Effect on Tumor Cells of Blocking Survival Response to Glucose Deprivation

Effect on Tumor Cells of Blocking Survival Response to
Glucose Deprivation
Hae-Ryong Park, Akihiro Tomida, Shigeo Sato, Yoshinori Tsukumo, Jisoo Yun,
Takao Yamori, Yoichi Hayakawa, Takashi Tsuruo, Kazuo Shin-ya
Background: Glucose deprivation, a feature of poorly vascularized solid tumors, activates the unfolded protein response
(UPR), a stress-signaling pathway, in tumor cells. We recently isolated a novel macrocyclic compound, versipelostatin (VST), that inhibits transcription from the promoter of
GRP78, a gene that is activated as part of the UPR. We
examined the effect of VST on the UPR induced by glucose
deprivation or other stressors and on tumor growth in vivo.
Methods: Human colon cancer HT-29, fibrosarcoma
HT1080, and stomach cancer MKN74 cells were cultured in
the absence of glucose or in the presence of glucose and a
UPR-inducing chemical stressor (the N-glycosylation inhibitor tunicamycin, the calcium ionophore A23187, or the
hypoglycemia-mimicking agent 2-deoxyglucose [2DG]). The
effect of VST on UPR induction was determined by reverse
transcription–polymerase chain reaction and immunoblot
analysis of the UPR target genes GRP78 and GRP94; by
immunoblot analysis of the UPR transcriptional activators
ATF6, XBP1, and ATF4; and by analyzing reporter gene
expression in cells transiently transfected with a GRP78
promoter–reporter gene. Cell sensitivity to VST was examined with a colony formation assay and flow cytometry. In
vivo antitumor activity of VST was assessed with an MKN74
xenograft model. Results: VST inhibited expression of UPR
target genes in glucose-deprived or 2DG-treated cells but not
in cells treated with tunicamycin or A23187. VST also inhibited the production of the UPR transcriptional activators
XBP1 and ATF4 during glucose deprivation. The UPRinhibitory action of VST was seen only in conditions of
glucose deprivation and caused selective and massive killing
of the glucose-deprived cells. VST alone and in combination
with cisplatin statistically significantly (P ⴝ .004 and P<.001
for comparisons with untreated control, respectively) inhibited tumor growth of MKN74 xenografts. Conclusion: Disruption of the UPR may provide a novel therapeutic approach to targeting glucose-deprived solid tumors. [J Natl
Cancer Inst 2004;96:1300 –10]
Glucose deprivation is a physiological cell condition that is
associated with several human diseases, including tissue ischemia and cancer (1). Cancer cells in poorly vascularized solid
tumors are constantly or intermittently exposed to glucose deprivation as well as to hypoxia (2,3). Glucose deprivation can
disrupt protein folding in the endoplasmic reticulum (ER) (4 – 6).
The accumulation of unfolded proteins in the ER activates the
unfolded protein response (UPR), which enhances cell survival
by limiting accumulation of unfolded or misfolded proteins in
the ER (5,6). Several genes are transcriptionally activated as part
of the UPR, including the ER-resident molecular chaperones
GRP78 (also known as BiP) and GRP94 (7). Attenuation of the
UPR by gene targeting renders mouse embryonic fibroblasts
1300 ARTICLES
vulnerable to glucose deprivation (8). In theory, therefore, the
UPR could be exploited for the selective killing of glucosedeprived solid tumor cells.
The UPR is initiated through signaling of the ER-localized
transmembrane proteins ATF6, IRE1␣ (and, in some cells,
IRE1␤), and PERK (4 – 6). These signaling pathways produce
several different active transcription factors that lead in turn to
the coordinated expression of multiple UPR target genes (4 – 6).
For example, ATF6 undergoes proteolytic cleavage to become
an active transcription factor for UPR target genes (9 –11),
whereas IRE1␣ mediates the unconventional splicing of XBP1
mRNA, resulting in a potent UPR transcriptional activator (12–
15). PERK induces the expression of the transcription factor
ATF4 by transiently inhibiting general protein synthesis
(16 –18).
In the course of a screen for modulators of molecular chaperones, we recently isolated a novel compound from Streptomyces versipellis, designated versipelostatin (VST), that has a
novel 17-membered macrocyclic structure with an ␣-acyltetronic acid moiety (19). VST can inhibit transcription from a
GRP78 promoter reporter construct (19). Here, we investigated the effect of VST on UPR activation in cells exposed to
glucose deprivation or other UPR-inducing stressors by examining the expression of UPR target genes and their activators.
We also examined the in vivo antitumor activity of VST.
MATERIALS
AND
METHODS
Chemicals
VST was prepared as a stock solution of 10 mM in methanol
or phosphate-buffered saline and stored at ⫺20 °C (19).
D-Glucose and 2-deoxyglucose (2DG) were purchased from
Sigma (St. Louis, MO), dissolved in sterilized distilled water at
stock concentrations of 200 mg/mL and 2 M, respectively, and
stored at ⫺20 °C. Tunicamycin and cycloheximide (CHX) were
purchased from Nacalai Tesque (Kyoto, Japan), A23187 from
Wako Pure Chemical Industries (Osaka, Japan), and MG132
Affiliations of authors: Laboratory of Chemical Biology (HRP, YH, KS);
Laboratory of Cell Growth and Regulation, Institute of Molecular and Cellular
Biosciences, The University of Tokyo, Bunkyo-ku, Tokyo, Japan (AT, YT, JY,
TT); Cancer Chemotherapy Center, Japanese Foundation for Cancer Research,
Toshima-ku, Tokyo, Japan (SS, TY, TT).
Correspondence to: Kazuo Shin-ya, PhD, Laboratory of Chemical Biology,
Institute of Molecular and Cellular Biosciences, The University of Tokyo,
Bunkyo-ku, Tokyo 113-0032, Japan (e-mail: [email protected]) or
Takashi Tsuruo, PhD, Laboratory of Cell Growth and Regulation, Institute of
Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1 Yayoi,
Bunkyo-ku, Tokyo 113-0032, Japan (e-mail: [email protected]).
See “Notes” following “References.”
DOI: 10.1093/jnci/djh243
Journal of the National Cancer Institute, Vol. 96, No. 17, © Oxford University
Press 2004, all rights reserved.
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004
from the Peptide Institute (Osaka, Japan). These compounds
were dissolved in dimethyl sulfoxide (DMSO) at stock concentrations of 4 mg/mL, 10 mg/mL (CHX), 10 mM (A23187), and
10 mM (MG132) and were stored at ⫺20 °C. All of the compounds were added to cell culture medium such that the solvent
(methanol or DMSO) made up less than 0.5% of the volume of
the culture medium.
allow semiquantitative comparisons among cDNAs developed
from identical reverse transcriptase reactions. The housekeeping
gene G3PDH was amplified as an internal control. PCR products
were separated by electrophoresis on 1.2% agarose gels (for
analysis of GRP78, GRP94, HSP70, and G3PDH) or a 4%–20%
polyacrylamide gel (for analysis of XBP1) and visualized with
ethidium bromide staining.
