Universite de Sherbrooke par Pier-Luc Dudemaine Departement de biochimie

Universite de Sherbrooke
*
Etude de l’etat immunitaire des vaches laitiere atteintes de la paratuberculose bovine
par
Pier-Luc Dudemaine
Departement de biochimie
Memoire presente a la faculte de medecine et des sciences de la sante
en vue de l’obtention du grade de maTtre es sciences (M.Sc.) en biochimie
Sherbrooke, Quebec, Canada
23 juillet 2013
Membres du jury devaluation
Nathalie Bissonnette (Biochimie, Universite de Sherbrooke)
Martin Bisaillon (Biochimie, Universite de Sherbrooke)
Viktor Steimle (Biologie, Universite de Sherbrooke)
1+1
Library and Archives
Canada
Bibliotheque et
Archives Canada
Published Heritage
Branch
Direction du
Patrimoine de I'edition
395 Wellington Street
Ottawa ON K1A0N4
Canada
395, rue Wellington
Ottawa ON K1A 0N4
Canada
Your file Votre reference
ISBN:
978-0-499-00351-5
Our file Notre reference
ISBN:
978-0-499-00351-5
NOTICE:
AVIS:
The author has granted a non­
exclusive license allowing Library and
Archives Canada to reproduce,
publish, archive, preserve, conserve,
communicate to the public by
telecommunication or on the Internet,
loan, distrbute and sell theses
worldwide, for commercial or non­
commercial purposes, in microform,
paper, electronic and/or any other
formats.
L'auteur a accorde une licence non exclusive
permettant a la Bibliotheque et Archives
Canada de reproduire, publier, archiver,
sauvegarder, conserver, transmettre au public
par telecommunication ou par I'lnternet, preter,
distribuer et vendre des theses partout dans le
monde, a des fins commerciales ou autres, sur
support microforme, papier, electronique et/ou
autres formats.
The author retains copyright
ownership and moral rights in this
thesis. Neither the thesis nor
substantial extracts from it may be
printed or otherwise reproduced
without the author's permission.
L'auteur conserve la propriete du droit d'auteur
et des droits moraux qui protege cette these. Ni
la these ni des extraits substantiels de celle-ci
ne doivent etre imprimes ou autrement
reproduits sans son autorisation.
In compliance with the Canadian
Privacy Act some supporting forms
may have been removed from this
thesis.
Conform em ent a la loi canadienne sur la
protection de la vie privee, quelques
formulaires secondaires ont ete enleves de
cette these.
W hile these forms may be included
in the document page count, their
removal does not represent any loss
of content from the thesis.
Bien que ces formulaires aient inclus dans
la pagination, il n'y aura aucun contenu
manquant.
Canada
RESUME
*
Etude de i ’etat immunitaire des vaches laitiere atteintes de la paratuberculose bovine
par
Pier-Luc Dudemaine
Departement de biochimie
Memoire presente a la faculte de medecine et des sciences de la sante en vue de l’obtention
du grade de maitre es sciences (M.Sc.) en biochimie, Faculte de medecine et des sciences
de la sante, Universite de Sherbrooke, Sherbrooke, Quebec, Canada, J1H 5N4
La paratuberculose bovine, ou maladie de Johne, est une maladie inflammatoire intestinale
chronique provoquant d’importantes pertes economiques chez les producteurs de ruminants
du monde entier. Que ce soit chez la vache laitiere ou de boucherie, ces pertes sont causees
majoritairement par une diminution de la capacite de reproduction, la baisse de production
laitiere et l’amaigrissement des vaches qui perdent ainsi beaucoup de valeur a 1’abattage, en
plus d’etre sujettes a une reforme precoce. Outre les pertes economiques, le potentiel de
transmission a l’humain est un facteur non negligeable en plus d ’un risque de
contamination de la chaine alimentaire. Cette maladie est causee par une bacterie
intracellulaire obligatoire nommee Mycobacterium avium subspecies paratuberculosis
(MAP). II n ’existe actuellement aucune strategic efficace pour combattre 1’infection chez
les animaux atteints. L’evolution lente de la maladie fait en sorte que les signes cliniques
apparaissent tardivement, soit plusieurs annees (4 a 7 ans) apres l’infection initiale. Au
cours de cette progression, les animaux infectes commencent a excreter le pathogene dans
leur environnement. Les animaux atteints deviennent infectieux et peuvent contaminer
d’autres congeneres, ainsi que leur propre veau. Afin de permettre aux producteurs
d’eliminer les vaches atteintes avant qu’elles n’atteignent ce stade, il s’avere important
d ’etablir un diagnostic precoce. Actuellement, ce n’est qu’en phase sous-clinique avancee
que les tests diagnostiques sont plus sensibles, soit 2 a 3 ans apres le debut des excretions
fecales chez les animaux infectes. L’incomprehension du manque de sensibilite des tests de
depistage et de 1’evolution de cette maladie justifient les efforts de recherche dans ce
domaine en vue de mieux comprendre les reponses immunitaires impliquees dans cette
maladie. En effet, une meilleure connaissance des processus d’inflammation chronique
pourrait aider a developper des outils diagnostiques complementaires. Nos resultats
suggerent une deregulation de la reponse immunitaire. Ainsi, en etudiant les composantes
et caracteristiques du sang provenant de vaches infectees, il nous a ete possible d ’observer
que les niveaux de cytokines plasmatiques telles l’interleukine 17 et Posteopontine se
trouvent secretees a differents niveaux chez les vaches atteintes de paratuberculose bovine.
De plus, Panalyse de la capacite de leur serum a soutenir efficacement la proliferation des
cellules mononucleees du sang peripherique revele que le serum de vaches infectees
interfere pour attenuer la proliferation cellulaire. II semble qu’un constituant du serum
provoque une diminution de la reponse immunitaire chez les vaches malades. Les resultats
offrent une appreciation des dereglements immunitaires provoques par la paratuberculose
bovine.
Mots cles : Paratuberculose bovine / Maladie de Johne / Mycobacterium avium subspecies
paratuberculosis / reponse immunitaire
TABLE DES MATIERES
RESUME...........................................................................................................................................ii
TABLE DES MATIERES............................................................................................................ iii
LISTE DES FIGURES................................................................................................................... v
LISTE DES ABREVIATIONS....................................................................................................vi
INTRODUCTION...........................................................................................................................7
1.
2.
3.
LA PARATUBERCULOSE B O V IN E ............................................................................. 7
1.2.
La decouverte de la maladie......................................................................................... 7
1.3.
Culture de la bacterie......................................................................................................7
1.4.
Dissemination de la maladie et ses h o tes....................................................................8
1.5.
Evolution de la paratuberculose................................................................................... 9
1.6.
Le diagnostic de la m aladie...........................................................................................9
1.7.
La prevalence de la m aladie........................................................................................ 11
LE SYSTEME IMMUNITAIRE.......................................................................................12
2.1.
Role et composantes..................................................................................................... 12
2.2.
La reponse immunitaire innee.....................................................................................15
2.3.
La reponse immunitaire adaptative............................................................................ 16
2.4.
Les lymphocytes T auxiliaires (Th)............................................................................ 16
2.5.
Role des lymphocytes T auxiliaires........................................................................... 19
2.6.
Regulation negative de 1’inflammation..................................................................... 21
PATHOGENESE DE LA PARATUBERCULOSE.......................................................21
3.1.
Infection initiale............................................................................................................21
3.2.
Initialisation de la reponse im m unitaire.................................................................... 23
3.3.
L’evolution de la paratuberculose bovine.................................................................24
3.4.
Genes de susceptibilite a la paratuberculose............................................................ 25
3.5.
Zoonose de la paratuberculose................................................................................... 26
3.6.
Objectifs et hypotheses................................................................................................27
AVANT-PROPOS DU PREMIER ARTICLE....................................................................... 29
RESUME DU PREMIER ARTICLE.......................................................................................31
PREMIER ARTICLE..................................................................................................................33
AVANT-PROPOS DU DEUXIEME A R T IC L E................................................................... 66
RESUME DU DEUXIEME ARTICLE..............................................................
71
DEUXIEME ARTICLE...............................................................................................................74
DISCUSSION ET CONCLUSION........................................................................................... 99
REMERCIEMENTS.................................................................................................................. 103
LISTE DES PUBLICATIONS.................................................................................................104
LISTE DES FIGURES
Figure 1 : Schema des progeniteurs immuns................................................................................14
Figure 2 : Molecules impliquees dans le developpement des lymphocytes T auxiliaires.... 18
Figure 3 : Voies de differenciations des lymphocytes T naifs en lymphocytes T effecteurs20
Figure 4 : Schema representant 1’invasion tissulaire de plusieurs bacteries intestinales
22
LISTE DES ABREVIATIONS
ADN
CCS
CD4/CD8
CMH
CPA
ELISA
HSC
IFN-y
IL
MAP
NK
NOD-2
NR AMP 1
OPN
PBMC
PCR
qRT-PCR
ROS
SNP
SPP1
STAT
TCR
TGF-P
Th
TNF-a
Treg
Acide desoxyribonucleique
Cote de cellules somatiques
Locus de differentiation 4 et 8
Complexe majeur d’histocompatibilite
Cellule presentatrice d ’antigene
Essai d’immuno-absorption enzymatique
Cellules souches hematopoi'etiques
Interferon-gamma
Interleukine
Mycobacterium avium subspecies paratuberculosis
Cellules "natural killer"
Domaine d ’oligomerisation nucleotidique-2
Proteine des macrophages associee a la resistance naturelle-1
Osteopontine
Cellules mononucleees du sang peripherique
Reaction de polymerisation en chaine
Transcription inverse quantitative
Especes reactives oxygenees
Polymorphisme de nucleotide unique
Phosphoproteine secretee-1
Transducteur de signal et activateur de transcription
Recepteur des cellules T
Facteur de croissance transformant-beta
Lymphocytes T auxiliaires
Facteur de necrose tumoral-alpha
Lymphocytes T regulateurs
INTRODUCTION
1. LA PARATUBERCULOSE BOVINE
1.2. La decouverte de la maladie
Mycobacterium avium subspecies paratuberculosis (MAP) est 1’agent causal de la
paratuberculose bovine, egalement appele maladie de Johne. Ce nom a ete decerne en
l’honneur du Dr Heinrich Albert Johne qui proceda, avec l’aide du Dr Langdon
Frothingham en 1894, a la toute premiere description clinique et necropsique de la maladie
(Johne, 1895). Ils identifierent a ce moment une bacterie acido-resistante a l’interieur des
lesions granulomateuses intestinales d’une vache affectee. En 1906, Bernhard Bang a etabli
qu’il existe une difference entre la tuberculose et la paratuberculose (Manning et Collins,
2010). II parvint a provoquer de la fievre et des plaies suintantes en injectant une
preparation proteique provenant d ’une souche aviaire chez des vaches atteintes de la
paratuberculose, sans toutefois y parvenir chez les vaches atteintes de la tuberculose. Ces
dernieres reagissaient seulement a la tuberculine preparee cette fois de Mycobacterium
bovis qui est 1’agent causal de la tuberculose chez les bovins. Cette experience demontra
que le betail presentait une reaction immunitaire en reponse au pathogene recueilli chez les
oiseaux et non en reponse au pathogene bovin causant la tuberculose. De ces resultats,
avant m£me d’etre capable de cultiver la bacterie, il avait ete etabli que la maladie de Johne
etait apparentee a la mycobacterie pathogene retrouvee chez les oiseaux et non au
pathogene bovin associe a la tuberculose. Des lors, le nom de paratuberculose etait attribue
a cette mycobacterie responsable de la maladie de Johne.
1.3. Culture de la bacterie
Ce n’est qu’en 1912 que la premiere culture de la bacterie fut reussie a l’aide d ’un milieu
enrichi d ’une preparation de Mycobacterium phlei tue par la chaleur. Cette decouverte
fortuite fut realisee par le scientifique britannique Frederick William Twort qui observa la
croissance de petites colonies bacteriennes autour de celles creees par M. phlei un bacille se
retrouvant communement dans le foin (Manning et Collins, 2010). C ’est a ce moment qu’il
8
fut etabli que M. phlei apportait un quelconque element nutritif essentiel a la croissance de
Mycobacterium enteriditis chronicae pseudotuberculosae bovis Johne’ tel qu’il la nomma.
Cet element essentiel est la mycobactine J qui sert de siderophore (De Voss et al., 2000,
Quadri et al., 1998) necessaire a 1’incorporation du fer chez la bacterie. Dans ces memes
travaux, il proceda a la demonstration de l’effet de causalite de la paratuberculose par la
confirmation des postulats de Koch. Baptisee Mycobacterium paratuberculosis, elle fut
officiellement incriminee comme l’agent etiologique de la maladie de Johne pour la
premiere fois dans l’edition initiale du Bergey’s Manual o f Determinative Bacteriology en
1923. La venue de 1’ere de la genetique au courant des annees ‘90 permit la reclassification
de la bacterie en une sous-espece de la famille de Mycobacterium avium, d ’ou son nom
actuel Mycobacterium avium subspecies paratuberculosis.
1.4. Dissemination de la maladie et ses hotes
La paratuberculose se retrouve principalement chez les ruminants, meme si des evidences
indiquent clairement 1’infection chez plusieurs autres especes animales, notamment le
renard, le lapin et le raton laveur (Beard et al., 2001, Corn et al., 2005). La transmission la
plus frequente se fait de maniere horizontale, soit d ’un animal a l’autre par la voie fecoorale. Cependant, le pathogene peut egalement emprunter une voie dite verticale,
generalement par l’ingestion de colostrum contamine (Nielsen et al., 2008, Streeter et al.,
1995). Selon certaines etudes, la transmission in utero serait aussi possible (Sweeney et al.,
1992, Whittington et Windsor, 2009). Le pathogene est capable de survivre jusqu’a un an
dans l’environnement, hors de son hote (Larsen et Miller, 1978), augmentant ainsi les
risques de contamination des congeneres. Les methodes de propagation enumerees
favorisent generalement une dispersion du pathogene de maniere intra-troupeau strictement.
Cependant, les echanges frequents d ’animaux entre les troupeaux ainsi que le contact avec
une faune sauvage infectee accroissent la probability d’une propagation inter-troupeaux.
Effectivement, considerant que les daims (Pavlik et al., 2000, Riemann et al., 1979), les
cerfs (Fawcett et al., 1995, Power et al., 1993), les wapitis (Manning et al., 1998, Rohonczy
et al., 1996) et plusieurs autres ruminants sont presents dans l’environnement entourant les
fermes, ces animaux infectes deviennent des vecteurs de propagation. Le risque de
contamination par la faune sauvage est reel. Ces risques ne sont pas seulement presents en
9
Amerique du Nord, mais bien a 1’echelle internationale, puisque des etudes ont demontre la
presence d’animaux contamines sur tous les continents.
1.5. Evolution de la paratuberculose
Suivant l’infection initiale via les voies enumerees precedemment, la maladie progresse
generalement selon 3 etapes. La premiere etant le stade d ’infection dite silencieuse, c’est-adire que l’hote est infecte, mais ne presente aucun signe clinique de la maladie et n ’excrete
pas le pathogene dans l’environnement. Cette periode etant tres variable, les animaux
demeurent a ce stade de la maladie habituellement pendant 4 a 5 ans. II est a noter que les
nouveau-nes de moins d ’un an sont plus susceptibles de contracter la maladie (Windsor et
Whittington, 2010), bien que ce soit contredit dans certaines etudes. Au cours du deuxieme
stade dit sous-clinique, le pathogene commence generalement a etre excrete dans les feces
des animaux atteints en plus d’y avoir apparition de signes precurseurs de la maladie. Ces
signes sont habituellement des diarrhees intermittentes, une baisse de production laitiere en
plus d ’une cachexie, malgre que l’appetit de l’animal soit maintenu. C ’est au cours de ce
stade que la plupart des vaches sont initialement diagnostiquees. Dependamment de la
methode diagnostique utilisee, la detection peut survenir a differents moments au cours de
la phase sous-clinique.
A ce moment, les vaches sont generalement agees entre 5 et 7 ans,
quoique certains animaux excretant des plus grandes quantites de bacteries dans leurs feces
peuvent etre diagnostiquees bien avant cet age (Pradhan et al., 2011). Le troisieme stade se
nomme la phase clinique, periode ou les signes cliniques de la maladie s’intensifient au
point ou toutes les defections sont sous forme de diarrhees chroniques, une production
laitiere drastiquement reduite et un amaigrissement extreme et ce, sans perte d ’appetit.
Malheureusement, jusqu’a ce jour, la seule issue possible pour les animaux atteints de cette
maladie incurable est une reforme prematuree.
1.6. Le diagnostic de la maladie
Les outils diagnostiques les plus couramment utilises se repartissent selon deux groupes.
Les outils directs incluent les techniques de culture bacterienne de MAP et 1’amplification
par PCR de sequence specifique au pathogene a partir de feces. Les outils indirects quant a
eux ont pour but la detection d’anticorps diriges contre MAP produits par les hotes infectes.
10
La methode utilisee pour y parvenir est l’ELISA applique sur le plasma, le serum ou le lait.
Tel que mentionne precedemment, les outils diagnostiques ne permettent presentement pas
la detection avant que 1’animal soit dans un stade avance de la phase sous-clinique, meme
pour la culture fecale qui s’avere habituellement etre un diagnostic plus hatif (Sweeney et
al., 2006). Pour l’essai ELISA, le diagnostic est etabli par la detection d ’anticorps diriges
contre le pathogene qui se trouvent en circulation dans le sang ou secretes dans le lait.
Ainsi, pour obtenir un resultat positif dans ces derniers tests, Tanimal doit avoir produit une
reponse immunitaire humorale contre le pathogene intracellulaire, ce qui survient
generalement apres le debut de 1’excretion de celui-ci dans les feces. D ’autre part, la
specificite des outils diagnostiques avoisine 100% pour la culture fecale et 99% pour les
ELISA (Whitlock et al., 2000). Cependant, la sensibilite differe grandement d’un essai a
l’autre et d’un systeme a l’autre. Dans le cas de la culture fecale, la sensibilite a rarement
ete determinee, puisqu’elle necessite l’analyse en necropsie. C ’est pourquoi la culture
bacterienne est generalement utilisee comme reference. Cependant quelques etudes ont
procede a la comparaison entre la culture de MAP dans les feces et celle provenant de tissus
intestinaux apres necropsie et la sensibilite de detection dans les feces est approximee
autour de 50% (Sockett et al., 1992, Whitlock et al., 2000). Ce faible taux de detection
obtenu par la culture du pathogene dans les feces est justifiee par quelques exigences. En
premier lieu, le pathogene doit se retrouver en nombre suffisant dans les feces pour
permettre sa detection. Puis s’ajoute a cette contrainte le succes de l’etape de disinfection
des feces. Cette derniere etape est critique, puisqu’elle doit favoriser la destruction de tout
organisme pouvant nuire a sa detection tout en permettant a MAP de survivre. La difficulte
majeure de la culture bacterienne de MAP vient du fait que le pathogene possede une
croissance tres lente, soit un temps de double-vie de 3,5 jours comparativement a 15
minutes pour Escherichia coli et de 20 minutes pour Staphylococcus aureus. En
consequence, la culture d ’une duree de 6 a 8 semaines ne doit pas etre souillee par un
contaminant dont la croissance serait plus rapide que celle de MAP. De ce fait, il est
generalement admis qu’une validation par PCR doit confirmer les cas positifs. En ce qui a
trait a l’analyse serologique, il s’agit d ’une approche indirecte. L’ELISA est beaucoup
moins sensible, puisqu’il determine si l’hote a produit une bonne quantite d ’anticorps
contre le pathogene. La nature meme des pathogenes intracellulaires rend la production
11
d ’anticorps chez l’animal tres ardue. En effet, la mission des mycobacteries est de demeurer
imperceptible par le systeme immunitaire de l’hote le plus longtemps possible et ainsi
prolonger leur survie a l’interieur des cellules. Ce qui explique pourquoi l’ELISA
serologique detecte les vaches generalement plus tardivement que la culture fecale
(Woodbury et al., 2008). En effet, avant le debut de l’excretion significative dans les feces,
le pathogene reussi a dejouer le systeme immunitaire de l’hote retardant du meme coup la
production d’anticorps specifiques au pathogene. L’avantage des techniques utilisant
1’ELISA est de livrer des resultats beaucoup plus rapidement en plus de faciliter
l’echantillonnage. Neanmoins leur sensibilite est tres reduite comparativement a la culture
fecale, approximee autour de 30% (Collins et al., 2005, McKenna et al., 2005).
Dependamment du test utilise, cette sensibilite peut monter pres de 50% en ayant une
specificite reduite a 85% (Collins et al., 2005). II est a noter que les sensibilites pour les
ELISA sont calculees par rapport a la culture fecale et non la culture de tissus lors de la
necropsie. On presume ainsi que leur sensibilite est deux fois moindre.
1.7. La prevalence de la maladie
La prevalence reelle de la paratuberculose est difficile a evaluer compte tenu de la faible
sensibilite des tests diagnostiques. D ’autre part, ce ne sont pas tous les laboratoires qui
utilisent les memes outils diagnostic. En considerant que les sensibilites sont tres
differentes d’un test a l’autre et que les laboratoires n ’utilisent pas tous les memes tests, il
est evident que la prevalence apparente calculee dans un cas utilisant la culture fecale est
tres divergente de celle calculee en utilisant un ELISA serologique. De plus, le seuil
critique etabli pour un diagnostic positif differe d ’un laboratoire a l’autre. Par exemple,
pour la detection directe de la bacterie dans les feces, un laboratoire pourrait decider que
l’obtention de dix colonies isolees est suffisante pour declarer 1’animal positif, alors qu’un
autre laboratoire peut etablir ce seuil a cinquante colonies. Dans le dernier cas, la certitude
de ne pas avoir de faux-positif est tres grande, par contre la sensibilite est reduite de
beaucoup. Pour ces raisons, on retrouve presentement de grands ecarts selon les etudes dans
la prevalence calculee des troupeaux infectes. Cette prevalence est de l’ordre de 20 a 30%
dans certaines etudes (Dieguez et al., 2007, Good et al., 2009) alors que d ’autres rapportent
des prevalences apparentes aussi elevees que 70% (Lombard et al., 2013, Pozzato et al.,
12
2011). Les sensibilites dans ces etudes varient entre 30 a 45%, ce qui explique difficilement
les tres grands ecarts rapportes. L’etude la plus interessante a ce jour a ete produite par le
departement de l’agriculture des Etats-Unis au niveau national en utilisant qu’un seul
laboratoire de diagnostic pour normaliser les resultats (Lombard et al., 2013). En ajustant
les resultats par rapport a la sensibilite et la specificite des tests, ils estiment que la
prevalence reelle des troupeaux laitiers comptant au moins un animal positif dans sa
cohorte aux Etats-Unis serait au-dela de 90%. II est certain que la prevalence des troupeaux
infectes varie d’un pays a 1’autre, puisque la regie des troupeaux est differente, la grosseur
des fermes varie et la faune sauvage environnante n ’est egalement pas la meme. Cependant,
a defaut d ’avoir une etude pancanadienne approximant la prevalence des troupeaux atteints
par la paratuberculose, il est envisageable qu’elle puisse s’apparenter a celle calculee pour
les fermes americaines. En prenant en consideration ces faits rapportes, il est flagrant que la
paratuberculose est une maladie dont il faut se preoccuper d ’avantage pour assurer une
diminution de la propagation et ainsi prevenir les risques non nuls de zoonose.
En resume, la paratuberculose bovine continue de se repandre partout dans le monde et les
efforts mis pour restreindre la propagation sont peut-etre vains tant et aussi longtemps que
les outils diagnostiques ne permettront pas d’obtenir une meilleure sensibilite. Cette
difficulte a developper de tels tests est probablement causee par une reponse immunitaire
humorale incoherente. Les prochains chapitres permettront de mieux comprendre les
principes regissant la production d ’une reaction immunitaire efficace en reponse aux agents
pathogenes.
2. LE SYSTEME IMMUNITAIRE
2.1. Role et composantes
Lors d’etudes sur les infections causees par un organisme comme MAP, il est important de
bien comprendre les mecanismes immunitaires, specifiques ou non, impliques dans la
reponse de l’hote pour ameliorer la comprehension globale de la reponse face au pathogene
etudie. Ce faisant, il sera plus aise d’elaborer des strategies efficaces pour controler la
progression de la maladie a l’interieur de 1’hote et eventuellement parvenir a obtenir un
13
traitement efficace. Cette section aura pour but d ’introduire les roles du systeme
immunitaire ainsi que les principaux types cellulaires impliques et leurs fonctions.
Pendant leur croissance, les vertebres developpent un systeme immunitaire leur permettant
de se defendre contre 1’invasion d ’agents pathogenes viraux, bacteriens, fongiques ou
parasitaires. Le systeme immun a pour but de detecter les organismes ayant fait intrusion
chez l’hote, empecher leur propagation et permettre leur elimination. Pour y parvenir, ce
systeme complexe emploie deux types de defenses, soit une reponse non specifique et une
specifique, respectivement nommees les reponses immunitaires innee et adaptative. Elies
ont des fonctions tres differentes, mais complementaires. Elies sont toutes deux necessaires
pour conserver l’etat sain de 1’hote. Les cellules impliquees dans chacune de ces reponses
proviennent d’un precurseur commun situe dans la moelle osseuse nomme cellule souche
hematopoietique (HSC, Figure 1).
14
CD = Cellules Dendritiques
Precurseur des
erythrocytes et
megacaryocytes
Precurseurdes
granulocytes
Monocvte
©
Precurseurdes
monocytes
Precurseur des granulocytes
et mcmocvtes
Precurseurdes
CD myelo'ides
T CD peripheriques
4 CD thymiques
CD peripheriques
j
Pre-CD
CD inflammatoires
Precurseur
myeloide
lymphoide
Z '
,
| CD peripheriques
" v , Precurseurdes
CD lymphoides
T CD thymiques
f
"V, Precurseurdes
, \ _J ; lymphocytes B
‘(
'S'-. Precurseurdes
\
cellules NK
^
j
,
Precurseur
lymphoide
thymique
X
/ —S'
U
Precurseur
; lymphoide des
, ' CD thymiques
Q
' Precurseur des
/ lymphocytes T
N ature Raviaw * | Im m unology
Figure 1 : Schema des progeniteurs immuns. Les differents types de cellules immunitaires
proviennent tous de progeniteurs communs situes dans la moelle osseuse qui tirent leur
origine de cellules souches hematopoietiques (HSC). Les cellules se differencient ensuite
selon deux voies, soit la voie lymphoide (en jaune) ou la voie myeloide (en mauve).
Modifie d ’Ardavin (2003).
Deux lignees distinctes sont produites a partir de ces cellules souches, la lignee myeloide et
la lignee lymphoide. Les cellules de la lignee lymphoide sont celles responsables de la
reponse adaptative, alors que celles impliquees dans la reponse innee sont issues de la
lignee myeloide. Le precurseur myeloide est egalement responsable de la production des
erythrocytes (globules rouges), les thrombocytes (plaquettes), les mastocytes et les
15
myeloblastes. Ces demiers peuvent ensuite donner les cellules granulocytaires, dont font
partie les basophiles, les neutrophiles et les eosinophiles, mais egalement les cellules
monocytaires qui peuvent se differencier en macrophages (Parham, 2003). Pour ce qui est
des cellules dendritiques, elles peuvent etre produites par Pune ou 1’autre des lignees
lymphoides et myeloides (Manz et al., 2001). Quant a la lignee lymphoide, elle produit les
lymphocytes B, les lymphocytes T ainsi que les cellules " natural killers" (cellules NK).
2.2. La reponse immunitaire innee
La reponse innee represente les premiers mecanismes de defense de Porganisme. La
protection initiale est assuree par les barrieres physiques, soit la peau, les muqueuses, ainsi
que certains aspects chimiques et biochimiques en Poccurrence Pacidite de Pestomac et les
enzymes digestives. La flore bacterienne presente sur la peau et les muqueuses est
egalement consideree comme une barriere physique, puisqu’elle protege Porganisme des
microorganismes pathogenes en leur faisant concurrence. Plusieurs types de cellules
immunitaires sont partie integrate de la reponse innee, car sans repondre specifiquement,
elles vont phagocyter les agents pathogenes en general et proceder a leur destruction. Du
nombre, on compte les granulocytes neutrophiles, basophiles et eosinophiles. Les
monocytes engendreront les macrophages et les cellules dendritiques, des types cellulaires
necessaires pour activer la transition de la reponse immunitaire innee vers une reponse
immunitaire adaptative. Ces deux types de cellules vont ingerer les agents pathogenes, les
detruire, puis eduquer les cellules lymphoides pour que celles-ci produisent une reponse
specifique contre le pathogene. La degradation des agents pathogenes par les macrophages
s’effectue a l’aide des lysosomes presents dans le macrophage. Apres que la cellule ait
phagocyte les bacteries, celles-ci se retrouvent a l’interieur de vesicules appelees
phagosomes. Lors de la maturation des phagosomes, ceux-ci fusionnent avec les
lysosomes. Le contenu des vesicules lysosomales etant compose d ’enzymes et de produits
antimicrobiens en plus de comporter un pH acide contribuera a la degradation de tout
organisme present a l’interieur du phago-lysosome. Le recrutement de pompes a protons a
la membrane du phagosome coopereront egalement a acidifier le milieu interne de la
vesicule de fusion (Sun-W adaet al., 2009).
