TCR Repertoire and Foxp3 Define Distinct Treg Subsets

Telechargé par Vũ Nghĩa Lộc Phan
TCR repertoire and Foxp3 expression define functionally distinct
subsets of CD4+ Treg cells1
Michal Kuczma2, Iwona Pawlikowska3, Magdalena Kopij2, Robert Podolsky2, Grzegorz A.
Rempala3, and Piotr Kraj2,4
2Center for Biotechnology and Genomic Medicine, Medical College of Georgia, Augusta, Georgia
30912
3Department of Biostatistics and the Cancer Center, Medical College of Georgia, Augusta, Georgia
30912
Abstract
Despite extensive research efforts to characterize peripheral regulatory T cells (Treg) expressing
transcription factor Foxp3, their subset complexity, phenotypic characteristics, TCR repertoire and
antigen specificities remain ambiguous. Here, we identify and define two subsets of peripheral
Treg cells differing in Foxp3 expression level and TCR repertoires. Treg cells expressing a high level
of Foxp3 and TCRs not utilized by naive CD4+ T cells present a stable suppressor phenotype and
dominate the peripheral Treg population in unmanipulated mice. The second Treg subset, expressing
a lower level of Foxp3 and utilizing TCRs shared with naive CD4+ T cells constitutes a small fraction
of all Treg cells in unmanipulated mice and enriches Treg population with the same antigen
specificities as expressed by activated/effector T cells. This Treg subset undergoes extensive
expansion during response to antigen when it becomes a major population of antigen-specific Treg
cells. Thus, Treg cells expressing TCRs shared with naive CD4+ T cells have a flexible phenotype
and may downregulate Foxp3 expression which may restore immune balance at the conclusion of
immune response or convert these cells to effector T cells producing inflammatory cytokines.
Keywords
T cells; Tolerance/Suppression/Anergy; Autoimmunity; Transcription Factors
Regulatory CD4+ T cells (Treg) expressing the transcription factor Foxp3 represent a major
population of suppressor cells maintaining homeostasis of the immune system (1). The origin,
subset composition and functional properties of Treg cells residing in peripheral lymphoid
organs of healthy mice are not well known. Previously, two major subsets of Treg cells, natural
(nTreg) and adoptive (a Treg) were defined based on whether their suppressor function is
acquired during normal T cell development or following TCR stimulation in peripheral tissues
or in vitro. Hence, nTreg cells, that have intrinsic suppressor function, arise and mature in the
thymus, and a Treg cells are generated from naive CD4+ T cells extrathymically, particularly
in conditions of sub-optimal antigen exposure (2–5). Of the two subsets, the nTreg population
has undergone the most characterization. However, a recent report showed that thymus-derived
1This work was supported by NIH grants R01 CA107349-01A1 to P.K. and 1R01DE019243-01 to G.A.R.
4Correspondence: Piotr Kraj, Center for Biotechnology and Genomic Medicine, Medical College of Georgia, CA-4141, Augusta, Georgia
30912. [email protected], Phone: (706) 721 7281, Fax: (706) 721 3482.
Disclosures
The authors have no conflicting financial interests.
NIH Public Access
Author Manuscript
J Immunol. Author manuscript; available in PMC 2010 September 1.
Published in final edited form as:
J Immunol. 2009 September 1; 183(5): 3118–3129. doi:10.4049/jimmunol.0900514.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
nTreg cells may be further subdivided into two functional subsets, which brings into question
whether the nTreg population is homogenous (6). In addition, the relative contribution of
nTreg and a Treg cells to the peripheral pool of Treg cells in healthy mice remains controversial.
It has been shown that a Treg cells are efficiently generated in vitro upon antigen stimulation
of naive cells in the presence of TGF-β and Il-2 and that their suppressor function is similar to
that of nTreg cells based on in vitro tests (7,8). Though, the extent to which these subsets are
equivalent in vivo is not known considering their function may be modified by differing homing
capacity, antigen specificity and ability to expand in response to antigen and/or inflammatory
cytokines. Further shown was the capacity of in vitro generated a Treg cells to suppress antigen-
induced T cell activation in cell culture and to protect mice from the development of
autoimmune diseases in vivo. However, in those experiments, most cells quickly lost Foxp3
expression in the recipient mice (9,10).
