exemple-type

publicité
Année Universitaire 2013 – 2014
Unité d’Enseignement 1
Concours Blanc
30 pages
54 questions
105 minutes
Pour ce concours blanc comme pour la deuxième épreuve, nous avons contacté
le professeur Nebois qui nous a apporté ses corrections mais faute de temps
(délai d’impression), celles-ci n’ont pu apparaître dans la version imprimée de
l’épreuve. La version imprimée de l’épreuve n’est donc pas celle corrigée par le
professeur Nebois.
Les modifications apportées seront publiées a posteriori sous forme d’erratas.
Les Dr. MOYRET-LALLE, Dr. VLAEMINCK et le Dr. ROUCHER (ED) ont relu
et corrigé leur partie.
Alexandre BONNEL
Maxime DIAZ
Paul HUBERT
Jérémy MURAT
Thomas SANCHEZ
06/12/13
PARTIE CHIMIE ORGANIQUE
Question 1 :(1 point)
Concernant les molécules ci-dessous :
3
2
1
4
5
Parmi les propositions suivantes, la(les)quelle(s) est (sont) vraie(s) :
A.
B.
C.
D.
E.
1 est de configuration (E)
2 est de configuration (Z)
3 est de configuration (E)
4 est de configuration (R)
5 est de configuration (S)
Le schéma suivant concerne les questions 2 et 3
Question 2 : (1 point)
D
B
C
A (2S,3R)
Parmi les propositions suivantes, la(les)quelle(s) est (sont) vraie(s) :
A.
B.
C.
D.
E.
Le composé A est un alcool primaire.
Le mécanisme mis en jeu dans cette réaction est une substitution nucléophile.
Le mécanisme mis en jeu dans cette réaction est une élimination de type E2.
La réaction est régiosélective.
Le composé C est chiral.
UE 1 – CCB
Page 2 sur 30
Question 3 : (10/0)
3
2
1
4
5
Parmi les composés ci-dessus, le(les)quel(s) peut (peuvent) correspondre à D, B ou C :
A.
B.
C.
D.
E.
1
2
3
4
5
Le schéma ci-dessous concerne les questions 4 et 5
F
w
Y
G
UE 1 – CCB
Page 3 sur 30
Question 4 : (1 point)
Parmi les propositions suivantes, la(les)quelle(s) est (sont) vraie(s) :
A.
B.
C.
D.
E.
Le compose W est un alcool primaire.
Le composé Y est un ester.
Le composé F est un ester.
Le composé G est un alcool primaire.
Toutes les réponses précédentes sont fausses.
Question 5 : (10/0)
3
2
1
5
4
Parmi les molécules ci-dessus, la(les)quelle(s) peut (peuvent) correspondre à F ou G.
A. 1
B.
C.
D.
E.
2
3
4
5
UE 1 – CCB
Page 4 sur 30
Le schéma ci-dessous concerne les questions 6 et 7
L
K
J
Z
M
U
H
Question 6 : (1 point)
Parmi les propositions suivantes, la(les)quelle(s) est (sont) vraie(s) :
A.
B.
C.
D.
E.
Le composé Z est une imine.
La réaction de l’éthanamine avec M est une réaction régiosélective.
K+L est un mélange racémique.
U est un chlorure d’acide et J une cétone.
H est le dichromate de potassium.
UE 1 – CCB
Page 5 sur 30
Question 7 : (10/0)
2
1
3
5
4
Parmi les composés ci-dessus, le(les)quel(s) peut (peuvent) correspondre à K,L,J ou H.
A.
B.
C.
D.
E.
1
2
3
4
5
PARTIE CHIMIE-PHYSIQUE
Question 8 : (1 point)
A.
B.
C.
D.
Un élément métalloïde appartient au bloc d du tableau périodique.
Le spectre d’émission d’un élément est continu.
Le nombre quantique azimutal détermine l’orientation de l’orbitale dans l’espace.
Suivant le modèle VSEPR, pour une molécule de formule AX 5, les doublets non liants
sont toujours équatoriaux.
E. Concernant la molécule ci-dessous, l’Azote est hybridé sp2.
UE 1 – CCB
Page 6 sur 30
Question 9 : (10/0)
a/ Parmi les structures ci-dessous, indiquez celle qui est la plus probable de l’acide
perchlorique HClO4 .
3
2
1
4
5
b/ Parmi les propositions suivantes, indiquez celle qui correspond à la formule VSEPR et à la
forme géométrique, de la structure la plus probable de l’oxacide précédent :
6- AX4
7- AX5
8- AX4
9- AX4E
10- AX5
et
et
et
et
et
tétraédrique
biprisme trigonal
plan carré
tétraédrique
plan carré
Cochez sur votre grille la combinaison juste :
A.
B.
C.
D.
E.
2 et 6
4 et 7
5 et 9
1 et 6
3 et 10
UE 1 – CCB
Page 7 sur 30
Question 10 : (10/0)
Soit la molécule de diphénylméthane :
On sait que le moment dipolaire de la molécule est égal à 1,98 D. Calculez le moment
dipolaire que l’on peut associer à la liaison C-H sachant que les deux liaisons C-H de la
molécule font un angle de 120° (on considère ici les deux liaisons avec le C « central » de la
molécule).
A. µCH =
B. µCH =
Calculez le moment dipolaire de la molécule d’oxétane :
On donne :
Electronégativité : C = 2,55 / O = 3,44 / H = 2,2
Moment dipolaire : CH = 0,4D / CO = 2,5D / CC = 0D
Longueur de liaison : CC = 1,3Å / CH = 1,9Å / CO = 1,1Å
C. 2,1 D
D. 2,5 D
E. 2,9 D
UE 1 – CCB
Page 8 sur 30
Question 11 : (10/0)
Soit la molécule de GeS. Parmi les propositions A à E suivantes représentant les diagrammes
d’orbitales moléculaires, indiquez celle(s) qui est (sont) exacte(s) :
Données: Germanium Z = 32 ; Ge (E4s = -14,3 eV ; E4p = -7,9 eV)
Soufre
Z = 16 ; S (E3s = -20,2 eV ; E3p = -10,4eV)
Question 12 : (5/0)
Parmi les propositions suivantes, indiquez le magnétisme et l’ordre de liaison de la molécule
GeS.
A.
B.
C.
D.
E.