16
2.3. La reponse immunitaire adaptative
La reponse adaptative debute au moment ou les cellules presentatrices d ’antigenes (CPA)
ont
digere
le
pathogene
et
presentent
a
leur
surface
les
complexes
majeurs
d ’histocompatibilite (CMH) liant un peptide provenant du pathogene. Les cellules appelees
lymphocytes T provenant de la lignee lymphoide sont chargees de reconnaitre ces
complexes a l’aide du recepteur des cellules T (TCR) et d ’engendrer la reponse
immunitaire requise. S’il s’agit d ’un pathogene intracellulaire, le peptide sera lie a un CMH
de classe 1 (CMH-I), alors que dans le cas d ’un pathogene extracellulaire, le peptide sera
lie a un CMH de classe 2 (CMH-II). Ainsi, deux types cellulaires differents, provenant de
la lignee lymphocytaire, seront aptes a reconnaitre le CMH-I ou le CMH-II. Dans le cas ou
un CMH-I est presente a la surface de la CPA, ce sont les lymphocytes T ayant le corecepteur CD8 qui seront capables de reconnaitre ce CMH-I et ils amorceront une reponse
de type cytotoxique. Lorsque 1’antigene est presente via un CMH-II, le processus est
totalement different. Generalement il sera reconnu par les lymphocytes T munis du corecepteur CD4 qui assureront la mise en place de la reponse immunitaire la plus efficace
possible. Pour y parvenir, une interaction avec la CPA est necessaire. Apres liaison du
CMH-II avec le TCR, un signal est envoye a la CPA qui procedera a la secretion de
cytokines. Les cytokines sont les proteines qui assurent une communication entre les
cellules du systeme immunitaire. Par exemple, certaines, telles que 1’interleukine 8 (IL-8),
servent d’agents chimio-attractants (Van Damme et al., 1989), d’autres telles que l’IL-2,
amorceront une proliferation cellulaire (Ettinghausen et al., 1985), alors que l’IL-12 et l’IL4 servent de signal de differenciation cellulaire (Hsieh et al., 1993).
2.4. Les lymphocytes T auxiliaires (Th)
Suivant le signal transfere par les recepteurs de surface des CPA (CMH-I ou CMH-II),
celles-ci produiront une gamme de cytokines tres differentes selon le type de reponse
immunitaire requise. Ainsi, s’il s’agit d ’un pathogene extracellulaire, la reponse
immunitaire etablie sera une reponse humorale. II y aura done production d ’anticorps
diriges contre le pathogene pour le neutraliser et favoriser sa degradation par les
macrophages. La neutralisation se fait par opsonisation, e’est-a-dire que les anticorps vont
se Her en grand nombre au pathogene et ainsi former un complexe immun qui sera mieux
17
reconnu par les cellules ayant pour role de degrader les agents pathogenes. Dans le cas d ’un
pathogene intracellulaire, il y aura favorisation de la voie cytotoxique ayant pour but
d ’enrayer la presence de cellules infectees. Pour assurer l’activation d’une reponse adequate
selon le genre d’infection en place, le systeme immunitaire s’est muni d ’un type cellulaire
mediant l’activation d ’une voie ou de l’autre. Ces cellules font partie de la lignee des
lymphocytes T exprimant le recepteur CD4 et elles sont appelees lymphocytes T auxiliaires
(Th). Jusqu’a tout recemment, deux types de lymphocytes Th etaient connus, soit les types 1
(Thi) et les types 2 (Th2 >. Au cours des demieres annees, les Thn, Th9 et Th22 furent
decou verts, cependant leurs roles sont moins bien connus. Les cellules T h l7 sont cependant
les plus etudiees des trois derniers types decouverts, ayant ete identifiees comme etant
impliquees dans une multitude de maladies inflammatoires chroniques telles que les
maladies intestinales inflammatoires (colon irritable) (Caprioli et al., 2008), la maladie de
Crohn (Brand, 2009) ainsi que l’arthrite rhumatoide (van Hamburg et al., 2011).
Pour bien comprendre le role des lymphocytes T auxiliaires, il est utile de connaitre leur
developpement. Tout d ’abord, avant d ’avoir rencontre un CMH-I sur une CPA qui est
complementaire a leur TCR, les lymphocytes T CD4 sont dits nai'fs, car ils ne se sont pas
encore differencies en cellules effectrices. Une liaison efficace des lymphocytes T nai'fs au
CMH-I ou CMH-II de la CPA aura pour effet d’amorcer la secretion de cytokines, tel que
mentionne precedemment. Ces cytokines different selon le signal re9 u d ’un CMH-I ou d ’un
CMH-II. Dans le cas d’une liaison d ’un lymphocyte T naif au CMH-I, la CPA percevra le
signal de devoir produire l’IL-12. Cette cytokine a pour effet d ’initier la differenciation du
lymphocyte T naif en lymphocyte Thi, en plus d’inhiber la possibility d ’une differenciation
en lymphocyte Th2 . L’inhibition de la voie Th2 se fera via la secretion d ’interferon-gamma
(IFN-y). L’effet contraire se produit lors d ’une liaison a un CMH-II qui resulte en la
secretion d ’IL-4 stimulant la differenciation du lymphocyte T naif en lymphocyte Th2
effecteur tout en restreignant la voie T hi (Ouyang et al., 1998). Ces mecanismes d ’inhibition
d’une voie pendant l’activation de l’autre sont regules par l’acetylation (Fields et al., 2002)
et la methylation (Jones et Chen, 2006) des histones d ’un locus particulier empechant la
liaison du facteur de transcription associe a cette voie. Les infections ou les causes menant
a la differenciation des lymphocytes en Thg, Thn et Th22 sont moins bien etablies.
Cependant, les cytokines requises pour les Thn sont bien connues. En effet, lorsque les
18
lymphocytes se trouvent dans un environnement riche en TGF-(3, IL -1p, IL-6 et IL-23, ils
se differencient en lymphocytes Thi7 (Guo et al., 2012, Mus et al., 2010).
L’activation de la differenciation en chacun des types de lymphocytes T auxiliaires se fait
via une liaison des cytokines requises a un recepteur STAT (Signal transducer and activator
of transcription) qui activera des facteurs de transcription appropries. Par exemple, la
liaison de l’IL-12 a STAT-4 aura pour effet d’activer le facteur de transcription T-bet et
resultera en une differenciation du lymphocyte T naif en lymphocyte Thi (Zhu et al., 2012).
De meme, lorsque STAT-4 enverra son signal intracellulaire, il y aura inhibition des
facteurs de transcription GATA-3 et ROR-yt qui sont les facteurs de transcription menant
respectivement a la generation des lignees Th2 et Thn (Murphy et Reiner, 2002). La figure 2
presente divers recepteurs cellulaires ainsi que les facteurs de transcription requis pour
chacune des voies Thi, Th2 et Thi7 . Suivant leur differenciation, les lymphocytes T naifs
debuteront l’expression d’un patron de cytokines specifiques a leur type. Les lymphocytes
Thi produiront majoritairement de l’IFN-y (Yang et al., 1999), l’IL-4 pour les Th2 (Guo et
al., 2002) et les Thn produiront TIL-17 (Korn et al., 2009). Ces cytokines ont des actions
sur d’autres types cellulaires dont les details seront rapportes subsequemment.
Bases moleculaires du developpement en TH1, TH2 et TH17
STAT-l, STAT 4 et T-bet
sont requis pour la
differentiation en TH1
STAT-6 et GATA-3 sont
requis pour la
differentiation en TH2
STAT 3, ROR yt et
ROR-a sont requis pour
la differentiation en TH17
3*3 ^ 3*3 ^
Differentiation en TH1
Differentiation en TH2
Differentiation en TH17
Figure 2 : Voies de signalisation impliquees dans le developpement des lymphocytes T
auxiliaires. Recepteurs membranaires requis ainsi que les facteurs de transcription actives
pour la differenciation des voies de lymphocytes auxiliaire de type 1 (Thi), 2 (Thi) et 17
(Thl7). Adapte d ’Awasthi et al. (2008).
19
2.5. Role des lymphocytes T auxiliaires
Suite a leur differenciation, les lymphocytes T auxiliaires subissent une etape de
proliferation intense appelee expansion clonale, dont les particularites ne seront pas
exposees. Cette etape est tout de meme cruciale pour engendrer une reponse immunitaire la
plus efficace possible. Suite a cette expansion, les lymphocytes T auxiliaires executeront le
role pour lequel ils ont ete crees, c’est-a-dire agir en tant que mediateurs de l’immunite. En
ce sens, lorsqu’ils se rendront a nouveau au site d ’infection, ils s’y rendront en grand
nombre et procederont a l’activation de differents types cellulaires selon leurs competences
dans le genre de reponse requise. Dans le cas d ’une infection intracellulaire, ce sera les
lymphocytes T CD8 qui seront actives (Nagata et Koide, 2010) a proceder a la destruction
des cellules infectees (Figure 3). Lors des reponses cytotoxiques, les macrophages seront
egalement actives a degrader un maximum de bacteries avant qu’elles n ’aient le temps
d ’etablir l’infection (Janeway et al., 2001). D ’une maniere semblable, lorsqu’un pathogene
extracellulaire procedera a l’invasion d’un hote, les lymphocytes Th2 actives stimuleront les
lymphocytes B a produire des anticorps (figure 3) a 1’aide de recepteurs de surface et de
cytokines.
20
Lymphocyte B
Cellule infectee
Cellule
presentatrice
d’antigine
MHC I + ag
C08 TCR
MHC II ♦ ag
C04TCR
87.1/87.2
C028
P rt-hm phoole
T cytotoxique
MHC II + ag
CD4TCR
11-2
IL-12
IFN-y
TN F-a
Th.
B7.1/B7.2
C028
a
1
11-4,IL-5
IL-6, IL- 10
TGF-P
Lymphocyte T naif
O
P ro d u c t km
d ’a n tico rp s
Lymphocyte T
cytotoxique
Plasmocyte
Lymphocyte B m£moire
Figure 3 : Voies de differenciations des lymphocytes T nai'fs en lymphocytes T effecteurs.
Representation des etapes menant a l’implantation d’une reponse cytotoxique, via les
lymphocytes Thi ou humorale, via les lymphocytes Th2 - Adapte de De Haes et al. (2012).
L’action des lymphocytes B, contrairement a celle des cellules mediant la reponse
cytotoxique, ne se fait en general pas au site d ’infection, mais bien dans un organe
lymphoide secondaire. Suite a la stimulation, une partie des lymphocytes B deviendront des
cellules nommees plasmocytes alors que d ’autres se differencieront en lymphocytes B
memoire. Les plasmocytes ont pour role la secretion massive d ’anticorps qui procederont a
la neutralisation du pathogene contre lequel ils sont diriges (Alberts et al., 2002). Quant aux
lymphocytes B memoires, ils resideront dans les organes lymphoides secondaires en
attendant une stimulation ulterieure. Lors d ’une infection subsequente, ils reagiront
beaucoup plus rapidement que lors de la reponse initiale produisant ainsi une reponse
humorale rapide.
21
2.6. Regulation negative de l’inflammation
Suite a l’induction d ’une reponse immunitaire, l’arrivee d ’un bon nombre de cellules
immunitaires aura pour effet de generer une inflammation. Cette inflammation est
necessaire pour resoudre le plus rapidement possible 1’infection, cependant si elle persiste,
elle sera nefaste a l’homeostasie du tissu dans lequel elle se trouve. Un groupe de cellules
dont il n’a pas encore ete question est responsable de ce desequilibre. II s’agit des
granulocytes. Plusieurs types cellulaires en font partie, dont les neutrophiles en grande
majorite, mais egalement les eosinophiles et les basophiles. La lignee des granulocytes est
la plus destructrice, car lors de leur arrivee au site d ’infection, ces cellules remplies de
molecules antimicrobiennes procederont a 1’excretion de plusieurs produits reactifs dans le
milieu extracellulaire. Ces produits tels les reactifs oxygenes (ROS), les gelatinases, du
lyzozyme, de la proteinase-3 auront pour effet d’induire des degats considerables aux tissus
avoisinants (Bergamini et al., 2004). C ’est pour cette raison qu’un type de lymphocytes T
existe dans le but d ’attenuer la reaction d ’inflammation quelque temps apres son induction,
pour ainsi reduire les risques de destruction tissulaire. Ces cellules se nomment les
lymphocytes T regulateurs (Treg). Comme mentionne precedemment, quelques heures apres
l’induction de la reponse immunitaire, les lymphocytes Trt>g procederont a l’expression de
cytokines ayant pour fonction de desamorcer les types cellulaires ayant produit l’etat
d’inflammation (Massa et al., 2007). Ainsi, les cytokines anti-inflammatoires telles que
l’IL-10 ainsi que le TGF-P seront produites par les lymphocytes Trt?g et inhiberont les
cellules Thi et Th2 (Fiorentino et al., 1991, van Scott et al., 2000). En regulant negativement
les cellules secretant les cytokines pro-inflammatoires, le systeme immunitaire essaie
d ’eviter la creation de foyers inflammatoires. Cependant, dans les cas ou les CPA ne
cessent de produire le signal indiquant la presence de corps etrangers, il arrive que Faction
des lymphocytes Tregne soit pas assez efficace pour controler l’inflammation.
3. PATHOGENESE DE LA PARATUBERCULOSE
3.1. Infection initiale
Tel que mentionne precedemment, l’infection par MAP se fait le plus souvent via
Fingestion de matieres contaminees. Ainsi, le pathogene se retrouve dans le tractus gastro-
22
intestinal et initiera son processus infectieux. Plus precisement, 1’infection se loge dans le
petit intestin, soit dans la region terminale de l’ileon que MAP penetrera dans les plaques
de Peyer (Sigurethardottir et al., 2004). Les plaques de Peyer sont des organes lymphoides
secondaires responsables d’initier la reponse immunitaire dans l’intestin. Les bacteries
presentes dans 1’intestin penetreront dans les organes lymphoides secondaires par la
membrane epitheliale, au niveau des cellules M (Figure 4); (Momotani et al., 1988).
Injectiond’effecteursparT3SS, T4SS etT 6SS
Invasion et transcvtose
r
Lumen intestinal
o
^
Couchede mucus
follicules
ffet sur le cytosquelette
lisaticm, la
taireetles
v^.»
©
brechedans la
barriere
6pith£lialeet
invasion tissolaire
© ©
Lymphocyte B
Lymphocyte T —I _ £ )
^
@
Cellules
dendritiques'
Plaque d« Peyer
■y
C ellules
presentatrice
d ’antigene
Lamina propria
Figure 4 : Schema representant 1’invasion tissulaire de plusieurs bacteries intestinales.
L’entree de Mycobacterium avium subspecies paratuberculosis dans les plaques de Peyer
s’effectue en passant par les cellules M tapissant ces organes lymphoides secondaires.
Modifiee de Nell et al. (2010).
23
Suivant son intrusion dans les plaques de Peyer, le pathogene sera pris en charge par les
macrophages et les cellules dendritiques charges de proceder a 1’education du systeme
immunitaire. Cette education evite de creer des reactions immunitaires indesirables contre
les bacteries commensales, tout en s’assurant de proceder a une clairance efficace des
bacteries potentiellement pathogenes. En temps normal, les macrophages ont pour objectif
de digerer les agents pathogenes et de proceder a la presentation antigenique aux
lymphocytes T. Cependant, une aptitude de MAP est de parvenir a echapper aux
mecanismes de degradation et arrive de ce fait a se nicher a l’interieur des macrophages et
s’y reproduire tranquillement sans activer le systeme immunitaire. II a ete etabli que MAP
interfere lors de la fusion du phagosome au lysosome, ce qui compromet l’apport
d ’enzymes ainsi que 1’acidification du phagosome necessaire a la degradation des
pathogenes (Kuehnel et al., 2001, Sturgill-Koszycki et al.,
1994). Le processus
d’autophagie est egalement sabote et les macrophages ainsi deroutes ne procederont pas
efficacement a la destruction de MAP qui en profite pour s’y multiplier lentement.
Neanmoins, les macrophages parviennent a amorcer une reponse innee, probablement par
l ’activation de recepteurs membranaires reconnaissant les patrons membranaires bacteriens
lors de la liaison de MAP a ceux-ci (Machugh et al., 2012, Weiss et al., 2008). Cela a pour
effet d ’induire un appel de monocytes au site d’infection qui provoquera une inflammation
locale. Des ce moment, la formation de granulomes est amorcee etant donne la colonisation
massive des plaques de Peyer par les cellules immunitaires. Grace a cet appel de cellules,
MAP se retrouve avec une grande quantite de monocytes et macrophages a infecter dans un
endroit tres restreint, ce qui favorisera la progression de l’infection. De surcroit, le
pathogene evite ainsi d’avoir a se deplacer hors des plaques de Peyer et risquer de
provoquer une reponse immunitaire acquise efficace dirigee contre lui. Ce phenomene
d ’inflammation locale aura pour effet de causer l’epaississement des muqueuses intestinales
qui est une caracteristique observee lors de necropsies des animaux en phases avancees de
la maladie de Johne.
3.2. Initialisation de la reponse immunitaire
Des l’implantation de MAP dans les plaques de Peyer, le systeme immunitaire de l’hote
semble se deregler. Les experts ne s’accordent toujours pas pour etablir le mecanisme
24
general. Certains d’entre eux pretendent qu’une phase pro-inflammatoire serait mise en
place dans les premiers jours suivant l’entree du pathogene dans le tissu intestinal
(Coussens, 2001). Cette inflammation serait provoquee par une secretion intense de
cytokines pro-inflammatoire telles que TNF-a, IL-1P et IL-6 par les macrophages ayant
reconnu MAP a l’interieur des plaques de Peyer (Coussens, 2001). Certains autres
proposent plutot une periode d’inhibition du systeme immunitaire par la secretion massive
d’IL-10 (Stabel et Robbe-Austerman, 2011) par les lymphocytes T regulateurs dans le but
de permettre a MAP d ’entrer dans les macrophages sans produire de reponse immunitaire
aigiie. Le second modele etant beaucoup plus recent, il est tres peu decrit et pour cette
raison ce sera le premier modele qui sera decrit plus en detail. Toutefois, afin de bien
comprendre 1’integration des resultats obtenus lors du projet, il est crucial de garder en tete
que le modele presentement accepte pourrait etre appele a subir des modifications.
3.3. L ’evolution de la paratuberculose bovine
Selon la theorie proposant une phase pro-inflammatoire en debut d ’infection, la reponse
immunitaire en place dans ces premiers temps serait une reponse de type Thi. Elle est
representee par un potentiel eleve de secretion d ’IFN-Y par les cellules mononucleees
isolees du sang peripherique (PBMC) mises en culture, puis stimulees avec une culture de
MAP soniquee (Stabel, 1996). Afin d ’evaluer le type de reponse en place, le dosage d’lFNy ainsi que de 1TL-10 suite a la stimulation a couramment ete utilise (Coussens et al., 2004,
Stabel, 2000). Une secretion d’IFN-Y etant attribute a une reponse de type Thi et celle d ’IL10 etait associee a une reponse de type Th2 - Le ratio IL-10/IFN-y ainsi obtenu appuyait
l’augmentation de la reponse de type T h2 au cours de la progression de la maladie. Selon ce
theoreme, les vaches presentent d’abord une reponse de type Thi qui serait remplacee par
une reponse de type Th2 au fur et a mesure que la maladie evolue. Cette hypothese est
egalement appuyee sur le fait qu’au debut de la maladie la grande majorite des vaches
infectees ne presentent aucune reponse humorale vis-a-vis du pathogene. Puis dans les
annees suivant l’infection, les anticorps diriges contre MAP se retrouvent peu a peu dans le
sang des animaux infectes et ceux-ci deviennent ainsi positifs au test diagnostique
serologique. Cependant, au moment d ’etablir les ratios IL-10/IFN-y, la secretion d ’IL-10
etait attribute a tort aux lymphocytes Th2 - La decouverte des lymphocytes Treg a depuis
25
change la vision de l’IL-10 et il a ete etabli que cette cytokine serait plutot majoritairement
secretee par les lymphocytes Treg (Maynard et al., 2007). Aucune etude n’a repris le ratio
IFN-y avec IL-4 qui est dorenavant connu comme etant une cytokine specifiquement
secretee par les lymphocytes Th2 - Toutefois, depuis quelques annees, des etudes tendent a
demontrer 1’implication les lymphocytes Thn dans la chronicite de la maladie. Cet aspect
est d’autant plus interessant que plusieurs maladies inflammatoires chroniques humaines
sont une consequence du dereglement de l’equilibre des lymphocytes Thn- Entre autre,
l’arthrite rhumatoi'de, les maladies inflammatoires intestinales et la maladie de Crohn.
3.4. Genes de susceptibilite a la paratuberculose
Comme c’est le cas pour plusieurs infections bacteriennes et virales, il existe des mutations
dans certains genes ayant pour consequence d ’augmenter la susceptibilite a l’infection par
MAP. La majorite des genes portant de telles mutations sont relies a l’immunite. Certaines
mutations surviennent dans des genes agissant au niveau de la detection de pathogenes, en
l’occurrence les recepteurs Toll-like (Mucha et al., 2009) et NOD-2/CARD15 (Pinedo et
al., 2009, Ruiz-Larranaga et al., 2010). D ’autres sont impliques directement dans la reponse
immunitaire tel BoLA-DRB3 (Rastislav et Mangesh, 2012), dont la proteine fait partie du
groupe des MHC-II responsables de la presentation d ’antigenes extracellulaires. Des
proteines sont egalement essentielles pour inhiber la croissance bacterienne a l’interieur des
macrophages pendant les phases d ’infection initiales notamment NRAMP1 (Paixao et al.,
2007). D est interessant de noter que NRAMP1 est un gene affecte par des polymorphismes
menant a sa defaillance dans les cas de maladies inflammatoires intestinales humaines
egalement (Stewart et al., 2010). Les polymorphismes ne se limitent pas aux genes
essentiels pour la detection du pathogene ou l’inhibition de sa proliferation. Certaines
mutations ponctuelles ont ete retrouvees dans des genes codants pour des proteines ayant
un role dans 1’orchestration d ’une reponse immunitaire efficace. Par exemple, le recepteur
de l’IL-10 possede une region polymorphique associee a une susceptibilite accrue pour la
paratuberculose (Verschoor et al., 2010).
Par ailleurs, il existe des genes qui semblent inferer une susceptibilite non pas a MAP en
particulier, mais aux mycobacteries en general. C ’est le cas de 1’osteopontine qui est une
proteine aux multiples facettes encodee par le gene SPP1. Effectivement, l’osteopontine est
26
impliquee dans un grand nombre de processus, que ce soit dans la cicatrisation (Liaw et al.,
1998), le remodelage tissulaire (Kohan et al., 2009) ou bien meme dans 1’activation precoce
des lymphocytes T (O'Regan et al., 2000, Patarca et al., 1989). Des etudes ont demontre
que des souris transgeniques dont le gene SPP1 a ete inactive possedent une plus grande
susceptibilite a l’infection par des pathogenes intracellulaires (Nau et al., 1999). Dans le cas
de la paratuberculose, l’osteopontine pourrait s’averer importante puisqu’elle semble jouer
un role crucial dans la detection ou le controle des mycobacteries (Karcher et al., 2008).
Etant donne son implication a activer precocement les lymphocytes T dans le cas
d ’infection, cette proteine est potentiellement une cible de choix pour les pathogenes
desirant se cacher sans etre detectes. En resume, les genes proferant une susceptibilite
accrue aux infections a MAP prennent part a differentes etapes regissant la reponse
immunitaire face aux pathogenes. Dans le meme ordre d’idee, plusieurs mutations peuvent
egalement inferer une resistance accrue a 1’infection par MAP. II n’en demeure pas moins
qu’un animal ayant une mutation dans un gene lui procurant une susceptibilite accrue ne se
retrouvera pas assurement infecte apres ingestion de matieres contaminees. En effet,
l’implantation ou non de la maladie repose sur une multitude de facteurs notamment la
susceptibilite genetique.
3.5. Zoonose de la paratuberculose
Au cours de la derniere decennie, il s’est tenu un grand debat a savoir si MAP etait
potentiellement transferable a l’etre humain en causant sensiblement les memes signes
cliniques que ceux apparents chez les bovins. II a ete clairement etabli que la bacterie peut
se retrouver en quantite detectable dans les feces d ’etres humains (Tuci et al., 2011),
cependant il n’est pas aussi evident de faire un parallele entre la presence de MAP dans les
feces et une maladie inflammatoire intestinale humaine. La maladie de Crohn chez
l’humain presente des similarites avec la paratuberculose bovine et a souvent ete etudiee
pour tenter d’arriver a definir si MAP etait un acteur potentiel dans le developpement de
cette maladie. Des mutations conferant une susceptibilite a la maladie dans des genes relies
a 1’immunite contre les mycobacteries comme NOD-2 (Ferwerda et al., 2007), IL23R
(Yamazaki et al., 2007) ainsi que ATG16L1 (Massey et Parkes, 2007) laissent croire
qu’une bacterie telle que MAP pourrait etre impliquee dans cette maladie. II est interessant
27
de constater que ces memes genes sont egalement associes a une susceptibilite accrue pour
la paratuberculose chez les bovins. Par contre, plusieurs aspects rendent l’association
directe plutot ardue. Tout d ’abord, Bull et al. (Bull et al., 2003) ont detecte la presence de la
bacterie dans 26% des patients controles remettant en perspective toute association entre la
maladie et la presence de MAP. De plus, il aurait ete logique de retrouver une plus grande
proportion de fermiers atteints de la maladie de Crohn sur les fermes ou la paratuberculose
est presente. Cependant, les ratios de personnes atteintes ne different pas de la population
ne se retrouvant pas en contact direct avec ces animaux (Jones et al., 2006). Par ailleurs,
meme s’il est complique d’etablir avec certitude une relation entre 1’infection par MAP et le
developpement d’une maladie intestinale, la presence de la bacterie vivante dans le sang de
patients atteints de la maladie de Crohn ou de colite ulcereuse represente un plus grand
pourcentage que chez les patients sains (Naser et al., 2004).
3.6. Objectifs et hypotheses
Dans le projet qui m ’a ete attribue, les objectifs etaient de mieux comprendre la
destabilisation du systeme immunitaire survenant lors d’infection par MAP en premier lieu.
L ’hypothese que les cellules immunitaires isolees du sang peripherique se comporteraient
de maniere differente en presence de serum de vaches infectees en comparaison a du serum
de vaches saines a ete emise. Dans un deuxieme temps, la concentration serologique de
certaines cytokines a ete mesuree afin de mesurer des differences entre les groupes de
vaches etablis lors du diagnostic. Effectivement, un aspect fort interessant de l’etude est
que lors du diagnostic, deux outils ont ete utilises, ce qui a permis la classification des
vaches en trois groupes. Les vaches diagnostiquees negatives par les deux tests, les vaches
positives uniquement en culture fecale et finalement les vaches diagnostiquees positives par
les deux methodes, soit la culture fecale et le depistage serologique (ELISA). Etant donne
que 1’ELISA detecte les vaches qui sont en general dans un stade plus avance de la maladie,
celles-ci ont ete considerees dans un groupe distinct. L’hypothese soutenant le dosage des
cytokines sanguines etait que la progression de la maladie n’apportait pas vraiment une
derive d’une reponse Thi vers Th2 au cours de l’infection, mais qu’il y aurait probablement
une implication des lymphocytes Thi7 , comme c’est le cas pour plusieurs maladies
inflammatoires chroniques. Dans cet ordre d ’idee, la reponse genique des macrophages face
28
a l’infection par le pathogene apporterait une precision quant a savoir s’il etait possible que
certaines voies lymphocytaires soient preferentiellement mise en place des les premieres
heures suivant l’infection par MAP. L’osteopontine sanguine a ete mesuree pour arriver a
determiner s’il etait possible qu’elle soit impliquee dans le developpement de la chronicite
de la maladie.
AVANT-PROPOS DU PREM IER ARTICLE
Haplotypes of the bovine osteopontin gene affect the level of OPN secreted into milk
and the host macrophage immune response
Auteurs de Particle : Pier-Luc Dudemaine, Karin Alain, Catherine Thibault et Nathalie
Bissonnette
Statut de Particle : Soumis la revue BMC Genomics le 6 mai 2013 avec le numero de
soumission 1900205853973017.
Avant-propos :
La premiere ebauche d ’un article qui fut amalgame dans un second temps a un deuxieme a
ete redigee par Pier-Luc Dudemaine. La fusion des deux etudes fut effectuee par Mme
Nathalie Bissonnette. Concernant le travail experimental, 1’organisation des phases
animates et le travail attribue a la mise au point de l’outil de dosage (ELISA) ainsi que la
quantification de l’osteopontine ont ete effectuees par M. Pier-Luc Dudemaine.
L’optimisation de la methode d’isolement de macrophages differencies a partir de
monocytes sanguins a egalement ete realisee par M. Pier-Luc Dudemaine. Mme Karin
Alain avait clone et caracterise les haplotypes du gdne SPP1. Les constructions de vecteurs,
les transfections ainsi que l’optimisation de la methode qRT-PCR sont le travail de Mme
Catherine Thibault, assistante de recherche.
a
u.'tviuiftoa
' _
SHERBROOKE
AUTOmSATXON B U ftfclM IIO ft
ix u n a r t i c l e t o u r r a t c o u a e o i u t x o m
A u * n tm a m o u u r n T w i n
H aototvpeaofthaSPPI
gene affect the ostaopbntin level tn bovine milk and the macrophage Immune response
reoanna**(raoonrateon*)quatoftartkdtsaraInduscommaparti*oonsdtuantadumtnatm QD d iltlM p t □
de r#udtoit(e) (nan):
Ptar-Luc Dudemaine________________________________________
ta o t(t) au programmed* Blochimte_______________ ______________________________________
defeFfcultfda
M ddadneetadonoaadetteanti •_____________dalUnfcmnftidaSherbrooto
Bn Itt da quot, im (nouaawoM)Ponte* angagMMrtten un noRtra^Mtltaanl d'ceraM ae*
II
^
I**"
Coontowifri
i
f
c
w t
i >
—
—
"
i . i A
i—
I.