Cell Lines
Plasmids and Transfection
Human HT-29 colon cancer, HT1080 fibrosarcoma, and
MKN74 stomach cancer cells were obtained from Dr. R. Shoemaker of the National Cancer Institute (National Institutes of
Health, Bethesda, MD), the American Type Culture Collection
(Manassas, VA), and IBL (Gunma, Japan), respectively. These
cell lines were maintained in RPMI 1640 medium (containing 2
mg of glucose/mL; Nissui, Tokyo, Japan) supplemented with
10% heat-inactivated fetal bovine serum and 100 ␮g/mL of
kanamycin and were cultured at 37 °C in a humidified atmosphere containing 5% CO2 (defined as “normal growth conditions”). Glucose-free RPMI 1640 medium was obtained from
Invitrogen (San Diego, CA) and supplemented with 10% heatinactivated fetal bovine serum as described previously (20,21).
All in vitro experiments were performed using exponentially
growing cells and were repeated at least twice.
The pcFlag vector was produced by ligating an oligonucleotide DNA sequence encoding a FLAG epitope to the HindIII site
of pcDNA3 (Invitrogen). The plasmids pATF6(F), which codes
for full-length ATF6; pATF6(A), which corresponds to the
active form of ATF6, i.e., amino acids 1–373; pXBP1(U), which
encodes the XBP1 protein corresponding to the unspliced
mRNA; and pXBP1(S), which encodes the XBP1 protein corresponding to the spliced mRNA were created by inserting each
cDNA [generated by PCR from untreated or 2DG-treated HT-29
cDNA, using the following primer pairs (5⬘ to 3⬘): CATC
CCAAGCTTTTGGGGGAGCCGGCTGGGGTTG and TGCTCT
AGAGTCCCACGCTCAGTTTTCCAG for pATF6(F); CATC
CCAAGCTTTTGGGGGAGCCGGCTGGGGTTG and TGCT
CTAGACTAACTAGGGACTTTAAGCCTCTG for pATF6(A);
and CATCCCAAGCTTTTGGTGGTGGTGGCAGCCGCGCC
GAAC and TGCTCTAGAAGTCAAGGAAAAGGGCAACAG
for pXBP1(U) and pXBP1(S)] in frame into the pcFlag vector at
the HindIII/XbaI site. The pGRP78pro160-Luc plasmid was
created by cloning the human GRP78 promoter region [nucleotides ⫺160 to ⫹7 relative to the start of transcription; generated
by PCR, using the primer pair (5⬘ to 3⬘) CGGGGTACCGGAG
CAGTGACGTTTATTGC and CATCCCAAGCTTTCGACCT
CACCGTCGCCTACTC, from genomic DNA isolated from
293T cells with the QIAamp DNA Mini Kit (Qiagen)] into the
KpnI/HindIII site of the pGL3-Basic vector (Promega, Madison,
WI), which contains the firefly luciferase gene. pHSP70pro-Luc
was created by inserting the human HSP70 promoter fragment
(1.4 kb; upstream of ⫹114 with respect to the start of transcription site), obtained by BglII/HindIII digestion of the Mammalian
Heat Shock Expression Vector p2500-CAT (StressGen), into the
BglII/HindIII site of the pGL3-Basic vector. pcDNA3.1/mycHis/lacZ was purchased from Invitrogen. The proper construction of all plasmids was confirmed by DNA sequencing. Transient transfections were performed using the FuGENE 6
Transfection Reagent (Roche Molecular Biochemicals, Indianapolis, IN) according to the manufacturer’s protocol.
Cell Treatments
To induce the UPR, we treated cells for various times with
glucose deprivation by replacing the medium with glucose-free
medium or by adding to glucose-containing culture medium one
of the chemical stressors 2DG (20 mM), tunicamycin (TM) (5
␮g/mL), or A23187 (1 ␮M). VST was added to the cells at
various final concentrations immediately after they were placed
in glucose-free medium or just before the chemical stressors
were added to glucose-containing culture medium. In experiments involving CHX, it was also added to the cells in the same
way as VST. In experiments that involved heat treatment, culture plates were floated on the water in a 42 °C water bath for 1
hour immediately after VST and 2DG were added to glucosecontaining culture medium. In some experiments, we treated
cells with the proteasome inhibitor MG132 at 10 ␮M during
exposure to the UPR inducers.
Semiquantitative RT–PCR Analysis
Total RNA was isolated from HT-29 and HT1080 cells by
using an RNeasy Mini Kit with DNase digestion (Qiagen, Tokyo, Japan) and was converted to cDNA with SuperScript II
reverse transcriptase (Invitrogen). The cDNAs for GRP78,
GRP94, HSP70, XBP1, and G3PDH were then amplified by
polymerase chain reaction (PCR) with PfuTurbo DNA polymerase (Stratagene, La Jolla, CA). The nucleotide sequences of the
primer pairs (5⬘ to 3⬘) were GTATTGAAACTGTAGGAGGT
GTC and TATTACAGCACTAGCAGATCAG for GRP78, TGA
AAAGGCTGTGGTGTCTC and TCGTCTTGCTCTGTGTCTTC
for GRP94, GCGCGACCTGAACAAGAGCATC and TCCGCT
GATGATGGGGTTACAC for HSP70, CCTTGTAGTTGAG
AACCAGG and GGGGCTTGGTATATATGTGG for XBP1,
and TGAAGGTCGGAGTCAACGGATTTGGT and CATGT
GGGCCATGAGGTCCACCAC for G3PDH. The reaction conditions (21–25 cycles of 94 °C for 1 min, 60 °C for 1 min, and
72 °C for 2 min) had been predetermined (data not shown) to
Immunoblot Analysis
Cells were lysed in 1⫻ sodium dodecyl sulfate (SDS)
sample buffer (62.5 mM Tris–HCl [pH 6.8], 2% SDS, 5%
2-mercaptoethanol, and 10% glycerol), and protein concentrations of the lysates were measured with a Bio-Rad protein
assay kit (Bio-Rad, Hercules, CA) (20,21). Equal amounts of
proteins were resolved on a 4%–20% SDS–polyacrylamide
gel and transferred by electroblotting to a nitrocellulose membrane (20,21). Immunoblots were probed with the following
primary antibodies: mouse monoclonal anti-KDEL (for detection of GRP78 and GRP94; StressGen, Victoria, British
Columbia, Canada); anti-FLAG M2 (for detection of FLAGtagged ATF6 and XBP1 proteins; Sigma); anti-Myc tag (for
detection of Myc-tagged ␤-galactosidase; Sigma); anti–␤-
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004
ARTICLES 1301
actin (for internal control; Sigma); anti-ATF6 (Active Motif,
Carlsbad, CA); and rabbit polyclonal anti-CREB-2 (ATF4)
(Santa Cruz Biotechnology, Santa Cruz, CA). Membranes
were pretreated for 1 hour with TBS–T (50 mM Tris–HCl [pH
7.5], 150 mM NaCl, and 0.1% Tween 20) containing 5%
nonfat dry milk at room temperature and incubated for 1– 4
hours with the above primary antibodies (1 : 500 for antiATF6 antibody and 1 : 1000 for the other antibodies) under
the same conditions. The membranes were washed with
TBS–T containing 5% nonfat dry milk at room temperature
and incubated for 1 hour with horseradish peroxidase–
conjugated sheep anti–mouse or donkey anti–rabbit immunoglobulin antibody (1 : 1000) (Amersham Pharmacia Biotech,
Tokyo, Japan) under the same conditions. After washing with
TBS–T, the specific signals were detected with an enhanced
chemiluminescence detection system (Amersham Pharmacia
Biotech).