0
1
3
Paramagnétique
Diamagnétique
UE 1 – CCB
Page 9 sur 30
Question 13 : (10/0)
A l’aide des réactions suivantes :
1/2 CH3CH2NH2(s) + 3/2 O2(g) ↔ 1/2 NH3+(g) + CO2(g) + H2O(l)
1/2 LiAlH4(aq) + O2(g) ↔ 1/2 LiAl(OH)4(s)
2 CH3CN(s) + 4 CO2(g) + 2 NH3+(g) + 8 H2O(l) ↔ 4 CH3CH2NH2(aq) + 8 O2(g)
CH3CH2NH2(s) ↔ CH3CH2NH2(aq)
ΔH°1 = +220 kJ
ΔH°2 = +130 kJ
ΔH°3 = - 160 kJ
ΔH°4 = - 100 kJ
Déterminez le ΔH de la réaction suivante (appelée X) :
CH3CN(s) + 1/2 LiAlH4(aq) + 2H2O(l) ↔ CH3CH2NH2(aq) + 1/2 LiAl(OH)4(s)
A.
B.
C.
D.
E.
– 590 kJ
+ 590 kJ
– 610 kJ
La réaction X est endothermique.
Si on ajoute du LiAl(OH)4(s) , la réaction X va évoluer dans le sens indirect.
UE 1 – CCB
Page 10 sur 30
PARTIE BIOCHIMIE
L’énoncé suivant peut servir à répondre aux questions 14 et 15.
Le 5 Décembre 2013 deux chercheurs ont découvert par hasard, au cours d’un programme
de recherche, un peptide permettant de décupler les facultés d’apprentissage.
Heureux de leur découverte ils décident de déterminer la séquence de ce peptide qu’ils
nomment [P].
Aimant seulement jouer avec les produits du laboratoire ils réalisent les expériences
nécessaires et se disent que l’analyse des résultats pourra être laissée aux P1s lors de leur
concours blanc du lendemain.
Voici leurs résultats :
1°) Après une digestion à la trypsine du peptide P on obtient un hexapeptide (que l’on
appellera [A]) et un tripeptide (que l’on appellera [B]).
2°) L’action d’une aminopeptidase sur [A] sépare un pentapeptide (que l’on appellera [C]) et
un acide aminé que l’on peut retrouver dans les protéines participant au métabolisme de
production du méthane.
3°) Après l’action combinée de la chymotrypsine et de l’acide 2-nitro-5-thiocyanobenzoïque
sur [B] on obtient 3 acides aminés libres (chaque outil chimique a agi une seule fois).
4°) Après l’hydrolyse de [C] on élue les acides aminés obtenus par chromatographie
échangeuse de cation avec une gamme de pH allant de 1 à 11. On admettra que l’ordre
d’élution des acides aminés correspond à leur ordre dans le peptide (N-term à C-term).
On réussit à éluer : l'histidine, l'acide glutamique, l'isoleucine et l’acide aspartique.
5°) On réalise une électrophorèse des peptides [B] et [C] à pH=11, voici le profil obtenu :
(Données : pKa1=2 / pKa2=9 / pKar(Asp)=3.9 / pKar(Glu)=4.3 / pKar(His)=6 / pKar(Cys)=8.3 /
pKar(Tyr)=10.1 / pKar(Lys)=10.5 / pKar(Arg)=12.5).
UE 1 – CCB
Page 11 sur 30
Question 14 : (15/0)
Quelle est la séquence du peptide [P] :
(Cochez la lettre ou le couple de lettres correspondant à votre réponse)
A
B
C
D
E
OHEIDRWMC
ODEIHRFMC
OEDIHRWMC
FMCKDEIHO
UDEIHKYMC
AB
BC
CD
DE
OHEIDRYMC
ODEIHRYMC
FMCRDEIHU
OEDIHKYMC
Question 15 : (2 points)
A. Sur l’électrophorèse la tâche 1 correspond au peptide [B] et la tâche 2 au peptide [C].
B. Le peptide [P] absorbe à 257nm.
C. Le glutathion, grâce à sa liaison iso-peptidique, possède deux C-term. C’est le
principal agent antioxydant intracellulaire.
D. La ghréline est une hormone anorexigène issue du même précurseur que
l’obestatine.
E. L’insuline et le glucagon font partie de la grande famille des peptides NRPS.
Question 16 : (2 points)
Concernant le lipide suivant :
Parmi les réponses suivantes la(les)quelle(s) est (sont) vraie(s) :
A.
B.
C.
D.
E.
C’est un AG insaturé.
Il est fabriqué dans notre organisme à partir de l’acide linoléique.
C’est AG essentiel
C’est AG est un précurseur direct des eicosanoïdes.
Ce lipide représente l’acide arachidonique.
UE 1 – CCB
Page 12 sur 30
Question 17 : (2 points)
Concernant le lipide ci-dessous :
A.
B.
C.
D.
E.
C’est un glycérophospholipide.
Il s’agit du 1-palmitoyl-2-oléyl-sn-glycéro-3-phosphoéthanolamine.
Ce glycérophospholipide est un TAG.
Ce lipide est surtout présent dans le cerveau.
Ce lipide possède de la phosphatidylcholine.
Question 18 : (1 point)
A. Le plasma humain véhicule le cholestérol, les AG et les TAG associés à des
phospholipides et à des protéines dans des particules appelées lipoprotéines.
B. Les lipoprotéines possèdent un cœur hydrophobe et une surface hydrophile.
C. Les chylomicrons sont constitués majoritairement de TAG.
D. VLDL et LDL peuvent transportés du cholestérol.
E. Un taux sérique élevé de cholestérol contribue à la formation de plaque d’athérome.
Question 19 : (1 point)
A. Les oses ont deux caractéristiques principales : leurs nombres de carbone et leurs
propriétés d’être hydrolysable ou non.
B. Tout comme les acides aminés, la plupart des oses naturels sont de série L.
C. L’aglycone est la partie non glucidique d’un holoside, elle peut être une base ou un
noyau stéroïde par exemple.
D. Les protéoglycanes sont composés de 10% de motifs disaccharidiques répétés (Ac
uronique-hexosamine)n.
E. Le glucose peut être dosé par méthode enzymatique (réaction d’oxydation), sa valeur
normale dans le sang est de 5,5g.L-1.
