Telomeres - Master Pathologie Humaine
publicité
1 Telomere function DNA damage response Cell cycle arrest Senescence Apoptosis Telomeres TCCCAATCCC AGGGTTAGGGTTAGGGTTAGGG ~ 10 Kb human ~ 40 Kb mouse ~ 0,3 Kb yeast Giraud-Panis et al. FEBS 2010 Titia de Lange, Genes & Dev, 2004, 2005 LES TELOMERES MAINTIENNENT LA STABILITE DU GENOME Télomères dysfonctionnels ou raccourcis Télomères protégés Télomères déprotégés Quelles sont les conséquences de le déprotection de l’extrémité des chromosomes? 6 La déprotection des chromosomes induit des réarrangement des chromosomes Télomères dysfonctionnels, ou très courts Télomères fusionnés 7 Dysfunctional telomeres Genomic instability E. Gilson and V. Géli, 2007. Dehe and Cooper, FEBS 2010 G-rich strand 5’ 3’ 5’ C-rich strand 3’ lagging telomere 5’ 3’ 5’ leading telomere 3’ 3’ 3’ 3’ 3’ 3’ 3’ 3’ 3’ Telomere-specific primase recruiting Factor (Cdc13 others) 5’ resection factor ? Mre11-Rad50-Xrs2, adapted from Faure, Coulon, Hardy & Géli, Mol Cell, 2010 The end replication problem 3’ 5’ DNA 3’ replication 5’ RNA primer Gap left after primer removed cell division DNA DR DNA DR Telomerase maintains the length of telomeres 3’ 3’ 3’ 5’ TERC TERCTERCTERC 5’3’ 5’ 5’ TCCCAATCCCAATCCCAATCCC AAUCCCAAU AAUCCCAAU AAUCCCAAU AAUCCCAAU AGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTA TERT TERTTERTTERT Giraud-Panis et al. Mol Cell 2010 A chaque division cellulaire, les télomères se raccourcissent γH2AX Protéines de surveillance des dommages à l’ADN Arrêt de la prolifération p53 Senescence Vieillissement Telomere Proliferation length signaling Il existe un mécanisme de surveillance qui empêche le raccourcissement excessif des télomères et la déprotection des 17 chromosomes ATM TRF2 ATM-P, ATR Chk1, Chk2 ? Apoptosis p53 p16 p21 Rb Senescence ATR Pot1 Takai, de Lange, 2003, Current Biol La télomérase est régulée au cours du développement Dynamique de la taille des télomères pendant le développement Cellules germinales In germinal cells Taille Telomere length des télomères Telomerase Télomérase activity In somatic cells Cellules somatiques Telomere Taille length des télomères Telomerase Télomérase activity BIRTH Naissance DEATH Mort telomere length Telomeres and aging germ cells Viable most somatic cells Cell cycle arrest / Senescence / Apoptosis number of cell divisions Permanent arrest = senescence Proliferation of primary normal human cells is not indefinite 1. period of rapid proliferation 2. slowing of the proliferation rate 3. cessation of proliferation = replicative senescence Senescent cells permanently arrested Diapositive 23 remains viable for extended periods of time changes in morphology, nuclear structure gene expression, metabolism Wild type G3 Terc-deficient Interfollicular epidermis Interfollicular epidermis Infundibulum Infundibulum * dermis Hair bulge * Hair bulge dermis dermis dermis Hair bulb Hair bulb Maria Blasco Laboratory, Image d’Ignacio Flores Le raccourcissement des télomères est une barrière anti-tumorale Les cellules précancéreuses vieillissent : Cellules normales mutation la croissance de la tumeur s’arrête carcinogène Mécanisme de surveillance actif carcinogène mutation Barrière antiproliférative (p53, Rb) Cellules précancéreuses Tumeur cancéreuse Le nombre accru de divisions des cellules entraîne une perte anormale des motifs télomériques : les cellules précancéreuses vieillissent en accéléré ce qui bloque 25 l’apparition du cancer hTERT +++ P53 RB Sénescence (M1) Crise Immortalité (M2) 90 % des cancers surexpriment la télomérase 10 % des cancers ne surexpriment pas la télomérase mais activent une voie alternative du maintien de l’ADN télomérique = ALT Telomere length dynamics during malignant transformation