Telechargé par thomasestenne

Cours M1 anapath2018

publicité
Analyse chromosomique sur puce à ADN :
Apports en pathologie
Dr Nicolas CHATRON
Laboratoire de Cytogénétique Constitutionnelle
Hospices Civils de Lyon
18/10/2018
Introduction
ADN et chromosome
Introduction
Structure des gènes
ADN
Gène
Introduction
Structure des gènes
ADN
Gène
TRANSCRIPTION
ARN
Epissage des introns
Introduction
Structure des gènes
Gène
ADN
TRANSCRIPTION
ARN
Epissage des introns
TRADUCTION
PROTEINE
Modifié à partir de http://www.snv.jussieu.fr/vie/dossiers/evolution/evol/traits_2.html
Génétique moléculaire: lecture des séquences codantes (exons)
Introduction
Niveaux d’étude du génome
Cytogénétique conventionnelle
« Etude à l’échelle du chromosome »
Cytogénétique moléculaire
Biologie moléculaire
« Etude à l’échelle du nucléotide »
La Cytogénétique
Le caryotype
❖ Culture cellulaire, coloration au Giemsa, classement des chromosomes
❖ 46 chromosomes chez l’homme (23 paires)
❖ Recherche anomalies de nombre, de structure
O'Connor, 2008, Nature Education
et http://www.nichd.nih.gov/
Principal problème : niveau de résolution : 5-10 Mb: 1 bande
La Cytogénétique
Cytogénétique moléculaire: la FISH
22q11.2
Non délété
Microdélétion 22q11.2
Niveau de résolution 150 kb mais analyse ciblée
Rauch et al. J Med Genet 2005
Introduction
Niveaux d’étude du génome
Cytogénétique conventionnelle
« Etude à l’échelle du chromosome »
Cytogénétique moléculaire
Biologie moléculaire
« Etude à l’échelle du nucléotide »
ACPA : Analyse Chromosomique sur puce à ADN
• CGH-array :
Hybridation Génomique
Comparative sur muse à
ADN.
Détection des variations
du nombre de copies
(CNV)
• SNP-array :
Single Nucleotide
Polymorphism
Détection des variations
du nombre de copies +
Détection des pertes
d’hétérozygotie
Génotypage
CGH array
…CGGACTGCCAGCATTCTGGTTTTAATTATCGGAGTATG
TGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTT
CTAATGCCTTTCTCAGCGCATCTAAGGAAAGACTAAGGA
AAAAAAAAAGTACAAAGAATTGTTGTTTGACTGTTGCCC
GA…
…GTTAATGGCTTTCTTACTCTCGTCTCACAGACACATAC
TCCATAATTTAAAACCAAATGCTTGTGAGAAAGCTTGCT
CATCATACTTGCTGCTTCAAAGAAAGACTAAGGAAAAAA
AAAAGTACAAAGAATTGTTGTTTGATTGTTGTCAATCAA
…
CGH array
Oligonucléotide X = 60 bases
…CGGACTGCCAGCATTCTGGTTTTAATTATCGGAGTATG
TGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTT
CTAATGCCTTTCTCAGCGCATCTAAGGAAAGACTAAGGA
AAAAAAAAAGTACAAAGAATTGTTGTTTGACTGTTGCCC
GA…
…GTTAATGGCTTTCTTACTCTCGTCTCACAGACACATAC