Reporter Gene Assay
HT1080 cells (3 ⫻ 105 in each well of 12-well plates) were
cultured overnight under normal growth conditions. The medium was then changed to antibiotic-free RPMI 1640 medium
supplemented with 5% fetal bovine serum, transfection mixtures
that contained 375 ng of the firefly luciferase gene– containing
reporter plasmids pGRP78pro160-Luc, pHSP70pro-Luc, or
pGL3 along with 125 ng of plasmid pRL-TK (Promega) (in
which Renilla luciferase expression is under the control of the
herpes simplex virus thymidine kinase promoter) as an internal
control were added, and the cells were incubated for 8 hours at
37 °C in a CO2 incubator. In some experiments, the reporter
plasmids were combined with 300 ng of plasmid mixtures containing pcFlag (mock transfection) with various amounts of
pATF6(A), pATF6(F), or pXBP1(U). In the case of pXBP1(S)
co-transfections, we used 1.7 ng of phRL-CMV (Promega) (in
which Renilla luciferase expression is under the control of the
cytomegalovirus promoter) as an internal control with 500 ng of
pGRP78pro160-Luc. The medium was then replaced with fresh
medium lacking plasmid DNA, and the cells were incubated
under the same conditions for another 4 hours. The cells were
then replated in 96-well plates (at 5 ⫻ 103 cells/well), cultured
overnight, and treated for 18 hours with various concentrations
of VST in the presence or absence of the UPR inducers. Heat
treatment (42 °C) was carried out during the first 60 minutes of
VST treatment. Ratios of firefly luciferase activity to Renilla
luciferase activity (mean values with 95% confidence intervals
from triplicate determinations) were determined using the dual
luciferase kit (Promega).
Measurement of Protein Synthesis
Protein synthesis was assayed by measuring incorporation of
[3H]alanine into trichloroacetic acid (TCA)–insoluble material.
Cells were seeded at 4 ⫻103 or 8 ⫻ 103 in each well of a 96-well
plate, cultured overnight under normal growth conditions, and
then treated with various concentrations of VST for various
times. During the last 1 or 2 hours of VST treatment, 2 ␮Ci/mL
of L-[2,3–3H]alanine (52 Ci/mmol; Amersham Pharmacia Biotech) was added to the cells. The cells were then recovered on
glass filters (Molecular Devices, Tokyo, Japan) with a cell
harvester device (Molecular Devices), and 1 mL/well of 5%
TCA was passed through the filters, which were then washed
1302 ARTICLES
with ethanol. The radioactivity on each filter was measured by
scintillation counting. For cell counting, duplicate plates were
treated with VST in the absence of [3H]alanine, and then the
culture medium was replaced with fresh medium lacking VST.
The cells were further cultured for an additional 2 hours under
normal growth conditions, and cell number was determined with
the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) assay (20). The amount of radioactivity
incorporated was normalized to cell number, and relative radioactivity (mean values with 95% confidence intervals from triplicate determinations) was calculated.
Cell Viability Assays
Cells were seeded at 105 or 2 ⫻ 105 in 12- or six-well plates,
cultured overnight, and treated with various concentrations of
VST for various times. For the colony formation assay, cells
were then diluted in fresh medium lacking VST, reseeded at 8 ⫻
102 cells per well in six-well plates, and cultured under normal
growth conditions for 7– 8 days to form colonies (20,21). Cell
survival (mean values with 95% confidence intervals from triplicate determinations) was calculated by setting the survival of
control cells (i.e., not treated with VST) as 100%. IC50 values
(concentration required for 50% inhibition of colony formation)
were determined from dose–response curves of colony formation inhibition. For the flow cytometry assays, the cells were
fixed with 70% ethanol, treated with RNase, and stained with
propidium iodide (22) or were stained directly (without ethanol
fixation) with 7-amino-actinomycin D (PharMingen, San Diego,
CA). Apoptotic and dead cells (mean values with 95% confidence intervals from triplicate determinations) were counted
using a Beckman-Coulter flow cytometer.
The growth inhibition assay with the human cancer cell
line panel and the COMPARE analysis were performed as
described previously (23–25). In brief, the cell line panel
consists of the following 39 human cancer cell lines: lung
cancer lines NCI3-H23, NCI-H226, NCI-H522, NCI-H460,
A549, DMS273, and DMS114; colorectal cancer lines HCC2998, KM-12, HT-29, HCT-15, and HCT-116; gastric cancer
lines MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, and
St-4; ovarian cancer lines OVCAR-3, OVCAR-4, OVCAR-5,
OVCAR-8, and SK-OV-3; breast cancer lines BSY-1,
HBC-4, HBC-5, MDA-MB-231, and MCF-7; renal cancer
lines RXF-631L and ACHN; melanoma line LOXIMVI; glioma lines U251, SF-295, SF-539, SF-268, SNB-75, and SNB78; and prostate cancer lines DU-145 and PC-3. All cell lines
were cultured in RPMI 1640 supplemented with 5% fetal
bovine serum, penicillin (100 U/mL), and streptomycin (100
mg/mL) at 37 °C in humidified air containing 5% CO2. The
GI50 (concentration required for 50% growth inhibition) of
VST for each cell line was determined after 48 hours of drug
treatment with a sulforhodamine B assay (23–25). We then
used the COMPARE algorithm to compare the GI50s of VST
and each of more than 400 standard compounds (including
various anticancer drugs and inhibitors of biological pathways) and assessed the correlations between the differential
growth inhibition patterns of VST and each standard compound in the cell line panel by determining the Pearson
correlation coefficient, as described previously (23,25).
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004
MKN74 Xenograft Tumors
MKN74 cells were grown as subcutaneous tumors in nude
mice, and 3 ⫻ 3 ⫻ 3–mm tumor fragments were then inoculated
subcutaneously into nude mice, as described (23). Therapeutic
experiments (involving six mice per group) were started when
tumors had grown to approximately 100 mm3 (day 0). VST was
administered intravenously at 13.5 or 18 mg/kg of body weight
per day on days 0, 1, and 2. The control group received
phosphate-buffered saline. For combination treatment, cisplatin
was administered intravenously at 7 mg/kg on day 2. The mice
were weighed twice each week up to day 24 to monitor the toxic
effects. Tumor volume was determined by measuring the length
(L) and width (W) of each tumor twice a week, up to day 24, and
was calculated as (L ⫻ W2)/2 (23).
Statistical Analysis
The statistical significance levels of differences in xenograft
volume between groups of control and treated mice were evaluated using a one-way analysis of variance with Dunnett’s test as
described previously (21). Differences with P values less than
.05 were deemed statistically significant using a two-tailed test
between the groups of control and drug-treated mice.
RESULTS
VST and Response to Glucose Deprivation and Other
UPR-Inducing Stressors
To examine the effect of VST on endogenous GRP78 gene
expression, we carried out a semiquantitative reverse transcription–polymerase chain reaction (RT–PCR) analysis of human
colon carcinoma HT-29 and fibrosarcoma HT1080 cells that had
been subjected to glucose deprivation for 18 hours in the presence or absence of VST. Whereas VST suppressed induction of
GRP78 and GRP94 mRNA in glucose-starved HT-29 and
HT1080 cells in a concentration-dependent manner (Fig. 1, a
and b), it had no effect on GRP78 and GRP94 expression levels
in cells grown in the presence of glucose (Fig. 1, b). Immunoblot
analysis of lysates from the glucose-starved cells showed that
VST also suppressed accumulation of the GRP78 and GRP94
proteins (Fig. 1, d).