In vivo upregulation of Foxp3 and conversion to a Treg cells happens during homeostatic
expansion, particularly in recipients expressing systemic antigen. Foxp3 can also be
upregulated by stimulation with low doses of cognate antigen (4,5,11). Some studies have
found that peripheral conversion of effector CD4+ T cells (Teff) may also occur in a steady-
state, particularly in organs like the respiratory tract and intestine subject to continuous antigen
stimulation (12–14). Still another study has shown that in situ conversion to a Treg cells has
only a marginal contribution to the expansion of Treg cells in acute inflammation (15).
Similarly, analysis of monoclonal T cells specific for islet self-antigen has led some to conclude
that peripheral conversion occurs infrequently (16). The conflicting data reported thus far
emphasize the need for an experimental model that would allow for further dissection of the
peripheral population of Treg cells in the steady state and during response to antigen.
Foxp3 is a transcription factor that regulates the expression of genes involved in the control of
multiple cellular and immune functions of CD4 lymphocytes (17,18). Some data suggest that
Foxp3 acts in a dose-dependent manner instead of being a binary switch between Teff and
Treg phenotypes (19). Thus, the differences in Foxp3 expression may form the basis for the
heterogeneity of the Treg population. Complete demethylation at the Foxp3 locus has been
found to be necessary for stable expression of the Foxp3 gene (20). Incomplete demethylation
of the Foxp3 locus leads to transient expression of Foxp3 observed in a Treg cells, as well as
expression of Foxp3 in activated human T cells that did not have suppressor function (21).
Thus, the stability of the Treg phenotype correlates with molecular features at the Foxp3 locus.
Weak signaling through the TCR, also responsible for the maintenance of T cells in peripheral
tissues, creates conditions for opening chromatin structure at the Foxp3 gene (22). In summary,
molecular studies suggest that the level of Foxp3 expression in peripheral CD4+ T cells may
vary depending on the environmental signals received through the TCR and could be further
modulated by cytokines like TGF-β.
Here, we utilize a new mouse model (Foxp3GFP mice) where we analyze Treg cells in
unmanipulated and immunized mice to gain further characterize their properties. This analysis
shows that the peripheral population of Treg cells consists of two major subsets that can be
discriminated by the level of Foxp3 expression and by the non-overlapping TCRs they express.
The Treg subset expressing high levels of Foxp3 presents a stable phenotype of suppressor
cells. Treg cells expressing lower levels of Foxp3 express the same TCRs as naive cells
suggesting that they represent Teff cells at various stages of differentiation towards becoming
a Treg cells. However, some cells within this subset can be diverted into Teff cells when
appropriately stimulated. Despite being only a small component in a steady state, this subset
expanded quicker than Treg cells expressing an exclusive set of TCRs upon stimulation, thus
playing an important role in maintaining the balance between tolerance and immunity.
Kuczma et al. Page 2
J Immunol. Author manuscript; available in PMC 2010 September 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
We propose that peripheral Treg cells expressing an exclusive set of TCRs, not found in the
population of naive CD4+ T cells, form the bulk of nTreg population. In contrast, Treg cells
sharing the same set of TCRs as naive cells dominate the a Treg subset. Our data also emphasize
the importance of thymic selection which endows a developing CD4+ T cell with distinctive
properties to become a Treg cell or to function as a Treg or a Teff cell depending on the expression
of a particular TCR.
Materials and Methods
Mice
Mice expressing the Foxp3GFP reporter transgene were produced by pronuclear injection of
the modified BAC construct encompassing Foxp3 locus into C57BL6 oocytes (submitted).