TCCATAATTTAAAACCAAATGCTTGTGAGAAAGCTTGCT
CATCATACTTGCTGCTTCAAAGAAAGACTAAGGAAAAAA
AAAAGTACAAAGAATTGTTGTTTGATTGTTGTCAATCAA
…
CGH array
Oligonucléotide X = 60 bases
…CGGACTGCCAGCATTCTGGTTTTAATTATCGGAGTATG
TGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTT
CTAATGCCTTTCTCAGCGCATCTAAGGAAAGACTAAGGA
AAAAAAAAAGTACAAAGAATTGTTGTTTGACTGTTGCCC
GA…
Oligonucléotide Y = 60 bases
…GTTAATGGCTTTCTTACTCTCGTCTCACAGACACATAC
TCCATAATTTAAAACCAAATGCTTGTGAGAAAGCTTGCT
CATCATACTTGCTGCTTCAAAGAAAGACTAAGGAAAAAA
AAAAGTACAAAGAATTGTTGTTTGATTGTTGTCAATCAA
…
CGH array
Oligonucléotide X = 60 bases
…CGGACTGCCAGCATTCTGGTTTTAATTATCGGAGTATG
TGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTT
CTAATGCCTTTCTCAGCGCATCTAAGGAAAGACTAAGGA
AAAAAAAAAGTACAAAGAATTGTTGTTTGACTGTTGCCC
GA…
Intervalle 30 Kb = environ 30 000 bases
Oligonucléotide Y = 60 bases
…GTTAATGGCTTTCTTACTCTCGTCTCACAGACACATAC
TCCATAATTTAAAACCAAATGCTTGTGAGAAAGCTTGCT
CATCATACTTGCTGCTTCAAAGAAAGACTAAGGAAAAAA
AAAAGTACAAAGAATTGTTGTTTGATTGTTGTCAATCAA
…
CGH array
Synthèse in silico des oligos
Oligonucléotide X = 60 bases
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGG
CTTTCTAATGCCTTTCTCAGCGC
Oligonucléotide Y = 60 bases
TGTGAGAAAGCTTGCTCATCATACTTGCTGCTTCAAAG
AAAGACTAAGGAAAAAAAAAAG
CGH array
Synthèse in silico des oligos
Oligonucléotide X = 60 bases
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
Oligonucléotide Y = 60 bases
TGTGAGAAAGCTTGCTCATCATACTTGCTGCTTCAAAGAAAGACTAAGGAAAAAAAAAAG
CGH array
Synthèse in silico des oligos
En réalité, nombreux oligonucléotides de même séquence par spot
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
CGH array
Synthèse in silico des oligos
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
Oligo X
… n fois
Nombre total d’oligonucléotides différent suivant les
formats de lame…
TGTGAGAAAGCTTGCTCATCATACTTGCTGCTTCAAAGAAAGACTAAGGAAAAAAAAAAG
TGTGAGAAAGCTTGCTCATCATACTTGCTGCTTCAAAGAAAGACTAAGGAAAAAAAAAAG
TGTGAGAAAGCTTGCTCATCATACTTGCTGCTTCAAAGAAAGACTAAGGAAAAAAAAAAG
Oligo Y
… n fois
CGH array
Préparation des ADNs
1.
2.
3.
4.
Extraction d’ADN
Normalisation à la même concentration
Digestion par des enzymes de restriction
Marquage par fluorochrome
CGH array
Hybridation
Exemple : même quantité d’ADN patient que d’ADN témoin / oligo
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…
CGH array
Hybridation
Exemple : même quantité d’ADN patient que d’ADN témoin / oligo
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…