UE 1 – CCB
Page 13 sur 30
Question 20 : (1 point)
A. La filiation des oses est réalisée par la méthode de Kiliani-Fischer. Les oses obtenus
sont tous de la même série.
B. Tous les aldohexoses et les cétohexoses ont la même formule brute.
C. Dans la forme cyclique, la fonction hémi-acétale est portée par C2 pour les aldoses et
C1 pour les cétoses.
Soit l’ose suivant :
D. C’est du -L-Mannopyranose
E. C’est du -D-Mannopyranose
Question 21 : (1 point)
A. La « voie du sorbitol » est la formation de fructose à partir de glucose, faisant
intervenir un aldose réductase et une sorbitol déshydrogénase.
B. La N-sulfatyl-glucosamine-6-sulfate est retrouvée dans des protéoglycanes tels que
l’héparine.
C. L’acide sialique ou N-acéyl-mannosamine dérive de l’acide N-Acétyl-neuraminique.
D. Le peptide LDNPSMENHTNRK possède un site de N-glycosylation et deux d’Oglycosylation.
E. Le sucre de table ne réagit avec la liqueur de Fehling qu’après hydrolyse.
Question 22 : (1 point)
A.
B.
C.
D.
Polyosides, polyholosides, polysaccharides et glycanes sont synonymes.
L’Amidon est l’équivalent végétal du glycogène.
L’amidon est constitué d’environ 70-80% d’isoamylose qui est un polyoside ramifié.
Le glycogène possède de nombreuses ramifications c’est pourquoi on parle de
« structure arborescente ».
E. Le lysozyme va détruire les parois bactériennes en hydrolysant les liaisons N-acétylmuramique/N-acétyl-glucosamine.
UE 1 – CCB
Page 14 sur 30
Question 23 : (2 points)
Sur la représentation ci-dessus, la courbe 1 est en absence d’effecteur.
A. La courbe 2 est en présence d’un inhibiteur.
B. La courbe 3 est en présence d’un activateur.
C. L’inhibiteur et l’activateur utilisés sont des effecteurs d’enzyme allostérique. On
retrouve ici 3 courbes sigmoïdes, caractéristiques des enzymes allostériques.
D. Entre les courbes 1 et 2, le Km a augmenté.
E. La pyruvate kinase est une enzyme allostérique qui possède 3 isoenzymes : L, M et R.
Question 24 : (2 points)
Pour les deux représentations ci-dessus, la vitesse est en µmol/min et la [S] en mM.
A.
B.
C.
D.
Le Km de la courbe 1 est d’environ 500 mmol.
La Vmax de la courbe 1 est de 0,30 µmol/min.
Entre 0 et 1000 mM, la courbe 1 possède une cinétique d’ordre 1.
La Vmax des courbes 3 et 4 est de 4 µmol/min. Celui de la courbe 2 est d’environ 2/3
µmol/min.
E. Le Km de la courbe 3 est supérieur à celui de la courbe 4. On peut donc dire que la
courbe 3 est en présence d’inhibiteur compétitif (par rapport à la courbe 4).
UE 1 – CCB
Page 15 sur 30
Question 25 : (1 point)
A. Soit la réaction A+B  C+D, si le ΔG est égale à – 5 kcal/mol, alors la réaction est
spontanée.
B. La constante de Michaelis (Km) peut s’écrire k2+k3/k1.
C. D’après la représentation de Lineweaver-Burke, on peut écrire : =
+
x
D. La fraction de sites occupés est égale à Vmax/V.
E. Une isoenzyme est une forme différente d’une même enzyme, variant par des
différences dans la structure secondaire.
Question 26 : (1 point)
Concernant le métabolisme général :
A. L’anabolisme est une voie de dégradation des nutriments permettant la production
d’énergie.
B. Le cycle de Krebs est une voie amphibolique.
C. La plupart des métabolismes utilisent des réactions d’oxydo-réduction, qui
correspondent à des échanges d’électrons.
D. Le catabolisme de l’ADP à partir d’ATP et de phosphate inorganique produit une
molécule de CO2 et une molécule d’H2O.
E. Une réaction énergétique défavorable ne peut se dérouler dans le métabolisme.
Question 27 : (1 point)
Concernant la glycolyse :
A. L’invertase permet la digestion du galactose et la lactase la digestion du lactose.
B. L’interconversion du D-Fructose en D-Glucose est possible par l’action de
déshydrogénase.
C. L’énolase agit lors d’une réaction d’isomérisation de la glycolyse.
D. Le passage de l’acide pyruvique à l’acide-L-lactique consomme un NAD+ et est réalisé
par la lactate déshydrogénase.
E. Le glucagon va directement phosphoryler l’enzyme bifonctionnelle PFK2/FBP2.
Question 28 : (1 point)
Concernant le pyruvate :
A.
B.
C.
D.
Il est le produit terminal de la glycolyse.
Il peut être le produit de la réduction du lactate.
Il peut être le produit de la transamination de l’alanine.
La pyruvate carboxylase transforme le pyruvate en oxaloacétate de manière
irréversible.
E. Il peut provenir de la carboxylation directe de l’Acétyl-CoA.
UE 1 – CCB
Page 16 sur 30
Question 29 : (2 points)
Concernant le cycle de Krebs ci-dessus :
A.
B.
C.
D.
Les réactions 1 et 4 sont réversibles.
D est le fumarate.
On passe par l’oxalo-succinate pour aller de G à H.
Lors de la réaction 4 on a action de la succinate déshydrogenase qui est une protéine
Fer-Soufre.
E. La réaction 2 produit du FADH2.
Question 30 : (2 points)
Concernant le cycle de Krebs ci-dessus :
A. La réaction 6 est une hydratation catalysée par la Fumarase.
B. On observe une β-décarboxylation oxydative à l’étape 3 et une α-décarboxylation
oxydative à l’étape 2.
C. La réaction 4 produit de l’ATP.
Concernant la Pyruvate Déshydrogénase (PDH) :
D. Elle est inactive quand elle est phosphorylée. L’augmentation d’équivalents réduits et
d’acétyl-CoA vont l’inhiber.
E. L’augmentation de Ca2+, d’insuline et de pyruvate vont l’activer.
UE 1 – CCB
Page 17 sur 30
Question 31 : (1 point)
Concernant le cycle de Krebs :
A. Il est exclusivement intra mitochondrial et produit peu d’énergie.
B. Peu fonctionner en anaérobie.
C. Pour une molécule d’Acétyl-CoA consommée, on va produire 3 NAD+, 1 FAD et 1 GTP
qui donneront 12 ATP après l’étape de phosphorylation oxydative mitochondriale.