......................... in .
I I . .
—
■
A°«»=2013-06^)3
^
Nathalie Bissonnette_____________ ______________ ___ ___
2000 rue du College
Sherbrooke. QC, Canada J1M 0C8
ggnab** /
7 J ________ 0***- 2013-06-^
Mom Catherine Thibault
awfcnntoe 2000 rue du College___________________________________ _
Shmbrooka. QC. Canada J1M0C8
S gw tw A
^ _________________ ;___ <*** 2013-05-O l
Mom Karin Alain
Q »*nn< a 2000 rue duC oieoe
Sherbrooke. QC. Canada J 1M PCS
Sgnabune
Mom
Obordomte
Date:
.
.
.
.
...
----------------
* Un etampteir* pour r&udbnte^ K&udlant, un ©cemplalnt pour cheque personne sJgretalre «t un
m ntptafo pour fe Service <fes bMotfiiques (I ramettrt avac le m tm eirew la thfcse au moment du
depeft final).
RESUME DU PREM IER ARTICLE
L’article porte sur l’etude de l’expression de l’osteopontine (OPN) dans le lait, le sang et
les macrophages bovins, en relation avec les variations genetiques situees dans son
promoteur. L ’osteopontine, codee par le gene SPP1, est associe a l’imumunite et consideree
comme
une
cytokine
impliquee
au
debut
de
1’infection
bacterienne.
Plusieurs
polymorphismes (SNP) ont ete recenses dans la sequence entourant le gene et une grande
proportion de ces polymorphismes se retrouvent dans sa region promotrice. II a ete rapporte
que la genetique du promoteur pourrait influencer la sante de la glande mammaire, puisque
certains haplotypes (H3) du gene presentent une cote de cellules somatiques (CCS) plus
elevee que d’autres (Alain et al., 2009). La CCS represente le nombre de cellules
somatiques infiltrees dans le lait et elle augmente drastiquement lors d ’infections
bacteriennes intra-mammaires, ce qui en fait un indicateur de sante de la glande mammaire.
Ainsi, sachant que certains haplotypes semblent demontrer une plus grande susceptibilite
aux infections, il est envisageable que les taux d ’OPN dans le lait et le sang varient.
Consequemment, il serait fort possible que son expression soit regulee differemment selon
la presence de SNP situes au site de reconnaissance de facteurs de transcription. La proteine
etant abondamment secretee dans le lait, le genotype du promoteur a potentiellement un
effet sur la production de la proteine dans le lait. Egalement, l’OPN etant un facteur
immunitaire ayant un role lors des infections bacteriennes, il serait possible que les
polymorphismes influencent la reponse immunitaire face aux pathogenes, dont celui
causant la paratuberculose bovine.
Dans un premier temps, la genetique du promoteur de l’OPN ne semble pas influencer la
production de lait, puisqu’il n’y a aucune difference entre les trois haplotypes etudies. II est
tout de meme interessant de noter qu’en fin de lactation, il semble y avoir une tendance a
produire plus de lait pour les vaches ayant la genetique H lxH 4. Lors de l’analyse en
immunobuvardage de la proteine provenant du lait, aucune difference entre les isoformes
presents n ’a ete observee, indiquant que 1’etat de la proteine secretee ne change pas au
cours de la lactation.
32
Au niveau de la concentration d’OPN dans le lait, les vaches genotypees H lxH 4, H lx H l et
H2xH3 presentent des differences au niveau des concentrations dans le lait. Pendant la
periode couvrant les semaines 25 a 30 de lactation, les niveaux sont plus eleves chez les
vaches ayant l’haplotype H lxH 4 (P < 0.05). Etant donne la tendance a produire plus de lait
en fin de lactation pour les vaches H lxH 4, la comparaison de la quantite totale produite est
interessante. Cette donnee correspond a la concentration multipliee par la quantite de lait
produite et presente des differences qui s’etendent jusqu’a la fin de la lactation, soit la
semaine 37
(P < 0.05). Le plasma quant a lui ne presente pas de difference entre les
haplotypes au cours de la lactation en plus d ’avoir un taux basal tres constant, demontrant
que 1’augmentation dans le lait ne provient pas d ’une augmentation de la concentration
sanguine.
L’analyse de l’expression de genes chez les macrophages bovins en reponses a differents
stimuli a montre que la genetique de 1’OPN etait potentiellement liee a son expression en
reponse a certaines stimulations in vitro. II a egalement ete possible de montrer un lien
hypothetique entre la genetique du gene SPP1 et d ’autres proteines impliquees dans les
reponses immunitaires, telles que l’IL-6 et NOD-2. Cet aspect amene une facette tres
interessante de la regulation de l’immunite, puisque l’OPN est une molecule ayant des roles
sur plusieurs types cellulaires distincts.
Finalement, il a ete possible d ’observer que la genetique du promoteur de l’OPN amene des
differences d ’activite en reponse au facteur de transcription SP1. Effectivement, les
haplotypes etudies presentent des differences au niveau des activites de la region
promotrice lors de l’ajout de SP1. Ainsi, il est possible de constater qu’il existe bel et bien
une relation entre la genetique du promoteur et son activite, et ce au niveau genotypique,
mais egalement au niveau phenotypique represente par la secretion dans le lait.
PREM IER ARTICLE
Running head: HAPLOTYPES AND OSTEOPONTIN SECRETION INTO MILK
Title: Haplotypes of the bovine osteopontin gene affect the level of OPN secreted into milk
and the host macrophage immune response
P. L. Dudemaine,* C. Thibault,f K. Alain,* and N. Bissonnette*!
*Departement de biochimie, Faculte de medecine et des sciences de la sante, Universite de
Sherbrooke, Sherbrooke, QC, Canada J1H 5N4
fDairy and Swine Research and Development Centre, Agriculture and Agri-Food Canada,
Sherbrooke, QC, Canada JIM 1Z3
34
Abstract
Background. Osteopontin (OPN) is found in nearly all body fluids and secreted by a
variety of cells and tissues. The role of OPN as a cytokine was first described as an early
component of the T-cell activation factor. Enhanced in T cells, OPN recruits macrophages
at the infection site and improves cell-mediated immunity by inducing secretion of Tm
cytokines. OPN is now recognized as an important proinflammatory cytokine with
pleiotropic functions that include pathogen clearance and wound healing. In a previous
study, we identified haplotypes of the OPN gene and found that OPN genetics was
associated with the milk somatic-cell score of the Holstein breed of dairy cattle. This
parameter is used to estimate the genetic value of the number of somatic cells in milk as an
indicator of udder health. Our study assessed whether the genotype of the OPN gene
promoter had an impact on transcriptional activity, immune response, or the level of OPN
secreted into milk.
Results. Cows were grouped according to the OPN haplotypes associated with a high
(H2xH3), average (H lx H l), or low (H lxH 4) somatic-cell score. Plasma concentration and
the amount of OPN secreted in milk were measured throughout lactation. As the OPN level
increased in late lactation, H lxH 4 cows associated with a low estimated breeding value for
somatic-cell score secreted greater amounts of OPN into milk and their macrophages were
less prone to sustain a higher level of SPP1 and proinflammatory IL-6 transcripts under
challenged conditions. The influence of DNA polymorphisms on the promoter activity of
the OPN gene was confirmed in vitro.
Conclusions. An inverse correlation between the OPN milk level during late lactation and
the breeding value estimated for somatic cells was found, with an elevated OPN level
associated with a lower SCS being favorable. The early T-cell activator and leukocyte
recruitment properties of OPN during late lactation may be beneficial for reducing the
incidence of infection during the transition period. When coupled with proven udder-health
management programs, genetics that influence the immune-cell response in milk could help
reduce mastitis or other health problems associated with the transition period.
Key words: osteopontin, haplotype, dairy milk, macrophage, immune response
35
Background
Osteopontin (OPN) is a secreted glycoprotein with cell-binding properties that regulates
activities through integrin (Liaw et al., 1995) or other cell receptors such as the CD44
immune ligand (Khan et al., 2005). Since it was first identified as a component of
mineralized tissues (e.g. bone), the phosphoglycoprotein OPN has been found secreted into
numerous body fluids (e.g., saliva, plasma, bile, and milk) and by cells into a variety of
tissues, including kidney, pancreas, brain, uterus, and several glands. Moreover, OPN is
expressed in activated macrophages, lymphocytes, and natural killer cells (Patarca et al.,
1993; Murry et al., 1994; Li et al., 2003). A variety of stimuli, including tumor necrosis
factor-a, interleukin (IL)-1p, IL-10, interferon gamma (IFN-y), and lipopolysaccharide
(LPS), are able to upregulate OPN expression (Denhardt and Noda, 1998; O'Regan and
Berman, 2000; Li et al., 2003; Konno et al., 2006), but little is known about the impact of
OPN gene variants on OPN expression in milk and in macrophages, the latter being a
critical cell type in the development and modulation of immune responses. Several
biological implications have been attributed to OPN, notably involvement in the initiation
of the migration of macrophages and DCs to inflammation sites (Nau et al., 1997; Giachelli
et al., 1998; Renkl et al., 2005). Because OPN induces key early type-1 factors produced by
activated T cells, it was initially considered a T hi cytokine (Singh et al., 1990), which was
later confirmed by studies using OPN knockout mice that shown reduced T Hi immune
response and increased susceptibility to mycobacterial infection (Nau et al., 1999). In
addition to its significance to immunity (Wang and Denhardt, 2008), OPN may have a
broader integrative function, given that it influences wound healing (Liaw et al., 1998;
Saika et al., 2007), cell survival and proliferation (Cho and Kim, 2009; Chiodoni et al.,
2010), and tissue homeostasis (Qu and Chaikof, 2010). While expressed in several organs,
OPN is highest in milk, assessed at 18 mg/L in dairy cows (Schack et al., 2009), and is
10 times higher in colostrum (Kumura et al., 2004). It has been suggested that the
abundance of OPN in milk can be accounted for by the bioactivity of this protein and its
roles in newborn immunity (Schack et al., 2009). Osteopontin’s potential to interact with
ubiquitously expressed multiple cell-surface receptors makes it an active player in many
physiological processes.
36
While osteopontin, a secreted intracellular protein, was found to be essential for mammarygland development (Nemir et al., 2000), its reported pleotropic roles suggest that OPN has
a broader impact. Indeed, genetic variants of the OPN gene (SPP1) affect milk production
and local immunity, as suggested by genomic studies (Schnabel et al., 2005; Alain et al.,
2009). A previous study reported the detection of this abundant transcript early on in
mastitis (Alain et al., 2009). Four DNA single-nucleotide polymorphisms (SNPs) were
identified using the estimated breeding value (EBV) of the somatic-cell score (SCS), which
is the most reliable information on udder health status and mastitis resistance (Heringstad et
al., 2008). Three SNPs are located in the promoter of the SPP1 gene, defining the
haplotypes H I, H2, and H3, which are the most common (93%) haplotypes in the Holstein
bull population (Alain et al., 2009). The fourth SNP, located in the 3’ untranslated region
(UTR), defines the minor allele H4 (5%), which shares the same genotype of the HI
promoter. As OPN is thought to be a potential candidate gene for both production and
immune traits, we hypothesized that haplotypes of the OPN gene promoter would influence
the secretion of the protein into milk. Thus, cows carrying haplotypes associated with a
high (HlxH 4) or low (H2xH3) EBV for SCS— which is an indicator of udder health—
would exhibit differences not only for the OPN milk content but also with respect to
immune response. Given OPN’s importance in many physiological processes, studying the
impact of genetic variations on OPN secretion and the immune response contributes to our
understanding of the mechanisms driving mammary-gland homeostasis. Taken together, all
signs point toward an important role for OPN in the lactation process, hence this study’s
importance and relevance.
RESULTS
M ilk yield and composition
Days in milk did not differ between the H lxH 4 (322 ± 26), H2xH3 (313 ± 26), and H lx H l
(298 ± 25) groups (P = 0.411). The amount of lactose, protein, or fat (yield and percentage)
and somatic cell count did not differ overall by genetic group (data not shown). Daily milk
yield increased, and milk yield peaked at nearly 50 days in milk, with no difference by
group (P > 0.527; Figure 1). Thereafter, a gradual decrease in milk production was
37
observed until the last day of sampling. Weekly mean milk yields for the H lxH 4 cows
were slightly higher (P < 0.05) at certain points, namely wk 14 and 16 and the period from
wk 26 to 28 (Figure 1).
300
—
Haplotype H2xH3
Haplotype HlxHl
Haplotype HlxH4
250 -
200
-
00
150 -
100
-
1
6
11
16
21
26
31
36
Week of sampling
Figure 1 Milk yield per week (kg/wk) measured for cows with haplotypes H2xH3, H lx H l,
or HlxH4. Results are shown as means of total milk production for 7 d. Differences in milk
yield between haplotypes (*P < 0.05) were observed at wk 14 and 16 and during wk 26 to
28.
38
Detection o f OPN in milk according to SPP1 haplotype
Western blots were performed on the milk of each cow for wk 2, 5, 10, 15, 20, 25, 30, 35,
and 40. No change in the profile of the isoforms of the protein was observed by
immunoblotting during the course of the lactation period (Figure 2).
A
B
M
M
8
75 kDa
75 kDa
50 kDa
50 kDa
37 kDa
37 kDa
Figure 2 Detection of osteopontin (OPN) by Western blot. Milk samples were analyzed by
SDS-PAGE (12%) and detected following immunoblotting using commercial mouse antiOPN MAB193P. Lane M is the molecular marker (Precision Plus Protein All Blue
Standard). In panel A, purified OPN from bovine milk is in lane 1, and commercial bovine
OPN is in lane 2. In panel B, milk samples representing wk 2, 5, 10, 15, 20, 25, 30, 35, and
40 of lactation are in lanes 1 to 9, respectively.
The concentration of OPN in the colostrum was remarkably elevated (-1,000 mg/L) and
decreased drastically by approximately 50 times by the second week (Figure 3A). The
concentrations of OPN in milk rose slightly, but no difference according to the genetics of
the cows was observed until wk 25. During wk 25 to 30, a marked difference (P < 0.05)
was seen for the H lxH 4 cows compared with the other groups (Figure 3B). The distinct
nature of the H lxH 4 group was further confirmed by the OPN value reported as the total
amount of secreted OPN according to weekly milk yield (Figure 3C). The amount of secreted
OPN was higher for the H lxH 4 cows than for the H2xH3 cows from wk 26 through to the
end of lactation (P < 0.05).
Osteopontin concentration (mg/L)
Osteopontin concentration (mg/L)
in
o
o
o
in
O
N
J
in
o
10
in
O
*
Q| NJ
3
CD
■o
3Q
O
Week of s a m p lin g
<
ftft N
0\J
7T
O
*J
ID
00
u>
v.O
*O
40
r*"
7 0 ,0 0 0
H a p lo ty p e H 2xH 3
H a p lo ty p e H lx H l
H a p lo ty p e H lx H 4
6 0 ,0 0 0
“>
5 0 ,0 0 0
z
a .
O
"g
4 0 ,0 0 0
ro
3 0 ,0 0 0
II
"1 k "
20,000
II
10,000
18
20
22
24
26
28
30
32
34
36
38
Week of sampling
Figure 3 Osteopontin (OPN) concentration in milk from cows with haplotypes H2xH3,
H lx H l, or H lxH 4 measured by sandwich ELISA. Concentrations measured throughout
lactation are presented in panel A. Data for wk 18 to 40 are presented in panel B. The total
amount of secreted OPN in milk for each haplotype group for wk 18 to 40 is presented in
panel C. Concentrations are given in milligrams of OPN per liter of milk, and the error bars
represent the standard error of the mean (±SEM). Significant differences are denoted by an
asterisk (*P < 0.01).
Evaluation o f plasm a OPN level during the lactation period
For the recovery assay performed using a plasma sample, a systematic 10-fold reduction in
the quantity of OPN was measured (data not shown). Each recovery assay performed in
plasma was reproducible and always presented a slope that was highly parallel to but lower
than the standard curves made with OPN diluted in buffer. Plasma may contain proteases
that degrade OPN during the incubation of the ELISA plate. The addition of protease
inhibitors to the samples or the use of a heat denaturation step overcame the loss of
sensitivity observed in the presence of plasma. Osteopontin was resistant to heat treatment,
given that approximately 98% of the OPN added to plasma just before heat denaturation
40
41
was recovered, as measured by ELISA; that stability was also validated by immunoblotting
(data not shown). The presence of protease inhibitors did not further improve the sensitivity
of the assay. Because treatment at 95°C for 3 min showed results similar to those achieved
with the use of protease inhibitors, this low-cost heat treatment approach was used for the
subsequent analysis. The plasma OPN concentration showed no variations throughout the
lactation period except in the first week, when the amount of OPN was higher during the
transition period (data not shown). However, no plasma difference according to the genetics
of the cows was observed. The plasma OPN concentrations for the entire lactation period
can be found in Additional File 3.
180
HlxH4
-♦ H2xH3
160
140
120
c
o
2
c
0u1
c
oo
100
80
Z
Q_
°
60
40
1
6
11
16
21
26
31
36
Week of sampling
Additional file 3 Osteopontin (OPN) concentration in plasma samples measured by
ELISA. Plasma was sampled each week throughout 40 wk of lactation for haplotypes
H2xH3 (n = 3) and H lxH 4 (n = 3), and OPN concentration was measured by ELISA. Data
are shown as means ± SEM.
42
M essenger RNA expression o f m onocyte-derived m acrophage genes
Expression levels for the key inflammatory and chemokine genes identified as
proinflammatory (IL-6, IL-12A, TNF-a, CCL3 [MIP-a], and SPP1) or the anti­
inflammatory 1L-10 factors were determined. Two other key factors, NOD2 and NRAMP1,
which are, respectively, the intracellular mycobacterial pattern (e.g., MDP) recognition
receptor and the natural resistance-associated macrophage protein, were included because
they are associated with a genetic susceptibility to mycobacterial infection (Table 1).
S n * o l'
XUM
ACTB
PPIA
P-Actm
Peptidvlprolyl
isomexase A
Ubiquitously expressed
transcript
Tyrosine
3-monooxygaiase
tryptophan
5-monooxygenase
activation protein, zeta
polypqttide
or
iw r n z
CCL3
K -5
E.-12A
Chemokine (C-C
motif) ligand 3;
M IP-la
Interleukin 6
{interferon, beta 2)
Interiaikin 12, subunit
Biological fsic b o a sad process
Housekeeping genes
Structural constitoast o f cytoskeLaion. nucleotide and ATP binding
Protein folding, component o f post-transduction processing
Structural comtituant o f cytoskeleton: P-tubulin, microtubule, and
unfolded protein binding
Signal transduction factor, binding topJwsphoserine-containing
proteins
Proirfflammatory cytoMnes
Activation and racntitmaEt o f pdymorpboxnadaar leukocytes, acute
phwt# factor aim irmrnsm as tnacticgslMiM ™flamfln*trwv pmtain-1 n.
(M IP-la)
Stimulation o f proliferation anHi
on o f mveloid cells (T
call lineage commitment): B-oell stimulatory factor-2
Stimulation and maitrtaramca c f Tui cdlular immune responses
A
A
2FX-?
Interferon gamma
SPP1
Osteopontin
SLCJIjU
Solute earner family
11A1;
NRAMP1
Nucleotide-binding
oligomerization
domain-containing
protein 2
XOD2
Stimulation o f cell-mediated immunity, critical for innate and
adaptive immunity against viral and intracellular bacterial infections.
macrophage-activating factor
Fatly T -cell activating factor
Others
Membrane solute earner family 11 A l transporter (proton-coupled
divalent metal icon transporters). Also knntvn at N'natural resistanceasjociated macrophage protein 1 (NRAMP 1)
Intracellular pathogen sensor through pattern recognition receptor tor
the recognition o f molecules ccaflamng the specific structure called
muramyl dipeptide •'MDP) found in certain bacteria
:F.ntrezGene; National Center for Biotechnology Infom aticrt.
Table 1. Gene symbols, names, and main biological functions of the genes
43
For normalization, the expression of four housekeeping genes was analyzed. The two most
stably expressed genes were PP1A and UXT in all the experimental conditions except for
the LPS challenge, in which ACTB and YWHAZ were less affected by the treatment (data
not shown). Using the geometric means of the threshold value (CT) of the two most stable
genes, fold change following stimulation was quantified. The level of gene expression in
MDMs after stimulation with MAP, MDP, LPS, or DNA was analyzed according to the
SPP1 genetics (i.e., H lxH 4 group vs. H2xH3 group). In macrophages from the H2xH3
cows, the OPN gene showed a sustained level of expression after stimulation with live
MAP (P = 0.05) compared with the H lxH 4 macrophages (Figure 4A). Stimulation with
MDP, an elementary constituent of bacterial peptidoglycan, also showed a tendency for a
higher level of the OPN gene at 14 h (P = 0.06). The genetics of the macrophages also
influenced the expression of the proinflammatory IL-6 gene, given that the IL-6 level in
MAP-infected H2xH3 cows was more than twice the level in H lxH 4 macrophages
(Figure 4B). However, it was interesting to observe a different pattern for NOD2, the major
sensor of MDP. The level of NOD2 in H lxH 4 was generally higher than the level measured
in the H2xH3 macrophages. Although stimulation with LPS induced much more variability
for most of the genes (data not shown), NOD2 was significantly induced in LPS-treated
macrophages from the H lxH 4 cows, and the expressed NOD2 level remained high in these
cells at 24 h (P = 0.02). The impact of the H lxH 4 genetics on the NOD2 level was also
observed with other agents, given that a tendency was observed following stimulation with
DNA at 14 h (P = 0.07) and MDP at 1 h (P = 0.07) (Figure 4C).
H2 x H3
a H I x H4
4ca
>
o
12
o
&:
00
ADN
MDP
Time post-induction (h)
MAP
44
B
900
400
800
700
<U
00
c
10
■ H2 x H3
350
■ H I x H4
300
600
250
500
200
75
400
300
200
100
u
LPS
150
100
50
i i
14
14
24
24
1
i
ADN
14
MDP
24
14
24
MAP
Time post-induction (h)
40
35
■ H2 x H3
30
©
■ HI x H4
25
20
22
o
LL.
CM
Q
o
15
10
Li
6
ADN
MDP
.. .1
14
24
MAP
Tim e p o st-in d u ctio n (h)
Figure 4 Expression of immune genes following MAP-infection or in response to bacterial
wall stimuli in bovine monocyte-derived macrophages. The macrophages were treated with
DNA, lipopolysaccharide (LPS), muramyl dipeptide (MDP), or Mycobacterium avium
subsp. paratuberculosis (MAP). Expression profiles of (A) the osteopontin gene (SPP1),
(B) the proinflammatory cytokine IL-6, and (C) the intracellular sensor of pathogens
(NOD2) are shown. The mean fold changes shown in the figure represent eight repeated
experiments and were calculated with the 2~AACl method using the untreated control
samples as the calibrator. The error bars represent the standard error of the mean (±SEM),
and significant fold changes are denoted by asterisks (*P < 0.07, **P < 0.05).
45
Prom oter activities o f bovine SPP1 haplotypes
Experiments were performed to determine whether the genotype of the promoter influences
the activity of the OPN gene. The three most common haplotypes of the promoter in the
Holstein bull population were compared using the firefly reporter in vitro assay. Transient
transfections were performed on two bovine cell lines (BoMac macrophages and MAC-T
epithelial cells; Figure 5 A and B, respectively) and using the human MCF7 mammary
epithelial cell line (Figure 5C) broadly used in gene reporter assays. The allele H l-G CG
generally had a stronger activity for all cell lines (P < 0.01). The H2-GTA promoter in the
human MCF7 (Figure 5C) showed weaker activity than did the allele H3-ACG (P < 0.001).
b
a
c
mock
Figure 5 Promoter activities of the haplotypes of the osteopontin gene. The Hl-GCG, H2GTA, and H3-ACG promoters were cloned in the luciferase reporter vector and were co­
transfected with pTK-RL (internal control vector reporting Renilla for transfection
normalization) into (A) BoMac, (B) MAC-T, or (C) MCF7 cells. The relative promoter
activities (Luc/Ren) of each variant are the means of six to nine independent transfections.
Bars indicate standard error. Means without a common superscript letter differ from each
other at the 5% level of significance.
The section of the 5' untranslated region (5TJTR) of the promoter corresponding to the first
intron and containing the third SNP (SPPIc.-430G>A) was measured. The presence of this
SPPlc.-430G>A polymorphism did not influence the activity of the promoter, given that
both alleles (intron-SPPlc.-430G and intron-SPPlc.-430A) generated similar Lu c/Ren
signals (Figure 6). The upstream section of the promoter containing the SNPs SPPlc.-
46
1301G>A and SP P lc.-l2 5 lC > T was responsible for the different activity observed
between the haplotypes, as seen with the truncated promoters (Hl-GC, H2-GT, and H3AC; Figure 6).
40,00
■ MacT
35,00
□ BoMac
ti
30,00
nj
25,00
>
<D
2
20,00
^
15,00
0)
>
4->
10,00
23?
£
5,00
0,00
Hl-GC
H2-GT
H3-AC
IL
H-xxG
H-xxA
pGL4.10
Figure 6 Analysis of the functional impact of single-nucleotide polymorphisms present in
the regulatory region. The Hl-GC, H2-GT, and H3-AC sequences (upstream region from
the transcription initiation site), the two introns (H-xxG for SPPlc.-430G and H-xxA for
SPPlc.-430A), and the empty pGL4-basic vectors were co-transfected with pTK-RL
(internal control vector reporting the Renilla luciferase gene) into MAC-T cells (dark
column) or BoMac cells (light column). The relative promoter activities (Luc/Ren) of each
variant are the means of six independent transfections. Bars indicate standard error.
Probability values of *P < 0.05 and **P < 0.005 were considered significant.
Structural analysis and regulation o f the SPP1 prom oter
The sequences of the three haplotypes were analyzed in silico to identify TF motifs that
could potentially be affected by the genotype. The TF binding motifs co-located with the
DNA polymorphisms are presented in Table 2. Several putative TF binding motifs were
found in the vicinity of the respective SNP of the haplotype, namely SPPlc.-130JG>A,
47
SPPIc.-1251C>T, and SPPlc.-430G>A. Among those abolished by the presence of a
single variation at the SPPlc.-1301G>A location, Ikaros was tested in co-transfection using
the luciferase reporter assays. The presence of Ikaros increased the SPP1 promoter activity
in bovine epithelial cells but not significantly in macrophages (Additional File 4).
■ H l-G C C
O H 2 -G T A
« H 3 -A C G
•a£0
qi
80
f
1
-
1
s&
A m o u n t o f Ikaros TF (ng)
B
0 .5
■ H l-G C G
O H 2-G T A
0 .5
O H 3-A C G
0 .4
^
>
■ p G L 4 .1 0
0 .4
33
O
«
0 .3
I
E
o
0 .3
O
>
02
O.
33
JO
of
O
02
0.1
0.1
0.0
0
10
25
50
10O
A m o u n t o f Ik a ro s TF (n g )
Additional file 4 Analysis of the influence of the transcription factor Ikaros on the H lGCG, H2-GTA, and H3-ACG promoters on two different cell lines. The promoter vectors
were co-transfected with pTK-RL (internal control vector harbouring Renilla luciferase
gene) in the absence or presence of 10 to 100 ng of Ikaros expression vector in (a) MAC-T
or (b) BoMac cells. The relative promoter activities of each variant are the means of four
independent transfections. Bars indicate standard error. P-values of *P < 0.05 were
considered significant.
48
No differential increase was observed among the haplotypes, as a greater technical
variability was detected with increased amounts of Ikaros. For SPPIc.-1251C>T, among
the three predictive TF binding motifs abolished when the reverse genotype of the sequence
was submitted to the search engine, the SP1 factor was tested because the presence of
polymorphisms in this GC-box motif was shown to influence DNA binding (Ordovas et al.,
2008; Larsson et al., 2009) and the transcriptional activity of the human OPN gene (SPP1)
promoter (Giacopelli et al., 2004). Co-transfection assays were carried out in the presence
of the TF SP1. The co-transfection experiments with SP1 resulted in a relative increase of
promoter activity from all the haplotypes (Figure 7). The presence of SP1 induced however
a higher activation of the F12-GTA allele measured as a percentage of increase compared
with the basal relative luciferase activity (i.e., in the absence of SP1). Although not always
significant in BoMac because of high technical variability with this cell line (Figure 7A),
the increase was significant in both epithelial cells (Figures 7B and C).
140
120
&
£o
100
<
»<o
e0
at
O'
T3
at
oc
H1-GCG | H2-GTA | H3-ACG
H l-G C G | H2-GTA | H3-ACG
H l-G C G | H2-GTA | H3-A CG
BOMAC
MACT
MCF7
Figure 7 Analysis of the functional impact of the transcriptional factor SP1. The Hl-GCG,
H2-GTA, and H3-ACG promoter variants were co-transfected with pTK-RL (internal
control expressing the Renilla luciferase gene) alone (light column, left axis) or with the
SP1 expression vector (dark column, right axis) into BoMac, MAC-T, or MCF7 cells. The
relative promoter activities (L.\\dReri) of each variant in the presence of SP1 are the means
of nine independent transfections. The percent increase in the activity of the promoter
variant in the presence of SP1 is calculated using the mean value of the respective variant
measured in the absence of SP1. Bars indicate standard error. Means within a cell-line
assay differ from each other at the 5% level of significance.
