répandues, il faut les étudier plus en détail. D'où l'importance des études de génétique des
populations.
12
2.4 Causes et transmission des mutations
Une mutation peut survenir à tout moment dans n'importe quelle cellule de l'organisme. Elle peut
être spontanée (résultant d'une erreur de recopiage de l'ADN car aucun système n’est parfait…) ou
induite par des agents qualifiés de « mutagènes », qui peuvent être chimiques ou physiques (par
exemple les rayons ultra-violets ou la cigarette). Nous réparons l'immense majorité des mutations
mais parfois celle-ci échappe à la réparation et se « fixe » dans l'ADN. Une mutation ne sera
transmissible que si elle se produit au niveau des cellules sexuelles. La descendance héritera alors
de la mutation. Si une mutation apparaît dans un autre type de cellule (par exemple dans le foie),
elle ne sera pas transmissible à la descendance mais pourra quand même provoquer une maladie
chez l'individu touché (cancer du foie, par exemple).


Une mutation avec laquelle naît un individu, qui est donc présente dans toute les cellules de son
corps, est dite constitutive
Une mutation « nouvelle », qui est présente chez un individu mais pas chez ses parents est une
néomutation (ou mutation de novo)
13
[3. MALADIES MONOGENIQUES ET MALADIES MULTIFACTORIELLES]
3.1. Définitions : Maladie familiale, héréditaire, congénitale, génétique

Attention ! Il est très important de ne pas confondre ces différents termes !
-
Une maladie congénitale est une maladie présente à la naissance.
Une maladie génétique est une maladie dans laquelle les gènes jouent un rôle important. Une
telle maladie est causée par une (ou plusieurs) modification(s) génétique(s).
Une maladie (génétique) héréditaire est une maladie causée par une modification génétique
transmise de génération en génération.
Une maladie familiale est une maladie qu'on retrouve chez plusieurs membres d'une famille, sur
plusieurs générations.
Essayons ensemble de mieux comprendre ces termes. Voici différentes affirmations qui sont toutes
vraies :
- Certaines maladies n’ont pas d’origine génétique (ex : rhume, gastroentérite).
- Certaines maladies familiales ne sont pas héréditaires
- Toutes les maladies héréditaires sont génétiques, mais certaines maladies génétiques ne sont pas
héréditaires
- Une maladie congénitale n'est pas toujours d’origine génétique
Une maladie familiale peut ne pas être héréditaire. Son caractère familial peut aussi être dû à un
environnement commun nocif partagé par la famille. Par exemple, dans certaines régions il était
courant que tous les membres masculins d'une famille aient une silicose (grave maladie des
poumons causée par l'ingestion de silice). Pourtant, celle-ci n'était pas du tout génétique mais due au
travail que faisaient la majorité des hommes dans la famille : mineur de fond.
Une maladie génétique n’est héréditaire que si la modification génétique correspondante est
présente dans les cellules sexuelles. Au contraire, une maladie génétique résultant d’une mutation
acquise à l’âge adulte dans d’autres cellules (par exemple cancer de la peau due à une exposition
prolongée aux UV) ne peut pas être transmise à la descendance et n’est donc pas héréditaire. On
estime à 5% le nombre de cancers d’origine héréditaire.
Certaines maladies congénitales sont dues à des agressions du fœtus par des substances chimiques
(la mère a pris de la thalidomide, médicament toxique, pendant la grossesse) ou virales (la mère a
eu la rubéole pendant le 1er trimestre de sa grossesse). Dans ce cas, la maladie ne sera pas présente
dans le reste de la famille (elle n'est donc pas familiale) et n’a pas d’origine génétique.
3.2. Maladies (génétiques) monogéniques
Les maladies dites monogéniques sont nombreuses (estimées à plus de 5 000) mais en général de
fréquence très rare. Elles sont souvent invalidantes voire fatales en l’absence de traitement ou de
prévention.
Dans le cas des maladies monogéniques à forte pénétrance (voir page 18), la présence d'un allèle
particulier (en simple ou en double exemplaire selon si la maladie est de transmission dominante ou
récessive) pour un seul gène est corrélé à une forte probabilité de développer la maladie, et ceci
14
quelque soit l'environnement dans lequel la personne vivra après sa naissance. C'est le cas
notamment de la maladie de Huntington, de la mucoviscidose ou des myopathies.
Transmission des maladies monogéniques

Transmission autosomique dominante (= dominante non liée à l'X)
Une maladie monogénique est dite « autosomique dominante » si :
- le gène associé à la maladie est situé sur un chromosome non sexuel
et
- la présence d’un seul allèle muté suffit à ce que la maladie se développe
La probabilité, lorsque l’un des 2 parents possède cet allèle, qu’il le transmette à son enfant est
alors de 50 %, et ceci à chaque grossesse, comme l'illustre le tableau ci-dessous.
Illustration des combinaisons possibles de chromosomes 4 et de leur conséquence dans le cas d'une maladie
autosomique dominante
Exemples de maladies monogéniques dominantes : maladie de Huntington, polypose colique,
syndrome de Marfan, polykystose rénale dominante …

Transmission autosomique récessive (ou récessive non liée à l'X)
Au contraire, une maladie monogénique est dite « autosomique récessive » si :
- le gène associé à la maladie est situé sur un chromosome non sexuel
et
- il faut que les deux allèles soient mutés pour que la maladie se développe
Dans le cas d'une maladie récessive, l'individu porteur d’un seul allèle muté ne développe pas de
maladie (ou une forme mineure), l’autre allèle « normal » étant suffisant pour empêcher
l’apparition de la maladie. La personne a alors le statut de « porteur sain » : elle n'est pas
atteinte mais peut transmettre la maladie. La probabilité lorsque chacun des parents est « porteur
sain » d’avoir un enfant qui possède les deux allèles mutés, et donc risque de développer la
maladie, est de 25 % (schéma ci-dessous). Les mariages consanguins augmentent la probabilité
d’avoir un enfant atteint d’une maladie autosomique récessive.
15
Illustration des combinaisons possibles de chromosomes 7 et de leur conséquence dans le cas d'une maladie
autosomique récessive
Exemples de maladies monogéniques récessives : mucoviscidose, drépanocytose …

Transmission dominante liée à l'X
Une maladie monogénique est dite « dominante liée à l’X » si :
- le gène associé à la maladie est situé sur le chromosome sexuel X
et
- la présence d’un seul allèle muté suffit à ce que la maladie se développe
La probabilité, lorsque l’un des 2 parents possède cet allèle, qu’il le transmette à son enfant est
alors de 50 %, et ceci à chaque grossesse, comme l'illustre le tableau ci-dessous.
Cas où la mère est malade
Cas où le père est malade
Exemples de maladies monogéniques dominantes liées à l’X : syndrome de l’X fragile,
rachitisme non traitable par la vitamine D …

Transmission récessive liée à l'X
Lorsque le gène impliqué dans une maladie monogénique récessive est situé sur le chromosome
X, la situation est différente de celle d’une maladie autosomique récessive. La maladie
surviendra presque exclusivement chez les hommes, puisqu’ils ne possèdent pas de deuxième
16
chromosome X qui puisse apporter l’allèle « normal ». Une femme porteuse d'un allèle muté
porte dans l'immense majorité des cas un allèle normal sur son autre chromosome X (l'allèle
muté étant très rare, il y a peu de chances qu'elle en ait hérité deux). En général elle ne
développera donc pas de maladie mais sera porteuse saine.
Exemples de maladies monogéniques récessives liées à l’X : dystrophie musculaire de
Duchenne, hémophilies …
Cas où la mère est porteuse saine
Cas où le père est malade

Dans ce chapitre, nous avons supposé que le gène associé à la maladie était situé sur une des 23
paires de chromosomes du noyau. En fait, il existe aussi un peu d'ADN en dehors du noyau, dans un
compartiment appelé mitochondrie. Le mode de transmission est dans ce cas différent, les
mitochondries étant transmises exclusivement par la mère ;
Les caractéristiques pour ce type de maladies sont les suivantes :
- Aussi bien les hommes que les femmes peuvent être atteints et peuvent avoir des symptômes
très variables (diabète, surdité, etc.).
- Seules les femmes transmettent la maladie.
- Les enfants d'une femme atteinte ne sont pas tous atteints.
Nous ne parlerons pas en détails ici de cette classe de maladies.

En moyenne nous sommes porteurs de 7 mutations correspondant à une maladie monogénique
récessive, présentes en un seul exemplaire ! Autrement dit, nous pouvons tous transmettre une
maladie à nos enfants si notre conjoint(e) est aussi porteur d'une de ces mutations. La raison pour
laquelle les maladies récessives sont malgré tout rares est que nous avons 20 000 gènes : la
probabilité que nous rencontrions quelqu'un qui porte l'une des mêmes 7 mutations que nous parmi
ces 20 000 gènes est donc faible.
17
Notion de pénétrance
Deux individus, porteurs de la même mutation dans un gène donné, ne vont pas forcément présenter
les mêmes symptômes de la maladie.

La « pénétrance d’une mutation » associée à une maladie monogénique dominante correspond à :
nombre d’individus porteurs de cette mutation et malades
Pénétrance d'une mutation =
nombre total d’individus porteurs de cette mutation
La pénétrance varie de 0 (ou 0 %) à 1 (ou 100 %). Si la pénétrance est complète (pénétrance=1),
tous les individus porteurs de la mutation seront malades. Si la pénétrance est incomplète
(pénétrance<1), un sujet porteur de la mutation pourra ne présenter aucun signe de la maladie
Il s'agit d'une notion très importante, car en pratique la plupart des maladies monogéniques ne sont
pas à pénétrance complète. Quels sont les facteurs qui modulent la pénétrance ? Il peut s’agir d’effet
de l’environnement : effet de l’environnement interne, génétique, lié à la présence d’autres gènes
(notamment les gènes « modificateurs ») ou effets de l’environnement extérieur.
Exemple : La phénylcétonurie est une maladie récessive. Dans cette pathologie, la présence de 2
allèles particuliers d’un même gène (le gène codant pour la protéine « phénylalanine-hydroxylase »)
provoque l’incapacité de cette protéine de transformer correctement la phénylalanine (un des acides
aminés présents dans la nourriture) en tyrosine. Ceci entraîne l’accumulation de composés toxiques
pour le cerveau et un retard mental important dès l’enfance. Sans précaution particulière, la
pénétrance de cette maladie est très élevée. Mais un dépistage systématique à la naissance (par un
test de nature biochimique qui mesure l’activité de l’enzyme correspondante) a permis depuis 30
ans de sauver tous les enfants ayant hérité de ces allèles par la mise en place dès la naissance d’un
régime alimentaire strict pauvre en phénylalanine et enrichi en tyrosine. Ainsi même quand la
pénétrance d’une maladie est extrêmement forte dans un environnement habituel, un changement de
cet environnement peut rendre cette pénétrance quasi nulle.
Enfin, la pénétrance peut varier avec l’âge. Par exemple, la maladie de Huntington est une maladie
neurodégénérative à déclenchement tardif. La pénétrance varie avec l’âge : elle est de 0 % à la
naissance, alors qu’à 30 ans, 20 % des sujets ont des signes de la maladie, contre 40 à 50 % à 40
ans, et 80 % à 60 ans.