D. Une molécule de glucose peut entrainer deux tours de cycle et ainsi la production de
36 ADP.
E. On peut produire du glucose à partir d’Acétyl-CoA issu de la glycolyse.
Question 32 : (1 point)
Concernant la néoglucogenèse :
A.
B.
C.
D.
Ce produit uniquement dans le cytosol.
La biotine est un composé essentiel à la néoglucogenèse.
Est majoritairement rénale et faiblement hépatique.
Seulement 3 réactions la différencient de la glycolyse. On peut donc considérer que
la néoglucogenèse est l’inverse de la glycolyse.
E. Une des destinées du pyruvate produit par transamination de l’alanine est la
néoglucogenèse.
Question 33 : (1 point)
Concernant la gluconéogenèse :
A. Le passage du pyruvate en acide phosphoénol pyruvique se fait en 2 étapes : il y a
d’abord consommation d’un GTP puis d’un ATP.
B. La Pyruvate Carboxylase est contrôlée par l’acétyl-CoA mitochondrial de façon
allostérique.
C. S’il y a un excès d’ATP, l’oxaloacétate se condense avec l’acétyl-CoA.
D. L’oxaloacétate est carboxylé et phosphorylé par la PEPCK.
E. Dans tous les tissus de l’organisme, le glucose pourra ressortir des cellules et passer
dans la circulation sanguine.
UE 1 – CCB
Page 18 sur 30
PARTIE BIOLOGIE MOLECULAIRE
Question 34 : (1 point)
A. La réplication de l’ARN est semi-conservative.
B. La gyrase bactérienne fait partie des topoisomérases.
C. Dans une cellule procaryote, la réplication est un processus avec une propagation bidirectionnelle.
D. Dans une cellule procaryote, la réplication est discontinue sur un des deux brins.
E. Dans une cellule procaryote, il existe plusieurs origines de réplication.
Question 35 : (1 point)
A.
B.
C.
D.
E.
Dans une cellule procaryote, la réplication est pendant la phase M du cycle.
Une télomérase est une ribonucléoprotéine.
La télomérase utilise une matrice d’ADN interne à celle-ci.
Les brins néo-synthétisés chez E.Coli seront acétylés après réplication.
Dans une cellule humaine sans système de réparation, il y a un raccourcissement des
chromosomes à chaque division cellulaire.
Question 36 : (1 point)
A. La lumière ultra-violette peut créer des dimères de cytosine.
B. Les radiations ionisantes peuvent provoquer des cassures de simple brin mais pas de
double brin d’ADN.
C. La mitomycine peut provoquer des pontages de brins d’ADN.
D. Chez E.coli, la réparation des mésappariements peut être guidée par les groupements
NH2.
E. Lorsque l’ADN est endommagé, il y a un arrêt du cycle cellulaire.
Question 37 : (2 points)
A. Une substitution par transition correspond à une base pyrimidique substituée par
une base pyrimidique.
B. Une substitution par transversion correspond à une base purique substituée par une
base purique.
C. La dépurination et la désamination correspondent à des lésions spontanées.
D. Un agent alkylant peut être la source d’une altération de l’ADN.
E. Un agent intercalant peut créer une insertion mais pas une délétion.
UE 1 – CCB
Page 19 sur 30
Question 38: (1 point)
A. L’ARN polymérase I se situe dans le nucléole alors que les ARN polymérase II et III se
situent dans le nucléoplasme.
B. L’acridine inhibe les ARN polymérases procaryote et eucaryote.
C. L’actinomycine D inhibe uniquement l’ARN polymérase procaryote.
D. Les deux brins d’ADN peuvent servir de matrice lors de la transcription.
E. Le mécanisme de la fin de la transcription procaryote est Rho-indépendant.
Question 39: (1 point)
A. La protéine Rho a une activité ADPasique.
B. Dans une cellule eucaryote, l’élongation des ARNm par l’ARNpol II s’accompagne
d’une maturation du transcrit dans le cytoplasme.
C. Dans une cellule eucaryote, la maturation comprend le retrait des introns par le
processus d’épissage.
D. Dans une cellule procaryote, l’ajout d’une coiffe (chapeau/cap) se fait en 3’.
E. La queue polyA en 3’ est spécifique des ARN procaryotes.
Question 40: (2 points)
A. Les ribosomes procaryotes sont constitués d’une grande sous-unité et d’une petite
sous-unité alors que les ribosomes eucaryotes sont constitués d’une grande sousunité et de deux petites sous-unités.
B. La maturation des ARN ribosomiques se fait dans le nucléole et le cytosol.
C. On retrouve la séquence de Kozak chez les eucaryotes et la séquence Shine-Dalgarno
chez les procaryotes.
D. Chez les procaryotes, la traduction est faite simultanément par plusieurs ribosomes.
E. Chez les procaryotes, il y a un couplage transcription/traduction.
UE 1 – CCB
Page 20 sur 30
Enoncé concernant les questions 41 à 43 :
La formule de stéroïde ci-contre est celle de la progestérone :
Ci-dessous les formules de plusieurs autres stéroïdes :
Question 41 : (2 points)
Parmi les stéroïdes ci-dessus, le(s)quel(s) est (sont) un substrat ou un produit de l’enzyme
P450c17 αhydroxylase :
A.
B.
C.
D.
E.
Molécule 1
Molécule 2
Molécule 3
Molécule 4
Molécule 5
UE 1 – CCB
Page 21 sur 30
Question 42 : (2 points)
Le déficit en cytochrome P450c17 est une maladie génétique à transmission autosomique
récessive due à une anomalie du gène CYP17. Dans le plasma d’un patient homozygote pour
une mutation abolissant totalement l’activité de l’enzyme, lequel ou lesquels des stéroïdes
ci-dessus est ou sont diminués :
A.
B.
C.
D.
E.
Molécule 1
Molécule 2
Molécule 3
Molécule 4
Molécule 5
Question 43 : (1 point)
En vous aidant du tableau et de vos connaissances on peut dire :
A.
B.
C.
D.
E.
L’aldostérone est un minéralocorticoïde à 21 atomes de carbone.