DNA fragment encoding GFP followed by the polyadenylation signal was introduced in frame
with Foxp3 translation initiation site into exon 1 of the Foxp3 gene. Foxp3GFP mice expressing
a limited TCR repertoire were produced by crossing TCRmini and Foxp3GFP mice (23). Mice
were housed under specific pathogen-free conditions and used according to the guidelines of
the Institutional Animal Care and Use Committee of the Medical College of Georgia.
Cell purification, flow cytometry and cell sorting
Single-cell suspensions were prepared from lymph nodes by mechanical disruption and cells
were stained with antibodies available commercially (eBioscience or BD Biosciences). Cells
were analyzed using FACSCanto flow cytometer (Becton Dickinson) and FACSDiva or
WinList software. Cells were sorted on a MoFlo cell sorter (Cytomation). Purity of sorted
populations exceeded 98.5%. For some experiments, CD4+ T cells were negatively sorted using
a commercial kit and an AutoMACS magnetic cell sorter (Miltenyi, Auburn, CA).
Single-cell RT-PCR and TCR sequencing
Single cells from various CD4+ populations were sorted for TCR sequencing as described
previously (23). Brachial, axillary and inguinal lymph nodes isolated from two 6 week old
TCRmini-Foxp3GFP mice were combined for cell sorting. We analyzed 701 TCRs from naive
CD44−CD62L+Foxp3GFP−, 341 from Foxp3GFPlo, 366 from Foxp3GFPhi and 298 from
activated CD44+CD62L−Foxp3GFP− T cell subsets of unmanipulated mice. Another two
TCRmini-Foxp3GFP mice were analyzed in a similar experiment (data not shown). For analysis
of CD4+ T cell subsets in mice undergoing response to antigen we sorted the same CD4+ T
cell populations from popliteal lymph nodes draining antigen injection site of two TCRmini-
Foxp3GFP mice immunized with Ep63K peptide and CFA. We analyzed 215 TCRs from naive
CD44−CD62L+Foxp3GFP−, 144 from Foxp3GFPlo, 64 from Foxp3GFPhi and 254 from activated
CD44+CD62L−Foxp3GFP− T cell subsets of immunized mice. DNA sequencing was done in
the DNA sequencing core facility at the University of Illinois.
Proliferation assay
Lymph node proliferation assays was performed with total population of lymph node cells from
TCRmini mice (4×105 cells/well) incubated with Ep63K peptide (■, ●) (0.1, 1 and 10 µM) in
round-bottom 96-well plates. IgGVH(59–74) peptide (□, ○)(0.1, 1 and 10 µM) was used as a
control. Proliferation responses were measured by adding 1 μCi/well of 3H-thymidine on day
3 of a 4-day culture.
Inhibition assay
Sorted CD4+Foxp3GFP− cells (5×104/well) were incubated on a 96-well plate with irradiated
splenocytes (5×104/well, 3000 Rad) and soluble anti-CD3ε (5 µg/ml). Various numbers of
sorted CD4+Foxp3GFP+ cells (1–5×104/well) were added. Cells were sorted using MoFlo
Kuczma et al. Page 3
J Immunol. Author manuscript; available in PMC 2010 September 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
sorter. After culturing cells for 3 days, proliferation was measured by adding 1 μCi/well
of 3H-thymidine. The percent of cells stimulated was calculated by dividing the proliferation
reading from a particular well by the reading from a well with only Foxp3GFP− cells.
In vitro cultures of Treg cells
Flow cytometer sorted CD4+Foxp3GFP−, CD4+Foxp3GFPlo and CD4+Foxp3GFPhi cells were
stimulated for 2 days with plate-bound anti-CD3ε/anti-CD28 antibodies alone or in the
presence of TGFβ (3 ng/ml). Foxp3GFP expression in cultured cells was assessed by flow
cytometry. To examine the TCR repertoire studies of Treg cells that retain or lose Foxp3
expression CD4+Foxp3GFP+ cells were stimulated for 5 days with plate-bound anti-CD3ε/anti-
CD28 antibodies in the presence of Il-2 (50 u/ml). Single CD4+Foxp3GFP+ and
CD4+Foxp3GFP− cells were sorted for TCR sequencing as described above.