To investigate whether the effect of VST on GRP expression
extended to divergent ER stress stimuli, we treated HT-29 and
HT1080 cells with one of three different types of chemical
stressors: the hypoglycemia-mimicking agent 2DG, the Nglycosylation inhibitor tunicamycin, and the calcium ionophore
A23187. As expected, VST suppressed 2DG-induced GRP78
and GRP94 mRNA (Fig. 1, b) and protein (Fig. 1, d) accumulation at the same concentrations at which it suppressed their
accumulation in glucose-deprived cells. Time-course experiments revealed that the inhibitory effect was seen from the onset
of GRP mRNA induction and was maintained for up to 18 hours
(Fig. 1, c, left). However, VST had no effect on GRP78 or
GRP94 mRNA expression at any concentration or time point in
cells that were stressed by treatment with TM (Fig. 1, b and c);
it also had no effect on GRP78 and GRP94 protein accumulation
in TM- or A23187-treated cells (Fig. 1, d).
We also examined the effect of VST on human GRP78
promoter activity in HT1080 cells transiently transfected with a
mammalian reporter gene plasmid (pGRP78pro160-Luc) that
Fig. 1. Versipelostatin (VST) effects on induction of GRP78 and GRP94.
Reverse transcription–polymerase chain reaction (a–c) and immunoblot (d)
analyses of GRP78, GRP94, and HSP70 expression. HT-29 (a, d) and HT1080
cells (b–d) were treated for 18 hours or for the indicated time periods with VST
under normal growth control (Con) or stress conditions, as indicated. GS ⫽
glucose starvation; 2DG ⫽ 20 mM 2-deoxyglucose; TM ⫽ 5 ␮g of tunicamycin/
mL; M ⫽ marker lane. G3PDH was measured for an internal control (a–c). The
data are representative of at least two independent experiments. Reporter assay:
HT1080 cells were transfected with pGRP78pro160-Luc (pGRP78, GRP78
promoter), pGL3-Control (pGL), or pHSP70pro-Luc (HSP70 promoter) and
subsequently treated for 18 hours with VST under normal growth conditions or
under stress conditions, i.e., in the presence of 2DG (20 mM, 18 hours) or TM
(5 ␮g/mL, 18 hours) (e), or in the presence of heat (42 °C, during the first 60
minutes only), 2DG (20 mM, 18 hours), or heat plus 2DG (f). Data (mean values
of triplicate determinations with upper 95% confidence intervals) are representative of at least two independent experiments.
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004
ARTICLES 1303
Fig. 2. Versipelostatin (VST)
depletion of the spliced form of
XBP1. a) Immunoblotting of
FLAG-tagged XBP1 (upper)
and ATF6 (lower). HT1080
cells were transfected with
pATF6(F) or pXBP1(U) (0.5
␮g each) and stressed for 6
hours by treatment with 2DG
(2-deoxyglucose, 20 mM) or
TM (tunicamycin, 5 ␮g/mL)
in the presence (⫹) or absence (–) of VST (3 ␮M,
6 hours). For better detection
of the unspliced and the
spliced forms of XBP1
[XBP1(U) and XBP1(S)]
and the full-length and the
activated forms of ATF6
[ATF6(F) and ATF6(A)],
we included MG132 (10
␮M) to prevent proteasomal
degradation during exposure
of cells to 2DG or TM.
pATF6(A) and pXBP1(S)
were also transfected as controls. Un- or underglycosylated ATF6 ⫽ un- or underglycosylated form (precursor)
of ATF6(F); Intermediate
ATF6 ⫽ intermediate form of
ATF6(F) during proteolytic
activation process. Reverse
transcription–polymerase
chain reaction analysis of endogenous XBP1 at 18 hours
(b) or the indicated time
points (c) after HT1080 cells
were treated, as in Fig. 1, b
and c, respectively. G3PDH
expression was measured as
an internal control. GS ⫽ glucose starvation; XBP1(U) ⫽ unspliced form of XBP1;
XBP1(S) ⫽ spliced form of
XBP1; M ⫽ marker lane. d)
Immunoblotting of indicated
FLAG- or Myc-tagged (LacZ) proteins. HT1080 cells were transfected with each
expression plasmid [pXBP1(S), pXBP1(U), pATF6(A), or pcDNA3.1/myc-His/
lacZ; 0.5 ␮g each] and subsequently treated with or without VST (3 ␮M) under 2DG
(20 mM) stress conditions for the indicated time periods. Data shown in all panels
are representative of at least two independent experiments.
includes the ⫺160 to ⫹7 promoter region of GRP78 cloned
immediately upstream of the firefly luciferase gene. This promoter region contains the cis-acting endoplasmic reticulum
stress response element (ERSE), which is required for transcriptional activation in response to ER stress (26). Because global
protein synthesis was affected by the UPR-inducing stimuli
whether or not VST was present, we could not compare absolute
firefly luciferase activities; instead, we co-transfected cells with
a control plasmid that contained a Renilla luciferase gene and
compared the ratios of the two luciferase activities. In HT1080
cells transfected with the pGRP78pro160-Luc plasmid, treatments with 2DG and TM increased relative firefly luciferase
activity by approximately five- and sevenfold, respectively (Fig.
1, e). Consistent with the GRP78 mRNA analysis, VST sup1304 ARTICLES
pressed 2DG-induced GRP78 promoter activity in a dosedependent manner (Fig. 1, e, left) but had little effect on TMinduced GRP78 promoter activity, even at 30 ␮M, a
concentration 10 times higher than that at which it suppressed
2DG-induced GRP78 promoter activity (Fig. 1, e, right). Under
normal growth conditions, VST (at 1–30 ␮M) had no effect on
GRP78 promoter activity. For use as a control, we transfected
cells with the pGL3-Control vector, which contains simian virus
40 promoter and enhancer sequences driving firefly luciferase
activity, and found that the promoter activity was not affected by
VST alone, by each of chemical stressors 2DG and TM, or by
combinations of the two compounds (Fig. 1, e).
To further define the specificity of the inhibitory effects of
VST, we examined expression of HSP70 (HSPA1A,
NM_005345), which represents a class of stress-inducible molecular chaperones distinct from those of the GRP family.
HSP70 mRNA levels in HT1080 cells increased in response to
glucose deprivation but decreased in response to 2DG and TM
(Fig. 1, b and c). VST (at 3 or 10 ␮M) had no effect on the
changes in HSP70 expression in the glucose-deprived and the
TM-stressed cells. In the 2DG-stressed cells, VST at 10 ␮M
strongly induced HSP70 gene expression. Thus, VST was incapable of inhibiting HSP70 gene expression under all conditions
examined. We also determined the effect of VST on promoter
activity of another HSP70 gene (HSPA6, NM_002155) by using
HT1080 cells transfected with the mammalian reporter plasmid
pHSP70pro-Luc. Although HSP70 promoter activity was inducible by treatment with heat (42 °C, 60 minutes), with 2DG, and
with both together, VST (at 3 ␮M) had little effect on promoter
activity under any of these conditions (Fig. 1, f). Taken together,
these results indicate that VST selectively inhibits ERSEdependent transcription during glucose deprivation.