Dans une maladie à pénétrance variable, il peut y avoir des « sauts de génération », c’est-à-dire des
générations où personne ne déclare les symptômes de la maladie bien que les individus soient
porteurs de la mutation alors que leurs enfants porteurs de la même mutation seront eux atteints.

Il est très important de garder à l'esprit la notion de pénétrance lorsque l’on aborde la question des
tests génétiques. Lorsque la pénétrance d’une maladie est forte mais pas totale, ce qui est le cas le
plus courant, la maladie ne se déclare pas systématiquement chez toute personne possédant l’allèle
(ou les deux allèles) en cause. Le test génétique ne donne alors qu'une probabilité, plus ou moins
importante, de survenue de la maladie.
18
3.3. Maladies multifactorielles
Des causes génétiques, sociales, environnementales interagissant les unes avec les autres
Outre les maladies monogéniques décrites ci-dessus dont la fréquence au sein de la population est
faible, une composante génétique est également présente dans des affections très fréquentes, telles
que les maladies cardiovasculaires, l’obésité, l’hypertension, les diabètes, les maladies
inflammatoires, certains cancers … Ces maladies sont dites multifactorielles et présentent les
caractéristiques suivantes :
 il existe une tendance familiale certaine
 mais leur transmission au sein d’une famille n’est pas compatible avec une hérédité de type
maladie monogénique
Ces maladies multifactorielles impliquent très souvent la présence simultanée de nombreux allèles
de gènes différents, et ayant chacun un effet limité. Chacun de ces variants génétiques, considéré
isolément, n'est ni indispensable ni suffisant pour entraîner la maladie. Au contraire, celle-ci
n'apparaît que lorsqu'un certain « seuil » de susceptibilité est dépassé et ce seuil peut être atteint par
l'action conjointe de facteurs génétiques (diverses combinaisons d'allèles correspondant à plusieurs
gènes) et de facteurs environnementaux.
Notion de gène de susceptibilité
On définit ainsi un gène de susceptibilité (il serait plus correct de dire un « allèle de
susceptibilité »…) comme un gène qui, combiné à l'action d’autres facteurs (génétiques,
environnementaux) peut être responsable d'une maladie. Un gène de susceptibilité pour une maladie
ne pourra pas à lui seul causer l’affection, toutefois sa présence augmente le risque pour l’individu
de développer la maladie.
Nous revenons sur cette notion et sur l’identification de tels gènes dans le chapitre suivant.
19
[4. COMMENT SONT IDENTIFIES DES GENES DE SUSCEPTIBILITE]
Il est rare qu'une maladie, ou d'ailleurs tout caractère physique ou comportemental, soit à 100%
contrôlé par le patrimoine génétique d'un individu. En général les gènes et l'environnement
« coopèrent » pour façonner un individu. Comment peut-on quantifier la part de la génétique et
celle de l'environnement dans l’apparition d’une maladie ? Peut-on identifier un ou plusieurs gènes
de susceptibilité, et comment ? La réponse à ces questions comporte trois étapes : montrer que la
maladie est familiale, montrer que cette tendance familiale est due à des facteurs génétiques, et
enfin identifier d'éventuels gènes impliqués.
4.1. Identification d'une composante génétique
Montrer que la maladie est familiale : principe
Pour démontrer qu’une maladie est familiale, on peut par exemple montrer que chez les apparentés
du 1er degré des malades (parents, frères, sœurs ou enfants), la maladie est plus fréquente que dans
la population générale (sujets « témoins » ou « de référence »). Pour faire ces comparaisons, il est
nécessaire de tenir compte de l’âge, du sexe, et même de l’ethnie des apparentés des sujets malades
ou témoins, de façon à comparer ce qui est comparable.
Recherche d'une composante génétique

Maladie familiale ne veut pas toujours dire maladie génétique !
Pour prouver qu'une maladie a une composante génétique, une solution consiste à faire appel à des
jumeaux. Considérons tout d'abord des vrais jumeaux. Ceux-ci ont un patrimoine génétique
identique à 100% (ce sont des clones). Mais ils partagent aussi un environnement très similaire
(familial, scolaire, culturel, etc.), ce qui brouille les cartes : si lorsqu'un vrai jumeau a une maladie,
l'autre l'a aussi, comment savoir si c'est une conséquence de leur patrimoine génétique commun ou
de leur environnement commun ? En théorie, il existe une méthode presque idéale : étudier des
vrais jumeaux séparés à la naissance (adoption par deux familles différentes). Ainsi, s'ils ont des
traits de caractère ou des maladies communes, cela ne viendra plus d'un environnement commun, et
donc sera attribuable principalement à une composante génétique. Le taux de similarité pour une
certaine caractéristique (maladie, trait de comportement …) est appelé taux de concordance. Par
exemple, dans le tableau ci-après, vous pouvez voir que le taux de concordance entre deux jumeaux
monozygotes (vrais jumeaux) pour une fente labiale est de 30% : autrement dit, si un des deux
jumeaux a une fente labiale, la probabilité que l'autre en ait une aussi est de 30%.
En pratique, il existe très peu de vrais jumeaux séparés à la naissance ! On a donc recours à une
astuce : on compare des vrais jumeaux et des faux jumeaux. En effet, des faux jumeaux partagent le
même environnement autant que des vrais jumeaux, mais n'ont en commun en moyenne que 50%
de leurs gènes (contre 100% chez des vrais jumeaux). Les différences de taux de concordance
observées entre les vrais et faux jumeaux sont donc (en théorie) d’origine génétique.
Le tableau ci-après donne plusieurs exemples. Ainsi, dans le cas du diabète insulinodépendant, la
prévalence (la fréquence au sein de la population) est de 0,4%, alors que la prévalence pour les
apparentés des malades est 12 fois plus élevée (5%) : il s'agit donc d'une maladie familiale. Le taux
de concordance entre vrais jumeaux est de 40%, soit 8 fois plus élevé que le taux de concordance
entre faux jumeaux (dizygotes) : ceci indique que la maladie a bien une composante génétique. Si
l'on regarde le taux de concordance entre vrais jumeaux, et qu'on le compare au taux de
concordance entre faux jumeaux, l'autisme semble avoir la composante génétique la plus forte (80%
20
de concordance pour les vrais jumeaux contre seulement 3% chez les faux jumeaux), suivi par la
schizophrénie (50% contre 15%).
Prévalence (fréquence au sein de la population) de quelques maladies multifactorielles chez les apparentés des
malades et des témoins, et dans la population générale, et taux de concordance chez les jumeaux.
D'après Médecine-Sciences 2005, 21(11), p 927-33
4.2. Identification de gènes de susceptibilité
Attention, quand on parle d'un gène de susceptibilité, on veut dire en fait qu'on a identifié un gène
dont un allèle confère une susceptibilité. Par exemple, ce n'est pas le gène HLA B qui confère une
susceptibilité à la spondylarthrite ankylosante (tout le monde a ce gène, ou plus précisément un ou
deux allèles de ce gène !). C'est l'allèle HLA B27 de ce gène qui confère un risque.
D'autre part, dans de nombreux cas, l'effet d'un allèle « à risque » est si faible que c'est la
combinaison de plusieurs allèles « à risque » qui déterminera une susceptibilité générale à
développer une maladie.

Quand on parle de « gène de susceptibilité », il s’agit en fait « d'allèle(s) de susceptibilité » !
Deux modèles d’étude pour les maladies multifactorielles
En raison de la complexité de la génétique des maladies multifactorielles, de l’importance des
combinatoires entre allèles de susceptibilité pour plusieurs gènes donnés, du mode d’interaction de
ces derniers, le généticien essaie de simplifier la situation en établissant des modèles théoriques qui
miment la situation réelle. On utilise essentiellement deux modèles : le modèle « polygénique » ou
« multifactoriel », et le modèle « mixte ».
Dans le premier modèle, on suppose que la susceptibilité à développer la maladie est sous la
dépendance d’allèles de nombreux gènes et de facteurs environnementaux dont l’effet individuel est
mineur : aucun des gènes impliqués n’est obligatoire. La contribution au développement de la
maladie de chaque allèle individuel est très petite. C’est au contraire le cumul d’un certain nombre
d’allèles de susceptibilité qui déterminera l’apparition de la maladie (effet seuil).
Dans le second modèle dit « mixte », la susceptibilité est sous le contrôle d’un gène majeur, dont
l’action est toutefois modulée par plusieurs autres gènes et des facteurs environnementaux.
21
Principe des études pour les maladies multifactorielles
Fondamentalement le concept des études pour les maladies complexes est environ le même que
pour les maladies génétiques monogéniques. Mais on peut étudier soit de grandes familles, soit des
populations entières. Très brièvement, on essaie de mettre en évidence une association entre des
marqueurs donnés (régions d'un chromosome présentes dans la population sous plusieurs allèles qui
sont techniquement très faciles à distinguer), et la présence de la maladie étudiée. Ensuite, une fois
identifié un locus suspect (région du chromosome située entre deux marqueurs suspectés), on affine
les études, étape très fastidieuse où l'on progresse région par région et gène par gène, jusqu'à
identifier un gène candidat. Ensuite on compare la fréquence des différents allèles de ce gène chez
les personnes saines et les personnes malades. S'il existe une corrélation entre la présence d'un allèle
et un risque plus élevé de développer cette maladie, cela signifie que cet allèle pourrait conférer une
susceptibilité, mais ce n'est pas encore sûr, pour les raisons développées plus bas (chapitre :
« corrélation n'est pas raison »). On conçoit que toutes ces études soient longues, complexes, et
coûteuses !
La différence principale entre ces études pour des maladies génétiques monogéniques et pour des
maladies complexes réside dans la faiblesse de l'effet recherché (susceptibilité de quelques %) qui
impose une contrainte drastique sur la méthodologie et les statistiques utilisées. Les difficultés qui
en découlent sont détaillées dans le chapitre suivant.
4.3. Difficultés des études de gènes de susceptibilité
Problèmes d'hétérogénéité génétique, de population et de méthodologie
L'une des principales difficultés dans l'identification de gènes de susceptibilité à une maladie (par
exemple le diabète) est tout simplement que le nom de cette maladie peut en fait recouvrir plusieurs
affections aux causes différentes mais aux symptômes similaires ou identiques, qui sont donc
gouvernées par des gènes de susceptibilité différents.
Une autre difficulté est que les gènes de susceptibilité varient fréquemment d'une population à
l’autre.
Enfin, un autre problème est la faiblesse de l'effet recherché (susceptibilité souvent inférieure à
5%). Ceci nécessite des statistiques très robustes et donc une grande taille de population étudiée
ainsi qu'une méthodologie très stricte.
La grande majorité des gènes de susceptibilité identifiés jusqu'à présent n'ont pu être confirmés par
des études ultérieures ! Par conséquent, aujourd'hui, pour être validée, l'identification d'un gène de
susceptibilité doit être reproduite au moins par deux équipes différentes travaillant sur des
populations différentes.