49
Discussion
Different roles have been attributed to OPN, including cytokine/chemokine-like associated
with monocyte attraction to the inflammation sites, stimulation of cell adhesion and
migration, and promotion of cell survival. We previously reported that the OPN gene was
found to be highly expressed in the early stage of bovine mammary-gland infection. A
genetic study made on 567 bulls revealed that SNPs in this gene are associated with milkproduction traits and the level of somatic cells in milk (Alain et al., 2009). The somatic-cell
score in milk is a parameter used to estimate the breeding value of udder health, basing
genetic selection on this functional criteria to assess susceptibility to cow mastitis
(Pritchard et al., 2013). Our study investigated the functional impact of the SNPs located in
the promoter and confirmed that they affect the activity of the OPN gene promoter.
Past genetic studies suggested that quantitative trait loci on bovine chromosome 6 are close
to OPN location. The association was confirmed using microsatellite markers, specifically,
a polymorphic variant in intron 4 (Leonard et al., 2005) and the Tn motif OPN3907 marker
(Schnabel et al., 2005). No causative mutation was found, leading the authors to conclude
that these markers were associated with other functional DNA polymorphisms. These SNPs
were not found to be polymorphic in our population. Interestingly, however, by sequencing
the OPN gene (SPP1) from 100 bulls selected for extreme breeding values, three SNPs
were identified in the SPP1 promoter (Alain et al., 2009). Two are located in putative
functional motifs within the first 100 bp upstream from the transcription initiation site.
These SNPs— by opposition to OPN3907 SNP, which is located at -1238 nt upstream to
the transcription start site—are more likely to be functional markers of the OPN gene. The
third SNP, SPPlc.-430G>A, is located in the first intron, a sequence with demonstrated
transcription activity (Figure 6). This intron, conserved in other species, also induced
transcription of the human (Giacopelli et al., 2004) and porcine (Murani et al., 2009) genes.
The intron’s transcriptional activity was attributed to the C/EBP beta-responsive motif,
which is important because a polymorphism identified in this binding motif affected the
expression of the porcine OPN gene in vivo (Murani et al., 2009). The bovine SPPlc.430G>A is +289 nt downstream from the C/EBP beta TF motif (Alain et al., 2009), which
might explain why this SNP did not influence the activity of the bovine promoter
50
(Figure 6). The SNPs SPPJc.-J301G>A and SPPlc.-J251C>T are respectively located
-125 and -7 5 nt upstream from the transcription start site (according to GenBank accession
no. AY878328) within a genomic region containing essential elements for the
transcriptional activity of the OPN gene (Giacopelli et al., 2003). This bovine region is
highly similar to the human sequence and conserved among species [additional file 5]. In
bovine cells, the H1_GCG allele of the OPN promoter was more active, and the H2_GTA
allele was more responsive to the SP1 factor. The impact of a polymorphism in the SP1
binding motif present in the promoter of the OPN gene was also confirmed in another
study. In particular, the human C>T polymorphism is colocated with SP P lc.-l251C > T in
the SP1 binding motif [additional file 5] and affected SP1 binding (Giacopelli et al., 2004),
suggesting that genetic variations in this regulatory region are functional markers.
C A A A A CC AGA GOOOO AAQTO TGOOA OC AAQTOO OC TOOGC AOTGOC AXAA A- A C C T C A T O A C A C A - T C T C T C C G C C T C C C T Q T O T T G O T G Q A O O A T O T C T O Q A O
140___________ 150__________ t£ 0 ___________ 170___________ 180___________ 190_________ Z^OO___________ 210I T \
’
H um an6
C him p1
Su*Sc*
Cant* l*
220___________ ^
_________
JA A G TG G G C TG G G TA G TG G CA A A A T- G C C C C A T GA CA < i- TC T C T C C G C C *
G T GT A GOT GGA GA OCA T CT GGA G
CAAAACCAGAGGGGGAAGT GTGGC
:AGOT GGG CTG G G C A O T OGCAG AAA- A C C T C A T GA CA < iA T CT CT C CG CC T C
( : 5' O TG TT G G T G G A G G A T G T C T G C A G
iA GOT GGGCT GGGCA OT GOCAGAAA* A C C T C A T GACAl kATCT CT C CG CC T i
GT G TT G O T G 0A G G A T OT CT GCAG
C AAAA CCAGA GGGGO AAGTG TGOC
GT GT T GOT G G C G G A TG T CT GO T O
TCTCTCCGCCCAAAACCAGAGGGGGAAGTGTGGG*JC|C)A
j AGTGGG TT GGGCAGT OGCACAA- - A C C T C A T GACA<
iAG T GGG TT GGGCAGT G G C AA AAAAA CC T C A T GACA<
TTTCTCCGCCTi
GT GT T GOTGGAGA A T GT CT GGA G
C AAAA CCAGA AGGGG AAGTG TGGC
caaaaccagagggggaaotgtggg
c: :•
c:
Additional file 5 Alignment of the promoters of different mammal species: Bos taurus,
Homo sapiens, Pan troglodytes, Sus scrofa, and Canis lupus familiaris. The bovine
polymorphisms SPPlc.-1301G>A and SPPlc.-1251C>T are highlighted (boxes) and are
respectively positioned at 5,025 and 5,075 according to GenBank accession
No. AY878328.1. The human C/T single-nucleotide polymorphism (SNP) highlighted in
red was shown to abolish transcription factor SP1 binding (Giacopelli et al., 2004). The
putative SP1 transcription binding motif [atctctccGCCCcct (+)] is in brackets. The
sequences from the different species were aligned using Meg Align software (DNASTAR
suite), and the region of the promoter encompassing the SNPs SPPlc.-1301G>A and
SPPlc.-l251C> T is shown. The sequences were aligned using MegAlign software
(DNASTAR suite) according to their reference number: Com plem ent of nt 5,000-5,100 of
GenBank accession No. AY878328.1 .C om plem ent of nt 2,133-2,235 of GenBank
accession No. D 14813.1 Com plem ent of nt 90,230,358-90,230,457 of GenBank accession
No. NC 006471.3.Com plem ent of nt 2,480-2,579
of GenBank
accession
No. M 84121.Com plem ent of nt 11,354,019-11,354,121 of GenBank accession No.
NC 006614.3.
The importance of these functional markers was also validated by in vivo studies as the
amount of OPN secreted into milk was associated with cow OPN genetics (S P P l). The
cows carrying haplotype H lxH 4 produced higher milk yields (P < 0.04; Figure 1), to some
51
extent, and secreted more OPN in late lactation (Figure 3c). Although overall milk yield
during 40 wk of lactation did not differ between the groups (P = 0.776), a difference was
occasionally measured for H lxH 4 cows. These H lxH 4 cows carry the GCG promoter, but
the alleles HI and H4 have, respectively, the genotypes SPPlc.*40A and SPPlc.*40C.
Nevertheless, these H lxH 4 cows secreted more OPN during late lactation than
homozygous HI or H2xH3 cows. As suggested in a previous study (Alain et al., 2009),
SPPlc.*40A>C may influence binding factors like NF-AT, whose binding motif is
colocalized with this SNP. While NF-AT promotes cell proliferation and the expression of
inflammatory cytokines, it also plays varied roles outside of the immune system (Nilsson et
al., 2008), including regulation of OPN expression (Nilsson-Berglund et al., 2010).
Alternatively, a more general mechanism such as microRNA may affect transcript stability,
yet SP P lc.*40C cannot solely explain the phenotypic observations because this SNP is also
found in the H2 allele. Accordingly, neither the promoter activity nor the presence of
SPPlc.*40C polymorphism in the 3’UTR of the H4 allele can account for the phenotypic
observations in the H lxH 4 cows. Therefore, studying the TF interactions in the biological
tissue is definitively a more accurate way to study the influence of the genetics on gene
expression and on the level of OPN secreted into milk. A study using a larger population or
including only homozygous cows would be easier to interpret. That notwithstanding, the
identification of homozygous cows is challenging, because some haplotypes are barely
represented in the population. For example, only 4 cows out of 100 had this H4 allele,
which can be explained by the low prevalence (5%) of this allele in the Holstein population
(Alain et al., 2009).
The next question addressed was therefore whether the different haplotypes of the SPP1
gene could influence immune response. As the amount of OPN secreted into milk was only
higher for the H lxH 4 cows (Figure 3c), this group’s immune response was compared to
that of the H2xH3 cows, which had genetics associated with an EBV for SCS (refer to
Table 6 from a previous publication (Alain et al., 2009)). Dairy cows with H2xH3 genetics
were then associated with poorer udder health. Our study showed that H lx H4 cows
associated with a reduced level of somatic cells in milk (e.g. lower EBV for the SCS) were
associated with a higher OPN level in milk. This suggests an inverse correlation between
the OPN milk level during late lactation and the EBV for SCS, with a lower SCS and an
52
elevated OPN level being favorable. Increased OPN levels in milk during late lactation may
be beneficial, because OPN can opsonize bacteria and enhance phagocytosis (Schack et al.,
2009). The positive impact of the SPPI genetics on the immune system was also observed.
Our study did not restrict analysis of the immune response to the stimulating agent in
mammary-gland infection. Osteopontin is also involved in other pathogen responses,
including facilitating the clearance of intracellular pathogens. Knockout mice (OPN -/-) are
more susceptible to intracellular pathogens such as Listeria monocytogenes (Ashkar et al.,
2000). In the genome, the site of Rickettsia resistance colocalizes with the OPN gene
(Patarca et al., 1993). The genetic susceptibility of dairy cows to intracellular pathogens has
also been reported. Interestingly, mutations in the NOD2 gene were reported to be
associated with genetic susceptibility to Johne’s disease (Pinedo et al., 2009). NOD2 is an
intracellular pathogen sensor, in particular, MAP, which is the causative agent of Johne’s
disease in cattle. In our study, we observed that NOD2 from the H lxH 4 macrophages was
more inducible after stimulation with almost all agonists, although significant variations
were observed in this assay.
Interestingly, the study of the IL-6 gene, a proinflammatory factor associated with chronic
enteric inflammation (Mudter and Neurath, 2007) and granuloma formation, revealed that
cow SPPI genetics affect the expression level of IL-6 in MAP-infected macrophages. The
ability to mount and sustain a mycobacterial-induced granulomatous response is severely
compromised by IL-6 deficiency (Abbott et al., 2011). It was thus interesting to observe
that SPPI genetics influenced both SPPI and IL-6 expression. The IL-6 gene was
approximately 10 times more induced in the H2xH3 than in the H lxH 4 macrophages
infected with MAP (Figure 4b), which was also associated with a sustained level of the
OPN gene (Figure 4a). These findings suggest a role for SPPI genetics in controlling this
proinflammatory IL-6 cytokine response and, potentially, in regulating granuloma
development.
The pattern of MDP stimulation was, however, different from MAP. The IL-6 expression
was promptly induced by MDP at 1 h and was not sustained later on. Similar results were
observed with other genes, such as TNF-a and IL-10 (data not shown). These observations
are intriguing, given that MDP is an agent used to mimic the mycobacterial membrane. The
53
expected pattern of immune response would be therefore similar if we assumed that
MDP— a gram-positive peptidoglycan— were recognized by NOD2 (Pauleau and Murray,
2003). This is, however, a controversial assumption, because MDP shares the same
signaling pathways required for the
LPS-induced
(gram-negative)
production
of
proinflammatory cytokines (Windheim et al., 2007). The different expression profiles in
response to MAP or MDP stimulation may, in turn, be attributed to the fact that MDP does
not become internalized, whereas live MAP does. MDP transfection was attempted but
unsuccessfully (Pauleau and Murray, 2003). The delivery of NOD2 agonists within
macrophages without any concomitant stimulation of a Toll-like receptor remains a
complex technical challenge, although the pattern was more defined for some agonists. For
instance, the endotoxin-free DNA agent— a Toll-like receptor 9 agonist— stimulated
NOD2, whereas the induction of IL-6 was clearly not sustained. Interestingly, NOD2 was
found to be affected by the cow’s genetics, being more abundant in the H lxH 4
macrophages despite the great variability measured for this gene.
Notwithstanding the limited scope of our understanding of the specific response of
macrophages to NOD2 or Toll-like receptor agonists, analysis of the immune response of
macrophages derived from different SPPI genetics makes it possible to identify
inflammatory genes affected by OPN variants. Macrophages are at the interface between
innate and adaptive immunity, and it is now clear that they direct different classes of
immune responses. Osteopontin, a Thi cytokine, is upregulated in relation to the severity of
chronic disease (Ashkar et al., 2000), considered as a biomarker of Crohn’s disease
(Neuman, 2012), and associated with genetic susceptibility to this disease (Glas et al.,
2011). In our study, both IL-6 and SPPI were found differentially expressed following
MAP
infection,
which
is
the
causative
agent
of
Johne’s
disease
(or
bovine
paratuberculosis). Similarities between Johne’s and Crohn’s diseases have been reported.
These findings on the genetic impact of the OPN gene on the immune response to MAP
infection provide insight into the unique interactions between host macrophages and
mycobacteria. The strategy of identifying host genes altered by infection and whose
expression is linked to animal genetics can provide valuable information for targeting
improved disease resistance in genetic selection.
54
Conclusions
The plasma OPN concentration was not influenced by the cow genetics for the OPN gene
(SPPI) and, with the exception of the peripartum period, levels were very similar
throughout lactation. The OPN in milk, in turn, increased during later lactation and the
level was associated with the SPPI genotype, since the H lxH 4 cows secreted higher OPN
amounts into milk. Interestingly, the promoter from both H 1 (GCG) and H4 (GCG), which
corresponds to the HI-GCG haplotype, had the highest activity in functional studies. Under
the condition of infection with the causative agent of Johne’s disease, however, the
expression level of SPPI in the H2xH3 macrophages was sustained, while the
proinflammatory IL-6 increased, suggesting a putative influence of both genes on
granuloma development. The importance of gaining insight into the unique interactions
between host macrophages and mycobacteria was shown. The strategy of identifying host
genes that are altered by infection and whose expression is linked to animal genetics can
provide valuable information for targeting improved disease resistance in genetic selection.
Methods
Animals and experimental procedures
For this study, 15 multiparous cows were selected from the local herd based on their SPPI
genetics, given haplotype H 1-H4 according to a previous study (Alain et al., 2009). The
cows were placed in groups of five based on their genotype (HlxH4, H2xH3, or H lx H l),
which is also associated with the estimated breeding value (EBV), assessed as high (HlxH4),
low (H2xH3), or average (H lx H l) for the somatic cell score (SCC) trait. In the H2xH3
group, one cow died during wk 30 of the study, and one cow was discarded because its milk
contained millions of somatic cells per milliliter, in association with a chronic infection.
Consequently, results from four H2xH3 cows were analyzed until wk 30, whereas data from
that period until the end of the lactation period were available for three cows in that group.
The partly mixed feed ration contained hay, corn, grass silage, and minerals, supplemented
with concentrates to meet the energy requirements of the cows based on milk production of
38 kg/d for the first 180 lactation days and then 28 kg/d until the dry period. The diet was
offered once daily in sufficient amounts for ad libitum intake. Water was freely available at
55
all times. After parturition, the cows were milked twice a day according to the regular
management of the herd. During each milking, milk yield was recorded with electronic
milk meters (MU480; DeLaval Inc., Kansas City, MO, USA) and input electronically
(DelPro software, version 3.5; DeLaval International AB, Tumba, Sweden). One-way
analysis of variance (ANOVA) was performed to compare the three groups. Blood and
milk (daily composite samples from the four quarters) were collected each week throughout
the lactation period. The cows were housed at Agriculture and Agri-Food Canada’s Dairy
and Swine Research and Development Centre (Sherbrooke, QC, Canada), and the animals
were used in accordance with Canadian Council on Animal Care guidelines.
Sample collection and treatment
Osteopontin concentrations were measured by ELISA. The milk was centrifuged at
3,500 x g and 4°C for 15 min, after which the fat fraction was discarded, and the milk was
then further centrifuged at 21,460 x g and 4°C for 60 min. Aliquots of the supernatant were
kept at -80°C until analysis. Blood was collected in 10-mL evacuated blood collection
tubes containing EDTA. The samples were then centrifuged at 1,800 x g and 4°C for
15 min. The plasma was aliquoted and stored at -80°C. Before analysis, the samples were
thawed on ice. The plasma samples were either used directly in ELISA assays with or
without protease inhibitors or heated at 95°C for 3 min to denature the proteins and
proteases prior to analysis. Following denaturation, the clots were broken up with the tip of
a pipette and then centrifuged at 21,460 x g and 4°C for 1 h. The supernatants were
analyzed by ELISA.
SDS-PAGE and immunodetection
Acrylamide gels (Bio-Rad Laboratories Ltd., Mississauga, ON, Canada) were used to
perform SDS-PAGE according to the Laemmli method (Laemmli, 1970) under reducing
conditions. The samples were run along with the molecular weight marker Precision Plus
Protein All Blue Standard (Bio-Rad Laboratories Ltd.). The proteins were transferred onto
Immun-Blot PVDF membranes (Bio-Rad Laboratories Ltd.). The membranes were blocked
overnight with Tris-buffered saline (150 mM NaCl, 10 mM Tris-HCl [pH 7.4]) containing
0.1% (vol/vol) Tween 20 (TBST) and 3% (wt/vol) bovine serum albumin (BSA) blocking
56
reagent (BioShop Canada Inc., Burlington, ON, Canada). The membranes were then
incubated for 1 h at room temperature in TBST-BSA buffer containing the primary
antibody. The membranes were washed three times for 5 min in TBST and incubated in
blocking buffer with the secondary antibody at room temperature for 1 h, after which they
were washed five times for 5 min before revelation. The primary antibodies, MAB193P
(Maine Biotechnology Services, Inc., Portland, ME, USA) and custom-made bOPN-117
(Bissonnette et al., 2012), were diluted 1:1,000 and 1:500, respectively. The monoclonal
antibody MAB193P recognizes one epitope located within the N-terminal part of the OPN
protein, and epitopes corresponding to the polyclonal antibody bOPN-117 are located in the
carboxyl extremity of the protein (Bissonnette et al., 2012). These primary antibodies were
detected by, respectively, the ECL anti-mouse (NA931V) and the anti-rabbit (NA934V)
IgG horseradish peroxidase-linked whole antibodies (GE Healthcare Bio-Sciences Inc.,
Baie d ’Urfe, QC, Canada), diluted 1:10,000 in blocking solution. The proteins were
revealed using ECL Plus Western Blotting Detection Reagent (GE Healthcare Bio-Sciences
Inc.). Images were analyzed using an Alpha Innotech FluorChem SP imaging system (Cell
BioSciences, Toronto, ON, Canada).
Sandwich ELISA analysis
The milk and plasma samples were analyzed by ELISA using 96-well ELISA plates
(Greiner Bio-One North America, Inc., Monroe, NC, USA) coated with commercial
monoclonal antibody MAB193P (anti-human OPN) diluted 1:1,000 in a coating buffer
(0.05 M Na2C 0 3 buffer [pH 9.2]), sealed, and incubated overnight at 4°C. The plates were
washed twice with the washing buffer (PBS [pH 7.4] containing 0.05% Tween 20).
Blocking solution (PBS [pH 7.4] containing 1% fish skin gelatin) was added, and the plates
were incubated at 37°C for 90 min. After this incubation, the wells were washed three
times. Following the final wash, 100 pL of either the trial or standard curve sample was
loaded. Duplicates of the standard curve were run for every plate and made with the
commercial OPN (bOPN, cat. No. 109-OP-050/C; R&D Systems, Inc., Minneapolis, MN,
USA) appropriately diluted in the blocking solution, which was also used for blanks. Next,
the plates were incubated at 37°C for 90 min and then washed three times. Subsequently,
the polyclonal antibody bOPN-121 (Bissonnette et al., 2012) diluted 1:500 in blocking
57
buffer was added and plate-incubated at room temperature for 2 h. Following the washing
step, a solution containing the horseradish peroxidase-coupled antibody (anti-rabbit IgG,
NA934V; GE Healthcare Bio-Sciences Inc.) diluted 1:10,000 in blocking buffer was added,
and incubation was carried out at room temperature for 90 min. Following the final wash,
the substrate, TMB Microwell Peroxidase Substrate (KPL, Inc., Gaithersburg, MD, USA),
was incubated for 10 min, and an equivalent volume of stopping solution (2.0 M H2SO4)
was added. The plates were read at 450 nm using a SpectraMax Plus384 microplate reader
(Molecular Devices, LLC, Downingtown, PA, USA). Statistical analysis was performed
using the MIXED procedure of the SAS software package (version 9.2; SAS Institute Inc.,
Cary, NC, USA). The trapezoidal method for the area under the curve was used to
determine the significance of the differences.
M onocyte isolation, culture o f bovine m onocyte-derived macrophages, an d stim ulation
For peripheral immune cell isolation, 350 mL whole blood was collected per cow in a
blood collection bag containing acid citrate dextrose buffer (cat. No. 108962; CDMV, StHyacinthe, QC, Canada). Peripheral blood mononuclear cells (PBMC) were isolated from
the buffy coat fractions of the peripheral blood and further purified by density gradient
centrifugation with Ficoll-Paque Plus medium (VWR International LLC, Ville Mont-Royal,
QC, Canada) as described previously (Alain et al., 2009). Isolated PBMC were resuspended
in RPMI 1640 supplemented with IX L-glutamine, sodium bicarbonate, and HEPES
(Wisent Inc., St-Bruno, QC, Canada). The monocytes were isolated by adherence as
described previously (Zhou et al., 2012) with minor modifications. Cells were seeded at
5 x 106 in a 6-well flat-bottom plate containing complete medium consisting of RPMI 1640
(Wisent Inc.) supplemented with 10% heat-inactivated bovine heterologous serum (pooled
from all cows) and IX antibiotics and antifungals (Wisent Inc.) at 39°C with 5% CO 2 in a
humidified atmosphere. The cells were incubated for 2 h to allow the monocytes to attach.
Then, the adherent cells were washed twice using pre-warmed RPMI 1640. Following 18 h
of incubation (d 1), the cells were washed twice to remove any non-tightly adhered cells,
and the medium was replaced with 2 mL fresh antibiotic-containing medium with 10%
heat-inactivated fetal bovine serum (FBS; Wisent Inc.). The identity and purity of the
monocytes was confirmed to be greater than 98% by flow cytometry (data not shown)
58
using an anti-CD 14 Pacific Blue-labeled antibody as described previously (Taraktsoglou et
al., 2011). The cells were then incubated with RPMI 1640 containing 10% FBS at 39°C in
5% CO2 for 8 to 10 d to reach 80%-to-90% confluent monolayers. The monocyte-derived
macrophages (MDMs) displayed the characteristic macrophage morphology, which was
confirmed by flow cytometry using the Monoclonal Mouse Anti-Human CD68 antibody
(Cedarlane, Burlington, ON, Canada). More than 98% of the MDM cells were CD68positive (data not shown). The MDM were used for the in vitro challenge experiments.
Preliminary assays using different multiplicities of infection for Mycobacterium avium ssp.
paratuberculosis (MAP, field strain 39382, 10:1 or 100:1), muramyl dipeptide (MDP, 10 or
100 pg/mL medium; Cedarlane), LPS (0.1 or 1 pg/mL; Cedarlane), or DNA (2 or
10 pg/mL, endotoxin-free DNA from Escherichia coli K12; Cedarlane) were carried out.
Selection of the dose was initially based on previously described stimulations of bovine or
human macrophages with LPS (Adler et al., 1995; Taraktsoglou et al., 2011), DNA
(Trevani et al., 2003; Talati et al., 2008), MDP (Yang et al., 2007; Hedl and Abraham,
2011), and MAP (Park et al., 2011). The following conditions were selected as the minimal
dose to induce the expression of IL-6, IL-10, and tumor necrosis factor-alpha (TNF-a):
MAP, multiplicity of infection of 10:1; MDP, 10 pg/mL; LPS, 100 ng/mL; and DNA,
2 pg/mL. Prior to MAP infection, the cells were incubated in antibiotic-free medium for
24 h. Because no fluctuation was observed for the no-treatment controls, only two controls,
the Time 0 and 24-h time points, were kept. The samples were harvested 1, 6, 14, or 24 h
post-treatment. The medium was discarded, and the cells were harvested using 1 mL Buffer
RLT (QIAGEN Inc., Toronto, ON, Canada) added to each well. Biological duplicates were
performed for each cow, including each stimulating agent and each time point.
RNA extraction and real-time quantitative reverse-transcription PCR
The RNA was extracted using the RNeasy kit (QIAGEN Inc.) and reverse-transcribed for
quantitative
reverse-transcription
transcriptase (Life Technologies
PCR
(qRT-PCR)
using
Superscript
II
reverse
Inc., Burlington ON, Canada) according to the
manufacturer’s protocol. The cDNA was then diluted in molecular-grade H 2 O and stored in
multiple aliquots at -20°C for subsequent use. Primers were designed for each gene with
the Primer Express 3 software package (Life Technologies Inc.) using the RefSeq sequence
59
downloaded
from
the
National
Center
for
Biotechnology
Information.
Primer
concentrations ranging from 50 to 900 nM were tested during optimization reactions.
Information about the primer sequence and the amplification efficiency of the PCR for all
tested genes are provided in Additional File 1. The qRT-PCR assays were carried out with
Fast SYBR Green PCR Master Mix in a StepOnePlus real-time PCR system (Life
Technologies Inc.) after denaturation at 95°C for 20 s and amplification during 40 cycles of
denaturation at 95°C for 3 s followed by an annealing/elongation period at 60°C for 30 s.
The expression of four putative reference genes (ACTB, PPIA, UXT, and YWHAZ) was
determined in all samples. The geometrical average of the most stable genes was used as an
internal control for longitudinal gene expression profiling as described previously (Bionaz
and Loor, 2007). The qRT-PCR results were analyzed according to the comparative CT
method, given by the arithmetic formula 2“AACt (Livak and Schmittgen, 2001), and
subjected to ANOVA using the GLM procedure of SAS (version 9.2; SAS Institute Inc.).
Gene name
ACTB
Accession
num ber
NM_173979
Hybridization
F 1051
R 1173
NM_174814
YWHAZ
F 530
R660
PPLi
NM_178320
F 317
R417
NMJXH037471 F 339
UXT
R443
IL6
NM_173923
F 454
R 597
118
NM_173925
F 239
R354
IL12A
NM_174355
F 157
R291
IL18
NM_174091
F 342
R491
NM_174187
SPPI
F 507
R652
ecu
NM_174511
F 129
R 232
JFXG
NM_174086
F 447
R 578
XOD2
NM_001002889 F 2511
R2641
SLC11A1
NM_174652
F 1342
R 1449
Exon-exon junctions ire underlined Other primers
Efficiency
(•/.)
Prim ers
(nM)
Size (bp)
92.43
300300
123
9693
300,300
131
89 02
300300
101
95.71
300300
105
89.35
300 300
144
92 69
300300
116
10345
900300
135
gtctttgaggatatgcctgattctg
gttctcacaggagagagtagacattttc
91.00
300 300
150
aaatgatggccgaggtgatagt
tcttaggtgcgtcatgcatctc
91 87
300300
146
10093
300 300
104
104 62
300 300
132
104.57
300 300
131
96 77
900 50
108
Prim er sequences (5'-3')
TGGCACCCAGCACAATGA
CCTGCTTGCTGATCCACATCT
AATGCAACCAACACATCCTATCAG
gttcagcaatggcttcatcaaat
ATGCTGGCCCCAACACAA
CCCTCTTTCACCTTGCCAAA
TGGC AG AAGCTCTC AAGTTC ATT
CATGTGGATATGGGCCTTGAT
gaaaatgtcagggatttgaggaa
TGCGTTCTTTACCCACTCGTTT
GAGAGTGGGCCACACTGTGAA
ttcacaaatacctgcacaaccttct
acgctacagaaggccagacaa
actctcattcgtggctaattcca
TCTTCTCGGCACCATTTGG
tggtctcaaaatagtcagctacgatt
gattcaaattccggtggatga
cggcctcgaaagagattctg
gcgtctgcaaagctctttacttg
gccatcggtcaacttgttgtt
cctcaacgacctgctcaatgt
ccattggcaaactcctgcat
are located on distinct exons
Additional file 1 Information on primer sequences and parameters for quantitative PCR
analysis. Reference gene target, primer design, concentration, and experimental information
on amplification efficiency for all the primer pairs used in quantitative PCR.
60
DNA constructs
In a Holstein population (n = 587) analyzed in a previous study (Alain et al., 2009), three
SNPs (SPPlc.-1301 G>A, SPPlc.-1251C>T, and SPPlc.-430G>A) were identified in the
promoter of the OPN gene (SPPI). The three alleles of the SPPI promoter, the haplotypes
HI-GCG, H2-GTA, and H3-ACG, were amplified from a homozygous bull using forward
(5'-AGCTGCTGCACACTTGAAACTC-3')
ATGATTTTTCCTGCAAAATATTTTGTAAG-3')
and
primers.
reverse
The
(5'-
1,739-bp
regulating
sequence (-l,7 4 4 /-5 from the start codon; GenBank accession No. AY878328) from each
allele was cloned into the Kpn I and Bgl II restriction sites of the pGL4.10 vector (Promega
BioSciences, Inc., Madison, WI, USA), which is used as a luciferase reporter to monitor the
promoter activity of the OPN gene. The fragments of the first intron (both alleles of the
SPPlc.-430G/A) that contains the third SNP of the haplotype were also cloned in the
pGL4.10 vector, giving the intron-SPPlc.-430G and the intron-SPPlc.-430A constructs.