5 µm
CGH array
Hybridation
Exemple : plus d’ADN patient que d’ADN témoin / oligo
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…
ATGTGTCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGCGC
…CACCUCUGCUCUCAUUCAUUUUGAUGUCCGUUUGAUUACGGAAAGAGUCGCG…

Niveau de résolution:
Dépend du nombre de sondes
Déposées sur la lame
180 000 oligos : résolution 30-50 kb
100 fois plus sensible que le caryotype
Miller AJHG 2010
La Cytogénétique
Du caryotype à l’ACPA
❖ ACPA: Analyse Chromosomique sur Puce à ADN = CGH array = Caryotype
moléculaire
❖ Etude à l’échelle de l’ADN (pas de culture de cellule, pas de visualisation des
chromosomes)
❖ Principe de l’ACPA:
ADN
témoin
ADN
patient
+
→
1 copie /
2 copies
La Cytogénétique
Du caryotype à l’ACPA
❖ ACPA: Analyse Chromosomique sur Puce à ADN = CGH array = Caryotype
moléculaire
❖ Etude à l’échelle de l’ADN (pas de culture de cellule, pas de visualisation des
chromosomes)
❖ Principe de l’ACPA:
ADN
témoin
ADN
patient
+
→
3 copies /
2 copies
CNV : Variation du Nombre de Copies
SNP array
SNP : Single Nucleotide Polymorphism = variants
nucléotidiques polymorphiques
Possibilité d’étudier à une position génomique le
génotype
SNP array
Plusieurs techniques coexistent :
Technologie Illumina :
1/ Hybridation d’une sonde à l’ADN
génomique juste en amont d’un SNP
2/ Action d’une polymérase pour ajout
du dNTP complémentaire au SNP
3/ Identification spécifique du dNTP
ajouté par réaction AC-haptène
SNP array
Technologie Affymetrix :
Utilisation de sondes « inversées » s’hybridant sur l’ADN.
Suppression de l’ADN génomique
Linéarisation puis hybridation et révélation
Avantage : permet de s’affranchir de la qualité de l’ADN
SNP array
Résultats :
Log ratio : niveau de
fluorescence par rapport
à un set de référence ➔
CNV
B-Allelle Frequency :
retranscription du
génotypage (à confronter
aux données log ratio)
SNP array : Interprétation
Log Ratio
2
1
0
-1
-2
B allele Frequency
1
0
Normal
Perte
Gain
Perte
d’hétérozygotie
SNP array
Technologie Agilent :
Action d’enzymes de restriction reconnaissant des motifs comprenant le SNP
➔ en fonction du génotype il y a cassure ou non cassure
PUIS : marquage, lavage et hybridation identique à la technique de CGH
Agilent
Avantage : permet de faire CGH et SNP sur une même puce
SNP array
Technologie Agilent : Résultats
SNP array
SNP array
SNP array
Apport de la SNP-array
En constitutionnel : détection des isodisomies
uniparentales MAIS peu de régions concernées
En acquis : Intérêt physiopathologique + pronostic +
possible détection de mutations de cibles.
La Cytogénétique
Du caryotype à l’ACPA
Confirmation par une seconde technique
Sélection d’une
sonde de FISH
1. Confirmation de l’anomalie
2. Etude parentale pour interprétation et conseil génétique
3. Etude de la mécanique chromosomique pour conseil génétique
La Cytogénétique
Du caryotype à l’ACPA
Limite principale : le niveau de résolution :
5-10 Mb
Niveau de résolution
théorique : 30-50 kb
100x plus sensible que le caryotype
La Cytogénétique
Histoire de la cytogénétique
1882
1882
Flemming:
découverte des
chromosomes
Zellsubstanz, Kern und
Zelltheilung, W. Flemming,
1882
1956
1956
Premiers caryotypes
Tijo et Levan: 46 chr
chez l’homme
1959
Lejeune, Gautier et
Turpin: Trisomie 21
Lejeune, Gautier et Turpin,
Annales de Génétique, 1959
1980
1970
Marquage en
bandes
1980
Techniques
de FISH
2000
1997
ACPA
1998
Applications en diagnostic
2010
Première intention
La Cytogénétique
L’ACPA: une révolution diagnostique
1882
1882
Flemming:
découverte des
chromosomes
1956
1956
Premiers caryotypes
Tijo et Levan: 46 chr
chez l’homme
1959
Lejeune, Gautier et
Turpin: Trisomie 21
Un chromosome
50 Mb
1980
1970
Marquage en
bandes
1980
Techniques
de FISH
2000
1997
ACPA
1998
Applications en diagnostic
2010
Première intention
Une bande
Un gène
5-10 Mb
30-50 kb
2x plus de
diagnostics faits
Pathologie
Constitutionnelle =
Présente dès la
naissance :
DI
Malformations
Epilepsie
…
Pathologie
Acquise
Tumeurs :
Diagnostique
Pronostic