Depletion of Spliced XBP1 by VST
The active form of ATF6 and the spliced form of XBP1
mediate ERSE-dependent transcriptional activation. To investigate whether VST inhibits the activation processes of ATF6 and
XBP1, we transiently transfected HT1080 cells with plasmids
containing cDNAs for full-length ATF6 [from pATF6(F)] or the
unspliced XBP1 [from pXBP1(U)] and detected activation of
each protein using immunoblot analysis (Fig. 2, a). To better
detect activation, we included the proteasome inhibitor MG132
to prevent proteasomal degradation of the activated forms of
each protein during exposure of cells to 2DG or TM. Using these
experimental conditions, we were able to detect both the
XBP1(S) and the ATF6(A) forms of these proteins (Fig. 2, a).
VST completely suppressed the emergence of the spliced form
of the XBP1 protein seen under 2DG stress conditions but not
that seen under TM stress conditions (Fig. 2, a, upper panel).
Moreover, VST did not inhibit production of the active form of
the ATF6 protein under either stress condition (Fig. 2, a, lower
panel).
To confirm that the effect of VST on the levels of spliced
XBP1 protein in glucose-deprived cells reflects the inhibition of
splicing of the XBP1 mRNA, we performed RT–PCR analysis
of RNA isolated from untransfected HT1080 cells by using PCR
primers for the region encompassing the splice junction of XBP1
(12). This analysis showed that VST inhibited the generation of
endogenous spliced XBP1 mRNA induced either by glucose
starvation or by 2DG at the same concentrations at which it
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004
Fig. 3. Effect of versipelostatin (VST) on general
protein synthesis. HT1080 cells were treated with
VST or cycloheximide (CHX) for the indicated
time periods (a), 4 hours (b), or 8 hours (c) under
normal growth or stress conditions of
2-deoxyglucose (2DG) (20 mM), glucose starvation (GS), or tunicamycin (TM) (5 ␮g/mL). During
the last 2 (a) or 1 hour (b) of treatments, the cells
were incubated with [3H]alanine. Incorporation of
[3H]alanine was determined as described in “Materials and Methods.” Data (mean values of triplicate determinations with upper 95% confidence
intervals) are representative of at least two independent experiments.
inhibited the accumulation of GRP78 mRNA (Fig. 2, b; compare
Fig. 1, b). Inhibition of XBP1 mRNA splicing was also observed
at all time points examined (4 –18 hours, Fig. 2, c). In addition,
VST treatment decreased the total expression levels of XBP1
mRNA under hypoglycemic conditions (Fig. 2, b and c), an
observation that is consistent with the fact that XBP1 mRNA is
induced by ER stress in an ERSE-dependent manner (27). Finally, VST had no effect on TM-induced splicing of XBP1
mRNA (Fig. 2, b and c), further demonstrating the selective
action of VST on hypoglycemic cells.
Immunoblot analysis of proteins from HT1080 cells transfected with each expression plasmid [pXBP1(S), pXBP1(U),
pATF6(A), or pcDNA3.1/myc-His/lacZ (as a control)] showed
that levels of the spliced XBP1 protein decreased more rapidly
than those of the other proteins when VST was added to cells
stressed by 2DG treatment (Fig. 2, d). Thus, VST can also
operate at the post-translational level, thereby leading to complete loss of spliced XBP1 protein. Levels of unspliced XBP1
protein, as well as of the active form of the ATF6 protein,
decreased more gradually in the presence of VST under 2DG
stress conditions (Fig. 2, d), possibly as a result of active
repression of protein synthesis in response to ER stress (28).
Indeed, we estimated protein synthetic activity by measuring
incorporation of tritiated alanine into protein. We found that
overall protein synthesis was repressed by VST alone and by
2DG alone but was repressed to a much greater extent by the
combination of VST and 2DG (Fig. 3, a). This effect was seen
over all time periods of treatment examined (4 –30 hours). However, VST alone had much less effect on global protein synthesis
than the translation elongation blocker cycloheximide, which
strongly inhibited protein synthesis in both the presence and
absence of 2DG (Fig. 3, b). VST also enhanced protein synthesis
repression during glucose deprivation but not during TMinduced stress (Fig. 3, c). Thus, VST enhanced translational
repression and prevented UPR activation in hypoglycemic cells
specifically.
Roles of XBP1 and ATF6 in VST Action
To address whether the depletion of spliced XBP1 protein
induced by VST is involved in the inhibition of ERSEdependent transcription, we co-transfected HT1080 cells with
the reporter plasmid pGRP78pro160-Luc and pXBP1(S). Cotransfection of a relatively small amount (3 ng) of pXBP1(S),
which encodes the spliced form of XBP1, was enough to en-
hance the basal reporter activity (i.e., in the absence of 2DG),
and the activity was further increased by 2DG treatment (Fig. 4,
a, left). Under these experimental conditions, 10 ␮M VST was
required to achieve complete inhibition of 2DG-induced reporter
gene activity in the pXBP1(S)-transfected cells, whereas 3 ␮M
was sufficient in mock-transfected cells. Thus, ectopic expression of the spliced form of XBP1 conferred resistance to the
inhibitory activity of VST against the ERSE-dependent transcription. By contrast, co-transfection with even large amounts
(300 ng) of a plasmid encoding the unspliced form [pXBP1(U)]
had little effect on basal reporter gene activity or VST sensitivity
(Fig. 4, b).
When the cells were transfected with 300 ng of pXBP1(S),
basal reporter gene activity was strongly enhanced such that no
further activity was induced by 2DG treatment (Fig. 4, a, right).
Thus, excess spliced XBP1 was expressed under these experimental conditions. VST did not inhibit reporter gene expression
under normal growth conditions in these cells, but it still inhibited the reporter gene activity in 2DG-stressed cells, probably
due to its ability to deplete spliced XBP1 protein under these
stress conditions (Fig. 2, d). Collectively, these results suggest
that the ability of VST to deplete the spliced form of XBP1,
possibly at both the mRNA and protein levels, plays an important role in the inhibition of ERSE-dependent transcription during glucose deprivation.
We also tested whether ectopic expression of either the fulllength or active (shorter) form of ATF6 had any effect on the
inhibitory activity of VST by using pGRP78pro160-Luc reporter
assays (Fig. 4, c–f). Co-transfection of HT1080 cells with 300 ng
of pATF6(F), which encodes the full-length form of ATF6,
enhanced basal reporter gene activity (Fig. 4, c). Reporter gene
activity was further increased by 2DG treatment, and this 2DGinduced activity was less sensitive to VST than that in mocktransfected cells (Fig. 4, c). The induction of VST resistance was
dependent on the amount of transfected ATF6(F) plasmid and
required at least 10 ng (Fig. 4, d), an amount that led to much
higher expression of full-length ATF6 protein than the endogenous level seen in mock-transfected cells (Fig. 4, e). Cotransfection of HT1080 cells with pATF6(A), which encodes the
active form of ATF6, also led to VST resistance in 2DG-treated
cells (Fig. 4, f), suggesting that proteolytic activation of the
full-length form of ATF6 mediates the induction of resistance in
2DG-treated cells overexpressing full-length ATF6. These results suggest that a relatively low level of expression of endog-
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004
ARTICLES 1305
Fig. 4. Effect of ectopic expression of XBP1
and ATF6 on versipelostatin (VST) action.
a–d, f) GRP78 reporter assay. HT1080 cells
were co-transfected with the reporter vector
pGRP78pro160-Luc, together with empty vector (Mock) or the indicated amounts of the
expression vectors pXBP1(S), pXBP1(U),
pATF6(F), and pATF6(A), as indicated. The
cells were treated for 18 hours with VST under
normal growth or 2-deoxyglucose (2DG) (20
mM) stress conditions. Data (mean values of
triplicate determinations with 95% confidence
intervals) are representative of at least two
independent experiments. e) Immunoblotting
for expression levels of ATF6 in HT1080 cells
transfected with the indicated amounts of
pATF6(F). Data are representative of two independent experiments. ATF6(F) ⫽ full-length
ATF6; endo ⫽ endogenous; exo ⫽ exogenous;
arrowhead ⫽ nonspecific band.
enous ATF6 is necessary for VST to effectively inhibit ERSEdependent transcriptional activation in glucose-deprived cells.