The transcription factor (TF) SP1 (-8/+2,459) was amplified from bovine mammary gland
cDNA
using
5'-TGCT ACCATGAGCGACC A AG ATC AC-3'
and
5'-
CCTGATCTCAGAAGCCATTGCCA-3' primers (in accordance with GenBank accession
No. NM_001078027), and the restriction HindlH-XhoI fragment was subcloned into
pCDNA3.1(+) (Life Technologies Inc.) under the cytomegalovirus promoter. The human
TF SP3, which is also under the cytomegalovirus promoter, was a gift from Dr. Guntram
Suske (Institute of Molecular Biology and Tumor Research, Marburg, Germany). The TF
Ikaros (plasmid pDNR-hlKZNFl) was purchased from DF/HCC DNA Resource Core
(Harvard Medical School, Boston, MA, USA) and subcloned in pCDNA3.1(+). All
constructs were analyzed for insert size by 1.2% agarose gel electrophoresis and sequenced.
The genotype of each clone was confirmed by sequencing both directions using the ABI
PRISM BigDye Terminator v3.1 Cycle Sequencing Kit in the ABI PRISM 3100-Avant
Genetic Analyzer (Life Technologies Inc.) according to the company’s recommendations.
All DNA constructs were purified using the E.Z.N.A. Endo-Free Plasmid Mini Kit II
(Omega Bio-Tek, Inc., Norcross, GA, USA) from three independent preparations. The
DNA constructs were quantified using an ND-1000 spectrophotometer (NanoDrop
Technologies Inc., Wilmington, DE, USA) and stored at -20°C.
61
Cell culture and transient transfection assays
The human (MCF7) and bovine (MAC-T) mammary epithelial cell lines were maintained
in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with F12 (DMEM/F12;
Wisent Inc.), and the bovine macrophage cell line (BoMac) was cultured in RPMI 1640
(Wisent Inc.). Cells were cultured in the presence of 10% FBS and IX antibioticantimycotic solution at 37°C in a humidified atmosphere with 5% CO 2 . Cells were seeded
at 5 x 105 cells per well in a 24-well plate and transfected at an estimated 50% to 60%
confluence. MAC-T is a transformed bovine mammary epithelial cell line (Huynh et al.,
1991), BoMac is an immortalized bovine macrophage cell line (Stabel and Stabel, 1995),
and MCF7 was obtained from the American Type Culture Collection. Transfections of the
epithelial cells were performed using PromoFectin-Macrophage (PromoCell, Heidelberg,
Germany). For transfection of macrophages (BoMac), the agent PromoFectin (PromoCell)
was used according to the manufacturer’s instructions. Conditions maximizing transfection
efficiency were established at transfection agent/DNA ratios (vol/pg DNA) of 2:1 for both
epithelial cell lines and 3:1 for BoMac. The optimal co-transfection condition for luciferase
(pGL4.10 constructs) and Renilla (pGL4.74/hRluc/TK; Promega BioSciences) was
determined to be a 50:1 Luc /Ren ratio. Some optimization assays are shown in Additional
File 2. Cell lysates were prepared with the Dual-Luciferase Reporter Assay System
(Promega BioSciences), and both luciferase and Renilla activities were determined with a
luminometer (Turner BioSystems Luminometer Model TD-20/20; Promega BioSciences)
according to the manufacturer’s recommendations. The relative promoter activity of each
transfection assay was determined using the luciferase value less the average background
activity of the empty pGL4-basic construct divided by Renilla. The effect of a TF on the
promoter activity was calculated as a percentage of increase in the normalized luciferase
data (fireflyIRenilla) compared with the value measured in the absence of SP1. Each
condition was transfected six to nine times and included three independent plasmid
preparations. Data were submitted to two separate one-way ANOVAs with heterogeneous
variances. Multiple comparisons were carried out with a Tukey correction. Data are
representative of three independent experiments. All analyses were performed using SAS
(version 9.2; SAS Institute Inc.).
62
Abreviations
ANOVA, one-way analysis of variance; EBV, estimated breeding value; ELISA, enzymelinked
immuno
sorbent
assay;
IL-,
interleukin;
EFN-y,
interferon-gamma;
LPS,
lipopolysaccharide; MDM, monocyte-derived macrophage; MDP, muramyl dipeptide;
MAP, Mycobacterium avium subp. paratuberculosis; OPN, osteopontin; SCS, somatic cell
score; SNP, single nucleotide polymorphism; SPPI, secreted phosphoprotein 1; TF,
transcription factor; TNF-a, tumor necrosis factor-alpha; UTR, untranslated region.
Competing interests
The authors have declared that they have no competing interests.
Authors' contributions
PLD participated in the design and carried out the optimizations and osteopontin
quantifications. KA identified the haplotypes and sequenced the constructs. CT participated
in the design and carried out the optimizations of the transfection and the real-time PCR
assays. NB conceived of the study, participated in its coordination and carried out the in
silico analysis. PLD and NB wrote the manuscript. All authors read and approved the final
manuscript.
Acknowledgments
The authors thank Karoline Lauzon for providing technical assistance with transfection and
real-time PCR assays and thank Caroline Roy and Clemence LeCoroller for performing
ELISA. This research was supported by Agriculture and Agri-Food Canada (grant no.
RBPI-1276).
63
References
Abbott, A. N., K. J. Welsh, S. A. Hwang, P. Ploszaj, T. Choudhury, S. Boyd, M. R.
Blackburn, R. L. Hunter, Jr., and J. K. Actor. 2011. IL-6 mediates llbetaH SD type 2 to
effect progression of the mycobacterial cord factor trehalose 6,6'-dimycolate-induced
granulomatous response. Neuroimmunomodulation 18(4):212-225.
Adler, B., H. Adler, T. W. Jungi, and E. Peterhans. 1995. Interferon-alpha primes
macrophages for lipopolysaccharide-induced apoptosis. Biochem. Biophys. Res. Commun.
215(3):921-927.
Alain, K., N. A. Karrow, C. Thibault, J. St-Pierre, M. Lessard, and N. Bissonnette. 2009.
Osteopontin: an early innate immune marker of Escherichia coli mastitis harbors genetic
polymorphisms with possible links with resistance to mastitis. BMC Genomics 10:444.
Ashkar, S., G. F. Weber, V. Panoutsakopoulou, M. E. Sanchirico, M. Jansson, S. Zawaideh,
S. R. Rittling, D. T. Denhardt, M. J. Glimcher, and H. Cantor. 2000. Eta-1 (osteopontin): an
early component of type-1 (cell-mediated) immunity. Sciences 287(5454):860-864.
Bionaz, M. and J. J. Loor. 2007. Identification of reference genes for quantitative real-time
PCR in the bovine mammary gland during the lactation cycle. Physiol. Genomics
29(3):312-319.
Bissonnette, N., P. L. Dudemaine, C. Thibault, and G. Robitaille. 2012. Proteomic analysis
and immunodetection of the bovine milk osteopontin isoforms. J. Dairy Sci. 95(2):567-579.
Chiodoni, C., M. P. Colombo, and S. Sangaletti. 2010. Matricellular proteins: from
homeostasis to inflammation, cancer, and metastasis. Cancer metastasis reviews 29(2):295307.
Cho, H. J. and H. S. Kim. 2009. Osteopontin: a multifunctional protein at the crossroads of
inflammation, atherosclerosis, and vascular calcification. Curr Atheroscler Rep 11 (3):206213.
Denhardt, D. T. and M. Noda. 1998. Osteopontin expression and function: role in bone
remodeling. J Cell Biochem Suppl 30-31:92-102.
Giachelli, C. M., D. Lombardi, R. J. Johnson, C. E. Murry, and M. Almeida. 1998.
Evidence for a role of osteopontin in macrophage infiltration in response to pathological
stimuli in vivo. The American journal of pathology 152(2): 353-358.
Giacopelli, F., R. Marciano, A. Pistorio, P. Catarsi, S. Canini, G. Karsenty, and R.
Ravazzolo. 2004. Polymorphisms in the osteopontin promoter affect its transcriptional
activity. Physiol Genomics 20(l):87-96.
Giacopelli, F., N. Rosatto, M. T. Divizia, R. Cusano, G. Caridi, and R. Ravazzolo. 2003.
The first intron of the human osteopontin gene contains a C/EBP-beta-responsive enhancer.
Gene Expression 11(2):95-104.
64
Glas, J., J. Seiderer, C. Bayrle, M. Wetzke, C. Fries, C. Tillack, T. Olszak, F. Beigel, C.
Steib, M. Friedrich, J. Diegelmann, D. Czamara, and S. Brand. 2011. The role of
osteopontin (OPN/SPP1) haplotypes in the susceptibility to Crohn's disease. PLoS One
6(12):e29309.
Hedl, M. and C. Abraham. 2011. Distinct roles for Nod2 protein and autocrine interleukinlbeta in muramyl dipeptide-induced mitogen-activated protein kinase activation and
cytokine secretion in human macrophages. J. Biol. Chem. 286(30):26440-26449.
Heringstad, B., E. Sehested, and T. Steine. 2008. Short communication: correlated selection
responses in somatic cell count from selection against clinical mastitis. J. Dairy Sci.
91(11):4437-4439.
Huynh, H. T., G. Robitaille, and J. D. Turner. 1991. Establishment of bovine mammary
epithelial cells (MAC-T): an in vitro model for bovine lactation. Exp Cell Res 197(2): 191199.
Khan, S. A., A. C. Cook, M. Kappil, U. Gunthert, A. F. Chambers, A. B. Tuck, and D. T.
Denhardt. 2005. Enhanced cell surface CD44 variant (v6, v9) expression by osteopontin in
breast cancer epithelial cells facilitates tumor cell migration: novel post-transcriptional,
post-translational regulation. Clin. Exp. Metastasis 22(8):663-673.
Konno, S., J. A. Eckman, B. Plunkett, X. Li, J. S. Berman, J. Schroeder, and S. K. Huang.
2006. Interleukin-10 and Th2 cytokines differentially regulate osteopontin expression in
human monocytes and dendritic cells. Journal of interferon & cytokine research : the
official journal of the International Society for Interferon and Cytokine Research
26(8):562-567.
Kumura, H., A. Miura, E. Sato, T. Tanaka, and K. Shimazaki. 2004. Susceptibility of
bovine osteopontin to chymosin. J Dairy Res 71(4):500-504.
Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227(5259):680-685.
Larsson, L., P. Johansson, A. Jansson, M. Donati, L. Rymo, and T. Berglundh. 2009. The
Spl transcription factor binds to the G-allele of the -1087 IL-10 gene polymorphism and
enhances transcriptional activation. Genes Immun. 10(3):280-284.
Leonard, S., H. Khatib, V. Schutzkus, Y. M. Chang, and C. Maltecca. 2005. Effects of the
osteopontin gene variants on milk production traits in dairy cattle. J Dairy Sci 88(11):40834086.
Li, X., A. W. O'Regan, and J. S. Berman. 2003. IFN-gamma induction of osteopontin
expression in human monocytoid cells. J Interferon Cytokine Res 23(5):259-265.
Liaw, L., D. E. Birk, C. B. Balias, J. S. Whitsitt, J. M. Davidson, and B. L. Hogan. 1998.
Altered wound healing in mice lacking a functional osteopontin gene (sppl). The Journal of
clinical investigation 101(7): 1468-1478.
65
Liaw, L., M. P. Skinner, E. W. Raines, R. Ross, D. A. Cheresh, S. M. Schwartz, and C. M.
Giachelli. 1995. The adhesive and migratory effects of osteopontin are mediated via
distinct cell surface integrins. Role of alpha v beta 3 in smooth muscle cell migration to
osteopontin in vitro. J. Clin. Invest. 95(2):713-724.
Livak, K. J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402-408.
Mudter, J. and M. F. Neurath. 2007. 11-6 signaling in inflammatory bowel disease:
pathophysiological role and clinical relevance. Inflamm Bowel Dis 13(8): 1016-1023.
Murani, E., S. Ponsuksili, H. M. Seyfert, X. Shi, and K. Wimmers. 2009. Dual effect of a
single nucleotide polymorphism in the first intron of the porcine Secreted phosphoprotein 1
gene: allele-specific binding of C/EBP beta and activation of aberrant splicing. BMC Mol.
Biol. 10:96.
Murry, C. E., C. M. Giachelli, S. M. Schwartz, and R. Vracko. 1994. Macrophages express
osteopontin during repair of myocardial necrosis. The American journal of pathology
145(6): 1450-1462.
Nau, G. J., P. Guilfoile, G. L. Chupp, J. S. Berman, S. J. Kim, H. Komfeld, and R. A.
Young. 1997. A chemoattractant cytokine associated with granulomas in tuberculosis and
silicosis. Proceedings of the National Academy of Sciences of the United States of America
94(12):6414-6419.
Nau, G. J., L. Liaw, G. L. Chupp, J. S. Berman, B. L. M. Hogan, and R. A. Young. 1999.
Attenuated host resistance against Mycobacterium bovis BCG infection in mice lacking
osteopontin. Infect. Immun. 67(8):4223-4230.
Nemir, M., D. Bhattacharyya, X. Li, K. Singh, A. B. Mukherjee, and B. B. Mukherjee.
2000. Targeted inhibition of osteopontin expression in the mammary gland causes
abnormal morphogenesis and lactation deficiency. J Biol Chem 275(2):969-976.
Neuman, M. G. 2012. Osteopontin Biomarker in Inflammatory Bowel Disease, Animal
Models and Target for Drug Discovery. Dig. Dis. Sci.
Nilsson-Berglund, L. M., A. V. Zetterqvist, J. Nilsson-Ohman, M. Sigvardsson, L. V.
Gonzalez Bose, M. L. Smith, A. Salehi, E. Agardh, G. N. Fredrikson, C. D. Agardh, J.
Nilsson, B. R. Wamhoff, A. Hultgardh-Nilsson, and M. F. Gomez. 2010. Nuclear factor of
activated T cells regulates osteopontin expression in arterial smooth muscle in response to
diabetes-induced hyperglycemia. Atertio. Thromb. Vase. Biol. 30(2):218-224.
Nilsson, L. M., J. Nilsson-Ohman, A. V. Zetterqvist, and M. F. Gomez. 2008. Nuclear
factor of activated T-cells transcription factors in the vasculature: the good guys or the bad
guys? Curr Opin Lipidol 19(5):483-490.
O’Regan, A. and J. S. Berman. 2000. Osteopontin: a key cytokine in cell-mediated and
granulomatous inflammation. Int J Exp Pathol 81(6):373-390.
66
Ordovas, L., R. Roy, S. Pampin, P. Zaragoza, R. Osta, J. C. Rodriguez-Rey, and C.
Rodellar. 2008. The g.763G>C SNP of the bovine FASN gene affects its promoter activity
via Sp-mediated regulation: implications for the bovine lactating mammary gland. Physiol.
Genomics 34(2): 144-148.
Park, K. T., A. J. Allen, J. P. Bannantine, K. S. Seo, M. J. Hamilton, G. S. Abdellrazeq, H.
M. Rihan, A. Grimm, and W. C. Davis. 2011. Evaluation of two mutants of Mycobacterium
avium subsp. Paratuberculosis as candidates for a live attenuated vaccine for Johne’s
disease. Vaccine 29(29-30):4709-4719.
Patarca, R., R. A. Saavedra, and H. Cantor. 1993. Molecular and cellular basis of genetic
resistance to bacterial infection: the role of the early T-lymphocyte activation-1/osteopontin
gene. Crit Rev Immunol 13(3-4):225-246.
Pauleau, A. L. and P. J. Murray. 2003. Role of nod2 in the response of macrophages to toll­
like receptor agonists. Mol. Cell. Biol. 23(21):7531-7539.
Pinedo, P. J., C. D. Buergelt, G. A. Donovan, P. Melendez, L. Morel, R. Wu, T. Y.
Langaee, and D. O. Rae. 2009. Association between CARD15/NOD2 gene polymorphisms
and paratuberculosis infection in cattle. Vet. Microbiol. 134(3-4):346-352.
Pritchard, T., M. Coffey, R. Mrode, and E. Wall. 2013. Genetic parameters for production,
health, fertility and longevity traits in dairy cows. Animal : an international journal of
animal bioscience 7(l):34-46.
Qu, Z. and E. L. Chaikof. 2010. Interface between hemostasis and adaptive immunity. Curr
Opin Immunol 22(5):634-642.
Renkl, A. C., J. Wussler, T. Ahrens, K. Thoma, S. Kon, T. Uede, S. F. Martin, J. C. Simon,
and J. M. Weiss. 2005. Osteopontin functionally activates dendritic cells and induces their
differentiation toward a Thl-polarizing phenotype. Blood 106(3):946-955.
Saika, S., K. Shirai, O. Yamanaka, K. Miyazaki, Y. Okada, A. Kitano, K. C. Flanders, S.
Kon, T. Uede, W. W. Kao, S. R. Rittling, D. T. Denhardt, and Y. Ohnishi. 2007. Loss of
osteopontin perturbs the epithelial-mesenchymal transition in an injured mouse lens
epithelium. Lab Invest 87(2): 130-138.
Schack, L., A. Lange, J. Kelsen, J. Agnholt, B. Christensen, T. E. Petersen, and E. S.
Sorensen. 2009. Considerable variation in the concentration of osteopontin in human milk,
bovine milk, and infant formulas. J. Dairy Sci. 92(11):5378-5385.
Schnabel, R. D., J. J. Kim, M. S. Ashwell, T. S. Sonstegard, C. P. Van Tassell, E. E.
Connor, and J. F. Taylor. 2005. Fine-mapping milk production quantitative trait loci on
BTA6: analysis of the bovine osteopontin gene. Proc Natl Acad Sci U S A 102(19):68966901.
Singh, R. P., R. Patarca, J. Schwartz, P. Singh, and H. Cantor. 1990. Definition of a specific
interaction between the early T lymphocyte activation 1 (Eta-1) protein and murine
67
macrophages in vitro and its effect upon macrophages in vivo. J Exp Med 171(6): 19311942.
Stabel, J. R. and T. J. Stabel. 1995. Immortalization and characterization of bovine
peritoneal macrophages transfected with SV40 plasmid DNA. Vet. Immunol.
Immunopathol. 45(3-4):211-220.
Talati, A. J., H. J. Kim, Y. I. Kim, A. K. Yi, and B. K. English. 2008. Role of bacterial
DNA in macrophage activation by group B streptococci. Microbes Infect 10(10-11):11061113.
Taraktsoglou, M., U. Szalabska, D. A. Magee, J. A. Browne, T. Sweeney, E. Gormley, and
D. E. Machugh. 2011. Transcriptional profiling of immune genes in bovine monocytederived macrophages exposed to bacterial antigens. Vet. Immunol. Immunopathol. 140(12): 130-139.
Trevani, A. S., A. Chorny, G. Salamone, M. Vermeulen, R. Gamberale, J. Schettini, S.
Raiden, and J. Geffner. 2003. Bacterial DNA activates human neutrophils by a CpGindependent pathway. Eur J Immunol 33(11):3164-3174.
Wang, K. X. and D. T. Denhardt. 2008. Osteopontin: Role in immune regulation and stress
responses. Cytokine Growth Factor Rev 19(5-6):333-345.
Windheim, M., C. Lang, M. Peggie, L. A. Plater, and P. Cohen. 2007. Molecular
mechanisms involved in the regulation of cytokine production by muramyl dipeptide.
Biochem J 404(2): 179-190.
Yang, Y., C. Yin, A. Pandey, D. Abbott, C. Sassetti, and M. A. Kelliher. 2007. NOD2
pathway activation by MDP or Mycobacterium tuberculosis infection involves the stable
polyubiquitination of Rip2. J. Biol. Chem. 282(50):36223-36229.
Zhou, L., R. Somasundaram, R. F. Nederhof, G. Dijkstra, K. N. Faber, M. P.
Peppelenbosch, and G. M. Fuhler. 2012. Impact of human granulocyte and monocyte
isolation procedures on functional studies. Clin Vaccine Immunol 19(7): 1065-1074.
AVANT-PROPOS DU DEUXIEME ARTICLE
Impaired cell proliferation and increased circulating IFN-y, IL-17 and osteopontin in
bovine paratuberculosis
Auteurs de I’article: Pier-Luc Dudemaine, Gilles Fecteau, Martin Lessard, Olivia
Labrecque, Jean-Philippe Roy et Nathalie Bissonnette
Statut de Particle : Soumis la revue Journal of Dairy Science le 23 mai 2013 et le numero
de soumission est JD S-13-7059
Avant-propos :
L ’article a ete redige par M. Pier-Luc Dudemaine, corrige et ameliore par Mrae Nathalie
Bissonnette et revise par M. Martin Lessard et Jean-Philippe Roy. Au niveau du travail
experimental,
le contenu
integral
a ete effectue par
Pier-Luc,
soit
l’essai
de
lymphoproliferation, le dosage des cytokines plasmatiques, Fisolement et 1’infection des
macrophages in vitro, ainsi que la mise au point et l’analyse du PCR quantitatif.
f n i Mvra-snr os
G3 SHERBROOKE
AUTOfUSATlOM DlNTiGRATION
DUN ARTICLE tO U T EN COLLABORATION
A UN MtMOUtt OU UNB THiSC
J* (ou nous), soussign4e<s), »ussfgn«s), co-aUeure<s), a>-aut»ur(s)d»rtotfcie inttuN : impaired cell proltfcratioo
and increased arctriatinq IFN-y. IL-17 and osteopontin in bovine paratubercuiosts____________________
reoomals{recormaissoro} qua led* titJde sera Indus aomme partie constftuanta du mAnelr* j*Q
der<Hu<flant(e) (nom):
detath&se □
Pier-Luc Dudemaine
irscrtt<e) au programme de Biochimle
de IDnimsifcfc de Sherbrooke
de la Facultd de
MEdeclne el sciences de la sanid
Enfmde qool, J'ai (nousavona) dpt* cel e n p a g a v^ t en un,nomty%suflteanttf exetnplaites*____________
5i9nmjm
f
° * * : 2013-07-09^
^
>*»"
Nathalie Bissonrfette
Coordonodes
2000 rue du College
I
____
Sherbrooke. QC. Canada J1M OCi
Signature
_L
/■
1
Gjies
Nom
f*om
_____
Coonfonndfls
r * - 'W f .c
.Cr ^
.4
Siqn<rture...
"
...,C
_
_
'
p* » :
Martin Lessard_______________________________ ;_________
Cbordonn^ta
2000 me du College_________________________________________
Sherbrooke. QC. Canada JIM 0C8___________________________
Signature
Hem
Coordonnto
*
Data:
.>» ' s* ?T7
Ohvia Laarec^ufc___________________________________________
c.P. 3500. St-H yacinthe, Qc J2X
7X9_________________________________
Un exempiafre pour f&udUnte, r&udfant, un exempiafre pour cheque personne slgnatalre et un
exempiafre pour le Service des bibfloth^ques ( i rernettre avec le mEmdre ou la these au moment du
d4pft final).
iM v n am o *
SHERBROOKE
AUTOIUSATZOM O U n taU T lO M
DUN AJmCUi ta U T (ft COtLASOftATXON
AUNM#MOmeO(IUN«THtS«
% (on nousX soumgmfactx s o u o l*i*i), ao-auteure(s), cchm*m*{*) d* IM d i M ftuN : tm paired call prtrtiteraticn
and tncreased circulating IFN-y. IL-17 and osteopontin in bovine paratuberculosis
rammafe (reoonnatsmnft) quo tod* vttde Mra indue axnme partto aontffcuante du mfrnolre ®
do I'&ufenfCe) (nan):
dctath^M □
Pier-Luc Dudemaine
irecr*(«)Mi programmed* Biochimio________________________________________________________
de la Facutti de
Mededna et sciences de la a a n t» _____________ dei\J»iM»sitideSherteooloB
En foide quoir fm (nouaarore) dgrtocftengagemere^uejwmfre suftlurt <r eHeroplalraB*__________t
'v
■»»=
^
h
t
j
l
3
M an-P hiiippe Roy ^
„ C g j & L & *. .
a
L
--------------- i p - s
.Z l -
YCO?
Signature_________________________________________ Date: __________________
Nom_________________________
Goordonnfcs
Signature ________________________________Gate
Nam__________________________________________
Coordonndes
Signature
Dace:
Horn
Coordonndes
"
Un exempteire pour I'&udUmte, r& udlant 0,1 exeroptaire pour cheque persormt signature e t un
exempialre pour to Service dee Wbioth^ques ( i rernettre avec le mdmolre ou la th&se au moment du
d£pdt final).
RESUME DU DEUXIEME ARTICLE
L’infection par Mycobacterium avium subspecies paratuberculosis (MAP) engendre un
desordre immunitaire important chez les bovins infectes. Ce derangement amorce
1’implantation d ’une maladie intestinale inflammatoire chronique qui resulte en une enterite
granulomateuse. Le type de reponse immunitaire en place chez les hotes infectes ne fait pas
l’unanimite dans la communaute scientifique. Pourtant, l’etablissement de strategies pour le
developpement d ’outils diagnostiques ou de traitements necessite une comprehension tres
precise des mecanismes de defense en reponse a 1’invasion par la bacterie. La theorie la
plus repandue consiste en une reponse lymphocytaire de type Thi en debut d ’infection pour
contrer le pathogene intracellulaire, puis au cours de l’avancement de la maladie, cette
reponse ferait place au type Th2 , d ’ou 1’apparition plus tardive d’anticorps diriges contre la
bacterie.
Depuis quelques annees, plusieurs maladies inflammatoires chroniques humaines ont ete
reliees a une augmentation de la reponse lymphocytaire de type Thi7 qui amene une pro­
inflammation locale. Ainsi, 1’hypothese que la paratuberculose evolue d ’une maniere
similaire a ces maladies chroniques a ete emise et certains indices laissent croire que les
lymphocytes Thn pourraient effectivement etre en cause dans le deploiement d ’une reponse
inflammatoire chronique. Etant donne que la culture fecale de la bacterie donne
generalement un diagnostic plus precoce de la maladie relativement a l’ELISA serologique,
il a ete possible d ’etablir deux groupes de vaches infectees. De ce fait, les vaches identifiees
positives seulement en culture fecale sont associees a un stade d’evolution plus precoce de
la maladie comparees a celles identifiees a la fois positives en culture fecale et en ELISA.
Pour mieux comprendre les bouleversements a ces differents stades de la maladie
progresse, une analyse de la capacite serologique a soutenir une proliferation cellulaire en
reponse a un stimulus bacterien a ete effectuee. Des cellules mononucleees ont ete isolees
et mises en culture a partir du sang peripherique de trois vaches donneuses (saines) en
presence de serum de vaches non-infectees ou infectees par MAP. Elies ont ensuite ete
stimulees avec de la concanavaline A, qui est une glycoproteine de la famille des lectines.
Les resultats obtenus lors de cet essai ont permis de conclure que les cellules immunitaires
ont une capacite de proliferation
reduite de 15% lorsqu’elles sont mises en culture en
72
presence de serum provenant des vaches atteintes de paratuberculose en comparaison au
serum de vaches saines. Quant a lui, le stade d ’infection n’apporte pas de difference au
niveau de capacite du serum a soutenir la proliferation cellulaire, il s’agit done
probablement d’un effet engendre par la presence de la bacterie chez 1’animal.
Les variations observees au niveau de la proliferation ont permis d ’emettre l’hypothese
qu’il y avait des differences entre les vaches a statut negatif et celles a statut positif au
niveau serologique. Dans cette optique, le dosage de cytokines plasmatiques a ete effectue
pour determiner s’il y avait des differences au niveau du type de reponse lymphocytaire en
place au niveau systemique qui pourrait expliquer la difference de proliferation cellulaire.
Les cytokines plasmatiques suivantes ont ainsi ete mesurees : l’IL-4, IL-10, IL-17, IFN-y et
1’OPN. L’interleukine 4 et 10 n ’ont demontre aucune difference avec les vaches negatives.
La reponse de type Th2 representee par la secretion d ’IL-4 n’est done pas augmentee chez
les vaches atteintes. De plus, IL-10 n’offrant aucune difference entre les groupes, cette
cytokine anti-inflammatoire ne peut expliquer la difference de proliferation mesuree. Pour
leur part, l’IFN-y et l’osteopontine ont donne des patrons similaires, puisque leur
concentration est moins elevee chez les vaches negatives que chez les deux groupes de
vaches positives et dans les deux cas, les vaches dans un stade plus avance de la maladie
ont une concentration legerement plus grande que les vaches dans un stade d ’infection plus
precoce. Ces deux cytokines aident a confirmer une reponse pro-inflammatoire accrue chez
les vaches positives, en plus d’indiquer la presence de cytokines associees a une reponse de
type Thi meme dans les stades plus avances de la maladie. II n ’en demeure pas moins que le
resultat le plus interessant provient du dosage de l’IL-17. Effectivement, cette cytokine
presente un patron tres different selon le stade d ’avancement de la maladie. Chez les vaches
dans le stade plus tardif, la concentration mesuree est plus grande que chez les vaches
saines. Le contraire survient chez les vaches positives dans le stade moins avance,
puisqu’elles ont une concentration moins elevee que les vaches saines. Ces resultats
suggerent qu’a long terme les vaches infectees par MAP developpent une reponse
systemique de type Thn, alors qu’a court terme cette reponse n ’est pas encore presente.