La DHEA possède une double liaison de type Δ5.
L’oestrone possède une fonction cétone en position 17.
La prégnenolone possède une chaine latérale hydrophobe de C20 à C27.
La Δ4-androstènedione donne la testostérone sous l’action d’une déshydrogénase.
Question 44 : (1 point)
La chromatine :
A. Le filament nucléosomique se replie grace à l’histone H1 en un solénoïde.
B. HAT (Histone Acétyl Transférase), HDAC (Histone DéACétylase), et HMT (Histone
Méthyl Transférase) réalisent des modifications post-traductionnelles sur les Lysines
des queues des histones.
C. Un nucléosome comprend un octamère d’histones : 2x (H2A, H2B, H3 et H4).
D. Les zones fortement transcrites présentent des histones méthylées et des cytosines
méthylées en grand nombre.
E. Pendant la mitose il y a phosphorylation des histones H2A et H2B.
UE 1 – CCB
Page 22 sur 30
Question 45 : (1 point)
Caractéristiques de l’ADN :
A. Une solution d’ADNdb dont la DO est de 1 contient plus d’ADN qu’une solution de DO
identique d’ADNsb.
B. L’augmentation de la température d’une solution favorise la spécificité de
l’hybridation des ADN.
C. L’augmentation de la concentration en formamide permet l’hybridation de brins
d’ADN qui présentent des mésappariements.
D. Pour avoir une stringence comparable, si on augmente la concentration en
formamide, il faut diminuer la température du milieu d’incubation.
E. La Tm d’une sonde présentant un fort GC% est plus faible que celle d’une sonde à
fort AT%.
Question 46 : (1 point)
Les enzymes de restriction :
A. Les fragments générés par la digestion d’ADNg par des enzymes de restriction sont
statistiquement plus long si le site de restriction utilisé comprend peu de paires de
bases.
B. Après coupure d’un plasmide par BamH1(5’ G/GATCC 3’), les extrémités de tous les
fragments générés sont de type : 5’ GATCC----- ; et 3’ G----- .
C. Les fragments générés par des enzymes de restrictions coupant à bouts cohésifs
peuvent tous être ligués entre eux.
D. Hpa1 (5’ G/TTAAC 3’) et EcoR1 (5’ G/AATTC 3’) génèrent des extrémités compatibles.
E. EcoR1 (5’ G/AATTC 3’) et Ksull (5’ GAA/TTC 3’) pourraient mettre en évidence le
même RFLP.
Par analogie avec la séquence de souris (séquence 3), homologue à 85% à celle de l’Homme,
un ADNc complet correspondant au gène d’ODF a été isolé, ainsi que la séquence d’ADNg
correspondante. ODF est un facteur de différenciation ostéoclastique de 75kDa avec une
hélice transmembranaire comprenant les aa 48 à 70, et une extrémité Cterm extracellulaire.
Les questions 47 à 52 concernent uniquement les séquences 1 et 2 :
Question 47 : (1 point)
A.
B.
C.
D.
E.
ODF est une protéine de 317aa.
Tous les introns ont des sites accepteurs forts.
Le transcrit primaire d’ODF est d’environ 33900pb.
La 5’UTR est de 151pb.
La séquence 2 possède une partie promotrice.
UE 1 – CCB
Page 23 sur 30
Question 48 : (1 point)
A.
B.
C.
D.
E.
Le gène ODF contient 5 exons.
Le +1 de la transcription est situé au nt 13 sur la séquence 1.
Le gène ODF contient 6 introns.
L’hélice transmembranaire est codée par l’exon 1.
Le site de polyadénylation est localisé aux nt 1783-1789 (séquence 2).
Question 49 : (3 points)
Chez deux sœurs atteintes d’ostéopétrose, maladie génétique autosomique récessive, on a
retrouvé la mutation p.M199K et la mutation c.828-829delCG :
A.
B.
C.
D.
E.
Ces deux sœurs sont homozygotes pour le gène d’ODF.
La mutation c.828-829delCG génère une protéine de 280 aa.
La mutation c.828-829delCG correspond à la mutation p.N276NfsX6.
La mutation p.M199K correspond à la mutation c.596 T>A
La mutation p.M199K est située dans l’exon 7.
Enoncé pour les questions 50 et 51 :
Chez un patient on a identifié la mutation IVS3-3C>T. A partir de l’ARNm de ce dernier on
effectue une RT-PCR afin de savoir quelle est la conséquence de cette mutation. L’une des
amorces utilisée commence au nt 7074 et la taille de l’amplicon obtenu est de 111pb. On a
obtenu la séquence suivante dans l’amplicon : 5’ GAGCGCAGGATGACTGG 3’.
Question 50 : (10/0)
Les amorces utilisées sont les suivantes :
A.
B.
C.
D.
E.
5’ CCTCCTGGGGCAGGGGCTGG 3’
5’ GATATTCTATTAGGATCCAT 3’
5’ GTTGTCTGCAGCGTCGCCCT 3’
5’ TGAAAATCTGCATTTCATG 3’
5’ ATGGATCCTAATAGAATATC 3’
Question 51 : (3 points)
A propos de cette mutation on peut dire :
A.
B.
C.
D.
E.
Elle change un site accepteur fort en site accepteur faible.
Il était certain que cette mutation entrainerait un épissage alternatif.
Les nt 7022-7024 ont été reconnus comme nouveau site accepteur.
Cette mutation entraine un décalage du cadre de lecture.
Cette mutation entraine la formation d’une protéine de 93 AA.
UE 1 – CCB
Page 24 sur 30
Question 52 : (2 points)
Chez un patient, un MLPA a été effectué pour chacun des exons de son gène ODF et on a
obtenu les résultats suivants :
E1
E2
E3 E4
E5
Témoin
E6 E7
E1 E2
E3 E4
E5
E6 E7
Patient
A. La méthode MLPA consiste en l’amplification pour chaque exon d’un fragment de
l’ADN de cet exon additionné, de part et d’autre, de séquence permettant cette
amplification et d’une séquence de taille déterminée permettant l’identification de
l’exon.
B. La méthode MLPA comprend une étape de type Southern.
C. La méthode MLPA comprend une étape de PCR dont le résultat sera quantifiable en
HPLC.
D. Ce patient présente probablement une délétion hétérozygote de l’exon 4.
E. Une partie des protéines ODF synthétisées ne présentent plus l’hélice
transmembranaire.