L'identification d'un gène de susceptibilité est très délicate et ne doit être prise au sérieux que si elle
est confirmée par des études indépendantes.
Le tableau ci-dessous vous donne quelques exemples de gènes de susceptibilités remplissant ces
critères. Par exemple, dans le cas de la maladie d'Alzheimer à révélation tardive, l'allèle epsilon 4 de
l'apolipoprotéine E confère un risque relatif de 2,8 aux personnes qui en ont un exemplaire, et de 8
aux personnes qui l'ont en double exemplaire. Le tableau illustre aussi le fait que nous sommes tous
à risque pour certaines maladies complexes : par exemple, le groupe sanguin O confère un léger
risque d'ulcère du duodénum par rapport au groupe sanguin A.
22
Exemples de gènes de susceptibilité à différentes maladies multifactorielles D'après Médecine-Sciences 2005,
21(11), p 927-33

Nous sommes tous porteurs d'allèles à risques pour plusieurs maladies complexes.
Difficulté de prouver une causalité : corrélation n'est pas raison
Même si en suivant les critères ci-dessus, on a mis en évidence avec certitude une corrélation
statistique entre un allèle d’un gène et une caractéristique, elle ne permet pas à elle seule de préjuger
que l'un est la cause ou la conséquence de l’autre. En effet, l’association peut être d’une autre
nature : les deux caractéristiques peuvent être, par exemple, toutes deux conséquences d’une autre
cause …

L'identification d'un gène statistiquement corrélé à une maladie nécessite de nombreuses études
ultérieures sur le rôle physiologique de ce gène avant qu'on puisse être sûr qu'il participe au
développement de cette maladie.
Illustration : Exemple du « gène de la criminalité »
Le gène SRY est présent dans la population humaine sous 2 allèles d'égales fréquences (environ
50% de la population a l'allèle 1, et 50% a l'allèle 2). En faisant une étude sur les gens ayant
commis un meurtre, on s'aperçoit que 90% d'entre eux possèdent l'allèle 1.
- Pensez-vous que cela soit statistiquement significatif (autrement dit, qu'il ne peut s'agir d'une
coïncidence ?)
- Pensez-vous que l'allèle 1 prédispose à commettre un meurtre ?
Correction de l’exercice : attention à l'effet « boîte noire » !
En fait, nous avons pris intentionnellement un exemple de la vie de tous les jours, avec un gène
connu, pour lequel la réponse vous sautera aux yeux. Nous souhaitons vous montrer à quel point
traiter les gènes comme une « boîte noire » en se laissant aveuglément guider par les statistiques
peut obscurcir le bon sens.
En fait ce gène SRY, situé sur le chromosome Y, est … le gène qui détermine le sexe ! Les hommes
possèdent un gène SRY (allèle 1), et les femmes n'en possèdent pas (allèle 2 : absence du gène). A
la question « pensez-vous que l'allèle SRY 1 prédispose-t-il à commettre un crime », vous pouvez
23
bien sûr maintenant répondre : « Non ! » C'est vrai que 90 % des gens commettant des crimes sont
des hommes, mais seule une infime proportion des hommes commettent des crimes : la corrélation
est ici loin d'être parfaite.
Vous vous êtes fait avoir ? C'est que vous avez oublié de vous poser la question réciproque : quelle
proportion des gens ayant l'allèle 1 de SRY commettent un crime ?

En conclusion, souvenez-vous qu'il ne faut pas traiter les caractères physiologiques,
comportementaux, etc. et leur relation avec les gènes comme une « boîte noire ». Le problème,
quand on croit a priori que tout est déterminé dans les gènes, c’est que lorsque apparaît une
corrélation robuste entre gène et comportement, on est tenté de considérer que la découverte de
cette corrélation tient lieu de réponse … au lieu d’être source d’un nouveau questionnement.
24
Principe, applications et limites des tests génétiques
[1. INTRODUCTION]
La plupart des tests génétiques visent à mettre en évidence la présence (déjà déclarée ou non) d'une
maladie héréditaire ou à détecter des porteurs sains de cette maladie, ayant un risque de la
transmettre à leur descendance. D'autres cherchent à prédire la probabilité qu'une maladie à
composante génétique se déclare ou non. Seul un nombre très restreint de tests permettent
d’identifier avec une certitude de 100 % la survenue d'une affection, et donc de proposer un
diagnostic très tranché. A l'inverse, notamment dans le cas des cancers où beaucoup d'entre eux sont
multifactoriels, le test génétique est plutôt un test de « prédisposition à » ou de « susceptibilité de »
développer la pathologie.

Selon la complexité de la maladie (nombre de gènes impliqués, pénétrance, …) et le rôle de
l’environnement, le résultat d’un test génétique peut être une quasi-certitude ou une simple
probabilité.
[2. DEFINITION ET PRINCIPE D'UN TEST GENETIQUE]
2.1. Définition
Il s'agit d'un test basé sur l'analyse de notre matériel génétique (chromosomes, ADN, ARN). C’est
la finalité du test qui compte (=mettre en évidence une modification de notre matériel génétique, et
ceci pour différentes applications) plutôt que la technique mise en œuvre pour faire le test. En effet,
pour réaliser un test génétique, on peut faire appel à un large éventail de techniques en fonction de
la nature de l’anomalie à détecter :
- soit un microscope dans le cas d’anomalies de nombre ou de structure des chromosomes
- soit des techniques plus pointues pour mettre en évidence la présence de mutations bien précises
dans le matériel génétique (séquençage, Southern blot, PCR, DHPLC, etc.).

De façon schématique, un test génétique permet de détecter la présence ou l’absence :
- d’une modification génétique particulière
- dans un gène particulier
- chez un individu donné
- dans un but bien précis (diagnostic, diagnostic présymptomique, DPI, DPN, statut de porteur sain,
…).
25
2.2. Détection de modifications constitutives ou acquises à l’âge adulte
Il existe deux grandes catégories de tests :
- ceux qui visent à repérer des modifications « constitutives » du matériel génétique (c’est-à-dire
présentes à la naissance et dans toutes les cellules de l’individu). En théorie, n’importe quelle
cellule de l’individu peut être utilisée pour réaliser ce test ;
- ceux qui visent à repérer les modifications apparues à l'âge adulte, dans un tissu donné et qui ne
seront a priori par transmises à la descendance (c’est le cas notamment des cancers à l’âge adulte).
Dans ce cas, seules les cellules issues du tissu peuvent être utilisées pour le test.

Dans le 1er cas, on indique un terrain génétique, valable a priori toute la vie ; dans le 2ème cas, on
indique une modification de ce terrain génétique survenue à un moment de la vie.
[3. DIVERSITE D’APPLICATIONS]
Nous ne parlerons que des tests génétiques effectués dans le cadre médical et pas des tests de
paternité ni des tests génétiques réalisés lors d’investigations criminelles.
3.1. Test de diagnostic
Ce test est effectué sur un individu pour confirmer ou affiner un diagnostic déjà évoqué par d'autres
méthodes. Par exemple, le test génétique est souvent utilisé pour confirmer et affiner le diagnostic
de certaines formes de fibrose kystique (mucoviscidose).

Il est important de noter que, dans ce cas, le test génétique n'est souvent pas la seule façon de faire
le diagnostic d'une maladie génétique : une échographie rénale pour la polykystose rénale ou une
coloscopie pour la polypose colique peut poser le diagnostic avec autant de certitude.
3.2. Test pré-symptomatique
Ces tests sont effectués sur des individus en bonne santé pour déterminer s'ils portent une mutation
génétique qui augmentera leur probabilité de développer des maladies et des troubles plus tard dans
leur vie. Le terme « test présymptomatique » est réservé généralement au cas des maladies
monogéniques.