Glucose-Regulated UPR-Inhibiting Activity
We next examined whether the UPR-inhibiting activity of
VST was seen specifically in glucose-deprived cells. Immunoblot analysis of lysates from both HT1080 and HT-29 cells
demonstrated that VST suppressed induction of GRP78 and
GRP94 protein accumulation even in the presence of TM, as
long as the cells were deprived of glucose (Fig. 5, a, left, and
data not shown). GRP expression was inhibited at essentially the
same VST concentrations in the presence or absence of TM,
suggesting that the inhibitory activity of VST was strictly dependent on glucose deprivation. Indeed, the inhibition of TMdependent GRP induction by VST was eliminated as the amount
of glucose increased (Fig. 5, a, right).
We also found that, during glucose deprivation, VST inhibited induction of ATF4 protein (Fig. 5, a, left), a downstream
transcription factor in the PERK signaling pathway (29). VST
inhibition of ATF4 expression also depended strictly on glucose
deprivation. Interestingly, in the presence of glucose, VST in1306 ARTICLES
duced ATF4 protein accumulation. Because ATF4 induction
occurs under conditions of diverse (and seemingly unrelated)
forms of stress (30), this observation raises the possibility that
VST can stimulate other stress-signaling pathway(s) and that its
mode of action changes depending on cellular glucose
availability.
Selective Killing of Glucose-Deprived Cells
We next examined the effects of VST on cell viability. Under
normal growth conditions, 24 hours of VST treatment of HT-29
cells had only a weak effect on cell viability, with approximately
30 ␮M VST required to inhibit colony formation by 50% (IC50).
By contrast, VST was highly toxic in cells exposed to glucosefree or 2DG-containing medium, resulting in approximately
30-fold lower IC50 (⬃1 ␮M) (Fig. 5, b, left and middle). Under
hypoglycemic conditions, the cytotoxic activity of VST was
associated with the inhibition of GRP expression (Fig. 1). By
contrast, there was no consistent combined effect of VST with
the chemical stressor TM (Fig. 5, b, right). HT1080 cells were
similarly sensitized to VST under glucose starvation conditions,
as indicated by flow cytometric assays of apoptotic cells show-
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004
Fig. 5. Glucose-dependent action of versipelostatin (VST). a) Immunoblotting of GRP78, GRP94,
and ATF4 for HT1080 cells at 18 hours after VST
(3 ␮M, right) plus TM (tunicamycin, 5 ␮g/mL) or
no stressor were added to normal medium (2
mg/mL glucose), glucose-free medium (left) or to
medium containing graded concentrations of glucose (0, 0.1, 0.5, 2 mg/mL; right). Data are representative of at least two independent experiments. b) Colony formation analysis of HT-29
cells after a 24-hour VST treatment under normal
growth (control) or stress conditions as indicated.
2DG ⫽ 20 mM 2-deoxyglucose; TM ⫽ 5 ␮g of
tunicamycin/mL. Data (mean values with 95%
confidence intervals in triplicate determinations)
are representative of at least two independent experiments. Flow cytometric analysis of apoptotic
(c) and dead (d, e) HT1080 cells at the indicated
time points (c) or 48 h (d, e) after the addition of
VST (3 ␮M) with or without glucose at the indicated concentrations (d) or at 0 or 2 mg/mL with
or without TM (5 ␮g/mL) (e). Data (mean values
with 95% confidence intervals in triplicate determinations) are representative of at least two independent experiments. In (c), the left panel shows
representative histogram data. Glc ⫽ glucose;
Con ⫽ control; GS ⫽ glucose starvation.
ing sub-G1 DNA content (Fig. 5, c) and of dead cells stained
with 7-amino-actinomycin D (Fig. 5, d and e). VST-induced cell
death was not substantial within 24 hours (Fig. 5, c), however,
indicating that inhibition of GRP expression preceded cell death.
Furthermore, induction of cell death by VST was seen at glucose
concentrations of 0.1 mg/mL or lower (Fig. 5, d), concentrations
at which GRPs were induced in a VST-suppressible manner
(Fig. 5, a, right). We also found that VST-induced cell death
under glucose starvation was not influenced by the further addition of TM (Fig. 5, e). Collectively, therefore, these data
indicate that VST selectively kills glucose-deprived cells by
disrupting the UPR.
We evaluated antiproliferative activity of VST with a panel of
39 human cancer cell lines (23–25). Across the entire cell line
panel, the average VST concentration at which growth was
inhibited by 50% (GI50) was 2.3 ␮M (for a 48-hour exposure).
The COMPARE analysis revealed that the differential growth
inhibition pattern of VST was unique, with little similarity to the
patterns of more than 400 standard agents, which also suggests
that VST has a unique mode of action. In the cell line panel
analysis, VST had antiproliferative effects on most of the cell
lines in the presence of glucose; the stomach cancer cell line
MKN74 was one of the most sensitive lines, with a GI50 of 0.42
␮M. MKN74 cells treated with VST for 48 hours showed little
apoptosis under normal growth conditions; by contrast, when
glucose was withheld for 48 hours, extensive apoptosis occurred
(Fig. 6, a). Similarly, in the colony formation assay, a 24-hour
treatment of VST was highly cytotoxic to glucose-deprived
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004
ARTICLES 1307
Fig. 6. Antitumor effect of versipelostatin (VST)
against MKN74 cells in vitro and in vivo. Flow cytometric analysis of apoptosis (a) and colony formation analyses (b) of MKN74 cells exposed to VST for
48 (a) or 24 (b) hours under normal or glucose-free
conditions. Data (mean values of triplicate determinations with 95% confidence intervals) are representative of at least two independent experiments. c)
Immunoblot analysis of GRP78 levels after 24-hour
treatments of MKN74 cells. The data are representative of three independent experiments. Treatment of
MKN74 tumor-bearing mice with VST alone (d) or in
combination with cisplatin (e). Tumor volumes are
expressed as mean valueswith 95% confidence interval for n ⫽ 6 mice. For (d): #, P ⫽ .01; *, P ⫽ .004
compared with control. For (e): * ⫽ P⬍.01 compared
with control. Exact P values are ⬍.001, .001, .009,
.002, and .004 for days 11, 14, 18, 21, and 24,
respectively.
MKN74 cells (Fig. 6, b). Therefore, the strong cytotoxic effect
of VST on MKN74 cells was evident only during glucose
deprivation, although VST had some antiproliferative effects in
the presence of glucose. At doses that resulted in strong cytotoxicity during glucose deprivation, VST also inhibited GRP78
induction in MKN74 cells (Fig. 6, c).