UE 1 – CCB
Page 25 sur 30
Les questions 53 et 54 nécessitent la comparaison des séquences 1 et 2 avec la séquence
3:
Question 53 : (2 points)
Chez un patient atteint de rigidité musculaire on a isolé un ADNc différent correspondant à
celui du gène ODF de la souris (séquence 3) :
A. Cet ADNc code pour une protéine dont le domaine Cterm est identique à celui de la
protéine ODF humaine normale.
B. Cet ADNc code pour une protéine soluble.
C. Le +1 de la transcription est différent du +1 de la transcription de la séquence 2.
D. Le transcrit primaire de cet ADNc par rapport à celui de la séquence 2 est plus petit
d’environ 380nt.
E. Pour cet ADNc, le site de polyadénylation 1548-1554 (séquence 3) a probablement
été utilisé.
Question 54 : (3 points)
A propos de l’ADNc de la séquence 3 :
A. L’ADNg qui correspondrait à cet ADNc possède 2 exons non codant.
B. Cet ADNc peut être issu d’un épissage alternatif de la séquence 1.
C. Les exons 2 et 3 précédemment identifiés dans la séquence 1correspondent pour cet
ADNc aux exons 2 et 3 et à une partie de l’intron 2.
D. La partie codant pour l’hélice transmembranaire dans la séquence 2 est non codante
dans cet ADNc.
E. Pour cet ADNc, les nt 129-130 et les nt 434-436 de la séquence 1 ont servi de site
donneur et accepteur.
UE 1 – CCB
Page 26 sur 30
Séquence 1:
1
61
121
181
241
1
301
11
361
31
421
51
481
71
541
7014
7074
74
7134
94
7194
114
7254
7314
26640
26700
130
26760
26820
145
26880
162
26940
27000
32385
178
32445
193
32505
213
32565
233
32625
253
32685
273
32745
293
32805
313
32865
32925
32985
33045
33105
33165
33225
33285
GAGGTGGGAGTGCCCGCTCGCCCGCGCGCGTAGAGGCAGCCTCGCCTGGGGCTGATTGAA
TTAGCCCAGGACCCAAAGCCGGGCTCCAAGTCGGCGCCCCACGTCGAGGCTCCGCCGCAG
CCTCCGGAGTTGGCCGCAGACAAGAAGGGGAGGGGTCGGGACCTTATGGCTCCCGAGGCC
AGGGCTCTCCAAGCGGTTTATAAGAGTTGGGGCTGCCGGCGCCTCAGAGCGGGAGAGGGA
GGAGAGCTCCGAAGCGAGAGGGCCGAGCGCCATGCGCCGCGCCAGCAGAGACTACACCAA
M R R A S R D Y T K
GTACCTGCGTGGCTCGGAGGAGATGGGCGGCGGCCCCGGAGCCCCGCACGAGGGCCCCCT
Y L R G S E E M G G G P G A P H E G P L
GCACGCCCCGCCGCCGCCTGCGCCGCACCAGCCCCCTGCCGCCTCCCGCTCCATGTTCGT
H A P P P P A P H Q P P A A S R S M F V
GGCCCTCCTGGGGCAGGGGCTGGGCCAGGTTGTCTGCAGCGTCGCCCTGTTCTTCTATTT
A L L G Q G L G Q V V C S V A L F F Y F
CAGAGCGCAGGTGAGTGGCCACCTTCCCAGGGGATCGCGGCTGAGAGCGCCCATCTCCTT
R A Q
CCCCCGCACTTGGAAACTTGA(...)CACACTGTATCTTGCGAGTATGAATTTTTTGTTC
TTAAATAGCAGGATGACTGGTTATTAGCACTCAAACGTCCTTACTGTTTCTCCTCCTCAG
ATGGATCCTAATAGAATATCAGAAGATGGCACTCACTGCATTTATAGAATTTTGAGACTC
M D P N R I S E D G T H C I Y R I L R L
CATGAAAATGCAGATTTTCAAGACACAACTCTGGAGAGTCAAGATACAAAATTAATACCT
H E N A D F Q D T T L E S Q D T K L I P
GATTCATGTAGGAGAATTAAACAGGCCTTTCAAGGAGCTGTGCAAAAGGTAAGTCCACAT
D S C R R I K Q A F Q G A V Q K
CGAGGCTGATAAGTCAAGGGCCCTTGCTGACTCTACCAATACTGAAAATTAAAACTGGAC
GCCCTGAAT(...)AAGAGGGTTAATTTGTTGCATATGTAACAGCCCTGAATTGCTTTAC
CTTATTGCTTTACAGAAAGAATGATTTTATAAATAAAATTATTTTTCCTTTTTATTTCAG
GAATTACAACATATCGTTGGATCACAGCACATCAGAGCAGAGAAAGGTAAGCATGGATCC
E L Q H I V G S Q H I R A E K
ATACATCTGTATGAAATCCCACAGGGTCACTACTATTTTGGCTATAATAATATGGTTTCT
CTCATCTCCAGCGATGGTGGATGGCTCATGGTTAGATCTGGCCAAGAGGAGCAAGCTTGA
A M V D G S W L D L A K R S K L E
AGCTCAGCCTTTTGCTCATCTCACTATTAATGCCACCGACATCCCATCTGGTAAGCTCTA
A Q P F A H L T I N A T D I P S
TCTGCATCCAGCCTGAAAAATATTTTAAGAGTCATTTATCAGCCCATTTCAATACTGAAA
TG(...)ATAGAATTGTGAAGACGTCCTTCTCATTTAAGGACTGACTTTCAAATCTTATG