L’intérêt d’un test pré-symptomatique et les enjeux d'un résultat positif pour ce test varient selon la
maladie, sa gravité, la pénétrance du gène testé et impliqué dans la maladie, la possibilité de
traitement préventif et/ou curatif.
En l'absence de traitement et donc de bénéfice médical direct pour le patient, les questions d’ordre
éthique sont nombreuses. Il est important de respecter certains principes : le droit de savoir ou de ne
pas savoir, l'autonomie de l'individu, le recueil du consentement éclairé, le bénéfice personnel à tirer
du test, la confidentialité, l'égalité d'accès. A ces principes s'ajoutent deux autres essentiels : la prise
en charge, par une équipe pluridisciplinaire (comprenant généticien, psychologue, éventuellement
26
psychiatre, assistante sociale, etc.), du candidat demandant le test et la nécessité de disposer d’un
temps de réflexion.
Dans certains cas au contraire, le test génétique pré-symptomatique permet de mettre en œuvre une
prévention efficace. C’est le cas par exemple de l'hémochromatose héréditaire et de la polypose
colique familiale. Ces notions seront abordées dans le chapitre « regard critique face à un test ».
3.3. Test de diagnostic prénatal (DPN) ou préimplantatoire (DPI)
Diagnostic prénatal (DPN) : Ce test est effectué avant la naissance pour déterminer si le foetus est
porteur d’une anomalie génétique. Il peut être proposé dans le cas de maladies génétiques graves
comme la myopathie de Duchenne ou la mucoviscidose. Le couple peut demander de recourir à une
interruption médicale de la grossesse (IMG) si le foetus est porteur de l’anomalie. Plus couramment,
le syndrome de Down (appelé aussi trisomie 21) est la maladie génétique la plus commune testée
par cette méthode.
Diagnostic préimplantatoire (DPI) : Il s’agit d’un examen génétique réalisé sur un embryon humain
obtenu par fécondation in vitro (FIV). Il est pratiqué au tout début du développement de l'embryon
lorsque celui-ci n'est âgé que de 3 jours et n'est constitué que de 4 à 8 cellules : une ou deux cellules
sont alors prélevées et analysées pour déterminer si elles sont porteuses de l’anomalie recherchée.
Le DPI est proposé aux couples risquant de transmettre une maladie génétique grave à leur futur
enfant. L'avantage du DPI par rapport au DPN est qu'il permet de réaliser le diagnostic génétique
avant la grossesse, et donc d'éviter au couple de débuter une grossesse puis de réaliser un DPN suivi
éventuellement d'une IMG. Néanmoins, le taux d’échec de grossesse dans le cas d’une FIV est très
élevé, de l’ordre de 70 à 80 %.
Les aspects réglementaires de ces tests sont traités dans la partie « encadrement juridique des
tests ».
3.4. Test de susceptibilité – Test de prédisposition
On utilise les termes tests « de susceptibilité » ou « de prédisposition » dans le cas des maladies
multifactorielles. Ces tests sont effectués pour identifier, chez un individu, la présence éventuelle
d’allèles de susceptibilité pour une maladie donnée.

Les tests génétiques de maladies multifactorielles ne donnent en général qu'une évaluation du risque
(pas de prédiction absolue).
Test de prédisposition ou test de susceptibilité ?
La situation est différente selon la maladie multifactorielle concernée :
- dans certains cas, l'affection peut relever majoritairement d'un gène unique et, par suite, se
transmettre de façon similaire à une maladie monogénique. Dans le cas des cancers du sein, 5%
d’entre eux sont liés à une prédisposition génétique majeure. Deux gènes, les gènes BRCA1 et
BRCA2, ont été identifiés dans le cas des cancers du sein et de l’ovaire (risques relatifs associés
variant de 1,5 à 5,3 selon le nombre de sujets atteints dans la famille, leur âge au diagnostic et le
degré de parenté). Dans une famille où la mutation d'un de ces gènes a été identifiée, il est alors
possible de tester et identifier les personnes particulièrement exposées à développer la maladie.
Trouver une mutation du gène BRCA1 ou BRCA2 permet une surveillance plus précoce et plus
rigoureuse des personnes à risque de développer un cancer du sein ou de l'ovaire. En revanche, la
personne qui n'est pas reconnue porteuse de la mutation familiale, demeure exposée à développer un
cancer du sein comme n'importe quelle autre femme et ne peut être rassurée, contrairement, par
exemple, à une personne à risque reconnue non porteuse de la mutation spécifique de la maladie de
27
Huntington (le cancer du sein est le plus fréquent des cancers féminins : le risque standard pour la
population féminine générale est de 11-12%, avec une apparition du cancer bien + tardive).
Dans ce cas, il apparaît correct de parler de « test de prédisposition » et ces tests présentent un réel
intérêt d’un point de vue médical (nombreuses applications notamment en cancérologie).

Un test génétique de prédisposition négatif n’indique pas une absence de risque de développer la
maladie. Il indique que le risque pour le patient de développer la maladie est le même que celui de
la population générale.
- Certaines maladies communes sont sous la dépendance conjointe de nombreux gènes et de
facteurs environnementaux. L'anomalie d'un seul gène n'est pas suffisante pour entraîner
l’apparition de la maladie mais dans un contexte environnemental particulier, une anomalie de
plusieurs de ces gènes peut le déclencher. L'ensemble de ces facteurs constitue un terrain de
susceptibilité génétique que peuvent partager des membres d'une même famille. Etre porteur d'un
marqueur (ou même de plusieurs) n'augmente que de peu la probabilité de développer la maladie.
On parle dans ce cas plus de « test de susceptibilité ».

Dans le cas des maladies multifactorielles, de nombreux gènes de susceptibilité ont été identifiés
ces dernières années, par le biais d’études sur le génome entier, notamment le projet international
HapMap. Certains allèles de susceptibilité ont été identifiés, mais conduisant à une augmentation
très faible du risque d’apparition de la maladie (exemple : cas du diabète de type 2). Comme aucun
allèle jouant un rôle majeur dans l’apparition de la maladie n’a été identifié, des tests de
susceptibilité sont actuellement peu utiles sur le plan médical.
3.5. Test du statut de « porteur sain »
Des couples peuvent demander ce type de test en prévision d’une grossesse. Il consiste à
déterminer, chez chaque individu du couple, s’il est « porteur sain » d'une mutation dans un gène
associé à une maladie récessive. Mais ce test n’a d’intérêt, à titre individuel, que si les personnes
testées font partie d’une population à risque pour une maladie récessive et n’est donc pas proposé en
routine. Par exemple, des couples canadiens réalisent ces tests pour déterminer s'ils sont porteurs de
maladies telles que la maladie de Tay-Sachs (maladie qui se retrouve avec une haute fréquence dans
certaines communautés comme les Juifs Ashkénazes et les Canadiens français) et pour les aider à
prendre la décision d'avoir des enfants.
3.6. Dépistage d’une population (test systématique)
On appelle dépistage un test systématique à l’échelle d’une population. Contrairement à un test de
diagnostic, il s'adresse à un large groupe de personnes qui ne présentent aucun signe clinique et
n'expriment pas de demande particulière. Il s'agit d'identifier le petit nombre de personnes « à
risque » de développer la maladie testée et qui nécessiteront des examens complémentaires.
Remarque : un dépistage n’est pas forcément réalisé à l’aide d’un test génétique. Par exemple, dans
le cas du cancer du sein, un dépistage systématique est proposé aux femmes de plus de 50 ans et est
réalisé par mammographie tous les 2 ans.
28
Cas particulier : dépistages systématiques des nouveaux-nés, axés sur l'identification de troubles du
métabolisme chez les nouveaux-nés. Leur détection et leur traitement précoce peuvent être cruciaux
pour réduire la progression de ces maladies. Depuis de nombreuses années en France, 5 maladies
sont dépistées systématiquement au 3ème ou 4ème jour après la naissance : la phénylcétonurie,
l’hypothyroïdie, l’hyperplasie congénitale des surrénales, la mucoviscidose et, de façon plus ciblée,
la drépanocytose.
3.7. Tests pharmacogénétiques
La réponse aux médicaments est souvent variable d'un individu à l'autre, ce qui rend parfois leur
utilisation difficile. Des facteurs génétiques affectant le métabolisme et le transport des
médicaments expliquent en partie la variabilité interindividuelle dans la réponse. C’est ce que
propose d’étudier la pharmacogénétique en visant à identifier les facteurs génétiques qui
influencent ou déterminent l’efficacité (ou l’inefficacité) et la toxicité (ou l’innocuité) d’un produit
thérapeutique, le plus souvent un médicament, chez un individu ou un groupe d’individus. Ceci
dans le but d'optimiser les traitements médicamenteux, tant en termes d'efficacité que de sécurité
d'emploi. L’un des exemples les plus fréquemment cités pour illustrer les promesses de la
pharmacogénétique est l’analyse des gènes des CYP450s, dont on sait qu’ils ont un impact sur le
métabolisme (=ensemble des réactions chimiques qui se produisent dans l’organisme) d’un
pourcentage important des médicaments les plus utilisés cliniquement.
La recherche pharmacogénétique n’en est encore qu’à ses débuts. Mais, le mouvement est lancé et
les espoirs sont grands. On espère grâce à cette recherche être un jour en mesure de personnaliser le
traitement de chaque patient en fonction de son profil génétique. Dans cette optique, la tendance
actuelle est clairement de promouvoir ce type de recherches, notamment dans le domaine de la
cancérologie.
[4. DES TESTS EVOLUTIFS ET COMPLEXES]
4.1. Une complexité variable en fonction des pathologies associées
D’un point de vue technique, la rapidité et les chances de succès d’un test génétique varient en
fonction du nombre de modifications génétiques et de gènes associées à la maladie concernée par le
test.
Prenons 2 cas extrêmes :
- La myopathie de Duchenne est associée à une anomalie dans le gène de la dystrophine. Il s’agit du
plus long gène jamais identifié (2 400 kb) et plus de 1000 modifications génétiques ont été
référencées (dont près de 200 mutations ponctuelles). Autant dire que la mise en évidence d’une
modification génétique dans la dystrophine peut être longue et laborieuse !...
- La maladie de Huntington est associée à un seul type de modification génétique : un nombre élevé
de répétitions d’un triplet (CAG) en début du gène de la huntingtine (répétitions variant de 40 à
400). Dans ce cas, le test génétique ne pose pas réellement de problème technique puisqu’il suffit de
regarder à un endroit précis dans le gène pour tester la présence ou non de la modification
génétique.
29
Maladies
Taille du gène
Modifications génétiques associées
Difficulté technique
Mucoviscidose
230 kb
> 1000 mutations ponctuelles
+
Hémophilie A
186 kb
Mutations ponctuelles, délétions,
insertions, réarrangements (+ de
1500 modifications référencées) …
+
Myopathie de
Duchenne
> 2000 kb
Mutations ponctuelles, petites ou
grosses délétions ou insertions :
> 1000 modifications référencées…
++
X-fragile
38 kb
Amplification variable d'un triplet
CGG en début de gène
-
Maladie de
Huntington
180 kb
Amplification variable d'un triplet
CAG en début de gène
-
Quelques exemples de maladies génétiques avec leurs modifications génétiques associées (1 kb = 1000 bases)