Théranostique
…
Introduction
Génétique constitutionnelle
Patient venant de lui-même ou adressé par un confrère pour:
❖ Syndrome polymalformatif, déficience intellectuelle (enfants)
-
-
But: établir un diagnostic (dysmorphologie++, recherche d’anomalies
viscérales: écho abdo, écho cœur, examen ophtalmo,…) avec l’aide des
outils de cytogénétiques et de biologie moléculaire
organiser la prise en charge
conseil génétique
❖ Pathologie de l’adulte: maladies à révélation tardive,
présymptomatique, absence de diagnostic antérieur, …
❖ ATCD dans la famille: conseil génétique (risque de récurrence
chez les apparentés)
❖ Diagnostic prénatal
La Cytogénétique
Les indications de l’ACPA
Nombreuses : détecter avec un haut niveau de résolution
des déséquilibres génomiques (perte ou gain de matériel
chromosomique)
Pathologie acquise
Pathologie constitutionnelle (pré et post natal)
Syndrome malformatif
Déficience intellectuelle
Troubles envahissants du développement
Caractériser des anomalies vues sur le caryotype
…
Introduction
Causes des déficiences intellectuelles (D.I.)
Plus de 60%
des causes
identifiables
sont
génétiques
Neuroscience and Biobehavioral Reviews, 2014
La Cytogénétique
L’ACPA
Détecte
Variations du nombre de copie : CNV
Perte (délétion) ou gain (duplication, triplication)
Ne préjuge pas de la structure du chromosome
La SNP array détecte les pertes d’hétérozygotie
Ne détecte pas :
Réarrangements équilibrés
Mosaïques ( < 20%)
Triploïdies
Anomalies moléculaires (mutation génique)
…
La Cytogénétique
L’ACPA en première intention
Etude de Hochstenbach et al, EJMG 2009
36 325 patients
ACPA en 1°
0,78 % « anomalies » non détectées
0,48 % familiales
0,23 % de novo
Si ACPA en 1° intention
Prévenir le clinicien et les parents de cette limite
Ne pas faire un caryotype (coût)
…
La Cytogénétique
Interprétation des résultats de l’ACPA
❖ Les variants identifiés en ACPA (CNV) sont classés en:
- Variants pathogènes / probablement pathogènes
- Polymorphismes / polymorphismes probables
- Variants de signification indéterminée
- Prédisposition ou variants à pénétrance incomplète
❖ Variants pathogènes le plus souvent de novo, récurrents ou uniques
❖ ACPA: détection de variants pathogènes dans 14-18% des cas testés (D.I. /
malformations congénitales)
❖ A Lyon, en 2013: 10,6% de variants pathogènes identifiés dans des cas de D.I. /
Troubles des apprentissages isolés dont 50 % de novo
❖ Prédispositions aux troubles neuro-développementaux (D.I., troubles du spectre
autistique, troubles spécifiques des apprentissages, épilepsie) récurrents
La Cytogénétique
Les polymorphismes: CNP
Nous sommes tous porteurs de délétions ou duplications !
Première carte du génome décrivant les microdélétions
et microduplications obtenue grâce à l’étude de 270
individus normaux de 4 populations différentes
La Cytogénétique
Les polymorphismes: CNP
1.447 CNVs couvrant 12% du génome (360 Mb)
CNP (copy number polymorphism) : CNV ayant une fréquence > 1 %
La Cytogénétique
Polymorphisme ou pathogène??
❖ Cf bases de données et littérature
❖ Si CNV jamais décrit ni comme un CNP ni comme
pathogène, schématiquement:
❖ Plus le CNV est de grande taille, plus la probabilité
qu’il soit pathogène est grande
❖ Ségrégation familiale +++
❖ Del > Dup
❖ Gènes dans la région?
❖ Le plus souvent, CNV classable
❖ Sinon: VOUS
❖En pathologie acquise
❖anomalies de très grande taille
La Cytogénétique
Quelques exemples
Pathologie constitutionnelle :
- Syndrome clinique reconnaissable = diagnostique
- Identification diagnostique
- Description de nouveaux syndromes
- Description de nouveaux gènes
Pathologie acquise :
- Classification pronostique = conséquences
thérapeutiques
- Distinction primitif vs métastases.
La Cytogénétique
Nouveaux syndromes microdélétionnels
Délétion 17q21.3
❖1 % des retards mentaux ?
❖ Clinique
–
–
–
–
–
Hypotonie sévère
Retard psychomoteur
Dysmorphie faciale
Convulsions
Difficultés d’alimentations
La Cytogénétique
Corrélations génotype-phénotype
Délétion 3p25