Compared with HT1080 and HT-29 cells, MKN74 cells
were the most sensitive to VST cytotoxicity during glucose
deprivation (compare Figs. 6, b and 5, b). We therefore tested
the in vivo antitumor activity of VST on MKN74 xenograft
tumors. Once tumor volumes reached approximately 100
mm3, animals were treated intravenously (in groups of six)
with VST. VST (at 13.5 or 18 mg/kg) inhibited tumor growth,
with statistically significant differences in tumor volume between control (saline)- and VST-treated groups on day 11
(Fig. 6, d). To further explore the anticancer utility of VST in
vivo, we administered the drug (13.5 mg/kg) in combination
with cisplatin (7 mg/kg). The combination had better antitumor activity than that of control treatment and led to statistically significantly smaller tumor volumes over the long term
(from days 11 to 24) than control treatment (Fig. 6, e).For
example, the mean tumor volumes of the control and combi1308 ARTICLES
nation treatments were 387.6 mm3 (95% confidence interval
[CI] ⫽ 311.6 to 463.6) and 205.1 mm3 (95% CI ⫽ 175.1 to
235.1), respectively, at day 11 (P⬍.001) and 819.8 mm3 (95%
CI ⫽ 610.8 to 1028.8) and 389.4 mm3 (95% CI ⫽ 300.5 to
478.3), respectively, at day 24 (P ⫽ .004). Single-agent
treatment with cisplatin also reduced tumor volumes, and
statistically significant differences (versus control) were observed up to day 11 (P ⫽ .022 at day 11) (Fig. 6, e). Under
these experimental conditions, tumor volume reduction was
similar between mice treated with VST or cisplatin alone
(Fig. 6, e). There were no deaths due to toxicity among mice
receiving either single-agent or the combination treatment.
The weights of mice treated with cisplatin alone or the
combination decreased slightly by day 8, but they recovered
afterward (Fig. 6, e, lower panel). These results suggest that
VST had a therapeutic effect at well-tolerated doses.
DISCUSSION
We have presented evidence that VST shows highly selective
cytotoxicity to glucose-deprived tumor cells that is associated
with inhibition of the UPR. Specifically, VST inhibited expres-
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004
sion of the UPR target genes GRP78 and GRP94 and repressed
the production of the UPR transcriptional activators XBP1 and
ATF4 during glucose deprivation. Moreover, VST showed in
vivo antitumor activity at well-tolerated doses.
In mammalian cells, the regulation of the UPR is a complicated process that involves three independent signaling pathways: ATF6, IRE1, and PERK. Indeed, cells defective for ATF6
cleavage show no induction of GRP78 mRNA but can still
induce XBP1 mRNA expression (10,15). Cells deficient in
IRE1␣ or both IRE1␣ and IRE1␤ display normal GRP78 induction and survive under conditions of ER stress (15,31,32).
PERK–/– cells show reduced survival, with defects in expression
of various UPR target genes, but they do not show attenuated
protein synthesis during ER stress (17,28). This complexity has
been an obstacle to developing UPR-targeted drugs.
Nevertheless, it is likely that the production and/or quality of
UPR transcriptional activators can be governed by a single
signaling pathway, as seen in cells that lack functional
GADD34, a downstream target gene product of the PERK
signaling pathway (33). Indeed, GADD34-mutated cells show
loss of GRP78 gene expression and impaired induction of the
UPR transcriptional activators XBP1 and ATF4 (33). Furthermore, GADD34-mutated cells display persistent repression of
protein synthesis and reduced cell survival in response to the
chemical stressor thapsigargin (33), like cells treated with VST
during glucose deprivation. The findings in GADD34 mutant
cells indicate that disruption of the UPR, which leads to reduced
cell survival during ER stress, can be achieved by mutation of a
single gene and likely by a single compound. Therefore, the
consistent observations between GADD34-mutated and VSTtreated cells support a link between the cytotoxic and the UPRinhibiting activities of VST during glucose deprivation. At
present, however, we cannot rule out the possibility that mechanism(s) other than prevention of the UPR account for the
biologic and therapeutic activity of VST. It will be important to
clarify the precise mechanisms by which VST affects the UPR.
In addition to showing that the UPR is a potential target for
cancer treatment, our findings have another important implication, namely that they provide insights into how to reduce
resistance to chemotherapy. It is widely recognized that hypoglycemia, as well as hypoxia, induces resistance to chemotherapy, the principal problem in treating most common solid tumors
(2,34,35). Indeed, under hypoglycemic conditions, a variety of
human cancer cells are resistant to many clinically important
antitumor drugs, as described previously (21,36). The induction
of resistance is associated with the induction of the UPR target
genes GRP78 and GRP94 (37,38). GRP78 and GRP94 show an
anti-apoptotic function (7,39) and are induced in malignant cells
(7,40,41). Therefore, selective inhibitors of the ER stress response, such as VST, may be useful to eliminate otherwise
drug-resistant, hypoglycemic tumor cells. In addition, the severe
hypoglycemic conditions under which VST becomes toxic are
not observed in normal tissue. Thus, VST may be an attractive
tool for exploring the potential of hypoglycemia-targeted therapy against solid tumors.
REFERENCES
(1) Semenza GL. Angiogenesis in ischemic and neoplastic disorders. Annu
Rev Med 2003;54:17–28.
(2) Brown JM, Giaccia AJ. The unique physiology of solid tumors: opportunities (and problems) for cancer therapy. Cancer Res 1998;58:1408 –16.
(3) Acker T, Plate KH. A role for hypoxia and hypoxia-inducible transcription
factors in tumor physiology. J Mol Med 2002;80:562–75.
(4) Ma Y, Hendershot LM. The unfolding tale of the unfolded protein response. Cell 2001;107:827–30.
(5) Harding HP, Calfon M, Urano F, Novoa I, Ron D. Transcriptional and
translational control in the mammalian unfolded protein response. Annu
Rev Cell Dev Biol 2002;18:575–99.
(6) Kaufman RJ, Scheuner D, Schroder M, Shen X, Lee K, Liu CY, et al. The
unfolded protein response in nutrient sensing and differentiation. Nat Rev
Mol Cell Biol 2002;3:411–21.
(7) Lee AS. The glucose-regulated proteins: stress induction and clinical
applications. Trends Biochem Sci 2001;26:504 –10.
(8) Scheuner D, Song B, McEwen E, Liu C, Laybutt R, Gillespie P, et al.
Translational control is required for the unfolded protein response and in
vivo glucose homeostasis. Mol Cell 2001;7:1165–76.
(9) Haze K, Yoshida H, Yanagi H, Yura T, Mori K. Mammalian transcription
factor ATF6 is synthesized as a transmembrane protein and activated by
proteolysis in response to endoplasmic reticulum stress. Mol Biol Cell
1999;10:3787–99.
(10) Ye J, Rawson RB, Komuro R, Chen X, Dave UP, Prywes R, et al. ER stress
induces cleavage of membrane-bound ATF6 by the same proteases that
process SREBPs. Mol Cell 2000;6:1355– 64.
(11) Okada T, Haze K, Nadanaka S, Yoshida H, Seidah NG, Hirano Y, et al. A
serine protease inhibitor prevents endoplasmic reticulum stress-induced
cleavage but not transport of the membrane-bound transcription factor
ATF6. J Biol Chem 2003;278:31024 –32.