Adoptive transfer
Donor cells for adoptive transfer were isolated by flow cytometry sorting of
CD4+Foxp3GFPlo or CD4+Foxp3GFPhi cells from Ly5.1+Foxp3GFP mice and
CD4+Foxp3GFP− cells from Ly5.1−Foxp3GFP mice. CD4+Foxp3GFPlo or CD4+Foxp3GFPhi
cells (105/mouse) were cotransferred i.v. with CD4+Foxp3GFP− (7.5×105/mouse) cell into
recipient TCRα chain knockout mice. To determine the stability of Foxp3 expression, recipient
mice were analyzed 4 weeks after adoptive transfer. Weight of the recipient animals was
measured over a period of 17 weeks to determine suppressive capacity of Foxp3GFPlo or
Foxp3GFPhi cells. To show upregulation of Foxp3 by peripheral naive CD4+ T cells
lymphoreplete Ly5.1− TCRmini-Foxp3GFP mice received i.v. transfer of 3×106 Foxp3GFP− cells
sorted by flow cytometry from C57BL6 Ly5.1+ Foxp3GFP mice. Lymph node cells of recipient
mice were analyzed by flow cytometry 8 days after transfer.
RT-PCR for Foxp3 transcript
Lymph node cells were isolated from Foxp3GFP transgenic mice. RNA was isolated from sorted
CD4+Foxp3GFP− and CD4+FoxpGFP+ cells expressing increased levels of the GFP reporter
(103 cells/sample). cDNA was produced using the Superscript III CellsDirect cDNA synthesis
system (Invitrogen) according to the manufacturer’s instructions. β-actin was used to normalize
cDNA quantities. Foxp3 cDNA was amplified with the sense primer
5’ATCCAGCCTGCCTCTGACAAGAACC 3’ and the reverse primer 5’
GGGTTGTCCAGTGGACGCACTTGGAGC 3’. These primers distinguish between the
amplification product of the endogenous Foxp3 gene (401 bp) and the transgenic transcript
(1357 bp). PCR products were resolved on agarose gels, with the gel being scanned. The
resulting gel image was analyzed and DNA bands were quantitated using ImageQuant software
(Molecular Dynamics). Relative band intensity was expressed in arbitrary units.
Western blotting
Foxp3 protein was detected in sorted (105 cells/sample) CD4+Foxp3GFP−, CD4+Foxp3GFPlo
and CD4+Foxp3GFPhi cells. Cells were lysed in the gel-loading buffer and resolved on 10%
polyacrylamide gel. Proteins were transferred onto a PVDF membrane (Millipore). Membranes
were probed with anti-Foxp3 antibody eBio7979 (eBioscience) followed by goat anti-mouse
polyclonal antibody coupled with horseradish peroxidase (BioRad). Membranes were
developed with ECL chemiluminescence kit (Amersham) according to the manufacturer’s
instructions.
Cytokine and transcription factor detection by RT-PCR
Production of cytokines in vitro by sorted CD4+Foxp3GFP−, CD4+Foxp3GFPlo and
CD4+Foxp3GFPhi T cells was assessed by RT-PCR. Cells were sorted onto 96-well plates
Kuczma et al. Page 4
J Immunol. Author manuscript; available in PMC 2010 September 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
(5×104/well) coated with anti-CD3 (10 µg/ml) and anti-CD28 (1 µg/ml) antibodies and cultured
under neutral, Th1, Th2 or Th17 conditions for detection of Il-2, IFNγ, Il-4, Il-17 respectively.