CCTCTCTTCTCCACAGGTTCCCATAAAGTGAGTCTGTCCTCTTGGTACCATGATCGGGGT
G S H K V S L S S W Y H D R G
TGGGCCAAGATCTCCAACATGACTTTTAGCAATGGAAAACTAATAGTTAATCAGGATGGC
W A K I S N M T F S N G K L I V N Q D G
TTTTATTACCTGTATGCCAACATTTGCTTTCGACATCATGAAACTTCAGGAGACCTAGCT
F Y Y L Y A N I C F R H H E T S G D L A
ACAGAGTATCTTCAACTAATGGTGTACGTCACTAAAACCAGCATCAAAATCCCAAGTTCT
T E Y L Q L M V Y V T K T S I K I P S S
CATACCCTGATGAAAGGAGGAAGCACCAAGTATTGGTCAGGGAATTCTGAATTCCATTTT
H T L M K G G S T K Y W S G N S E F H F
TATTCCATAAACGTTGGTGGATTTTTTAAGTTACGGTCTGGAGAGGAAATCAGCATCGAG
Y S I N V G G F F K L R S G E E I S I E
GTCTCCAACCCCTCCTTACTGGATCCGGATCAGGATGCAACATACTTTGGGGCTTTTAAA
V S N P S L L D P D Q D A T Y F G A F K
GTTCGAGATATAGATTGAGCCCCAGTTTTTGGAGTGTTATGTATTTCCTGGATGTTTGGA
V R D I D *
AACATTTTTTAAAACAAGCCAAGAAAGATGTATATAGGTGTGTGAGACTACTAAGAGGCA
TGGCCCCAACGGTACACGACTCAGTATCCATGCTCTTGACCTTGTAGAGAACACGCGTAT
TTACAGCCAGTGGGAGATGTTAGACTCATGGTGTGTTACACAATGGTTTTTAAATTTTGT
AATGAATTCCTAGAATTAAACCAGATTGGAGCAATTACGGGGTGACCTTATGAGAAACTG
CATGTGGGCTATGGGAGGGGTTGGTCCCTGGTCATGTGCCCCTTCGCAGCTGAAGTGGAG
AGGGTGTCATCTAGCGCAATTGAAGGATCATCTGAAGGGGCAAATTCTTTTGAATTGTTA
CATCATGCTGGAACCTGCAAAAAATACTTTTTCTAATGAGGAGAGAAAATATATGTATTT
TTATATAATATCTAAAGTTATATTTCAGATGTAATGTTTTCTTTGCAAAGTATTGTAAAT
UE 1 – CCB
Page 27 sur 30
33345
33405
33465
33525
33585
33645
33705
33765
33825
33885
33945
TATATTTGTGCTATAGTATTTGATTCAAAATATTTAAAAATGTCTTGCTGTTGACATATT
TAATGTTTTAAATGTACAGACATATTTAACTGGTGCACTTTGTAAATTCCCTGGGGAAAA
CTTGCAGCTAAGGAGGGGAAAAAAATGTTGTTTCCTAATAAATGATCCAGTATATTTCTT
CGTTCTTTTTAAGTTAATAGATTTTTTCAGACTTGTCAAGCCTGTGCAAAAAAATTAAAA
TGGATGCCTTGAATAATAAGCAGGATGTTGGCCACCAGGTGCCTTTCAAATTTAGAAACT
AATTGACTTTAGAAAGCTGACATTGCCAAAAAGGATACATAATGGGCCACTGAAATCTGT
CAAGAGTAGTTATATAATTGTTGAACAGGTGTTTTTCCACAAGTGCCGCAAATTGTACCT
TTTTTGTTTTTTCAAAATAGAAAAGTTATTAGTGGTTTATCAGCAAAAAAGTCCAATTTT
AATTTAGTAAATGTTATCTTATACTGTACAATAAAAACATTGCCTTTGAATGTTAATTTT
TTGGTACAAAAATAAATTTATATGAAAACCTGCCTTGTGATTTTGTACTTCACCTTCATG
TCTCTTTTGCTCTGTGATCCTATTATTTTCAATATGGTAATGTGGCTTCTATCTCTTTCC
UE 1 – CCB
Page 28 sur 30
Séquence 2 :
1
61
121
1
181
11
241
31
301
51
361
71
421
91
481
111
541
131
601
151
661
171
721
191
781
211
841
231
901
251
961
271
1021
291
1081
311
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
CCCGCTCGCCCGCGCGCCCCAGGACCCAAAGCCGGGCTCCAAGTCGGCGCCCCACGTCGA
GGCTCCGCCGCAGCCTCCGGAGTTGGCCGCAGACAAGAAGGGGAGGGAGCGGGAGAGGGA
GGAGAGCTCCGAAGCGAGAGGGCCGAGCGCCATGCGCCGCGCCAGCAGAGACTACACCAA
M R R A S R D Y T K
GTACCTGCGTGGCTCGGAGGAGATGGGCGGCGGCCCCGGAGCCCCGCACGAGGGCCCCCT
Y L R G S E E M G G G P G A P H E G P L
GCACGCCCCGCCGCCGCCTGCGCCGCACCAGCCCCCTGCCGCCTCCCGCTCCATGTTCGT
H A P P P P A P H Q P P A A S R S M F V
GGCCCTCCTGGGGCAGGGGCTGGGCCAGGTTGTCTGCAGCGTCGCCCTGTTCTTCTATTT
A L L G Q G L G Q V V C S V A L F F Y F
CAGAGCGCAGATGGATCCTAATAGAATATCAGAAGATGGCACTCACTGCATTTATAGAAT
R A Q M D P N R I S E D G T H C I Y R I
TTTGAGACTCCATGAAAATGCAGATTTTCAAGACACAACTCTGGAGAGTCAAGATACAAA
L R L H E N A D F Q D T T L E S Q D T K
ATTAATACCTGATTCATGTAGGAGAATTAAACAGGCCTTTCAAGGAGCTGTGCAAAAGGA
L I P D S C R R I K Q A F Q G A V Q K E
ATTACAACATATCGTTGGATCACAGCACATCAGAGCAGAGAAAGCGATGGTGGATGGCTC
L Q H I V G S Q H I R A E K A M V D G S
ATGGTTAGATCTGGCCAAGAGGAGCAAGCTTGAAGCTCAGCCTTTTGCTCATCTCACTAT
W L D L A K R S K L E A Q P F A H L T I
TAATGCCACCGACATCCCATCTGGTTCCCATAAAGTGAGTCTGTCCTCTTGGTACCATGA
N A T D I P S G S H K V S L S S W Y H D
TCGGGGTTGGGCCAAGATCTCCAACATGACTTTTAGCAATGGAAAACTAATAGTTAATCA