Pour appuyer l’hypothese d’une orientation de la reponse lymphocytaire vers une
augmentation des lymphocytes Thn, un essai d’infection de macrophages in vitro a ete
73
realise a partir des monocytes isoles du sang de 8 vaches saines. Par la suite, l’expression
genique a permis d ’observer l’augmentation significative de plusieurs genes impliques dans
la differentiation en lymphocytes Thn- Ainsi, l’IL-ip, l’IL-6 et l’IL-23 presentent une
augmentation soutenue de leur expression suite a 1’infection par MAP, et ce jusqu’a 24
heures apres l’infection. Quant au TGF-{3, il augmente legerement suite a l’infection,
cependant d’autres types cellulaires peuvent secreter cette cytokine et done expliquer le fait
que son expression n’est que tres legerement augmentee. Pour ce qui est de 1’IL-10,
1’augmentation de son expression de maniere tres precoce, soit des la premiere heure apres
l’infection suggere un mecanisme mis en place par la bacterie pour eviter un appel massif
ainsi qu’une pro-inflammation avant son entree dans les macrophages. Cette hypothese
explique pourquoi l’expression du TNF-a et de l’IL-8 est a leur plus bas a 1 heure
d’infection, alors que par la suite survient une phase pro-inflammatoire ainsi qu’un appel
soutenu de monocytes au site d’infection et ce jusqu’a 24 heures apres l’infection.
DEUXIEME ARTICLE
Interpretive Summary: Impaired cell proliferation and increased circulating IFN-y, IL-17
and osteopontin in bovine paratuberculosis. Dudemaine. Dairy cows infected with
Mycobacterium avium subsp. paratuberculosis had lower capacity to sustain cellular
proliferation, suggesting an altered immune response. Plasma IFN-y levels were higher in
positive cows than in non-infected cows, whereas IL-4 and IL-10 levels did not differ.
Osteopontin and IL-17 were higher in the seropositive infected cows, suggesting a T-helper
type-17 (Thl7) response similar to that in many chronic inflammatory diseases. This Thi7
response was supported by gene expression results from an in vitro macrophage infection
assay, suggesting a shift toward a Thi7 immune response early in infection.
Running head: ALTERED IMMUNE RESPONSE IN PARATUBERCULOSIS
Title: Impaired cell proliferation and increased circulating IFN-y, IL-17 and
osteopontin in bovine paratuberculosis
P. L. Dudemaine*!, G. Fecteau!, M. Lessard*, O. Labrecque §, J. P. Roy !, and N.
Bissonnette*!
*Dairy and Swine Research and Development Centre, Agriculture and Agri-Food Canada,
Sherbrooke, QC, Canada JIM 1Z3
tDepartement de biochimie, Faculte de medecine et des sciences de la sante, Universite de
Sherbrooke, QC, Canada J1H 5N4
£Faculte de medecine veterinaire, Universite de Montreal, St-Hyacinthe, QC, Canada J2S
2M2
§Laboratoire d’epidemiosurveillance animale du Quebec, St-Hyacinthe, QC, Canada J2S
7X9
75
ABSTRACT
Bovine paratuberculosis, also known as Johne’s disease, is a chronic granulomatous
enteritis caused by Mycobacterium avium subsp. paratuberculosis (MAP). Bovine
paratuberculosis is currently incurable. The intracellular pathogen MAP subverts the
immunological vigilance of the host, and antibody response to MAP takes time to develop.
Therefore, serological detection of subclinical cows is difficult and some infectious animals
remain seronegative for years. Diagnostic tools involving direct PCR, microbiological
culture of the pathogen from feces, or serological detection by ELISA are not consistently
effective. Diagnostic tools are more efficient during the later phases of the disease. A better
understanding of the immune response is required to achieve better Johne’s disease control
programs. Negative animals (n = 29) were selected from paratuberculose-free herds with at
least 80% of the animals diagnosed negative in fecal culture (FC) and ELISA without any
positive results in the herd during the 2-year study. Positive animals were selected with a
positive FC (n = 31). According
positive
cows:
single-positive
to ELISA results, two groups were
(n = 22) and
double-positive
madefrom the FC
(n = 9). Analysis
of
lymphoproliferation in the presence of serum from healthy or MAP-infected cows showed
15% less lymphocyte proliferation in the infected group. The plasma levels of the IL-4,
IL-10, IL-17, IFN-y, and osteopontin cytokines were measured and revealed distinct
patterns. Whereas IL-4 and EL-10 concentrations in the healthy cows were similar to those
in the ELISA-positive cows, the latter had elevated levels of IFN-y, IL-17, and osteopontin,
showing that a proinflammatory
state was established in these subclinical cows. These
results suggest a strong T-helper type-17 (Thn) immune response, supported by gene
expression data from in vitro MAP infection of bovine macrophages. High upregulation of
tumor necrosis factor-a, IL-ip, IL-6, IL-23, and transforming growth factor-(3 was observed
as early as 6 h postinfection for all those cytokines required in the establishment of a Thn
immune response.
Key Words: bovine paratuberculosis, immune response, Thn, lymphoproliferation
76
INTRODUCTION
Bovine paratuberculosis, also called Johne’s disease (JD), is caused by Mycobacterium
avium subsp. paratuberculosis (MAP). Infection by this pathogen results in a chronic,
slowly progressive granulomatous enteritis affecting a wide range of wildlife and
domesticated ruminants (Collins et al., 1994; Carta et al., 2013). The MAP pathogen is an
intracellular bacterium that infects mainly the immune cells associated with the digestive
system. An individual becomes infected by the fecal-oral route, by contaminated food, or
even in utero (Whittington and Windsor, 2009). The MAP bacteria establish themselves in
the intestinal submucosa, where they niche and slowly proliferate. The onset of clinical
disease is unpredictable. A number of years later (5-7 yr), the animal will develop the
clinical signs of the disease, which include intermittent to chronic diarrhea, granulomatous
inflammation, and cachexia, and which cause the eventual death of the infected animal. The
disease is insidious, because before the clinical signs appear, an infected animal excretes
the pathogen in feces and potentially sheds MAP into the environment. Given that
paratuberculosis is an incurable disease, it must be controlled and detected effectively in
subclinical animals before they become infectious.
Although MAP can infect multiple mammalian species, it is primarily a disease problem in
ruminants worldwide. In the Canadian dairy industry, this slowly progressive disease is
responsible for significant economic losses, which reach nearly $2,500/yr for a 50-cow
herd and are estimated at $15 million to $90 million annually (Chi et al., 2002). Johne’s
disease is responsible for huge economic losses in livestock productivity worldwide
(Whittington et al., 2012), a situation that is compelling numerous countries to increase
efforts to control the disease (Bakker et al., 2000). The economic losses associated with JD
are due mainly to reduced production, wasting, weight loss, and the inevitable culling of
infected animals (Harris and Barletta, 2001).
The pathogen MAP inducing ruminant paratuberculosis is zoonotic; the typical clinical
characteristics associated to paratuberculosis are being described as the Johne’s disease.
Although JD is not an epidemic disease and its incidence was formerly sporadic, the
prevalence of infected animals as a result of modern farming practices has raised bovine
paratuberculosis disease to a global concern. Dairy, beef, and goat producers have invested
77
significantly in eradicating JD, but the diagnostic tests available are disappointing, and
there is still controversy surrounding the effectiveness of vaccines in preventing infection
(Park et al., 2011; Stabel et al., 2011; Alonso-Heam et al., 2012; Knust et al., 2013; Lu et
al., 2013). Efforts to control JD have been impeded by the failure to detect early infection,
the lack of an effective vaccine, and the lack of understanding of the immune response to
MAP. Although precautions to decrease herd-to-herd transmission through better on-farm
biosecurity procedures have been taken in place in many countries, paratuberculosis is
unfortunately thought to have reached high herd prevalence, above 70% for US dairies
(Lombard et al., 2013). To control the disease assuming such wide dissemination in herds,
it is obviously necessary to achieve effective diagnosis during the initial period following
MAP infection to help eliminate subclinical cows. Most diagnostic tools have high
specificity and use either the direct methods for detection (e.g. by PCR or the bacterial
culture of the feces) or an indirect method (e.g. ELISA for detecting antibody in the serum
or milk). However, these diagnostic tools become more sensitive generally in the late stages
of JD. Moreover, the diagnosis of paratuberculosis is hampered by several factors. The
slow progression of the disease, with intermittent and low shedding of MAP in feces by
subclinical animals, makes isolation of the organism difficult (Leite et al., 2012). Because
the antibody production is considerably impaired as the intracellular pathogen MAP
subverts the immune system, the serological detection (ELISA) is not sensitive. The result
is low sensitivity for diagnostic tools, which is thought to be between 30% and 50% for
fecal culture compared with necropsy (Sockett et al., 1992; Whitlock et al., 2000) and for
antibody-related assays relative to fecal culture (Kalis et al., 2002; McKenna et al., 2005).
No efficient treatment for JD exists, and the confusion surrounding whether vaccination,
direct detection, and indirect detection are effective has impaired the control of bovine
paratuberculosis. Analysis of the immune status of MAP-infected cows seems to be a prime
step toward a better understanding of the immune response as the disease progresses and
therefore might provide useful clues about the efficiency of diagnosis based on antibody- or
cell-mediated immune response. Immunological studies in subclinical adult ruminants with
paucibacillary and multibacillary lesions have led to the proposal that a T-helper type-1
(Thi)-dominant lymphocyte immune response (IFN-y secretion) is induced predominantly
during the early subclinical stages of the infection and is followed by a switch to a T-helper
78
type-2 (Th2) response later on (Chiodini et al., 1984; Stabel, 2000; Coussens, 2004). The
microorganism elicits a cell-mediated response by the host, and as the disease progresses
from subclinical to clinical, the cell-mediated immune response wanes, and a strong
humoral response becomes dominant. Recently, this theory has been questioned (Begg et
al., 2011), and the proposed switch does not seem to be so obvious. However, experts agree
that MAP infection alters many aspects of the immune response, including activation
through toll-like receptors (Subharat et al., 2012) and the cytokine expression profiles of
peripheral blood mononuclear cells (PBM C) (Verschoor et al., 2010). Such modifications
in the immune response may cause serious difficulty in terms of dealing with MAP
invasion and could possibly lead to greater chronicity and severity of the disease.
In the last few years, several human autoimmune and inflammatory disorders, such as
inflammatory bowel disease, rheumatoid arthritis, allergic asthma, and psoriasis (Varona et
al., 2003; Teraki et al., 2004; Lundy et al., 2005; Hirota et al., 2007), have been associated
with the secretion of IL-17 by T-helper type-17 (Thn) lymphocytes. The proinflammatory
cytokine IL-17 is believed to sustain a long-term inflammation site, causing dysfunction of
the tissue, which has been invaded with numerous immune cells. Interesting data also
suggest that the Thn subset may be involved in Crohn’s disease (Brand, 2009). It remains
unknown whether this subset has implications in JD, but some recent studies proposed a
role in mycobacterial host defense (Curtis and Way, 2009). Also, it has been shown that
IL-17 is upregulated in mesenteric lymph node cells from MAP-infected cows (Shu et al.,
2011). Besides the resemblance between Johne’s and Crohn’s diseases, the implication of
the Thn population in inflammatory bowel disease provides insight into the potential
involvement of this lymphocyte class in the development of paratuberculosis.
With a view to improving our understanding of the mechanisms involved in the
development of JD, the goal of the present study was to investigate and compare the
capacity of serum to sustain lymphocyte functions and cytokine profiles of healthy cows
and MAP-infected cows. It was hypothesized that, first, immune response is systematically
disturbed through inherent serum inhibitor content and, second, plasma cytokines exhibit
diverse profiles regarding animal status for MAP infection.
79
MATERIALS AND METHODS
Ethics Statement
All animal procedures were carried out according to the Canadian Council on Animal Care
guidelines for institutional animal use, and ethical approval for the study was obtained from
the Agriculture and Agri-Food Canada Animal Ethics Committee (protocol number 362).
A nim al Diagnosis and Selection
The animals used for this study were screened by the Laboratoire d ’epidemiosurveillance
animale du Quebec (Saint-Hyacinthe, Qc) for paratuberculosis both by bacterial culture of
individual fecal samples and by serological detection using the Pourquier ELISA (IDEXX
Laboratories, Markham, ON, Canada), as described by the manufacturer. A total of 24 destall dairy herds in Quebec with known status (19 infected and 5 uninfected) were sampled
twice in 2011. Cows diagnosed as negative for bovine paratuberculosis (n = 29) were
selected from the 5 herds without positive serological results. At least 80% of the herd was
confirmed negative in 2 consecutive bacterial cultures of individual feces. Negative animals
older than 4.5 yr were selected for the study and were tested again on the day of sampling to
ensure that no positive animals would be used in the following experiments. A total of
31 positive animals were identified from the 24 herds on the basis of a positive result in fecal
culture and then separated into 2 cohorts, the first called single-positive (n = 22), as those
cows were diagnosed as positive by fecal culture only, and the second called double-positive,
as those cows were diagnosed as positive by both tests (n = 9).
Blood Collection and Treatment
Blood samples were taken from the jugular vein in 10-mL Vacutainer tubes with EDTA for
plasma or without anticoagulant for serum. The EDTA tubes were chilled on ice
immediately after sampling, whereas the serum was allowed to clot at 4°C for 4 h. The
samples were centrifuged at 1,800 x g and 4°C for 15 min and then aliquoted into 2-mL
portions and stored at -80°C until analysis.
80
Proliferation Assay
To assess the capacity of the serum collected from paratuberculosis-free and infected cows
to sustain cell proliferation, PBMC from 3 healthy cows were isolated, and then cells from
incubated with serum from MAP uninfected and infected cows with or without
concanavalin A (ConA; Sigma-Aldrich). Unless otherwise stated, all steps in the isolation
were carried out at room temperature. Briefly, blood from the donor cows was collected
from the jugular vein in 450-mL blood collection bags containing citrate dextrose. The
buffy coat was collected from the interface following standard centrifugation in 50-mL
sterile tubes at 1,200 x g for 15 min, diluted 1:2 with room-temperature RPMI 1640
medium (Wisent, St-Bruno, QC, Canada), and layered on Ficoll-Paque PLUS (GE
Healthcare, Baie d’Urfe, QC, Canada), followed by centrifugation at 850 x g for 35 min.
The PBMC were washed with RPMI 1640 medium, resuspended in 4 mL red blood cell
lysing buffer (Sigma-Aldrich, Oakville, ON, Canada) for 2 min, and immediately diluted in
RPMI 1640 medium, followed by centrifugation at 100 x g for 8 min. The cell count and
viability were determined using the Countess Automated Cell Counter (Invitrogen,
Burlington, ON, Canada). The cells were labeled with the Vybrant carboxyfluorescein
diacetate succinimidyl ester (CFDA SE) Cell Tracer Kit (Molecular Probes, Burlington,
ON, Canada) and diluted in Hanks’ balanced salt solution (Wisent) at a concentration of
1 \iM following incubation at 39°C for 20 min to ensure uniform marking of the cells. After
centrifugation at 100 x g for 8 min, excess CFDA-SE was removed by incubating the cells
in RPMI 1640 medium at room temperature for 20 min, and then the cells were pelleted at
100 x g for 8 min. The cells were seeded at a density of 1 x 106 cells per well in 24-well
plates containing antibiotic-free RPMI 1640 medium and 5% serum from negative or
positive cows, supplemented with 200 mM L-glutamine (Wisent). Four wells were used for
each condition with 0.3 and 1 pg/mL ConA and without (control). To avoid technical bias
in the assays, each plate contained equal amounts of MAP-infected positive and negative
cow sera. After 3 d of incubation, the non-adherent cells were pelleted in cytometry tubes,
fixed in PBS/formaldehyde (4% vol/vol), and read in a 3-laser FACSCanto II flow
cytometer (BD Biosciences, Mississauga, ON, Canada).
81
M easurem ent o f Plasma IFN-y, IL-17, an d IL-10 by ELISA
Bovine IFN-y was measured using the Bovine IFN-y ELISA Development Kit (Mabtech,
Mariemont, OH, USA) as described by the manufacturer. The samples and standard curve
were measured in duplicate. Interleukin-10 in plasma was measured using the Bovine
Interleukin 10 (IL-10) ELISA Kit (CUSABIO, Wuhan, Hubei Province, China) as
recommended by the manufacturer. Interleukin-4 in plasma was measured using the ELISA
Kit for Interleukin 4 (IL4) (USCN Life Science, Houston, TX, USA) as recommended by
the manufacturer. Interleukin-17 in plasma was measured using the ELISA Kit for
Interleukin 17 (IL17) (USCN Life Science) as recommended by the manufacturer. All
ELISA plates were read using a SpectraMax Plus384 microplate reader (Molecular
Devices, Downingtown, PA, USA).
Osteopontin M easurem ent in Plasm a Samples
Plasma osteopontin concentration was measured using sandwich ELISA as previously
described (Bissonnette et al., 2012). Briefly, 96-well ELISA plates (Greiner Bio-One North
America, Monroe, NC, USA) were coated with MAB193P (Maine Biotechnology Services,
Portland, ME, USA) diluted 1:1,000 in a coating buffer (0.05 M Na2C 0 3 buffer [pH 9.2]),
sealed, and incubated at 4°C overnight. The plates were washed twice with the washing
buffer (PBS [pH 7.4] containing 0.05% Tween 20), incubated for 2 h with the blocking
solution (PBS [pH 7.4] containing 1% fish skin gelatin), and finally washed 3 times prior to
loading of the samples. The plates were incubated at room temperature for 1 h and then
washed 3 times prior to the addition of the second antibody (bOPN-121) diluted in the
blocking solution. The plates were incubated for 2 h and then washed 6 times before the
addition of the anti-rabbit IgG coupled to horseradish peroxidase NA934V (GE
Healthcare). Following incubation for 1 h and the final washing step, a solution of TMB
Microwell Peroxidase Substrate (KPL, Gaithersburg, MD, USA) was added to each well,
and the plates were incubated for 10 min before stopping solution (2.0M H2S 0 4) was
added. The plates were read at 450 nm using a SpectraMax Plus384 microplate reader
(Molecular Devices). Duplicates of the standard curve were included on every ELISA plate.
82
Preparation o f Bovine M onocyte-D erived M acrophages and Stimulation
For monocyte isolation, 700 mL whole blood was collected from 8 healthy cows, and
PBMC were collected as described above. Monocytes were isolated by adherence as
described by Zhou et al. (2012) with minor modifications. Cells were seeded at a density of
5 x 106 cells in 6-well flat-bottom plates in complete medium consisting of RPMI 1640
medium supplemented with 10% heat-inactivated bovine heterologous serum and IX
antibiotics and antifungals (Centrafarm, Etten-Leur, The Netherlands) at 39°C in a
humidified atmosphere with 5% CO 2 . The cells were incubated for 2 h to allow monocytes
to adhere, and then cells in suspension were removed. Following 18 h incubation (d 1), the
cells were washed twice, and the medium was replaced with 2 mL fresh antibioticcontaining medium to remove any non-adherent cells. The identity and purity of monocytes
was confirmed by flow cytometry using an anti-CD 14 Pacific Blue-labeled antibody as
described by Taraktsoglou et al. (2011), and CD14+ cell purity greater than 99% was
achieved. The cells were then incubated with RPMI 1640 medium containing 10% heatinactivated fetal bovine serum (Sigma-Aldrich) at 39°C in 5% CO 2 for 8 to 10 d. By d 10,
80-90% confluent monolayers displayed the characteristic macrophage morphology and
confirmed purity greater than 98% using flow cytometry with an anti-CD68 antibody. The
monocyte-derived macrophages were used for the in vitro challenge experiments. A
multiplicity of infection of 10:1 for the MAP pathogen (field strain 39382) was used to
stimulate the cells. Prior to add MAP to cell culture, macrophages were incubated for 24 h
in antibiotic-free media. Infection periods of 1, 6, 14, and 24 h were performed, and
uninfected controls were harvested at time zero and 24 h. Assays were stopped using 1 mL
of cell lysing buffer (RLT buffer; Qiagen, Toronto, ON, Canada) added to each well.
RNA Extraction and Quantitative Real-Tim e PCR
The RNA extraction and quantification by real-time PCR following reverse transcription
(qRT-PCR) were performed as previously described (Levesque-Sergerie et al., 2007) with
minor modifications. All qRT-PCR reactions were performed in triplicate using 500 ng
total RNA. The cDNA was then diluted in molecular-grade H 2 O and stored in multiple
aliquots at -20°C for subsequent use. Primers were designed for each gene using the Primer
Express 3 software package (Applied Biosystems, Life Technologies Corporation,
83
Burlington, ON, Canada) using the reference sequence from the RefSeq database of the
National Center for Biotechnology Information depository. Optimizations were performed
for each gene by testing different concentrations of both forward and reverse primers, each
ranging from 50 to 900 nM. Estimations of primer efficiencies were analyzed using the
standard curves made from a serial dilution of a pool of cDNA samples. Supplementary
Table 1 provides experimental information and PCR amplification efficiency for all genes.
The qRT-PCR reactions (20-pL final volume) were performed on 96-well plates using
Power SYBR Green PCR Master Mix (Applied Biosystems) in a StepOnePlus Real-Time
PCR System (Applied Biosystems) as per the manufacturer’s instructions. The PCR
thermal cycling conditions comprised an initial 20-s denaturation step at 95°C followed by
40 cycles at 95°C for 3 s followed by an annealing/elongation period at 60°C for 30 s. A
dissociation step was included for all amplifications to confirm the presence of single
discrete PCR products of the expected size; this was further confirmed by visualization of
the amplification products on 2% agarose gels. The expression of 4 putative reference
genes, namely P-actin (ACTB), cyclophilin A (PPIA), ubiquitously expressed transcript
( UXT), and tyrosine 3-monooxygenase/tryptophan 5-monoxygenase activation protein, zeta
polypeptide (YWHAZ), was determined for all samples. The UXT or PPIA genes were
identified by BestKeeper (Pfaffl et al., 2004) as the most stable genes. Pairwise analysis of
expression ratios using the geNorm software (Vandesompele et al., 2002) was used to
confirm UXT and PPIA as internal controls. Their geometrical means were used for
normalization of longitudinal gene expression profiling as described previously (Bionaz
and Loor, 2007). The qRT-PCR results were analyzed according to the comparative CT
method, given by the arithmetic formula 2_(AACt) (Livak and Schmittgen, 2001).
Statistical Analysis
Differences in lymphoproliferation were analyzed using one-way ANOVA and Tukey’s
multiple comparison tests. Differences in plasmatic cytokine secretion were determined on
transformed data using ANOVA and Tukey’s multiple comparison tests for IL-17, IFN-y,
and osteopontin. Plasma concentrations of IL-10 and IL-4 were analyzed using ANOVA
and Tukey’s multiple comparison tests. Quantitative RT-PCR was analyzed by average
fold-change analysis in combination with Student’s t-test.
84
RESULTS AND DISCUSSION
Currently, there is no test available for rapid, sensitive, and accurate detection of subclinical
MAP-infected cows. Diagnosis of MAP infection in live animals is currently performed by
carrying out PCR amplification of MAP genetic material from feces, by culturing the
bacteria from feces, or by testing serum by ELISA to detect MAP-specific antibodies. This
serological detection is positive only when the cow develops an immune response to the
bacteria. Currently, there appears to be some confusion regarding the reason for the lack of
sensitivity of ELISA detection. On the basis of immune response studies on animals with
paucibacillary or multibacillary (abundant) lesions, many researchers have suggested that a
Thi (cell-mediated; IFN-y) and Th2 (humoral; specific antibody) balance occurs over time
((Whittington et al., 2013), and references therein). This assumption is further supported by
the ability of the intracellular pathogen to subvert the immune system. As a result, it has
been generally accepted that MAP-specific antibodies are produced only late in the disease
process. However, other studies have indicated that the immune responses to MAP
infection are more complex than previously thought, with both humoral and cellular
immunity potentially playing key roles (Waters et al., 2003; Begg et al., 2011). In the
present study and as observed by Whittington et al. (2013)), the patterns of MAP antigen
inducing production of IFN-y (Thi) and antibody responses vary dramatically among
subclinical animals (data not shown). However, the serum from the MAP-infected cows
dampened lymphocyte proliferation compared to serum from to negative cows, an
observation confirmed using the PBMC isolated from 3 different non-infected cows
(Figure 1; P = 0.001). The serum from the subclinical cows that did not have a clear
humoral immune response (single-positive) generated results similar to those for the serum
from the ELISA-positive cows (P = 0.198).
85
70 •
60 •
■ -/«
5 0
.2
40 ■
£
c
'
□ + /-
□ +/+
2
Q>
|
oZ
30 ■
20
■
10
■
0
•
Figure 1. Capacity of the serum from cows infected with bovine paratuberculosis to
support the proliferation of peripheral blood mononuclear cells. Data are shown as means ±
SEM. Statistical analysis was performed using ANOVA with Tukey’s corrections.
In other words, the serum from both infectious and subclinical-infected cows contains
antiproliferative factors that do not support lymphocyte proliferation. This observation may
explain, in part, the progressive evolution of the disease toward an anergic state (Waters et
al., 1999). If systemic suppression of the immune system occurs and impairs the
lymphocyte response, it may also explain the delay in antibody production. Whether this
inhibition is generated by the MAP pathogen or is a consequence of chronic impaired
immunity of the host is unknown, but such generalized and sustained inhibition of
lymphocyte proliferation by the serum represents a real advantage for this slow-growing
pathogen. Bacteria have evolved in parallel with their hosts and have found many ways to
interfere with normal cell signaling to unsettle host defenses against pathogens (Hornef et
al., 2002). Many bacteria can produce proteins that have the potential to impair
phagocytosis and to modulate the activation of innate and acquired immune functions
(Rosenberger and Finlay, 2003). The main goal of which is to disturb the host immune
86
system while the pathogen is establishing infection. Therefore, the dampening of
lymphocyte proliferation is an efficient strategy used by this slow-growing pathogen to
establish infection.
The reduced capacity of serum to support lymphocyte proliferation leads to the hypothesis
that the serum of MAP-infected cows contains anti-inflammatory cytokines. Accordingly,
many researchers have suggested that the development of regulatory T (Treg) cells that
effectively limit effector T cell responses would account for the loss of proinflammatory
responses (Buza et al., 2004; Coussens, 2004; Weiss et al., 2005). In particular, it has been
postulated that the anti-inflammatory IL-10 cytokine secreted by the Treg lymphocytes
limits the peripheral and tissue-specific Thi immune responses of JD-positive cows (de
Almeida et al., 2008). In the present study, however, the plasma concentration of IL-10 did
not differ between the groups (Figure 2A; P = 0.404), an observation that suggests that
IL-10 may not be implicated in the long-term systemic disorder observed in bovine
paratuberculosis. Alternatively, the reduced proliferation may be associated with a switch
that, it has been suggested, occurs as the disease progresses (Stabel, 2000). According to
the Th|-Th2 dogma, cows become ELISA positive as the switch occurs. Given that IL-4 and
IFN-y are the Thi- and ^ -a ss o c ia te d cytokines, respectively, plasma levels of IL-4 and
IFN-y (Figures 2B and C, respectively) were measured. The levels of IL-4 in the MAPinfected cows were similar to those in the uninfected cows (Figure 2B; P > 0.07), IFN-y
blood concentrations were more elevated in both positive groups than in the negative group
(Figure 2C; P = 0.013). These results did not fit the Thi-Th2 dogma. Many studies have
reported an augmentation of IFN-y expression in the tissue and PBMC of subclinical cows
(Sweeney et al., 1998; Coussens et al., 2004) and JD-positive cows (Shu et al., 2011), but to
the present authors’ knowledge, this is the first time that a higher IFN-y concentration has
been reported in the plasma of MAP-infected cows. Interestingly, the infected cows with
serologically negative results (i.e. absence of MAP-specific antibodies) had a reduced IL-4
blood level (Figure 2b; P = 0.029) compared with the infected group with ELISA-positive
results. Although the difference with the uninfected cows was not significant (P = 0.075),
the lower level of this Th2 cytokine suggests an impaired humoral immune response for
these MAP-infected cows.
87
Dysregulation of cytokine signaling from infected cells could progressively induce a
resilient immunity, as previously suggested (Koo et al., 2004; Allen et al., 2009; Park et al.,
2011). Studies in humans and mice infected with Mycobacterium tuberculosis have
suggested that dysregulation of cytokine signaling leads to induction of Treg cells (Kursar et
al., 2007; Sharma et al., 2009). It is postulated that Treg cells play a similar role in bovine
paratuberculosis (de Almeida et al., 2008). However, much of the evidence for the
importance of Treg cells in bovine paratuberculosis is circumstantial and speculative. More
recent findings suggest that Thi and Thn cytokines in PBMC in response to live MAP
stimulation, rather than Treg-associated factors, are associated with bovine paratuberculosis
(Park et al., 2011). Considering the resemblance between JD and Crohn’s disease and the
implication of Thn lineage cells in the pathogenesis of Crohn’s disease (Brand, 2009), IL17 was quantified in the present study. The plasma IL-17 level in the MAP-infected cows
from the double-positive group showed a higher concentration (Figure 2D; P = 0.001).
Similar to the results obtained for the IL-4 cytokine, the IL-17 level in the plasma of the
cows in the single-positive group was also lower (Figure 2D; P = 0.020) than the
concentration measured in the non-infected cows, an observation that suggests that
infection in these single-positive cows was at a less advanced stage.
B
P
0 404
/* -
0.011
14
1/
40
■/
V.
a */
[ > /•
40
i
H - 0 .0 0 *
/>
P
o:<t
so
90
p
J
40
-
to
1
t
OOP
100
o o :v
A
P
80
10
W
30
70
/* - 0 031
40
60
40
4S
i JS
/O
2
0 001
P - 0020
;s
JO
is
IO
10
s
0
0
Figure 2. Plasma concentration of IL-10, IL-4, IFN-y, IL-17, and osteopontin cytokines. The cows were classified according to their
status as negative, single-positive (positive results from the bacterial culture of fecal samples), or double-positive (both serological
detection and bacterial positive cultures). The concentrations of IL-10 (A), IL-4 (B), EFN-y (C), IL-17 (D) and osteopontin (E) were
measured in the plasma. Data are shown as means ± SEM. Statistical analysis was performed using ANOVA with Tukey’s multiple
corrections.