• 1ère description en 1978 : del(3)(p25)
• Hypothèse d’un point de cassure récurrent
écartée aux débuts de la cytogénétique moléculaire
• srGAP3 = principal gène candidat de DI car :
– Exprimé dans le cerveau, nécessaire au développement axonal
– Modèle murin srgap3 -/- : activité synaptique anormale, troubles du
comportement
– 1 cas de patient DI porteur d’une t(X;3) avec point de cassure dans
srGAP3
Mutation perte de fonction découverte chez un patient DI
héritée d’un parent sain et présente chez plusieurs autres
MAIS
membres sains de la famille (Hamdan et al. 2009)
59
Implication de SETD5 dans la déficience intellectuelle dans le syndrome de délétion 3p25
Eté 2014
Un seul gène est concerné
par l’ensemble des délétions :
SETD5
60
Gène SETD5
9 cas de mutations (distinctes) pertes de fonction identifiées
en NGS dans deux cohortes distinctes de patients DI (0,7%)
Comparaison de profils :
primitif ou métastases ?
Rein gauche
Rein droit
➔ Profils génomiques distincts = deux primitifs
Activité d’ACPA en pathologie
acquise à Lyon
Mise en routine en septembre 2014
- Mélanomes uvéaux : classification pronostique
- Tumeurs cérébrales :
- Glioblastome : confirmation diagnostique
- Médulloblastome : classification pronostique
- Astrocytome pilocytique : recherche de mutations
- Tumeurs du rein : apport diagnostique
L’ACPA ne
détecte pas
les mutations
- Tumeurs pulmonaires : distinction primitifs vs métastases en
cas de tumeurs bifocales
- Tumeurs gynécologiques : intérêt diagnostique
- Tumeurs dermatologiques : aide à la distinction bénin / malin
Analyse globale:
- 55 prélèvements reçus
•Indications
Hémopathies; 3
Mélanomes
cutanés; 4
1
T. Rein
Hémopathies T. Ovaire
4%
4%
5%
T. Ovaire; 2 T. Rein; 2
Mélanomes
uvéaux, 19
Mélanomes
cutanés
7%
Mélanomes
uvéaux
35%
T. cérébrales; 8
T. cérébrales
14%
T. utérus; 17
3
T. Utérus
31%
2
Nb
%
Analyse globale:
-Résultats pré-analytiques
Echecs d’extraction
MU
19
T. Utérus
17
T. SNC
8
T. peau
4
Hémopathies
3
Autres
4
Total
5
(26%)*
/
/
/
/
/
5/55 (9%)
Analyse réalisable : 91%
*dont 1 ponction blanche
Analyse globale:
-Résultats analytiques (évalués sur 46 prélèvements analysés en a-CGH [hors reins et ovaires])
➢ Qualité technique basée sur l’analyse des dlrs
dlrs < 0,3
MU
14
T. Utérus
17
T. SNC
8
T. Cutanées
4
Hémopathies
3
Total
5 (36%)
2 (12%)
8 (100%)
1 (25%)
3 (100%)
19/ 46 (41%)
5 (36%)
7 (41%)
0
2 (50%)
/
14/46 (31%)
4 (89%)
8 (47%)
0
1 (25%)
/
13/46 (28%)
100 %
75 %
100 %
72%
Résultats de bonne qualité
0,3 <dlrs < 0,5
Résultats acceptables
dlrs > 0,5
Résultats sous réserve
1E
dlrs
bonnes/acceptables
72%
53 %
Analyse de qualité correcte : 72 %
MELANOMES DE L’UVEE
Profils et pronostic
-
Curie (338 pts)
HCL (13 pts)
Risque faible
27%
3 (23%)
Risque intermédiaire
26%
4 (31%)
Risque élevé
47%
6 (46%)
N= 338 pts
low risk: chrom. 3 et 8q normaux
intermédiate risk: -3/8N ou 3N/gain 8q
High risk: -3 et gain 8q
Série lyonnaise encore petite mais les résultats sont en adéquation
avec ceux d’un laboratoire de référence.
D ’après Cassoux N, 2014
Conclusions
Révolution technologique
• Pas de nécessité de
culture cellulaire =
éviter les biais + gain de
temps
• Résolution analytique
améliorée = contenu
génique = progrès dans
les connaissances
• Technique
automatisable =
reproductibilité + débit
• Coût
• Expérience
JB Rivière, CHU de Dijon
Prendre en charge, à l’horizon 2020,
environ 235 000 séquençage de
génomes par an correspondant à :
- 20 000 patients atteints de
maladies rares et leurs familles
(environ 60 000 génomes)
- 50 000 patients prioritaires car
atteints de cancers
métastatiques/réfractaires au
traitement (environ 175 000).
Au-delà de 2020, une montée en
puissance du dispositif est prévue
avec la prise en considération de
maladies communes.
Téléchargement
Random flashcards
amour

4 Cartes mariam kasouh

Le lapin

5 Cartes Christine Tourangeau

Fonction exponentielle.

3 Cartes axlb48

relation publique

2 Cartes djouad hanane

Algorithme

3 Cartes trockeur29

Créer des cartes mémoire