Les tests génétiques sont souvent complexes (délai de rendu du résultat très variable en fonction de
la pathologie testée). Ils sont aussi évolutifs (en fonction des avancées techniques et des avancées
des recherches sur les mutations).
4.2. Pourquoi un délai plus long pour tester le 1er individu d’une famille ?
Il faut là encore distinguer deux types de test :
- le test qui est réalisé pour la première fois chez un individu d’une famille pour rechercher
l’anomalie retrouvée spécifiquement dans cette famille,
- le test qui recherche cette anomalie dans la descendance (une fois l’anomalie détectée chez le 1er
individu).
Le premier test s’effectue sur la personne la plus susceptible d’avoir cette anomalie. Par exemple,
dans le cas du cancer du sein, on peut le pratiquer chez une personne qui a déjà développé ce
cancer. La recherche de mutations peut être longue et laborieuse en fonction du nombre de
mutations déjà référencées dans les bases de données internationales. Pour cette première étude, il
faut savoir qu’on ne trouve pas toujours de modifications génétiques, du fait des limites techniques.
Par exemple, dans le cas du cancer du sein, on estime aujourd’hui qu’on détecte environ 70 % des
mutations dans les gènes BRCA1 et BRCA2 (il y a donc des mutations à côté desquelles on passe).
De plus, il ne faut pas oublier que ces 2 gènes rendent compte seulement des ⅔ des prédispositions
au cancer du sein. Ainsi, si le résultat du test génétique (réalisé chez le 1er individu de la famille) est
négatif mais que l’histoire familiale est très évocatrice d’une prédisposition au cancer du sein, le
généticien ne peut pas rassurer la personne et sa famille.
30

Un résultat de test négatif à la suite d’une première étude n’a qu’une signification limitée ! Cela
signifie juste que, pour l’instant, aucune mutation n’a été identifiée mais le test ne permet
généralement pas de détecter 100% des mutations…
En revanche, si on a trouvé de façon claire une modification génétique chez un individu de la
famille, on peut alors proposer un test chez les apparentés. Dans ce cas le test est très fiable et est
réalisé généralement dans un délai bien plus court.
4.3. Différence entre un test de recherche et un test en routine
A l'origine, la découverte d'un gène associé à une maladie est généralement faite dans des familles
où plusieurs personnes sont atteintes (« test de recherche »). Dans un deuxième temps, de nouvelles
études doivent alors être menées chez d'autres individus touchés par la même maladie (pour aboutir
à un « test de routine »). De telles études révèlent souvent des mutations supplémentaires capables
elles aussi d’influencer la survenue de la maladie. Pour des maladies multifactorielles courantes,
d’autres facteurs, génétiques ou environnementaux, peuvent exacerber les effets délétères d’un
allèle de susceptibilité donné, affectant ainsi la pénétrance de cet allèle.

Par conséquent, les tests génétiques de recherche qui ne détecteraient que les mutations identifiées
par les recherches initiales n'auraient qu'une faible sensibilité lorsqu'ils étaient utilisés pour une
population plus globale.
Par conséquent, la valeur informative d’un résultat positif de test génétique dans les familles
étudiées initialement (chez lesquelles ces autres facteurs peuvent être présents) peut être plus élevée
que pour d’autres familles qui ne sont pas soumis aux autres facteurs (génétiques ou
environnementaux).

Avant de passer d’un test de recherche à un test en routine, il est donc essentiel de démontrer la
validité du test sur un plus grand nombre de personnes que celles incluses dans l’étude initiale.
31
Validité, valeur informative et usage des tests génétiques
Pour évaluer l'intérêt d'un test, il faut se poser les questions suivantes :
- quelle est la validité du test (a-t-elle été confirmée) ?
- en pratique, quel risque un patient déclaré positif par le test a-t-il d'être atteint de la maladie
correspondante ?
- quel bénéfice apporte le test pour le patient, en particulier quelle valeur ajoutée apporte-t-il par
rapport à des tests existants ?
- quels risques (discrimination, dépression …) fait courir l'annonce d'un test positif ?
Nous allons détailler ces différents points et vous donner des règles pratiques pour évaluer un test.
Mais tout d'abord, nous devons vous expliquer quelques notions.
[1. VALIDITE DU TEST]
- Dans le cas des maladies monogéniques à forte pénétrance ou associées à des aberrations
chromosomiques, les tests génétiques sont fiables et largement utilisés.
- Au contraire, la situation est plus délicate dans le cas des maladies multifactorielles : comme nous
l'avons évoqué précédemment, l'annonce de l’identification de nouveaux allèles de susceptibilité
doit être prise avec une certaine réserve car le pouvoir prédictif de chaque allèle pris seul est très
faible pour l’apparition de la maladie. Dans ce cas, la valeur prédictive du test génétique doit être
confirmée par plusieurs études pour pouvoir considérer ce test comme fiable.
En résumé, il est donc important de se poser la question suivante : La fiabilité du test a-t-elle été
prouvée par au moins deux laboratoires indépendants, portant sur deux populations différentes ?
Sinon, le test doit être considéré comme préliminaire (test de « recherche ») et doit impérativement
être validé par d'autres études.
[2. MIEUX COMPRENDRE LE RISQUE POTENTIEL INDIQUE PAR UN TEST]
2.1. Notions de prévalence, risque absolu et risque relatif, risque standard, facteur de
risque, facteur protecteur
La prévalence d’une maladie est sa fréquence dans une population donnée à un moment donné. Elle
s’exprime généralement en pourcentage ou sous la forme de « 1 personne sur X personnes ».
Par exemple : 0,05% de la population (soit une personne sur 2000) est atteinte de spondylarthrite
ankylosante. On dit que cette maladie a une prévalence de 0,05%, ou de 1 sur 2000, dans la
population.

Pour convertir un nombre exprimé en probabilité ("1 risque sur X" ou "1 personne sur X") en
pourcentage, il faut le calculer explicitement puis le multiplier par 100.
Par exemple 1 risque sur 500 = 1/500 = 0,002 = (0,002*100)%= 0,2%.
Réciproquement, si on veut exprimer un pourcentage sous forme de probabilité, X s'obtient
en divisant 100 par le pourcentage.
Par exemple si une personne a 2% de chances de développer une maladie donnée, cela
correspond à 1 risque sur (100/2) soit 1 risque sur 50.
32
Le risque standard (ou risque de référence) pour une maladie est le risque de développer cette
maladie pour un invidvidu pris au hasard dans la population. Par exemple, le risque de développer
une spondylarthrite ankylosante pour une personne prise au hasard est de 1/2000.
Notez que dans ce cas le risque standard correspond à la prévalence. Ce n'est pas toujours le cas car
les risques liés aux maladies peuvent changer avec le temps. D’autre part, le risque correspond
parfois à une certaine période. Par exemple, le risque de développer une maladie coronarienne chez
la femme augmente grandement après la ménopause.
Le risque relatif d'une personne pour une maladie donnée correspond à la variation du risque par
rapport au risque standard de la population. Cette variation peut être causée par des facteurs de
risque (voir définition ci-dessous) génétiques ou environnementaux (comme l'alcool ou le tabac).
Par exemple, un individu porteur de l'allèle HLA B27 a 80 fois plus de risque d'être atteint de
spondylarthrite ankylosante que la population générale. On dit que cet individu a un risque relatif
(RR) de 80.
Le risque relatif peut correspondre à une augmentation du risque (RR>1) mais aussi à une
diminution du risque (RR<1) - l'individu est alors partiellement « protégé » contre ce risque. Par
exemple, la pratique régulière d’une activité physique d’endurance serait susceptible de réduire le
risque d’infarctus.
Le risque absolu d'un individu pour une maladie donnée est le risque qu'il a de développer cette
maladie, compte tenu de ses caractéristiques personnelles. Par exemple, le risque absolu de
développer la spondylarthrite ankylosante au cours de sa vie, pour un individu porteur de l'allèle
HLA B27 évoqué ci-dessus, est de 4% (= 80 × 0,05%).

Risque absolu (en %) = risque standard de la population (en %) × risque relatif
Facteurs de risque : ce sont des facteurs mesurables (quantitatifs ou qualitatifs) qui augmentent le
risque de développer une maladie. Par exemple, des facteurs de risque d'infarctus (accident
cardiaque) incluent : l'hypercholestérolémie, l'hypertension artérielle, l'excès de sucre dans le sang
(diabète), le tabac. L'âge est également un facteur de risque d'accident cardiaque, dès 45 ans pour
les hommes et dès 55 ans pour les femmes.
Facteurs protecteurs : ce sont des facteurs qui diminuent le risque de développer une maladie. Par
exemple, l'exercice physique régulier diminue le risque d'accident cardiaque.
2.2. Notions de sensibilité et de spécificité
La sensibilité d’un test est la probabilité que le test détecte les individus atteints par la maladie
recherchée. Par exemple, un test qui détectera 98% des gens porteurs d’une mutation donnée (càd
donnera un résultat positif pour 98% des gens porteurs de cette mutation) aura une sensibilité de
98%. On parle aussi de « faux négatifs » : dans cet exemple, 2% des gens porteurs de cette mutation
sont déclarés (à tort) négatifs par le test, on dit qu’il donne 2% de faux négatifs. La sensibilité se
calcule par la formule simple :
Sensibilité (%) = 100%- pourcentage de faux négatifs.
La spécificité d’un test est la probabilité que le test ne détecte pas les individus non atteints par la
maladie recherchée. Par exemple, si un test est négatif chez 90% des individus non atteints, il aura
une spécificité de 90%. On parle aussi de « faux positifs ». Dans ce cas, le test sera positif à tort
chez 10% des individus (càd que 10% des résultats positifs concernent des gens qui en fait ne sont
33
par porteurs de la mutation recherchée : ce sont des « faux positifs »). La spécificité se calcule par la
formule simple :
Spécificité (%) = 100% - pourcentage de faux positifs