(12) Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is
induced by ATF6 and spliced by IRE1 in response to ER stress to produce
a highly active transcription factor. Cell 2001;107:881–91.
(13) Shen X, Ellis RE, Lee K, Liu CY, Yang K, Solomon A, et al. Complementary signaling pathways regulate the unfolded protein response and are
required for C. elegans development. Cell 2001;107:893–903.
(14) Calfon M, Zeng H, Urano F, Till JH, Hubbard SR, Harding HP, et al. IRE1
couples endoplasmic reticulum load to secretory capacity by processing the
XBP-1 mRNA. Nature 2002;415:92– 6.
(15) Lee K, Tirasophon W, Shen X, Michalak M, Prywes R, Okada T, et al.
IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6
cleavage merge to regulate XBP1 in signaling the unfolded protein response. Genes Dev 2002;16:452– 66.
(16) Harding HP, Zhang Y, Ron D. Protein translation and folding are coupled
by an endoplasmic-reticulum-resident kinase. Nature 1999;397:271– 4.
(17) Harding HP, Zhang Y, Bertolotti A, Zeng H, Ron D. Perk is essential for
translational regulation and cell survival during the unfolded protein response. Mol Cell 2000;5:897–904.
(18) Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Calfon M, et al. An
integrated stress response regulates amino acid metabolism and resistance
to oxidative stress. Mol Cell 2003;11:619 –33.
(19) Park HR, Furihata K, Haykawa Y, Shin-ya K. Versipelostatin, a novel
GRP78/BiP molecular chaperone down-regulator of microbial origin. Tetrahedron Lett 2002;43:6941–5.
(20) Ogiso Y, Tomida A, Tsuruo T. Nuclear localization of proteasomes participates in stress-inducible resistance of solid tumor cells to topoisomerase
II-directed drugs. Cancer Res 2002;62:5008 –12.
(21) Ogiso Y, Tomida A, Lei S, Omura S, Tsuruo T. Proteasome inhibition
circumvents solid tumor resistance to topoisomerase II-directed drugs.
Cancer Res 2000;60:2429 –34.
(22) Suzuki H, Tomida A, Tsuruo T. Dephosphorylated hypoxia-inducible
factor 1alpha as a mediator of p53-dependent apoptosis during hypoxia.
Oncogene 2001;20:5779 – 88.
(23) Yamori T, Matsunaga A, Sato S, Yamazaki K, Komi A, Ishizu K, et al.
Potent antitumor activity of MS-247, a novel DNA minor groove binder,
evaluated by an in vitro and in vivo human cancer cell line panel. Cancer
Res 1999;59:4042–9.
(24) Dan S, Tsunoda T, Kitahara O, Yanagawa R, Zembutsu H, Katagiri T, et
al. An integrated database of chemosensitivity to 55 anticancer drugs and
gene expression profiles of 39 human cancer cell lines. Cancer Res 2002;
62:1139 – 47.
(25) Yamori T. Panel of human cancer cell lines provides valuable database for
drug discovery and bioinformatics. Cancer Chemother Pharmacol 2003;52
Suppl 1:S74 –9.
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004
ARTICLES 1309
(26) Yoshida H, Haze K, Yanagi H, Yura T, Mori K. Identification of the
cis-acting endoplasmic reticulum stress response element responsible for
transcriptional induction of mammalian glucose-regulated proteins. Involvement of basic leucine zipper transcription factors. J Biol Chem
1998;273:33741–9.
(27) Yoshida H, Okada T, Haze K, Yanagi H, Yura T, Negishi M, et al. ATF6
activated by proteolysis binds in the presence of NF-Y (CBF) directly to the
cis-acting element responsible for the mammalian unfolded protein response. Mol Cell Biol 2000;20:6755– 67.
(28) Ron D. Translational control in the endoplasmic reticulum stress response.
J Clin Invest 2002;110:1383– 8.
(29) Harding HP, Novoa I, Zhang Y, Zeng H, Wek R, Schapira M, et al.
Regulated translation initiation controls stress-induced gene expression in
mammalian cells. Mol Cell 2000;6:1099 –108.
(30) Rutkowski DT, Kaufman RJ. All roads lead to ATF4. Dev Cell 2003;4:442– 4.
(31) Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP, et al.
Coupling of stress in the ER to activation of JNK protein kinases by
transmembrane protein kinase IRE1. Science 2000;287:664 – 6.
(32) Urano F, Bertolotti A, Ron D. IRE1 and efferent signaling from the
endoplasmic reticulum. J Cell Sci 2000;113:3697–702.
(33) Novoa I, Zhang Y, Zeng H, Jungreis R, Harding HP, Ron D. Stress-induced
gene expression requires programmed recovery from translational repression. EMBO J 2003;22:1180 –7.
(34) Yu JL, Coomber BL, Kerbel RS. A paradigm for therapy-induced microenvironmental changes in solid tumors leading to drug resistance. Differentiation 2002;70:599 – 609.
(35) Tsuruo T, Naito M, Tomida A, Fujita N, Mashima T, Sakamoto H, et al.
Molecular targeting therapy of cancer: drug resistance, apoptosis and
survival signal. Cancer Sci 2003;94:15–21.
(36) Tomida A, Tsuruo T. Drug resistance mediated by cellular stress response
to the microenvironment of solid tumors. Anticancer Drug Des 1999;14:
169 –77.
1310 ARTICLES
(37) Shen J, Hughes C, Chao C, Cai J, Bartels C, Gessner T, et al. Coinduction
of glucose-regulated proteins and doxorubicin resistance in Chinese hamster cells. Proc Natl Acad Sci U S A 1987;84:3278 – 82.
(38) Yun J, Tomida A, Nagata K, Tsuruo T. Glucose-regulated stresses confer
resistance to VP-16 in human cancer cells through a decreased expression
of DNA topoisomerase II. Oncol Res 1995;7:583–90.
(39) Reddy RK, Mao C, Baumeister P, Austin RC, Kaufman RJ, Lee AS.
Endoplasmic reticulum chaperone protein GRP78 protects cells from
apoptosis induced by topoisomerase inhibitors: role of ATP binding site
in suppression of caspase-7 activation. J Biol Chem 2003;278:20915–
24.
(40) Song MS, Park YK, Lee JH, Park K. Induction of glucose-regulated protein
78 by chronic hypoxia in human gastric tumor cells through a protein
kinase C-epsilon/ERK/AP-1 signaling cascade. Cancer Res 2001;61:8322–
30.
(41) Shuda M, Kondoh N, Imazeki N, Tanaka K, Okada T, Mori K, et al.
Activation of the ATF6, XBP1 and grp78 genes in human hepatocellular
carcinoma: a possible involvement of the ER stress pathway in hepatocarcinogenesis. J Hepatol 2003;38:605–14.
NOTES
H.-R. Park and A. Tomida contributed equally to this work.
Supported in part by an Industrial Technology Research Grant program from
New Energy and Industrial Technology Development Organization (NEDO) of
Japan and by a Grant-in-Aid for Scientific Research on Priority Areas Cancer
from the Ministry of Education, Culture, Sports, Science, and Technology of
Japan.
Manuscript received November 27, 2003; revised June 28, 2004; accepted
June 29, 2004.
Journal of the National Cancer Institute, Vol. 96, No. 17, September 1, 2004