Telomere length Telomerase activity Abnormal Extensive proliferation proliferation Telomeres and aging 1 Kb G1 Terc-/x G1 Terc-/- G2 Terc-/x G2 Terc-/- G3 Terc-/- 1 Kb Herrera et al., EMBO J. (1999a, 1999b, 2000); Samper et al., Blood (2002); Leri et al., EMBO J. (2003) Telomeres and aging X G3 Terc-/- Wild type Restoration of telomerase rescues premature aging in Terc-/- mice with short telomeres Samper et al. EMBO Rep. 2, 1-8 (2001), Siegl-Cachedienier et al. JCB. in press. Telomeres and cancer DMBA + TPA wild-type G1 Terc-/- G5 Terc-/- C57BL6 x DBA/2 22 weeks telomerase normal telomeres no telomerase normal telomeres no telomerase short telomeres mTerc -/- mice are resistant to chemical-induced tumorigenesis Gonzalez-Suarez et al. Nature Genet. 26, 114-117 (2000) K5-mTert mice: a model of telomerase over-expression More than 90% of tumors up-regulate telomerase Not I Not I K5 Promoter G1 mTert mTert Gonzalez-Suarez et al. EMBO J. 20, 2619-2630 (2001) PA Telomerase papillomas per mouse Telomerase and cancer 4 wild-type 3 Tert K5-Tert 14-20mm 8-14mm 6-8mm 4-6mm 2-4mm 1-2mm 4 Tert 3 2 2 1 1 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 * * weeks weeks K5-Tert / Terc-/4 Tert 3 2 1 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 * weeks mTert over-expression promotes chemical-induced tumorigenesis Gonzalez-Suarez et al. EMBO J. (2001), Cayuela et al. EMBO Rep. (2005) Telomerase and cancer …and aging Telomerase overexpression increases maximum lifespan in mice González-Suárez et al. Oncogene, 2005 “Telocentric” view of cancer and aging aging cancer aging cancer K5-mTert mice mTerc-/mice telomerase stem cells telomere length Telomerase is specifically expressed in stem/progenitor compartments S. cerevisiae telomere Ku Rif1 Sir Sir Rif2 Rap1 Rap1 Rif1 Rif2 Rap1 Stn1 Ten1 Rif1 Rif2 Rap1 Ku Cdc13 3’ EST2+ 1 EST2+ 2 4 3 2 3 4 Teng & Zakian MCB 1999 Teng & Zakian Sénescence réplicative: subtelomeric DNA Y’-element subtelomeric DNA TG1-3 repeats TG1-3 repeats 50 générations Y’-element Core X TG1-3 repeats TG1-3 repeats RAD52, RAD54, RAD57, MRC1, RAD51, SGS1, SIR4 EXO1, SAE2,SAS2, SIR3 Replicative senescence DNA damage signal Stalled replication fork? excessive 3’-overhang? double strand ends? Low inhibitory signal from temomeric proteins ? Checkpoint reponse Slow growth and G2/M arrest , Cell death MEC1,DDC2, MEC3, RAD24, MRX. Rad53 phosphorylation (not required: Rad9, Rad53) TLC1 Tet Off Recruitment of proteins to a DSB (foci) A model for the telomeres tethering at the nuclear periphery (telomerase positive cells) Bühler M. & Gasser S. – EMBO journal20 09 Eroded telomeres co-localize with nuclear pore complexes Khadaroo et al., Nat Cell Biol, 2009 DNA DAMAGE DNA repair systems PARP TLS HR, NHEJ Struct spec Nucleases MUTATIONS Inactivation of tumor suppressor genes Activation of proto-oncogenes CANCER DNA double-strand breaks Causes Specialized V(D)J recombination Meiotic recombination Exogenous Radiation Chemicals Endogenous Free radicals Replication forks Mauro Modesti ‘s team: mechanisms of DSB repair Homologous recombination HR DSB (NHEJ) (non-homologous end joining) Homologous matrix « Classical » NHEJ and DSB repair IR KU70/80 Recognition Artemis nuclease Synapsis DNA-PKcs P DNA-PKcs autophosphorylation Processing P + PNK, DNA polymerases mu and beta P P P P P DNA ligase IV P P XRCC4 P Ligation Cer-XLF Pierre-Henri Gaillard: Structure-specific DNA endonucleases and genome stability Essential surgical tools Secondary DNA structures Xpf‐Ercc1 5’ 3’ Xpg Xpf‐Ercc1 3’ 5’ Nucleotide excision repair Xpf‐Ercc1 3’ 5’ 3’ 3’ 5’ 3’ Single-strand annealing (HR) 3’ 5’ Mismatch repair Slx1‐Slx4 Fen1 Dna2 Mus81‐Eme1 Homologous Recombination DNA Replication rDNA maintenance