Pour mieux comprendre cette notion de spécificité et de sensibilité, vous pouvez imaginer un
« robot chasseur » doté d'un système de reconnaissance des formes sophistiqué, destiné à tirer sur
les faisans dans les vignes. Un dispositif très sensible tirera sur tout ce qui bouge … au risque de
tuer des promeneurs humains ! Au contraire, un dispositif très spécifique évitera de tuer des
humains … au risque de manquer certains faisans. Dans ce cas, étant donné le risque encouru (tuer
quelqu'un), on conçoit que les dispositifs privilégieront la spécificité, et seront donc moins
sensibles. Dans le cas de tests génétiques, en fonction des conséquences d'un résultat positif et du
cadre du test (individuel ou dépistage de population), on privilégiera la sensibilité ou la spécificité,
mais dans tous les cas, il est impossible de faire un test à la fois extrêmement spécifique et
extrêmement sensible : il faut rechercher un compromis. C'est pourquoi la plupart des tests doivent
être confirmés par un second test, si possible fondé sur une méthode différente (et qui n'est donc pas
sujet aux mêmes erreurs).
2.3. Règles pratiques pour évaluer le risque posé par un test
Il faut se poser les questions suivantes :
1) le risque mentionné en cas de résultat positif est-il un risque absolu ou relatif ?
2) si c'est un risque relatif, le ramener à un risque absolu par la formule donnée ci-dessus.
Munis de ces informations, vous pouvez maintenant évaluer de façon critique le risque qu'a un
individu positif au test de développer la maladie (ou une des formes de la maladie).
Exemple 1 : cas de l’autisme
Prenons l'exemple de l'autisme, dont la prévalence au sein de la population est estimée à 1/150, soit
0,67% (valeur pour l’ensemble du spectre autistique). 4 gènes ont fait l’objet d’études : la présence
de mutations dans ces 4 gènes de susceptibilité augmenterait de 15 le risque d'être autiste par
rapport à la population générale. Il s'agit d'un risque relatif (« 15 fois plus … que … »).
Le raisonnement à tenir est de ramener ce risque à un risque absolu.
risque absolu indiqué par le test=0,67% × 15 = 10%.
Il faut ensuite se demander quelle est la valeur informative de ce résultat ? Une personne qui aurait
un résultat positif pour ce test (c’est-à-dire qui aurait des mutations dans les 4 gènes testés) n’aurait
en réalité que 10% de risque d’être réellement autiste. De façon plus globale, cela veut donc dire
que sur 10 enfants déclarés positifs au test de l’autisme, un seul sera réellement autiste et 9 enfants
sur 10 seraient étiquetés "pré-autistes" à tort (la spécificité du test est de 10%) ! La valeur
informative de ce test est donc faible dans ce cas.
(pour plus d’informations, vous pouvez lire l’article de B. Jordan dans Médecine/Sciences 2005 n°10, vol.21, oct.2005)
Exemple 2 : cas du cancer du côlon
Le cancer du côlon est l'une des maladies les plus fréquentes dans la population générale, avec une
prévalence d’environ 2%. Le risque d'être atteint d'un cancer si on est porteur d'une mutation d'un
gène MMR (il en existe plusieurs) est 45 fois plus élevé. Il s'agit d'un risque relatif (« 45 fois plus
… que … »).
34
On applique le même raisonnement que précédemment pour calculer le risque absolu, à savoir le
risque de développer un cancer du côlon si on est porteur de la mutation. Ce risque est donc de :
2% × 45= 90%.
Ce risque est estimé comme très important aussi bien par les malades que par les professionnels de
santé, surtout compte tenu de la gravité de la maladie et du fait qu'elle est évitable par une opération
chirurgicale (ablation du côlon).
[3. VALEUR AJOUTEE DU TEST]
S'il existe d'autres tests de diagnostic, qu'est-ce que ce nouveau test génétique apporte en plus pour
le patient ?
Par exemple, permet-il :
 de confirmer et d'affiner un diagnostic
 de proposer un diagnostic plus rapide ou nettement moins cher ;
 d'orienter vers un traitement préventif
 d’orienter vers une hygiène de vie appropriée
 d'améliorer la surveillance de l'évolution de la maladie
 d'orienter vers un traitement mieux approprié ;
 de proposer un diagnostic prénatal ;
 d'indiquer des atteintes à l'ADN résultant d'une cause environnementale, en vue de la
reconnaissance d'une maladie professionnelle ou environnementale ?
3.1. Confirmer et affiner un diagnostic
Prenons le cas d'un patient qui présente un taux de cholestérol LDL très élevé. Ce taux peut être dû
à des problèmes ponctuels ayant augmenté seulement récemment ce taux de cholestérol, ou bien à
une maladie génétique, l'hypercholestérolémie familiale. Dans ce dernier cas, le patient a en fait
présenté un taux de cholestérol LDL anormal depuis la naissance ! Un test génétique indiquant une
hypercholestérolémie familiale fournira donc une valeur ajoutée puisqu'il indique une situation
chronique et permet d'orienter vers des mesures thérapeutiques adaptées nécessaires dans ce cas.
Dans d'autres cas, le test génétique n'offre pas de valeur ajoutée par rapport à l'examen clinique. Par
exemple, les signes cliniques de la Progeria, une maladie caractérisée par un vieillissement accéléré
conduisant au décès des patients vers 12-14 ans, sont évidents et uniques ; un test génétique ne
permet donc pas d'affiner le diagnostic et n'est pas utile pour le patient (même s'il pourrait
éventuellement servir à des fins de recherche).
3.2. Proposer un diagnostic plus simple ou moins cher
Dans certains cas, les tests biochimiques sont invasifs. Le test génétique présente alors un intérêt
indéniable puisqu'il peut en théorie être réalisé à partir de n'importe quelle cellule du corps. Par
exemple, dans le cas de la myopathie des ceintures de type 2I, le diagnostic est couramment fait par
biopsie musculaire sous anesthésie locale, qui montre une diminution marquée ou une absence
complète d’une protéine appelée alpha-dystroglycane (mais l’interprétation de ces marquages est
parfois délicate surtout dans les formes cliniquement peu sévères).
Au contraire, le diagnostic génétique de cette maladie est assez facile à obtenir et ce pour deux
raisons : il repose sur l’analyse d’un seul gène FKRP, bien caractérisé et de petite taille. D’autre
part, il existe une mutation (notée L276I) que l’on retrouve avec une très grande fréquence dans le
gène FKRP chez les patients atteints de ce type de myopathie. C’est pourquoi certaines équipes
préconisent de tester la présence de la mutation L276I de manière systématique sur toute personne
présentant une myopathie des ceintures à l’âge adulte, avant même la pratique d’une biopsie
musculaire.
35
A l’inverse, le test génétique de nombreuses maladies est plus cher ou plus complexe que le test
biochimique. Par exemple, la phénylcétonurie est due à un dysfonctionnement d’une protéine, la
phénylalanine hydroxylase (cette protéine transforme l’acide aminé phénylalanine en tyrosine).
Bien que le gène correspondant soit parfaitement connu, le diagnostic de cette maladie est réalisé
par un test biochimique très simple et fiable, fondé sur la recherche de phénylalanine, réalisable à
l’aide d’une simple goutte de sang déposé sur un papier buvard (test de Guthrie). En France ce test
est réalisé systématiquement à la naissance, car l’accumulation de phénylalanine dans le sang
conduit à un grave retard mental qui est parfaitement évitable par un régime alimentaire approprié à
l’enfance.
3.3. Orienter vers un traitement préventif
Le bénéfice médical d’un diagnostic présymptomatique varie selon que l’on dispose ou non de
méthodes de surveillance, de prévention ou de traitement pour la maladie. La figure ci-dessous
donne plusieurs exemples de maladies à composante héréditaire et leur possibilité de surveillance
ou de traitement en cas de diagnostic présymptomatique.
Un exemple intéressant est la fièvre méditerranéenne récurrente familiale, une maladie assez
fréquente chez les sujets originaires du pourtour méditerranéen, qui s'exprime par des crises de
fièvres et de douleurs violentes, à intervalle variable. Elle présente en outre un risque important
d'une complication très grave, l'amylose rénale. Du fait de ses symptômes peu spécifiques, elle est
souvent diagnostiquée tardivement, par élimination. Pourtant, il existe un traitement, à prendre à
vie, la colchicine. Celui-ci non seulement est très efficace contre les douleurs mais permet aussi de
retarder l'apparition des complications rénales dans 2/3 des cas. La réalisation d'un test génétique
présente dans ce cas un intérêt pratique : les membres de la famille d'un sujet atteint pourraient
bénéficier de l'information s'ils sont eux-mêmes à risque, et ainsi prendre en prévention de la
colchicine, pour éviter l'apparition de syndromes rénaux.
Au contraire, certains tests apportent peu de possibilité de traitement préventif, bien qu'ils prédisent
avec certitude qu'une maladie va se développer. C'est le cas de la maladie de Huntington ou de la
sclérose latérale amyotrophique (figure ci-après).
Bénéfice médical du diagnostic présymptomatique des maladies héréditaires. D'après Médecine-Sciences 2005,
21(11), p 934-9.
3.4. Orienter vers une hygiène de vie appropriée
De nombreuses maladies multifactorielles sont sous l'influence de facteurs environnementaux bien
connus (typiquement une alimentation trop riche en graisses ou en sucres, le tabac, la pollution, le
manque d'exercice …). Bien sûr il est toujours recommandé d'avoir une hygiène de vie saine, mais
savoir qu'on a un allèle de susceptibilité à une maladie particulière permet d'y porter un soin tout
particulier (par exemple une personne ayant une susceptibilité génétique à l'hypertension adopterait
un régime alimentaire approprié, ...).
36
3.5. Améliorer la surveillance de la maladie
La majorité des maladies génétiques présente une grande variabilité de symptômes et d'âge
d'apparition, y compris au sein d'une même famille. Dans ce cas, le test permet-il d'évaluer l'âge
d'apparition de la maladie concernée, ou de prédire ses symptômes, en vue d'une meilleure
surveillance de la maladie ?
Par exemple, le cancer du côlon héréditaire à polypes, est causé par une mutation du gène APC, qui
peut se situer à plusieurs endroits du gène. Une mutation délétère provoquera la formation de
polypes qui évolueront en cancer dans 100% des cas, mais avec une sévérité et un âge d'apparition
variable. Or la localisation de la mutation dans le gène APC est fortement corrélée à la gravité des
manifestations coliques. Ainsi, certaines mutations sont responsables de cancers survenant avant 10
ans ; au contraire, d’autres mutations sont associées à une apparition tardive des polypes. La
connaissance de la mutation permet donc d'adapter le suivi : celui-ci se fait généralement par
coloscopie et le malade apprécie toute diminution de la fréquence de cet examen ! D'autre part, des
lésions rétiniennes peuvent apparaître en plus, mais seulement pour certaines mutations : le test
génétique permet donc de conseiller, seulement si nécessaire, un suivi ophtalmologique.
A l'inverse, le test génétique de la maladie de Rett (une maladie neuronale qui touche des enfants)
est utile pour confirmer le diagnostic mais ne permet pas de prédire l'évolution des symptômes (âge
d'apparition ou gravité, problèmes respiratoires par exemple).
3.6. Orienter vers un traitement mieux approprié (une fois la maladie déclarée)
Dans certaines maladies, comme le cancer, il existe des traitements efficaces, mais en pratique deux
facteurs diminuent leur efficacité : premièrement, un traitement donné est efficace seulement sur
une partie des patients, deuxièmement, il pourra être toxique pour d’autres (ce qui les empêchera de
poursuivre le traitement même s'il est efficace). Il serait souhaitable de pouvoir orienter à l'avance le
patient vers le traitement qui a le moins de risque d'être toxique et le plus de chance de succès (un
traitement « à la carte »). Par exemple, l'agence de sécurité sanitaire et alimentaire américaine (la
FDA) a approuvé l’utilisation de tests génétiques pour prédire les effets secondaires (et donc
améliorer la sécurité d’administration) de l’Irinotecan, utilisé dans la chimiothérapie du cancer du
côlon. Ces tests, appelés « pharmacogénétiques », sont encore pour la plupart en phase de
développement.
3.7. Proposer un diagnostic prénatal
La grande sensibilité des tests génétiques permet de les pratiquer facilement sur les embryons, et
permet une interruption de grossesse dans le cas d'un résultat positif, si les parents le souhaitent. Il
est important de rappeler que ce type de diagnostic prénatal n'est aujourd'hui praticable que pour des
maladies d'une particulière gravité et incurables (par exemple la maladie d'Huntington) ; ce point est
traité au chapitre « encadrement juridique des tests ».
3.7. Faciliter la reconnaissance d'une maladie professionnelle ou environnementale
Certaines mutations responsables de maladies pourraient être associées à une exposition à des
substances toxiques (dans un cadre professionnel ou environnemental). Par exemple, on soupçonne
que c'est le cas d'une mutation du codon 249 du gène p53 associée à une exposition à l'aflatoxine
B1. Cependant, à l'heure actuelle, nos connaissances en la matière sont rudimentaires et aucun test
n'est officiellement reconnu pour cette indication.