After 3 days, cells were collected and RNA was isolated with an RNeasy Mini Kit (Qiagen)
and reverse transcribed using a Superscript kit (Invitrogen) according to the manufacturer’s
instructions. cDNA prepared from cells directly after sorting served as a negative control. β-
actin was used to normalize cDNA quantities and was amplified with the sense primer
5’CCTTCTACAATGAGCTGCGTGTGGC3’ and antisense primer
5’CATGAGGTAGTCTGTCAGGTCC3’. Cytokine cDNA was amplified using the following
primers: Il-2, sense: 5’CCTTGCTAATCACTCCTCACA’, antisense:
5’GAGCTCCTGTAGGTCCATCA3’, Il-4 sense: 5’CAAGGTGCTTCGCATATTTT3’,
antisense: 5’ATCCATTTGCATGATGCTCT3’, Il-17, sense:
5’AGGCCCTCAGACTACCTCAA3’, antisense: 5’CAGGATCTCTTGCTGGATGA3’,
IFN-γ, sense: 5’AGTGGAGCAGGTGAAGAGTG3’, antisense:
5’TTCGGAGAGAGGTACAAACG3’. Transcription factor cDNAs were amplified with the
following primers: GATA-3, sense: 5’CTCCTTTTTGCTCTCCTTTTC3’, antisense:
5’AAGAGATGAGGACTGGAGTG3’, T-bet, sense:
5’TTCCCATTCCTGTCCTTCACCG3’, antisense:
5’CTGGAAGGTCGGGGTAGAAACG3’, RORγt: sense:
5’GCACCCGCTGAGAGGGCTTCACC3’, antisense:
5’CTGCACTTCTGCATGTAGACTGTCCC3’. cDNA prepared from cells known to produce
a particular cytokine or transcription factor was used as a positive control.
Immunization
TCRmini-Foxp3GFP mice were immunized s.c. in the footpad with 1:1 emulsified mixture of
Ep63K peptide (5 mM sol. in PBS) and CFA. Popliteal lymph nodes were removed after 7
days and analyzed by flow cytometry. Single cells from various CD4+ T cell subsets were
sorted for TCR repertoire studies.
Statistical analysis
The similarity indices, Shanon means and overlap estimators were used as described previously
(23). Additional information can be found in the help files for the EstimateS software
(http://viceroy.eeb.uconn.edu/estimates).
Testing for symmetry in protein sequence distribution among naive (N) and Foxp3GFP+ (G)
cells was done using two approaches. In both of them we consider binomial counts Xi, i=1…
m, of the protein sequences in N group for ni trials (hence G group count is simply ni - Xi). We
restricted our attention to proteins sequences where ni>l>0 for some fixed integer l.
In the first approach the probability of a random sequence distribution, given the experimental
data about TCR distribution, was calculated. We made an assumption that Xi’s are independent
with binomial distribution with parameters ni, pi (Xi ~binom (ni, pi)) where pi has an unknown
distribution of Fp (pi ~ Fp). We tested the hypothesis H0 of between-groups-symmetry i.e.,
H0: p=dq (or Fq(1 - x) = 1 - Fp(x)), where q = 1 - p. Using the fact that under the null hypothesis
we have P(k zeros in N) = P(k zeros in G), we defined a test statistic for H0 given by: D0 =
(number of zeros in N) – (number of zeros in G). It is symmetric on H0, and the p-value was
calculated as p-val ≈ #(| D0perm | > |D0obs |)/B where, # is the number of elements for which
expression in the parenthesis is true, D0perm is the permutation distribution of D0, that is the
approximate distribution (conditional on the data) of D0, recalculated many times (say B) from
pairs of counts from data sets N, G but in which the labels were randomly scrambled. For the
experimental data where we have taken l = 4, we obtained D0perm = 13 and as p-val = 0.01.
Kuczma et al. Page 5
J Immunol. Author manuscript; available in PMC 2010 September 1.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
1 / 28 100%
La catégorie de ce document est-elle correcte?
Merci pour votre participation!

Faire une suggestion

Avez-vous trouvé des erreurs dans l'interface ou les textes ? Ou savez-vous comment améliorer l'interface utilisateur de StudyLib ? N'hésitez pas à envoyer vos suggestions. C'est très important pour nous!