00
00
89
The osteopontin level was also examined in the present study to further support the idea
that the chronicity of the disease occurs concomitantly with a gradual and progressive Thn
shift. Osteopontin is suspected to play a role in the secretion (Murugaiyan et al., 2008),
regulation (Shinohara et al., 2008), and differentiation of naive CD4 and CD8 T cell subsets
with Thn effector activity (Chen et al., 2010). In the present study, a higher osteopontin
concentration was measured in the MAP-infected cows (Figure 2E). The level was slightly
but significantly more elevated in the blood of the cows from the single-positive group
(P = 0.031) and nearly 25% higher (P = 0.004) in the blood of the double-positive group
compared with the levels in the non-infected cows. The osteopontin level in the non­
infected cows was similar to the plasma level measured in a previous study in 15 cows
sampled weekly during a full lactation period (Dudemaine et al., 2013). The blood level of
the osteopontin cytokine is thus highly stable. Interestingly, given that osteopontin is a
marker for inflammatory bowel disease (Neuman, 2012), the significantly higher
osteopontin level is therefore associated with the proinflammatory condition prevailing for
the MAP-infected cows. These results suggest that the cows in the double-positive group
were in a later stage of the disease, as suggested previously for ELISA-positive cows
shedding MAP into their feces (Chiodini et al., 1984; Collins et al., 1991; Collins and
Sockett, 1993; Whitlock et al., 2000). Accordingly, these results also suggest a slow
progression toward a Thn state. Robinson et al. (2011) demonstrated that IL-17 mRNA is
upregulated in jejunal lymph nodes from severely diseased animals compared with those
from healthy or minimally diseased animals, and proposed that the progression to a Thn
state could be due to the chronicity of the disease. In the same way, the present results
suggest that this Thn shift becomes predominant for ELISA-positive cows shedding MAP
into their feces as a consequence of the systemic proinflammatory status.
In support of this new Thi/Thn paradigm, the gene expression profiles of several cytokines
were analyzed in MAP-infected macrophages, considering that cytokine signaling by
primed macrophages activates naive T cells to differentiate into T cell subsets. The analysis
confirms that the secretion of cytokines may play a pivotal role in driving the
differentiation of naive CD4 and CD8 T cells into the type of subsets with Thn effector
activity. The levels of IL-lfi, IL-6, and IL-23 transcripts were quantified by qRT-PCR, and
an upregulation was observed as early as 1 h postinfection (Figure 3; P < 0.05.
90
160
140
■ IL-10
120
■ IL-6
C
o
100
■ TGF-0
a
s4*
06
41
?<9
80
2
60
o
■ IL-23A
■ TNF-a
□ IL-8
40
■ IL-10
20
14
24
Post infection (h)
Figure 3. Transcription of cytokines in bovine macrophages infected with live
Mycobacterium avium subsp. paratuberculosis. Total RNA was extracted from
macrophages after 1, 6, 14, and 24 h infection, and the gene expression of cytokines was
measured by qRT-PCR. The relative gene expression (fold increase) was calculated using
two housekeeping genes (PPIA and UXT) and the uninfected macrophages (nil control) as
normalized by the 2-<AACt) method. Data are shown as the means of 3 independent assays.
The error bars indicate standard error. *, significant difference compared with cytokine
transcription in the nil control (P < 0.05).
Interestingly, these cytokines are implicated in the differentiation or maintenance of human
or mouse Thn cells (Bettelli et al., 2006; Manel et al., 2008; Jonsson et al., 2012), and their
high levels persisted for longer infection periods (Supplementary File 2). The transforming
growth factor-p (TGF-fi) gene was slightly (~ 1.5-fold) induced at 14 h and for a longer
infection period (Figure 3; P < 0.05). Although the cooperation of TGF-p with IL-6
supports naive T cell differentiation into Thn effector cells, IL-23 is associated with the
clonal expansion of these cells. Indeed, Thn cells are differentiated by a combination of the
cytokines TGF-P, IL-6, and IL-1p, which induce RORyt, a transcription factor required for
91
the generation of these cells (Mangan et al., 2006). Whereas TGF-P and IL-6 can induce
Thi7 cells, exposure to another cytokine, IL-23, is crucial for the clonal expansion and
stabilization of these cells and for their ability to induce autoimmune tissue inflammation.
Additionally, the proinflammatory tumor necrosis factor-a (T N F -a) and IL-8 genes were
abundantly expressed in bovine macrophages and increased, respectively, of nearly
104±41 times
(at 6 h; P = 0.020)
and
15±3 times
(14— 24 h;
PcO.OOlA).
Anti­
inflammatory IL-10 gene expression was also induced throughout the infection period
(P < 0.011), but to a lesser extent. As the infection progressed, IL-10 was less abundant and
decreased to 2-fold at 24 h. Although TNF-a cooperates with LL-17 in the proinflammatory
processes induced in many autoimmune diseases
(Ouyang et
al.,
2008), these
proinflammatory cytokines may contribute to the recruitment of neutrophils and other
immune cells. The in vitro macrophage infection assays with live MAP provide a better
understanding of the initial processes in place. These results support the hypothesis that
macrophages infected with MAP lead to a global dominance of a Thn-polarizing
environment.
Results from this project may contribute to a better understanding of the immune
dysregulation and provide information for the development of immune-based diagnosis of
bovine paratuberculosis. The different cytokine profiles observed between experimentation
groups suggest that thorough characterization of the immune profile associated with bovine
paratuberculosis worth consideration for studying disease progression. In addition, the
identification of the factors in the serum of paratuberculosis cows which impair
proliferative capacity of the lymphocyte cells could turn out to be useful markers for
diagnosis. In the light of these results, further investigations are required to better
understand this complex disease.
CONCLUSIONS
Bovine paratuberculosis results in inhibition of the proliferative capacity of the immune
cells induced by the serum content of infected dairy cows. Plasma levels of IL-10 were
similar for the non-infected cows and the MAP-infected cows from the positive groups.
However, both IFN-y and osteopontin levels were higher in the MAP-positive cows,
including those from the ELISA-positive groups. Interestingly, these MAP-infected cows
92
also had higher IL-17 blood levels, evidence of a systemic proinflammatory Thi7 state.
Gene expression profiling of in vitro bovine macrophage infection with live MAP supports
the hypothesis of a Thn lineage commitment with the upregulation of most of the cytokines
required for the differentiation of naive T lymphocytes into a Thi7 subset. These results do
not fit into the classical Thi/Th2 dichotomy. Rather, existing data from the present study and
others point to sequential windows toward a proinflammatory Thi7 shift for cows with
subclinical bovine paratuberculosis, similar to the situation in other chronic intestinal bowel
diseases.
ACKNOWLEDGMENTS
The authors thank Drs G. Cote, E. Dore and S. Buczinski, for their assistance for
coordinating the herd visits, Catherine Thibault and Karine Deschene for providing
technical assistance with sampling and cell culture and Karoline Lauzon and Laurine Gil
for performing ELISA assays. This research was supported by Agriculture and Agri-Food
Canada, Novalait inc., Fonds quebecois de la recherche sur la nature et des technologies,
and the Ministere de l’Agriculture, des Pecheries et de l’Alimentation du Quebec (Grant
No. RBPI-2037).
REFERENCES
Allen, A. J., K. T. Park, G. M. Barrington, K. K. Lahmers, M. J. Hamilton, and W. C.
Davis. 2009. Development of a bovine ileal cannulation model to study the immune
response and mechanisms of pathogenesis of paratuberculosis. Clin Vaccine Immunol
16(4):453-463.
Alonso-Hearn, M., E. Molina, M. Geijo, P. Vazquez, I. A. Sevilla, J. M. Garrido, and R. A.
Juste. 2012. Immunization of adult dairy cattle with a new heat-killed vaccine is associated
with longer productive life prior to cows being sent to slaughter with suspected
paratuberculosis. J. Dairy Sci. 95(2):618-629.
Bakker, D., P. T. Willemsen, and F. G. van Zijderveld. 2000. Paratuberculosis recognized
as a problem at last: a review. Vet Q 22(4):200-204.
Begg, D. J., K. de Silva, N. Carter, K. M. Plain, A. Purdie, and R. J. Whittington. 2011.
Does a thi over th2 dominancy really exist in the early stages of mycobacterium avium
subspecies paratuberculosis infections? Immunobiology 216(7):840-846.
93
Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K.
Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic
effector T H I7 and regulatory T cells. Nature 441(7090):235-238.
Bionaz, M. and J. J. Loor. 2007. Identification of reference genes for quantitative real-time
PCR in the bovine mammary gland during the lactation cycle. Physiol. Genomics
29(3):312-319.
Bissonnette, N., P. L. Dudemaine, C. Thibault, and G. Robitaille. 2012. Proteomic analysis
and immunodetection of the bovine milk osteopontin isoforms. J. Dairy Sci. 95(2):567-579.
Brand, S. 2009. Crohn's disease: T h i, T h i7 or both? The change of a paradigm: new
immunological and genetic insights implicate T h i7 cells in the pathogenesis of Crohn's
disease. Gut 58(8): 1152-1167.
Carta, T., J. Alvarez, J. M. Perez de la Lastra, and C. Gortazar. 2013. Wildlife and
paratuberculosis: a review. Res. Vet. Sci. 94(2): 191-197.
Chen, G., X. Zhang, R. Li, L. Fang, X. Niu, Y. Zheng, D. He, R. Xu, and J. Z. Zhang. 2010.
Role of osteopontin in synovial T h i7 differentiation in rheumatoid arthritis. Arthritis
Rheum 62(10):2900-2908.
Chi, J., J. A. VanLeeuwen, A. Weersink, and G. P. Keefe. 2002. Direct production losses
and treatment costs from bovine viral diarrhoea virus, bovine leukosis virus,
Mycobacterium avium subspecies paratuberculosis, and Neospora caninum. Prev Vet Med
55(2): 137-153.
Chiodini, R. J., H. J. Van Kruiningen, and R. S. Merkal. 1984. Ruminant paratuberculosis
(Johne's disease): the current status and future prospects. Cornell Vet 74(3):218-262.
Collins, M. T. and D. C. Sockett. 1993. Accuracy and economics of the USDA-licensed
enzyme-linked immunosorbent assay for bovine paratuberculosis. J Am Vet Med Assoc
203(10): 1456-1463.
Collins, M. T., D. C. Sockett, W. J. Goodger, T. A. Conrad, C. B. Thomas, and D. J. Carr.
1994. Herd prevalence and geographic distribution of, and risk factors for, bovine
paratuberculosis in Wisconsin. J Am Vet Med Assoc 204(4):636-641.
Collins, M. T., D. C. Sockett, S. Ridge, and J. C. Cox. 1991. Evaluation of a commercial
enzyme-linked immunosorbent assay for Johne's disease. J Clin Microbiol 29(2):272-276.
Coussens, P. M. 2004. Model for immune responses to Mycobacterium avium subspecies
paratuberculosis in cattle. Infect. Immun. 72(6):3089-3096.
Coussens, P. M., N. Verman, M. A. Coussens, M. D. Elftman, and A. M. McNulty. 2004.
Cytokine gene expression in peripheral blood mononuclear cells and tissues of cattle
infected with Mycobacterium avium subsp. paratuberculosis: evidence for an inherent
proinflammatory gene expression pattern. Infect. Immun. 72(3): 1409-1422.
94
Curtis, M. M. and S. S. Way. 2009. Interleukin-17 in host defence against bacterial,
mycobacterial and fungal pathogens. Immunology 126(2): 177-185.
de Almeida, D. E., C. J. Colvin, and P. M. Coussens. 2008. Antigen-specific regulatory T
cells in bovine paratuberculosis. Vet. Immunol. Immunopathol. 125(3-4):234-245.
Dudemaine, P.-L., C. Thibault, K. Alain, and N. Bissonnette. 2013. Haplotypes of the
bovine osteopontin gene affect the level of OPN secreted into milk and the host
macrophage immune response. BMC Genomics submitted.
Harris, N. B. and R. G. Barletta. 2001. Mycobacterium avium subsp. paratuberculosis in
Veterinary Medicine. Clin Microbiol Rev 14(3):489-512.
Hirota, K., H. Yoshitomi, M. Hashimoto, S. Maeda, S. Teradaira, N. Sugimoto, T.
Yamaguchi, T. Nomura, H. Ito, T. Nakamura, N. Sakaguchi, and S. Sakaguchi. 2007.
Preferential recruitment of CCR6-expressing T h i7 cells to inflamed joints via CCL20 in
rheumatoid arthritis and its animal model. J Exp Med 204(12):2803-2812.
Hornef, M. W., M. J. Wick, M. Rhen, and S. Normark. 2002. Bacterial strategies for
overcoming host innate and adaptive immune responses. Nature immunology 3(11): 10331040.
Jonsson, B., M. Ridell, and A. E. Wold. 2012. Non-tuberculous mycobacteria and their
surface lipids efficiently induced IL-17 production in human T cells. Microbes and
infection / Institut Pasteur 14(13): 1186-1195.
Kalis, C. H., H. W. Barkema, J. W. Hesselink, C. van Maanen, and M. T. Collins. 2002.
Evaluation of two absorbed enzyme-linked immunosorbent assays and a complement
fixation test as replacements for fecal culture in the detection of cows shedding
Mycobacterium avium subspecies paratuberculosis. Journal of veterinary diagnostic
investigation : official publication of the American Association of Veterinary Laboratory
Diagnosticians, Inc 14(3):219-224.
Knust, B., E. Patton, J. Ribeiro-Lima, J. J. Bohn, and S. J. Wells. 2013. Evaluation of the
effects of a killed whole-cell vaccine against Mycobacterium avium subsp paratuberculosis
in 3 herds of dairy cattle with natural exposure to the organism. J. Am. Vet. Med. Assoc.
242(5):663-669.
Koo, H. C., Y. H. Park, M. J. Hamilton, G. M. Barrington, C. J. Davies, J. B. Kim, J. L.
Dahl, W. R. Waters, and W. C. Davis. 2004. Analysis of the immune response to
Mycobacterium avium subsp. paratuberculosis in experimentally infected calves. Infect.
Immun. 72(12):6870-6883.
Kursar, M., M. Koch, H. W. Mittrucker, G. Nouailles, K. Bonhagen, T. Kamradt, and S. H.
Kaufmann. 2007. Cutting Edge: Regulatory T cells prevent efficient clearance of
Mycobacterium tuberculosis. Journal of immunology (Baltimore, Md. : 1950) 178(5):26612665.
95
Leite, F. L., K. D. Stokes, S. Robbe-Austerman, and J. R. Stabel. 2012. Comparison of
fecal DNA extraction kits for the detection of Mycobacterium avium subsp.
paratuberculosis by polymerase chain reaction. Journal of veterinary diagnostic
investigation : official publication of the American Association of Veterinary Laboratory
Diagnosticians, Inc.
Levesque-Sergerie, J. P., M. Duquette, C. Thibault, L. Delbecchi, and N. Bissonnette. 2007.
Detection limits of several commercial reverse transcriptase enzymes: impact on the lowand high-abundance transcript levels assessed by quantitative RT-PCR. BMC Mol Biol
8(93): 1-18.
Livak, K. J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402-408.
Lombard, J. E., I. A. Gardner, S. R. Jafarzadeh, C. P. Fossler, B. Harris, R. T. Capsel, B. A.
Wagner, and W. O. Johnson. 2013. Herd-level prevalence of Mycobacterium avium subsp.
paratuberculosis infection in United States dairy herds in 2007. Preventive veterinary
medicine 108(2-3):234-238.
Lu, Z., Y. H. Schukken, R. L. Smith, and Y. T. Grohn. 2013. Using vaccination to prevent
the invasion of Mycobacterium avium subsp. paratuberculosis in dairy herds: A stochastic
simulation study. Prev Vet Med.
Lundy, S. K., S. A. Lira, J. J. Smit, D. N. Cook, A. A. Berlin, and N. W. Lukacs. 2005.
Attenuation of allergen-induced responses in CCR6-/- mice is dependent upon altered
pulmonary T lymphocyte activation. J Immunol 174(4):2054-2060.
Manel, N., D. Unutmaz, and D. R. Littman. 2008. The differentiation of human T(H)-17
cells requires transforming growth factor-beta and induction of the nuclear receptor
RORgammat. Nat Immunol 9(6):641-649.
Mangan, P. R., L. E. Harrington, D. B. O'Quinn, W. S. Helms, D. C. Bullard, C. O. Elson,
R. D. Hatton, S. M. Wahl, T. R. Schoeb, and C. T. Weaver. 2006. Transforming growth
factor-beta induces development of the T(H)17 lineage. Nature 4 4 1(7090):231-234.
McKenna, S. L., G. P. Keefe, H. W. Barkema, and D. C. Sockett. 2005. Evaluation of three
ELISAs for Mycobacterium avium subsp. paratuberculosis using tissue and fecal culture as
comparison standards. Vet. Microbiol. 110( 1-2): 105-111.
Murugaiyan, G., A. Mittal, and H. L. Weiner. 2008. Increased osteopontin expression in
dendritic cells amplifies IL-17 production by CD4+ T cells in experimental autoimmune
encephalomyelitis and in multiple sclerosis. J Immunol 181(11):7480-7488.
Neuman, M. G. 2012. Osteopontin biomarker in inflammatory bowel disease, animal
models and target for drug discovery. Dig Dis Sci 57(6): 1430-1431.
Ouyang, W., J. K. Kolls, and Y. Zheng. 2008. The biological functions of T helper 17 cell
effector cytokines in inflammation. Immunity 28(4):454-467.
96
Park, K. T., A. J. Allen, J. P. Bannantine, K. S. Seo, M. J. Hamilton, G. S. Abdellrazeq, H.
M. Rihan, A. Grimm, and W. C. Davis. 2011. Evaluation of two mutants of Mycobacterium
avium subsp. Paratuberculosis as candidates for a live attenuated vaccine for Johne's
disease. Vaccine 29(29-30):4709-4719.
Pfaffl, M. W., A. Tichopad, C. Prgomet, and T. P. Neuvians. 2004. Determination of stable
housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26(6):509-515.
Robinson, M. W., R. O’Brien, C. G. Mackintosh, R. G. Clark, and J. F. Griffin. 2011.
Immunoregulatory cytokines are associated with protection from immunopathology
following Mycobacterium avium subspecies paratuberculosis infection in red deer. Infect
Immun 79(5):2089-2097.
Rosenberger, C. M. and B. B. Finlay. 2003. Phagocyte sabotage: disruption of macrophage
signalling by bacterial pathogens. Nature reviews. Molecular cell biology 4(5):385-396.
Sharma, P. K., P. K. Saha, A. Singh, S. K. Sharma, B. Ghosh, and D. K. Mitra. 2009.
FoxP3+ regulatory T cells suppress effector T-cell function at pathologic site in miliary
tuberculosis. Am. J. Respir. Crit. Care Med. 179(11): 1061-1070.
Shinohara, M. L., J. H. Kim, V. A. Garcia, and H. Cantor. 2008. Engagement of the type I
interferon receptor on dendritic cells inhibits T helper 17 cell development: role of
intracellular osteopontin. Immunity 29(l):68-78.
Shu, D., S. Subharat, D. N. Wedlock, D. Luo, G. W. de Lisle, and B. M. Buddie. 2011.
Diverse cytokine profile from mesenteric lymph node cells of cull cows severely affected
with Johne's disease. Clin Vaccine Immunol 18(9): 1467-1476.
Sockett, D. C., D. J. Carr, and M. T. Collins. 1992. Evaluation of conventional and
radiometric fecal culture and a commercial DNA probe for diagnosis of Mycobacterium
paratuberculosis infections in cattle. Can J Vet Res 56(2): 148-153.
Stabel, J. R. 2000. Transitions in immune responses to Mycobacterium paratuberculosis.
Vet Microbiol 77(3-4):465-473.
Stabel, J. R., W. R. Waters, J. P. Bannantine, and K. Lyashchenko. 2011. Mediation of host
immune responses after immunization of neonatal calves with a heat-killed Mycobacterium
avium subsp. paratuberculosis vaccine. Clinical and Vaccine Immunology 18(12):20792089.
Subharat, S., D. Shu, G. W. de Lisle, B. M. Buddie, and D. N. Wedlock. 2012. Altered
patterns of toll-like receptor gene expression in cull cows infected with Mycobacterium
avium subsp. paratuberculosis. Vet. Immunol. Immunopathol. 145(l-2):471-478.
Sweeney, R. W., D. E. Jones, P. Habecker, and P. Scott. 1998. Interferon-gamma and
interleukin 4 gene expression in cows infected with Mycobacterium paratuberculosis. Am J
Vet Res 59(7):842-847.
97
Taraktsoglou, M., U. Szalabska, D. A. Magee, J. A. Browne, T. Sweeney, E. Gormley, and
D. E. Machugh. 2011. Transcriptional profiling of immune genes in bovine monocytederived macrophages exposed to bacterial antigens. Vet. Immunol. Immunopathol. 140(12): 130-139.
Teraki, Y., A. Miyake, R. Takebayashi, and T. Shiohara. 2004. Homing receptor and
chemokine receptor on intraepidermal T cells in psoriasis vulgaris. Clin Exp Dermatol
29(6):658-663.
Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, and F.
Speleman. 2002. Accurate normalization of real-time quantitative RT-PCR data by
geometric
averaging
of
multiple
internal
control
genes.
Genome
Biol
3(7):RESEARCH0034.
Varona, R., V. Cadenas, J. Flores, A. C. Martinez, and G. Marquez. 2003. CCR6 has a nonredundant role in the development of inflammatory bowel disease. Eur J Immunol
33(10):2937-2946.
Verschoor, C. P., S. D. Pant, Q. You, D. F. Kelton, and N. A. Karrow. 2010. Gene
expression profiling of PBMCs from Holstein and Jersey cows sub-clinically infected with
Mycobacterium avium ssp. paratuberculosis. Vet. Immunol. Immunopathol. 137(1-2): 1-11.
Waters, W. R., J. M. Miller, M. V. Palmer, J. R. Stabel, D. E. Jones, K. A. Koistinen, E. M.
Steadham, M. J. Hamilton, W. C. Davis, and J. P. Bannantine. 2003. Early induction of
humoral and cellular immune responses during experimental Mycobacterium avium subsp.
paratuberculosis infection of calves. Infect Immun 71(9):5130-5138.
Waters, W. R., J. R. Stabel, R. E. Sacco, J. A. Harp, B. A. Pesch, and M. J. Wannemuehler.
1999. Antigen-specific B-cell unresponsiveness induced by chronic Mycobacterium avium
subsp. paratuberculosis infection of cattle. Infect. Immun. 67(4): 1593-1598.
Whitlock, R. H., S. J. Wells, R. W. Sweeney, and J. Van Tiem. 2000. ELISA and fecal
culture for paratuberculosis (Johne's disease): sensitivity and specificity of each method.
Vet. Microbiol. 77(3-4):387-398.
Whittington, R. J., D. J. Begg, K. de Silva, K. M. Plain, and A. C. Purdie. 2012.
Comparative immunological and microbiological aspects of paratuberculosis as a model
mycobacterial infection. Vet Immunol Immunopathol 148(l-2):29-47.
Whittington, R. J., D. J. Begg, K. de Silva, K. M. Plain, and A. C. Purdie. 2013.
Comparative immunological and microbiological aspects of paratuberculosis as a model
mycobacterial infection. Vet. Immunol. Immunopathol.
Whittington, R. J. and P. A. Windsor. 2009. In utero infection of cattle with
Mycobacterium avium subsp. paratuberculosis: a critical review and meta-analysis. Vet J
179(1 ):60-69.
98
Zhou, L., R. Somasundaram, R. F. Nederhof, G. Dijkstra, K. N. Faber, M. P.
Peppelenbosch, and G. M. Fuhler. 2012. Impact of human granulocyte and monocyte
isolation procedures on functional studies. Clin Vaccine Immunol 19(7): 1065-1074.
DISCUSSION ET CONCLUSION
La paratuberculose bovine est reconnue comme etant une infection bacterienne qui
engendre un dereglement du systeme immunitaire des animaux atteints. Cependant,
beaucoup de controverse existe au niveau des etapes menant a cette destabilisation generate
de la reponse immunitaire. Lors de l’analyse des resultats obtenus pendant ce projet,
plusieurs interrogations surviennent quant a la veracite du modele theorique adopte par la
communaute scientifique. Effectivement, il est possible de se questionner sur les
mecanismes d’implantation de la maladie, ainsi que le type de reponse immunitaire mise en
place au niveau systemique. Plusieurs etudes menees precedemment avaient pour but
d ’analyser la capacite des PBMC a produire une reponse de type Thi ou Th2 dans un
contexte in vitro. Cependant, en supposant 1’induction d’une reponse immunitaire dirigee
contre un pathogene intracellulaire chez les animaux infectes, une grande quantite de
cellules de type Thi se retrouveront au site d’entree de l’organisme pathogene dans le but de
combattre l’infection. II semble alors logique qu’en isolant les PBMC du sang peripherique,
une plus grande proportion de lymphocytes Th2 s’y retrouveront. Dans cette optique, pour
un isolement du mSme nombre de cellules immunes, il est normal d ’obtenir une capacite de
production des cytokines de type T h2 plus elevee que chez des animaux sains ayant des
proportions plus equilibrees de chacun des types cellulaires. C ’est pour cette raison que le
dosage des cytokines plasmatiques a ete selectionne comme marqueur de la reponse
immunitaire systemique mise en place. II est toutefois evident que ce genre de dosage ne
considere pas la reponse immunitaire locale. D ’un autre cote, etant donne la secretion tres
localisee des cytokines dans des conditions normales, l’observation d’un dereglement
sanguin aussi important que celui mesure sous-entend une tres forte reponse locale de type
Thi7 chez les vaches dans les stades plus avances dans la maladie.
Plusieurs etudes tendent a demontrer une possible implication des lymphocytes Thi7 dans
1’evolution de la paratuberculose bovine (Allen et al., 2011, Robinson et al., 2011).
Neanmoins, a notre connaissance, il s’agit de la premiere fois ou une difference est
rapportee lors du dosage sanguin d’une cytokine specifique au type Thi7 , l’IL-17. Cette
decouverte est potentiellement liee a la classification des animaux selon les deux tests
diagnostiques utilises. En effet, les etudes portant sur l’immunite associee a la
100
paratuberculose utilisent un diagnostic unique des animaux, soit par culture fecale ou par
ELISA. Dans le cas present, 1’utilisation des deux outils accorde la possibility d ’une
classification plus elaboree, qui permet 1’appreciation de differences imperceptibles lors
d’une classification selon la culture fecale seule. II est certain que 1’utilisation systematique
des deux outils diagnostiques n’est pas envisageable dans un contexte de depistage.
Toutefois, dans le but d’ameliorer la comprehension
du developpement de
la
paratuberculose, 1’utilisation de tous les outils a la disposition permettra peut-etre de mettre
en evidence des particularites telles que celles rapportes dans le deuxieme article.
L’osteopontine etant impliquee dans un grand nombre de processus dans le corps et qu’il
etait inconnu si les concentrations sanguines et du lait variait en fonction du stade de
lactation, il a fallu etablir les taux d’osteopontine dans les deux fluides. Ainsi, il a ete
possible d ’affirmer qu’il existe un taux basal dans le sang qui demeure constant tout au
long de la lactation. De ce fait, les differences observees au travers nos groupes peuvent
etre consideres comme etant reelles et non dependantes du stade de lactation au moment du
prelevement. Pour la concentration dans le lait, etant donne sa variation au courant de la
lactation, il est malheureusement impossible d ’entrevoir un dosage qui serait moins invasif
pour les prelevements qu’une prise de sang. De plus, lors des essais d ’infection des
macrophages in vitro, une difference d’expression de quelques genes relies a 1’immunite a
ete mesuree selon le genotype du gene de l’osteopontine. II semblerait que selon les
mutations observees dans le promoteur du gene, celui-ci soit regule differemment et ait le
potentiel d ’affecter l’expression d ’autres genes immuns. Ainsi, si le gene peut etre regule
differemment selon la genetique de son promoteur, il est envisageable que certains
genotypes engendrent une susceptibility ou une resistance accrue aux infections par MAP.
Quant a l’approche in vitro utilisee avec 1’infection des macrophages isoles a partir des
monocytes sanguins, elle permet de fortifier les hypotheses mises en place. D ’une part, les
cytokines subissant une forte augmentation de leur expression sont pour la plupart
impliquees dans la voie de differenciation des lymphocytes T nai'fs en lymphocytes Thn.
D’autre part, 1’augmentation de YIL-10 tres tot apres l’infection prone en faveur d ’une
inhibition de I’inflammation pour permettre au pathogene de demeurer invisible du systeme
immunitaire pendant qu’il s’etablit. L’analyse de la reponse des macrophages face au
101
pathogene a permis l’acquisition de connaissances tres interessantes, meme si ce type
cellulaire seul ne donne en aucun cas une estimation globale des processus inities par le
systeme immunitaire au complet. La mesure de l’expression de TGF-fi est un bon exemple
en ce sens, puisque chez les macrophages, son expression n’est augmentee que d ’environ
une fois et demie, alors que pour amorcer la differenciation en lymphocytes Thi7 , la
presence marquee est requise. Done, cela propose qu’il y ait probablement d ’autres types
cellulaires impliques dans le processus d ’implantation d’une reponse lymphocytaire de type
T„I 7 .