En résumé, ce qui compte pour un test de diagnostic, c'est qu'il apporte une valeur ajoutée pour le
patient, et non qu'il soit génétique ou biochimique
37
[4. RISQUES A L'ANNONCE D'UN TEST POSITIF]
Ils sont essentiellement de deux sortes : risque de discrimination et risques psychologiques.
4.1. Risques de discrimination
Les risques de discrimination sont nombreux. Par exemple, les assurances ou mutuelles de santé
pourraient être tentées de refuser d'assurer des personnes positives à un test comme celui de la
maladie de Huntington, qui permet d'affirmer avec certitude que le porteur sera atteint d'une
maladie neurodégénérative grave. Le milieu scolaire pourrait placer à l'avance en classes spéciales
les enfants positifs à un éventuel test de l'autisme. Une entreprise pourrait refuser un emploi à un
salarié estimé à risque pour l'exposition à certains produits chimiques toxiques (dans ce dernier cas,
on peut même noter un effet pervers, puisqu'il vaut mieux de façon générale diminuer l’exposition
de tous les salariés à ces substances …).
4.2. Risques psychologiques
Dans le cas de maladies se déclarant à l'âge adulte, pour lesquelles il n'existe aucun traitement, les
risques psychologiques (dépression) sont très grands pour le patient, aussi bien à l'annonce d'un test
positif que d'un test négatif, comme en témoigne l'article « Les tests présymptômatiques en
neurogénétique » (Médecine/Sciences, 2005, 21(11), p 934-39) qui rend compte de 10 ans
d'expérience dans le diagnostic génétique de la maladie de Huntington par une équipe
pluridisciplinaire dédiée de l’Hôpital de la Salpêtrière. Un autre témoignage direct est fourni par le
livre de Jean Baréma, « Le test ». Le risque psychologique reste très élevé dans le cas où la
pénétrance est variable, comme c’est le cas pour la maladie de Strümpell Lorrain, une maladie
neurodégénérative, à évolution particulièrement imprévisible ; dans ce cas, c'est l'incertitude
entourant les conséquences d’un test positif qui décourage la plupart des patients de passer un test
génétique.

Les risques psychologiques d'un diagnostic « mal annoncé » ne doivent pas être sous-estimés. Lors
des stages de formation à la biologie que nous organisons, certains malades nous ont dit qu'ils
avaient mis jusqu'à 10 ans à récupérer du choc d'une annonce de diagnostic mal faite.
[5. CAS PARTICULIER D'UN DEPISTAGE GENETIQUE]
Quelles sont les conditions où il peut être intéressant de réaliser un dépistage génétique d'une
maladie, c'est-à-dire d'étendre un test génétique à l'échelle d'une population ?
Compte tenu des bénéfices et des risques potentiels liés à l'annonce d'un test, évoqués aux chapitres
précédents, les chercheurs en génétique ainsi que les professionnels de santé se sont accordés sur les
critères essentiels pour envisager un tel programme. Nous n'en donnerons qu'un bref aperçu. Le
lecteur intéressé peut se référer pour plus de détails à :
“ Population genetic screening programmes: technical, social and ethical issues”, European Journal of Human Genetics,
2003(11), p 903-905
Un programme de dépistage génétique ne doit être envisagé que si, entre autres :
- il y a un accord général sur ses bénéfices attendus, de la part des professionnels, des patients, et de
la société.
38
- il s'agit d'un problème de santé important en terme de nombre de personnes affectées ou de
sévérité de la maladie
- le résultat des tests donne accès à une décision ou à une intervention pour la personne concernée
- le test a une valeur prédictive reconnue.
De plus, compte tenu des risques associés au dépistage génétique, celui-ci devrait être considéré
seulement si les bénéfices dépassent nettement les désavantages, en particulier du point de vue du
patient. Des programmes pilotes devront évaluer au préalable ces bénéfices et désavantages et
explorer toutes les alternatives possibles au dépistage.
39
Encadrement juridique des tests génétiques
Source et références :
 Le service public de la diffusion des droits : www.legifrance.gouv.fr
 Site internet de l’agence de la biomédecine : www.agence-biomedecine.fr/fr/index.aspx
[1. DOMAINE COUVERT PAR LA REGLEMENTATION]
Les lois de bioéthique de 1994, révisées en 2004, concernent les tests réalisés dans le cadre d’une
demande individuelle. Ces lois autorisent « l'examen des caractéristiques génétiques d'une
personne » (c’est-à-dire, la réalisation de tests génétiques !), tout en assurant un encadrement très
strict de l'emploi des tests génétiques dans le champ médical (Articles L. 1131-1 à 1131-6 du Code
de la santé public (CSP)). Seuls sont autorisés les tests à finalité médicale ou de recherche
scientifique. De plus la personne testée doit signer, au préalable, un consentement éclairé.

Ces articles ne concernent pas :
- le dépistage systématique d'une population
- l'identification des personnes par leurs empreintes génétiques ordonnées par un tribunal à des fins
d'enquête pénale ou dans le cadre d'un procès de filiation (art. 16-11 du Code civil)
- les diagnostics anténataux soumis à des dispositions spéciales (CSP art. L. 2131-1 à 5 et abordé
dans un paragraphe spécifique par la suite).
[2. CONDITIONS DE PRESCRIPTION ET DE REALISATION]
Les tests génétiques à des fins médicales sont également réglementés par un décret n° 2000-570 du
23 juin 2000. Le texte s'applique aux examens qui ont pour objet :
- soit des tests à visée diagnostique chez une personne présentant des symptômes évoquant une
maladie génétique
- soit des investigations à valeur prédictive chez une personne asymptomatique (CSP art. R.1131-1)

Cette définition apparaît aujourd'hui trop restrictive car de nouvelles activités telles la
pharmacogénétique nécessitent des tests qui ne correspondent exactement à aucune de ces
catégories.
2.1. Consentement
Il est obligatoire de recueillir le consentement par écrit du patient avant d'entreprendre des tests
génétiques à des fins médicales (article 16-10 du Code civil et article L.1131-1 du Code de la santé
publique (CSP)). Le fait de pratiquer de tels examens sans recueillir le consentement est un délit
puni d'un an d'emprisonnement et de 15000 euros d'amende (art. L.1133-1 du CSP et art 226-25 du
Code pénal). Le consentement est signé par le patient et le médecin, un exemplaire est remis au
patient.
40
L'article 16-10 du code civil a été complété par la loi du 6 août 2004, il précise que le consentement
écrit et préalable doit mentionner la finalité de l'examen et qu'il est révocable à tout moment.
 Cas des mineurs
Lorsque la personne concernée est un mineur, le consentement est donné par les titulaires de
l'autorité parentale (article R.1131-4 du CSP).
 Etudes familiales
Dans le cadre des études familiales, le décret du 23 juin 2000 prévoyait seulement en cas de
découverte d'une anomalie, qu'il appartenait au patient, sur les conseils de son médecin, de prévenir
les membres de sa famille et d'obtenir leur consentement. La loi du 6 août 2004 énonce que le
médecin doit informer son patient des risques que son silence ferait courir à certains membres de sa
famille potentiellement concernées. Il délivre un document contenant un résumé de cette
information, il appartient alors au patient d'informer lui-même sa famille. A cette fin, la nouvelle loi
instaure une nouvelle procédure dite de "l'information médicale à des fins familiales" : si la
personne le souhaite, elle peut faire procéder à l'information de sa famille par le biais de l'Agence
de la biomédecine (1) (art. L. 1131-1, al. 4 CSP).
(1)
: http://www.agence-biomedecine.fr/fr/index.aspx
2.2. Prescription
Toute prescription d'un examen des caractéristiques génétiques doit intervenir dans le cadre d'une
consultation médicale individuelle (art. R.1131-5 du CSP). Les tests génétiques ne sont autorisés
sur un mineur que si celui-ci peut personnellement en bénéficier dans sa prise en charge ou si des
mesures préventives ou curatives peuvent être prises pour sa famille. Si le mineur est
asymptomatique, ce bénéfice doit en outre être "immédiat".
Pour les personnes asymptomatiques qui présentent des antécédents familiaux, cette consultation
doit être effectuée par un médecin oeuvrant au sein d'une équipe pluridisciplinaire rassemblant des
compétences cliniques et génétiques (généticien, neurologue, psychologue, etc…).
2.3. Agrément et autorisation à la pratique des analyses de biologie médicale
nécessaires à l'examen des caractéristiques génétiques
En vertu de l'article R.1131-6 du Code de la santé publique, les tests génétiques ne peuvent être
réalisés que sous la responsabilité de praticiens agréés exerçant dans des laboratoires autorisés.
Autorisations et agréments sont délivrés pour une durée de 5 ans par le Préfet de Région (après avis
de la Commission consultative nationale en matière d'examens des caractéristiques génétiques à des
fins médicales) et ils peuvent être généraux, c’est-à-dire valable pour tous les tests génétiques, ou
limités.
2.4. Communication des résultats
En vertu de l’article R.1131-14 du Code de la santé publique, le compte-rendu des analyses
commenté et signé par un praticien agréé est adressé au médecin prescripteur à qui il revient de
communiquer ces résultats à la personne concernée (ou aux titulaires de l'autorité parentale ou au
représentant légal du majeur sous tutelle). La remise des résultats, même s’ils sont négatifs (c’est-àdire la personne n’a pas de mutation détectée), doit se faire dans le cadre d'une consultation
médicale individuelle. La personne concernée peut refuser que les résultats lui soient communiqués.
Dans ce cas, le refus doit être consigné par écrit dans le dossier. Les résultats sont conservés
pendant 30 ans.
41
2.5. Cas du diagnostic prénatal
Initialement, le diagnostic prénatal était encadré par l’article L.2131-4 du CSP qui précise :
- son objectif : "détecter in utero chez l'embryon ou le foetus une affection d'une particulière
gravité reconnue comme incurable au moment du diagnostic"
- l’obligation qu’il soit précédé "d'une consultation médicale adaptée à l'affection recherchée" et
que les deux membres du couple expriment par écrit leur consentement à la réalisation du
diagnostic
Comme dans le cas précédent, les analyses ne peuvent être pratiquées que dans "des établissements
publics de santé et des laboratoires d'analyses de biologie médicale autorisés". Les autorisations
sont, là encore, délivrées pour une durée de 5 ans. La création de centres pluridisciplinaires de
diagnostic prénatal dans des organismes et établissements de santé publics et privés à but non
lucratif est autorisée par l'Agence de la biomédecine instituée à l'article L. 1418-1.
Les conditions du diagnostic prénatal se sont ensuite élargies. Sont autorisés le diagnostic et le tri
préimplantatoire d’une part, lorsque "a été préalablement et précisément identifiée, chez l'un des
parents ou l'un de ses ascendants immédiats dans le cas d'une maladie gravement invalidante, à
révélation tardive et mettant prématurément en jeu le pronostic vital" (art. L.2131-4 mod.). Le
couple peut demander alors de recourir à une interruption médicale de la grossesse (IMG) si le
foetus est porteur du gène responsable de la maladie.
D’autre part, et à titre expérimental, le diagnostic et le tri préimplantatoire sont également autorisés
si "le couple a donné naissance à un enfant atteint d'une maladie génétique entraînant la mort dès les
premières années de la vie et reconnue comme incurable au moment du diagnostic" et que "le
pronostic vital de cet enfant peut être amélioré, de façon décisive, par l'application sur celui-ci d'une
thérapeutique ne portant pas atteinte à l'intégrité du corps de l'enfant né du transfert de l'embryon in
utero". Il s’agit là d’embryons susceptibles de fournir des cellules pour une sœur ou un frère malade
("bébés médicaments") (Article L2131-4-1).

En résumé, le diagnostic prénatal est aujourd'hui autorisé pour détecter chez un embryon une
maladie génétique très grave et incurable présente dans sa famille, que celle-ci se déclenche avant la
naissance ou plus tardivement. Le couple peut demander de recourir à une interruption médicale de
la grossesse (IMG) si le foetus est porteur du gène responsable de la maladie.
Il est aussi autorisé de façon expérimentale pour un couple désirant faire un « bébé médicament »
ayant le potentiel de guérir un précédent bébé né avec une affection génétique grave.
2.6. Rôle du conseiller en génétique
La loi du 9 août 2004 (art. L.1132-1) reconnaît la profession de conseiller en génétique. Ce dernier,
sur prescription médicale et sous la responsabilité d'un médecin qualifié en génétique, participe au
sein d'une équipe pluridisciplinaire :
1º A la délivrance des informations et conseils aux personnes et à leurs familles susceptibles de
faire l'objet ou ayant fait l'objet d'un test génétique à des fins médicales (défini à l'article L. 1131-1),
ou d'une analyse aux fins du diagnostic prénatal (défini à l'article L. 2131-1) ;
2º A la prise en charge médico-sociale, psychologique et au suivi des personnes pour lesquelles cet
examen ou cette analyse est préconisé ou réalisé.
42

La création du métier de conseiller en génétique permet aux patients de disposer de plus de temps
pour obtenir le maximum d’information sur les tests génétiques et leurs implications.
Pour plus d’informations :
http://asso.orpha.net/AFCG/cgi-bin/index.php?lng=fr
43
Messages principaux et conclusion
[1. ADN ET MUTATIONS]
- Nous sommes tous des mutants, porteurs de nombreuses mutations conférant ou pas une
susceptibilité à des maladies complexes et porteurs sains de plusieurs mutations correspondant à des
maladies récessives.
- La notion de mutation « bénéfique » ou « néfaste » peut varier en fonction de l'environnement ou
d'autres paramètres. Une mutation qui confère une susceptibilité à une maladie peut avoir un effet
protecteur vis-à-vis d'une autre maladie.
- L'identification d'un gène de susceptibilité est très délicate et ne doit être prise au sérieux que si
elle est confirmée par plusieurs études indépendantes.
[2. TESTS GENETIQUES]
Champs d’applications
Les tests génétiques peuvent avoir des applications très variées (diagnostic, diagnostic pré
symptomatique, DPI, DPN, test de susceptibilité, test pharmacogénétique, …).
En général, pas de prédiction
- Un test génétique indique un terrain génétique, et non un état clinique. Il ne donne en général
qu’une probabilité plus ou moins importante de survenue d’une maladie. Dans le cas des maladies
multifactorielles, il ne donne qu’une évaluation du risque (pas de prédiction).
- L’intérêt d’un test pré-symptomatique et les enjeux d'un résultat défavorable pour ce test varient
selon la maladie, sa gravité, la pénétrance du gène testé et impliqué dans la maladie, la possibilité de
traitement préventif et/ou curatif.
Des tests souvent complexes et évolutifs
Les tests génétiques sont souvent complexes (délai de rendu du résultat très variable en fonction de
la pathologie testée). Ils sont aussi évolutifs (en fonction des avancées techniques et des avancées
des recherches sur les mutations).
Suivi et encadrement autour des tests
- On estime qu'on peut prendre jusqu'à 10 ans à récupérer du choc d'une annonce de résultat de test
génétique mal faite.
- Un patient qui se sait à risque pour une maladie génétique rare et qui a la possibilité de passer un
test présymptomatique sera encadré par une équipe pluridisciplinaire dûment formée.
- Toute prescription d'un test génétique intervient dans le cadre d'une consultation médicale
individuelle. Pour les personnes asymptomatiques qui présentent des antécédents familiaux, cette
consultation est effectuée par un médecin oeuvrant au sein d'une équipe pluridisciplinaire
rassemblant des compétences cliniques et génétiques (généticien, neurologue, psychologue, etc…).
Le patient est ainsi accompagné durant tout son cheminement, avant et après l'annonce du résultat.
Il est nécessaire de rester vigilant à l’égard des tests "sauvages" et onéreux proposés sur Internet,
aux conclusions potentiellement erronées et non expliquées par des spécialistes.
44
Bibliographie
[1. ARTICLES DE RECHERCHE]
Nous remercions la revue Médecine-Sciences pour nous avoir permis de reproduire certaines parties
de ses articles. Cette revue qui résulte d'une collaboration franco-québecoise, est consultable en
ligne (www.edk.fr) ; ses articles de revues, écrits en Français et destinés à un public biologique ou
médical mais non spécialisé, sont accessibles gratuitement 6 mois après leur parution.
Maladies multifactorielles : un cauchemar pour le généticien.
Médecine/Sciences, nov 2005, vol 21, n°11, p 927-933
Les tests présymptômatiques en neurogénétique.
Médecine/Sciences, nov 2005, vol 21, n°11, p 934-939
L'offre de tests de prédisposition génétique au cancer du sein ou de l'ovaire en France,
Médecine/Sciences, août/sept 2004, vol 20, n°8-9, p 788-792
Prédispositions génétiques aux cancers : actualités et perspectives en 2005
Médecine/Sciences, nov 2005, vol 21, n°11, p962-968
La diffusion des tests génétiques - le cas de la cancérologie
Médecine/Sciences, mars 2007, vol , n°23, p327-332
Diagnostic prénatal et diagnostic pré-implantatoire : arbre décisionnel, nouvelles pratiques ?
Médecine/Sciences, nov 2005, vol 21, n°11, p987-992
Demandez le test de l'autisme !
Médecine/Sciences, oct 2005, vol 21, n°11, p886-887
L'autisme d'une entreprise
Médecine/Sciences, fév 2007, vol 2, n°23, p215-6
Mucoviscidose : vers la fin du dépistage génétique ?
Communiqué de presse Inserm du 27 septembre 2005
[2. LIVRES]
"Le test", par Jean Baréma, éditions JC Lattès, 2002
"Les imposteurs de la génétique", par Bertrand Jordan, éditions Seuil, 2000
"La Génétique médicale" par Josue Feingold, collection Que sais-je ?, Presses Universitaires de
France, 2003
"Autobiographie de l'espèce humaine en 23 chapitres", par Matt Ridley, éditions Pocket, 2003
"Mille milliards de cellules" et "Génétique, Génétoc !" G. Macagno, éd. Ellipses
45
Téléchargement