Dans un autre ordre d’idee, l’infection in vitro a egalement cause une augmentation tardive
et soutenue de l’expression de YIL-8 ce qui insinue un appel de monocytes constant au site
d ’infection et ce seulement quelques heures apres 1’infection initiale. Ainsi. MAP agit tout
d’abord en s’assurant de penetrer les defenses de son hote en passant inapergu, puis amorce
un appel continu de cellules etant des niches potentielles, dans le but d ’assurer sa
dissemination dans un espace restreint.
Dans tous les cas, il est evident que la paratuberculose cause une reaction proinflammatoire, que ce soit par les dosages de cytokines plasmatiques ou une augmentation
d’lFN-y et d’IL-17 sont observees ou l’analyse de l’expression genique pour laquelle le
TNF-a, IL -ip et IL-6 furent identifies comme fortement surexprimes. Toutefois, il demeure
intriguant de constater en tout debut d ’infection l ’expression de YlL-10 en aussi grande
quantite. II serait interessant de valider si ce phenomene est cause par MAP dans le but
d ’assurer 1’implantation d ’une infection plus efficace.
En conclusion, les experiences effectuees ont permis d’etablir des pistes afin de mieux
comprendre la reaction immunitaire engendree lors d ’infection a MAP en plus de prendre
conscience de l’ampleur de la dysfonction systemique generee chez les animaux infectes. II
est maintenant possible d’envisager que la derive d ’une reponse T hi vers Th2 n ’est pas
fondee, puisque les taux d ’IFN-y sont plus eleves chez les vaches positives que chez les
vaches negatives. De plus, 1’implication des lymphocytes Thn semble evidente dans la
progression de la maladie, lorsque les vaches sont classees selon les trois groupes etablis
lors du diagnostic. Les resultats obtenus dans l’essai de lymphoproliferation donnent espoir
d’arriver a identifier un marqueur expliquant une telle inhibition de la proliferation chez les
102
vaches ayant la paratuberculose. Dans le cas echeant, ce meme marqueur pourrait
possiblement devenir un outil complementaire au diagnostic de la maladie.
En perspective, le genotypage du gene SPP1 des vaches saines et infectees pourrait amener
a decouvrir des mutations conferant une plus grande susceptibilite ou bien une resistance a
la paratuberculose. De plus, une analyse plus approfondie des mecanismes menant a
l ’implantation de la voie Thn devra etre menee. Etant donne que l’expression genique des
macrophages semble indiquer une polarisation des les premieres heures vers cette voie, il
sera necessaire de comprendre les raisons pour lesquelles la cytokine IL-17 n ’apparait dans
le sang que plusieurs annees apres 1’infection initiale. De plus, il serait probablement utile
de proceder a une etude chez des macrophages provenant de vaches saines et de vaches
infectees pour mieux cibler au niveau genetique les causes de 1’implantation d ’une infection
efficace chez certains animaux alors que d ’autres reussissent a controler le pathogene et
s’en departir. II n’en demeure pas moins qu’une grande part de recherche devra encore etre
effectuee pour arriver a mieux comprendre le faible rendement des outils diagnostiques et
egalement identifier des methodes de controle efficaces a l’interieur des troupeaux infectes.
REMERCIEMENTS
Tout d’abord, j ’aimerais remercier tout specialement Dre Nathalie Bissonnette pour
m ’avoir permis d ’effectuer mon projet de maftrise dans son laboratoire, mais egalement
pour son aide et son devouement tout au long de mes etudes graduees.
Un gros merci a Catherine Thibault egalement, assistante de recherche dans le laboratoire,
pour son appui lors des experimentations et des nombreux prelevements sur les vaches.
Frederic Beaudoin pour ses connaissances en immunologie, Karine Deschene pour son aide
technique, Steve Methot pour les statistiques meritent aussi des remerciements.
Encore merci aux personnes de l’etable du Centre de recherche et de developpement sur le
bovin laitier et le pore de Sherbrooke, pour leur support lors des multiples prelevements.
Finalement, un merci particulier a ma conjointe Claudie Lariviere pour m’avoir encourage
et endure pendant toutes mes etudes, mes freres Daniel et Louis-Olivier ainsi que ma mere
Ghislaine Lajoie et Jean mon pere.
Merci
LISTE DES PUBLICATIONS
Alain, K., N. A. Karrow, C. Thibault, J. St-Pierre, M. Lessard, and N. Bissonnette. 2009.
Osteopontin: an early innate immune marker of Escherichia coli mastitis harbors genetic
polymorphisms with possible links with resistance to mastitis. BMC Genomics 10:444.
Allen, A. J., K. T. Park, G. M. Barrington, K. K. Lahmers, G. S. Abdellrazeq, H. M. Rihan,
S. Sreevatsan, C. Davies, M. J. Hamilton, and W. C. Davis. 2011. Experimental infection of
a bovine model with human isolates of Mycobacterium avium subsp. paratuberculosis. Vet
Immunol Immunopathol 141(3-4):258-266.
Ardavin, C. 2003. Origin, precursors and differentiation of mouse dendritic cells. Nat Rev
Immunol 3(7):582-590.
Awasthi, A., G. Murugaiyan, and V. K. Kuchroo. 2008. Interplay between effector T hl7
and regulatory T cells. J Clin Immunol 28(6):660-670.
Beard, P. M., M. J. Daniels, D. Henderson, A. Pirie, K. Rudge, D. Buxton, S. Rhind, A.
Greig, M. R. Hutchings, I. McKendrick, K. Stevenson, and J. M. Sharp. 2001.
Paratuberculosis infection of nonruminant wildlife in Scotland. J Clin Microbiol
39(4): 1517-1521.
Bergamini, C. M., S. Gambetti, A. Dondi, and C. Cervellati. 2004. Oxygen, reactive
oxygen species and tissue damage. Curr Pharm Des 10( 14): 1611-1626.
Brand, S. 2009. Crohn's disease: T hl, T hl7 or both? The change of a paradigm: new
immunological and genetic insights implicate T h l7 cells in the pathogenesis of Crohn's
disease. Gut 58(8): 1152-1167.
Bull, T. J., E. J. McMinn, K. Sidi-Boumedine, A. Skull, D. Durkin, P. Neild, G. Rhodes, R.
Pickup, and J. Hermon-Taylor. 2003. Detection and verification of Mycobacterium avium
subsp. paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals
with and without Crohn's disease. J Clin Microbiol 4 1(7):2915-2923.
Caprioli, F., F. Pallone, and G. Monteleone. 2008. T hl7 immune response in IBD: A new
pathogenic mechanism. Journal of Crohn’s & colitis 2(4):291-295.
105
Collins, M. T., S. J. Wells, K. R. Petrini, J. E. Collins, R. D. Schultz, and R. H. Whitlock.
2005. Evaluation of five antibody detection tests for diagnosis of bovine paratuberculosis.
Clin Diagn Lab Immunol 12(6):685-692.
Corn, J. L„ E. J. Manning, S. Sreevatsan, and J. R. Fischer. 2005. Isolation of
Mycobacterium avium subsp. paratuberculosis from free-ranging birds and mammals on
livestock premises. Appl Environ Microbiol 71(11):6963-6967.
Coussens, P. M. 2001. Mycobacterium paratuberculosis and the bovine immune system.
Animal health research reviews / Conference of Research Workers in Animal Diseases
2(2):141-161.
Coussens, P. M., N. Verman, M. A. Coussens, M. D. Elftman, and A. M. McNulty. 2004.
Cytokine gene expression in peripheral blood mononuclear cells and tissues of cattle
infected with Mycobacterium avium subsp. paratuberculosis: evidence for an inherent
proinflammatory gene expression pattern. Infect Immun 72(3): 1409-1422.
De Haes, W., C. Pollard, G. Vanham, and J. Rejman. (2012). "Wrapped Up" Vaccines in
the Context of HIV-1 Immunotherapy, in Immunodeficiency. Prof. Krassimir Metodiev
(Ed.). ISBN: 978-953-51-0791-0. Publisher: InTech.DOI: 10.5772/51583
De Voss, J. J., K. Rutter, B. G. Schroeder, H. Su, Y. Zhu, and C. E. Barry, 3rd. 2000. The
salicylate-derived mycobactin siderophores of Mycobacterium tuberculosis are essential for
growth in macrophages. Proc Natl Acad Sci U S A 97(3): 1252-1257.
Dieguez, F. J., I. Arnaiz, M. L. Sanjuan, M. J. Vilar, M. Lopez, and E. Yus. 2007.
Prevalence of serum antibodies to Mycobacterium avium subsp. paratuberculosis in cattle
in Galicia (northwest Spain). Prev Vet Med 82(3-4):321-326.
Ettinghausen, S. E., E. H. Lipford, 3rd, J. J. Mule, and S. A. Rosenberg. 1985.
Recombinant interleukin 2 stimulates in vivo proliferation of adoptively transferred
lymphokine-activated killer (LAK) cells. J Immunol 135(5):3623-3635.
Fawcett, A. R., P. J. Goddard, W. A. McKelvey, D. Buxton, H. W. Reid, A. Greig, and A.
J. Macdonald. 1995. Johne's disease in a herd of farmed red deer. Vet Rec 136(7): 165-169.
Ferwerda, G., B. J. Kullberg, D. J. de Jong, S. E. Girardin, D. M. Langenberg, R. van
Crevel, T. H. Ottenhoff, J. W. Van der Meer, and M. G. Netea. 2007. Mycobacterium
paratuberculosis is recognized by Toll-like receptors and NOD2. J Leukoc Biol 82(4): 10111018.
106
Fields, P. E., S. T. Kim, and R. A. Flavell. 2002. Cutting edge: changes in histone
acetylation at the EL-4 and IFN-gamma loci accompany Thl/Th2 differentiation. J Immunol
169(2):647-650.
Fiorentino, D. F., A. Zlotnik, P. Vieira, T. R. Mosmann, M. Howard, K. W. Moore, and A.
O'Garra. 1991. IL-10 acts on the antigen-presenting cell to inhibit cytokine production by
Thl cells. J Immunol 146(10):3444-3451.
Giacopelli, F., R. Marciano, A. Pistorio, P. Catarsi, S. Canini, G. Karsenty, and R.
Ravazzolo. 2004. Polymorphisms in the osteopontin promoter affect its transcriptional
activity. Physiol Genomics 20(l):87-96.
Good, M., T. Clegg, H. Sheridan, D. Yearsely, T. O'Brien, J. Egan, and P. Mullowney.
2009. Prevalence and distribution of paratuberculosis (Johne's disease) in cattle herds in
Ireland. Ir Vet J 62(9):597-606.
Guo, L., J. Hu-Li, J. Zhu, C. J. Watson, M. J. Difilippantonio, C. Pannetier, and W. E. Paul.
2002. In TH2 cells the 114 gene has a series of accessibility states associated with
distinctive probabilities of IL-4 production. Proc Natl Acad Sci U S A 99(16): 1062310628.
Guo, W„ C. Luo, C. Wang, Y. Zhu, X. Wang, X. Gao, and W. Yao. 2012. Protection
against T h l7 cells differentiation by an interleukin-23 receptor cytokine-binding homology
region. PLoS One 7(9):e45625.
Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O'Garra, and K. M. Murphy.
1993. Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced
macrophages. Science 260(5107):547-549.
Johne, H. A., Frothingham, L. . 1895. Ein eigentumlicher Fall von Tuberculose beim Rind
[A peculiar case of tuberculosis in a cow], Deutsche Zeitschrift fur Tiermedizin und
vergleinchende Pathologie 21:438-455.
Jones, B. and J. Chen. 2006. Inhibition of IFN-gamma transcription by site-specific
methylation during T helper cell development. Embo J 25(11):2443-2452.
Jones, P. H., T. B. Farver, B. Beaman, B. Cetinkaya, and K. L. Morgan. 2006. Crohn’s
disease in people exposed to clinical cases of bovine paratuberculosis. Epidemiol Infect
134(l):49-56.
107
Karcher, E. L., D. O. Bayles, J. P. Bannantine, D. C. Beitz, and J. R. Stabel. 2008.
Osteopontin: a novel cytokine involved in the regulation of Mycobacterium avium
subspecies paratuberculosis infection in periparturient dairy cattle. J. Dairy Sci. 91(8):30793091.
Kohan, M., R. Breuer, and N. Berkman. 2009. Osteopontin induces airway remodeling and
lung fibroblast activation in a murine model of asthma. Am J Respir Cell Mol Biol
41(3):290-296.
Korn, T., E. Bettelli, M. Oukka, and V. K. Kuchroo. 2009. IL-17 and T h l7 Cells. Annu
Rev Immunol 27:485-517.
Kuehnel, M. P., R. Goethe, A. Habermann, E. Mueller, M. Rohde, G. Griffiths, and P.
Valentin-Weigand. 2001. Characterization of the intracellular survival of Mycobacterium
avium ssp. paratuberculosis: phagosomal pH and fusogenicity in J774 macrophages
compared with other mycobacteria. Cell Microbiol 3(8):551-566.
Larsen, A. B. and J. M. Miller. 1978. Mammary gland exposure of cows to Mycobacterium
paratuberculosis. Am J Vet Res 39(12): 1972-1974.
Liaw, L., D. E. Birk, C. B. Balias, J. S. Whitsitt, J. M. Davidson, and B. L. Hogan. 1998.
Altered wound healing in mice lacking a functional osteopontin gene (sppl). J. Clin. Invest.
101 (7): 1468-1478.
Lombard, J. E., I. A. Gardner, S. R. Jafarzadeh, C. P. Fossler, B. Harris, R. T. Capsel, B. A.
Wagner, and W. O. Johnson. 2013. Herd-level prevalence of Mycobacterium avium subsp.
paratuberculosis infection in United States dairy herds in 2007. Prev Vet Med 108(23):234-238.
Machugh, D. E., M. Taraktsoglou, K. E. Killick, N. C. Nalpas, J. A. Browne, D. E. P. S, K.
Hokamp, E. Gormley, and D. A. Magee. 2012. Pan-genomic analysis of bovine monocytederived macrophage gene expression in response to in vitro infection with Mycobacterium
avium subspecies paratuberculosis. Vet Res 43(1 ):25.
Manning, E. J., H. Steinberg, K. Rossow, G. R. Ruth, and M. T. Collins. 1998. Epizootic of
paratuberculosis in farmed elk. J Am Vet Med Assoc 213(9): 1320-1322, 1280-1321.
Manning, E. J. B. and M. T. Collins. 2010. History of Paratuberculosis. Pages 1-9 in
Paratuberculosis: Organism, Disease, Control. M. A. Behr and D. M. Collins, ed. CAB
International, Preston, UK, ISBN: 978 1 84593 613 6
108
Manz, M. G., D. Traver, T. Miyamoto, I. L. Weissman, and K. Akashi. 2001. Dendritic cell
potentials of early lymphoid and myeloid progenitors. Blood 97(11):3333-3341.
Massa, M., M. Passalia, S. M. Manzoni, R. Campanelli, L. Ciardelli, G. P. Yung, S.
Kamphuis, A. Pistorio, V. Meli, A. Sette, B. Prakken, A. Martini, and S. Albani. 2007.
Differential recognition of heat-shock protein dnaJ-derived epitopes by effector and Treg
cells leads to modulation of inflammation in juvenile idiopathic arthritis. Arthritis Rheum
56(5): 1648-1657.
Massey, D. C. and M. Parkes. 2007. Genome-wide association scanning highlights two
autophagy genes, ATG16L1 and IRGM, as being significantly associated with Crohn's
disease. Autophagy 3(6):649-651.
Maynard, C. L., L. E. Harrington, K. M. Janowski, J. R. Oliver, C. L. Zindl, A. Y.
Rudensky, and C. T. Weaver. 2007. Regulatory T cells expressing interleukin 10 develop
from Foxp3+ and Foxp3- precursor cells in the absence of interleukin 10. Nat Immunol
8(9):931-941.
McKenna, S. L., G. P. Keefe, H. W. Barkema, and D. C. Sockett. 2005. Evaluation of three
ELISAs for Mycobacterium avium subsp. paratuberculosis using tissue and fecal culture as
comparison standards. Vet Microbiol 110(1-2): 105-111.
Momotani, E., D. L. Whipple, A. B. Thiermann, and N. F. Cheville. 1988. Role of M cells
and macrophages in the entrance of Mycobacterium paratuberculosis into domes of ileal
Peyer's patches in calves. Vet Pathol 25(2): 131-137.
Mucha, R., M. R. Bhide, E. B. Chakurkar, M. Novak, and I. Mikula, Sr. 2009. Toll-like
receptors TLR1, TLR2 and TLR4 gene mutations and natural resistance to Mycobacterium
avium subsp. paratuberculosis infection in cattle. Vet Immunol Immunopathol 128(4):381388.
Murphy, K. M. and S. L. Reiner. 2002. The lineage decisions of helper T cells. Nat Rev
Immunol 2(12):933-944.
Mus, A. M., F. Cornelissen,
Hendriks, and E. Lubberts.
inhibiting T-bet and FoxP3
interleukin-21, in autoimmune
P. S. Asmawidjaja, J. P. van Hamburg, L. Boon, R. W.
2010. Interleukin-23 promotes T h l7 differentiation by
and is required for elevation of interleukin-22, but not
experimental arthritis. Arthritis Rheum 62(4): 1043-1050.
109
Nagata, T. and Y. Koide. 2010. Induction of Specific CD8 T Cells against Intracellular
Bacteria by CD8 T-Cell-Oriented Immunization Approaches. J Biomed Biotechnol
2010:764542.
Naser, S. A., G. Ghobrial, C. Romero, and J. F. Valentine. 2004. Culture of Mycobacterium
avium subspecies paratuberculosis from the blood of patients with Crohn's disease. Lancet
364(9439): 1039-1044.
Nau, G. J., L. Liaw, G. L. Chupp, J. S. Berman, B. L. Hogan, and R. A. Young. 1999.
Attenuated host resistance against Mycobacterium bovis BCG infection in mice lacking
osteopontin. Infect Immun 67(8):4223-4230.
Nell, S., S. Suerbaum, and C. Josenhans. 2010. The impact of the microbiota on the
pathogenesis of IBD: lessons from mouse infection models. Nat Rev Microbiol 8(8):564577.
Nielsen, S. S., H. Bjerre, and N. Toft. 2008. Colostrum and milk as risk factors for infection
with Mycobacterium avium subspecies paratuberculosis in dairy cattle. J. Dairy Sci.
91(12):4610-4615.
O'Regan, A. W., J. M. Hayden, and J. S. Berman. 2000. Osteopontin augments CD3mediated interferon-gamma and CD40 ligand expression by T cells, which results in IL-12
production from peripheral blood mononuclear cells. J Leukoc Biol 68(4):495-502.
Ouyang, W., S. H. Ranganath, K. Weindel, D. Bhattacharya, T. L. Murphy, W. C. Sha, and
K. M. Murphy. 1998. Inhibition of T hl development mediated by GATA-3 through an IL4-independent mechanism. Immunity 9(5):745-755.
Paixao, T. A., F. P. Poester, A. V. Carvalho Neta, A. M. Borges, A. P. Lage, and R. L.
Santos. 2007. NRAMP1 3' untranslated region polymorphisms are not associated with
natural resistance to Brucella abortus in cattle. Infect Immun 75(5):2493-2499.
Parham, P. 2003. Le systeme immunitaire.
Patarca, R„ G. J. Freeman, R. P. Singh, F. Y. Wei, T. Durfee, F. Blattner, D. C. Regnier, C.
A. Kozak, B. A. Mock, H. C. Morse, 3rd, and et al. 1989. Structural and functional studies
of the early T lymphocyte activation 1 (Eta-1) gene. Definition of a novel T cell-dependent
response associated with genetic resistance to bacterial infection. J Exp Med 170(1): 145161.
110
Pavlik, I., J. Bartl, L. Dvorska, P. Svastova, R. du Maine, M. Machackova, W. Yayo Ayele,
and A. Horvathova. 2000. Epidemiology of paratuberculosis in wild ruminants studied by
restriction fragment length polymorphism in the Czech Republic during the period 19951998. Vet Microbiol 77(3-4):231-251.
Pinedo, P. J., C. D. Buergelt, G. A. Donovan, P. Melendez, L. Morel, R. Wu, T. Y.
Langaee, and D. O. Rae. 2009. Association between CARD15/NOD2 gene polymorphisms
and paratuberculosis infection in cattle. Vet Microbiol 134(3-4):346-352.
Power, S. B., J. Haagsma, and D. P. Smyth. 1993. Paratuberculosis in farmed red deer
(Cervus elaphus) in Ireland. Vet Rec 132(9):213-216.
Pozzato, N., K. Capello, A. Comin, N. Toft, S. S. Nielsen, G. Vicenzoni, and N. Arrigoni.
2011. Prevalence of paratuberculosis infection in dairy cattle in Northern Italy. Prev Vet
Med 102(l):83-86.
Pradhan, A. K., R. M. Mitchell, A. J. Kramer, M. J. Zurakowski, T. L. Fyock, R. H.
Whitlock, J. M. Smith, E. Hovingh, J. A. Van Kessel, J. S. Karns, and Y. H. Schukken.
2011. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis in a
longitudinal study of three dairy herds. J Clin Microbiol 49(3):893-901.
Quadri, L. E., J. Sello, T. A. Keating, P. H. Weinreb, and C. T. Walsh. 1998. Identification
of a Mycobacterium tuberculosis gene cluster encoding the biosynthetic enzymes for
assembly of the virulence-conferring siderophore mycobactin. Chem Biol 5(1 1):631-645.
Rastislav, M. and B. Mangesh. 2012. BoLA-DRB3 exon 2 mutations associated with
paratuberculosis in cattle. Vet J 192(3):517-519.
Riemann, H., M. R. Zaman, R. Ruppanner, O. Aalund, J. B. Jorgensen, H. Worsaae, and D.
Behymer. 1979. Paratuberculosis in cattle and free-living exotic deer. J Am Vet Med Assoc
174(8):841-843.
Robinson, M. W., R. O'Brien, C. G. Mackintosh, R. G. Clark, and J. F. Griffin. 2011.
Immunoregulatory cytokines are associated with protection from immunopathology
following Mycobacterium avium subspecies paratuberculosis infection in red deer. Infect
Immun 79(5):2089-2097.
Rohonczy, E. B., A. V. Balachandran, T. W. Dukes, J. B. Payeur, J. C. Rhyan, D. A. Saari,
T. L. Whiting, S. H. Wilson, and J. L. Jarnagin. 1996. A comparison of gross pathology,
Ill
histopathology, and mycobacterial culture for the diagnosis of tuberculosis in elk (Cervus
elaphus). Can J Vet Res 60(2): 108-114.
Ruiz-Larranaga, O., J. M. Garrido, M. Iriondo, C. Manzano, E. Molina, A. P. Koets, V. P.
Rutten, R. A. Juste, and A. Estonba. 2010. Genetic association between bovine NOD2
polymorphisms and infection by Mycobacterium avium subsp. paratuberculosis in
Holstein-Friesian cattle. Anim Genet 41 (6):652-655.
Sigurethardottir, O. G., M. Valheim, and C. M. Press. 2004. Establishment of
Mycobacterium avium subsp. paratuberculosis infection in the intestine of ruminants. Adv
Drug Deliv Rev 56(6):819-834.
Sockett, D. C., D. J. Carr, and M. T. Collins. 1992. Evaluation of conventional and
radiometric fecal culture and a commercial DNA probe for diagnosis of Mycobacterium
paratuberculosis infections in cattle. Can J Vet Res 56(2): 148-153.
Stabel, J. R. 1996. Production of gamma-interferon by peripheral blood mononuclear cells:
an important diagnostic tool for detection of subclinical paratuberculosis. J Vet Diagn
Invest 8(3):345-350.
Stabel, J. R. 2000. Transitions in immune responses to Mycobacterium paratuberculosis.
Vet Microbiol 77(3-4):465-473.
Stabel, J. R. and S. Robbe-Austerman. 2011. Early immune markers associated with
Mycobacterium avium subsp. paratuberculosis infection in a neonatal calf model. Clin
Vaccine Immunol 18(3):393-405.
Stewart, L. C., A. S. Day, J. Pearson, M. L. Barclay, R. B. Gearry, R. L. Roberts, and R. W.
Bentley. 2010. SLC11A1 polymorphisms in inflammatory bowel disease and
Mycobacterium avium subspecies paratuberculosis status. World J Gastroenterol
16(45):5727-5731.
Streeter, R. N., G. F. Hoffsis, S. Bech-Nielsen, W. P. Shulaw, and D. M. Rings. 1995.
Isolation of Mycobacterium paratuberculosis from colostrum and milk of subclinically
infected cows. Am J Vet Res 56(10): 1322-1324.
Sturgill-Koszycki, S., P. H. Schlesinger, P. Chakraborty, P. L. Haddix, H. L. Collins, A. K.
Fok, R. D. Allen, S. L. Gluck, J. Heuser, and D. G. Russell. 1994. Lack of acidification in
Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase.
Science 263(5147):678-681.
112
Sun-Wada, G. H., H. Tabata, N. Kawamura, M. Aoyama, and Y. Wada. 2009. Direct
recruitment of H+-ATPase from lysosomes for phagosomal acidification. J Cell Sci 122(Pt
14):2504-2513.
Sweeney, R. W., R. H. Whitlock, S. McAdams, and T. Fyock. 2006. Longitudinal study of
ELISA seroreactivity to Mycobacterium avium subsp. paratuberculosis in infected cattle
and culture-negative herd mates. J Vet Diagn Invest 18(l):2-6.
Sweeney, R. W., R. H. Whitlock, and A. E. Rosenberger. 1992. Mycobacterium
paratuberculosis isolated from fetuses of infected cows not manifesting signs of the disease.
Am J Vet Res 53(4):477-480.
Tuci, A., F. Tonon, L. Castellani, A. Sartini, G. Roda, M. Marocchi, A. Caponi, A.
Munarini, G. Rosati, G. Ugolini, L. Fuccio, M. Scagliarini, F. Bazzoli, and A. Belluzzi.
2011. Fecal detection of Mycobacterium avium paratuberculosis using the IS900 DNA
sequence in Crohn's disease and ulcerative colitis patients and healthy subjects. Dig Dis Sci
56(10):2957-2962.
Van Damme, J., J. Van Beeumen, R. Conings, B. Decock, and A. Billiau. 1989.
Purification of granulocyte chemotactic peptide/interleukin-8 reveals N-terminal sequence
heterogeneity similar to that of beta-thromboglobulin. Eur J Biochem 181(2):337-344.
van Hamburg, J. P., P. S. Asmawidjaja, N. Davelaar, A. M. Mus, E. M. Colin, J. M. Hazes,
R. J. Dolhain, and E. Lubberts. 2011. T hl7 cells, but not Thl cells, from patients with early
rheumatoid arthritis are potent inducers of matrix metalloproteinases and proinflammatory
cytokines upon synovial fibroblast interaction, including autocrine interleukin-17A
production. Arthritis Rheum 63(l):73-83.
van Scott, M. R., J. P. Justice, J. F. Bradfield, E. Enright, A. Sigounas, and S. Sur. 2000.
IL-10 reduces Th2 cytokine production and eosinophilia but augments airway reactivity in
allergic mice. Am J Physiol Lung Cell Mol Physiol 278(4):L667-674.
Verschoor, C. P., S. D. Pant, Q. You, F. S. Schenkel, D. F. Kelton, and N. A. Karrow.
2010. Polymorphisms in the gene encoding bovine interleukin-10 receptor alpha are
associated with Mycobacterium avium ssp. paratuberculosis infection status. BMC Genet
11:23.
Weiss, D. J., C. D. Souza, O. A. Evanson, M. Sanders, and M. Rutherford. 2008. Bovine
monocyte TLR2 receptors differentially regulate the intracellular fate of Mycobacterium
avium subsp. paratuberculosis and Mycobacterium avium subsp. avium. J Leukoc Biol
83(l):48-55.
113
Whitlock, R. H., S. J. Wells, R. W. Sweeney, and J. Van Tiem. 2000. ELISA and fecal
culture for paratuberculosis (Johne's disease): sensitivity and specificity of each method.
Vet Microbiol 77(3-4):387-398.
Whittington, R. J. and P. A. Windsor. 2009. In utero infection of cattle with
Mycobacterium avium subsp. paratuberculosis: a critical review and meta-analysis. Vet J
179(l):60-69.
Windsor, P. A. and R. J. Whittington. 2010. Evidence for age susceptibility of cattle to
Johne's disease. Vet J 184(1 ):37-44.
Woodbury, M. R., M. Chirino-Trejo, and B. Mihajlovic. 2008. Diagnostic detection
methods for Mycobacterium avium subsp. paratuberculosis in white-tailed deer. Can Vet J
49(7):683-688.
Yamazaki, K., Y. Onouchi, M. Takazoe, M. Kubo, Y. Nakamura, and A. Hata. 2007.
Association analysis of genetic variants in IL23R, ATG16L1 and 5 p l3.1 loci with Crohn’s
disease in Japanese patients. J Hum Genet 52(7):575-583.
Yang, J., T. L. Murphy, W. Ouyang, and K. M. Murphy. 1999. Induction of interferongamma production in Thl CD4+ T cells: evidence for two distinct pathways for promoter
activation. Eur J Immunol 29(2):548-555.
Zhu, J., D. Jankovic, A. J. Oler, G. Wei, S. Sharma, G. Hu, L. Guo, R. Yagi, H. Yamane,
G. Punkosdy, L. Feigenbaum, K. Zhao, and W. E. Paul. 2012. The transcription factor Tbet is induced by multiple pathways and prevents an endogenous Th2 cell program during
Thl cell responses. Immunity 37(4):660-673.