R G W A K I S N M T F S N G K L I V N Q
GGATGGCTTTTATTACCTGTATGCCAACATTTGCTTTCGACATCATGAAACTTCAGGAGA
D G F Y Y L Y A N I C F R H H E T S G D
CCTAGCTACAGAGTATCTTCAACTAATGGTGTACGTCACTAAAACCAGCATCAAAATCCC
L A T E Y L Q L M V Y V T K T S I K I P
AAGTTCTCATACCCTGATGAAAGGAGGAAGCACCAAGTATTGGTCAGGGAATTCTGAATT
S S H T L M K G G S T K Y W S G N S E F
CCATTTTTATTCCATAAACGTTGGTGGATTTTTTAAGTTACGGTCTGGAGAGGAAATCAG
H F Y S I N V G G F F K L R S G E E I S
CATCGAGGTCTCCAACCCCTCCTTACTGGATCCGGATCAGGATGCAACATACTTTGGGGC
I E V S N P S L L D P D Q D A T Y F G A
TTTTAAAGTTCGAGATATAGATTGAGCCCCAGTTTTTGGAGTGTTATGTATTTCCTGGAT
F K V R D I D *
GTTTGGAAACATTTTTTAAAACAAGCCAAGAAAGATGTATATAGGTGTGTGAGACTACTA
AGAGGCATGGCCCCAACGGTACACGACTCAGTATCCATGCTCTTGACCTTGTAGAGAACA
CGCGTATTTACAGCCAGTGGGAGATGTTAGACTCATGGTGTGTTACACAATGGTTTTTAA
ATTTTGTAATGAATTCCTAGAATTAAACCAGATTGGAGCAATTACGGGGTGACCTTATGA
GAAACTGCATGTGGGCTATGGGAGGGGTTGGTCCCTGGTCATGTGCCCCTTCGCAGCTGA
AGTGGAGAGGGTGTCATCTAGCGCAATTGAAGGATCATCTGAAGGGGCAAATTCTTTTGA
ATTGTTACATCATGCTGGAACCTGCAAAAAATACTTTTTCTAATGAGGAGAGAAAATATA
TGTATTTTTATATAATATCTAAAGTTATATTTCAGATGTAATGTTTTCTTTGCAAAGTAT
TGTAAATTATATTTGTGCTATAGTATTTGATTCAAAATATTTAAAAATGTCTTGCTGTTG
ACATATTTAATGTTTTAAATGTACAGACATATTTAACTGGTGCACTTTGTAAATTCCCTG
GGGAAAACTTGCAGCTAAGGAGGGGAAAAAAATGTTGTTTCCTAATAAATGATCCAGTAT
ATTTCTTCGTTCTTTTTAAGTTAATAGATTTTTTCAGACTTGTCAAGCCTGTGCAAAAAA
ATTAAAATGGATGCCTTGAATAATAAGCAGGATGTTGGCCACCAGGTGCCTTTCAAATTT
AGAAACTAATTGACTTTAGAAAGCTGACATTGCCAAAAAGGATACATAATGGGCCACTGA
AATCTGTCAAGAGTAGTTATATAATTGTTGAACAGGTGTTTTTCCACAAGTGCCGCAAAT
TGTACCTTTTTTGTTTTTTCAAAATAGAAAAGTTATTAGTGGTTTATCAGCAAAAAAGTC
CAATTTTAATTTAGTAAATGTTATCTTATACTGTACAATAAAAACATTGCCTTTGAATGT
TAATTTTTTGGTACAAAAATAAATTTATATGAAAA
UE 1 – CCB
Page 29 sur 30
Séquence 3 :
1
6
66
126
1
186
18
246
38
306
58
366
78
426
98
486
118
546
138
606
158
666
178
726
198
786
218
846
238
906
966
1026
1086
1146
1206
1266
1326
1386
1446
1506
1566
CCCGC
TCGCCCGCGCGCCCCAGGACCCAAAGCCGGGCTCCAAGTCGGCGCCCCACGTCGAGGCTC
CGCCGCAGCCTCCGGAGGGCTGGGCCAGGTTGTCTGCAGCGTCGCCCTGTTCTTCTATTT
CAGAGCGCAGATGGATCCTAATAGAATATCAGAAGATGGCACTCACTGCATTTATAGAAT
M D P N R I S E D G T H C I Y R I
TTTGAGACTCCATGAAAATGCAGATTTTCAAGACACAACTCTGGAGAGTCAAGATACAAA
L R L H E N A D F Q D T T L E S Q D T K
ATTAATACCTGATTCATGTAGGAGAATTAAACAGGCCTTTCAAGGAGCTGTGCAAAAGGA
L I P D S C R R I K Q A F Q G A V Q K E
ATTACAACATATCGTTGGATCACAGCACATCAGAGCAGAGAAAGCGATGGTGGATGGCTC
L Q H I V G S Q H I R A E K A M V D G S
ATGGTTAGATCTGGCCAAGAGGAGCAAGCTTGAAGCTCAGCCTTTTGCTCATCTCACTAT
W L D L A K R S K L E A Q P F A H L T I
TAATGCCACCGACATCCCATCTGGTTCCCATAAAGTGAGTCTGTCCTCTTGGTACCATGA
N A T D I P S G S H K V S L S S W Y H D
TCGGGGTTGGGCCAAGATCTCCAACATGACTTTTAGCAATGGAAAACTAATAGTTAATCA
R G W A K I S N M T F S N G K L I V N Q
GGATGGCTTTTATTACCTGTATGCCAACATTTGCTTTCGACATCATGAAACTTCAGGAGA
D G F Y Y L Y A N I C F R H H E T S G D
CCTAGCTACAGAGTATCTTCAACTAATGGTGTACGTCACTAAAACCAGCATCAAAATCCC
L A T E Y L Q L M V Y V T K T S I K I P
AAGTTCTCATACCCTGATGAAAGGAGGAAGCACCAAGTATTGGTCAGGGAATTCTGAATT
S S H T L M K G G S T K Y W S G N S E F
CCATTTTTATTCCATAAACGTTGGTGGATTTTTTAAGTTACGGTCTGGAGAGGAAATCAG
H F Y S I N V G G F F K L R S G E E I S
CATCGAGGTCTCCAACCCCTCCTTACTGGATCCGGATCAGGATGCAACATACTTTGGGGC
I E V S N P S L L D P D Q D A T Y F G A
TTTTAAAGTTCGAGATATAGATTGAGCCCCAGTTTTTGGAGTGTTATGTATTTCCTGGAT
F K V R D I D *
GTTTGGAAACATTTTTTAAAACAAGCCAAGAAAGATGTATATAGGTGTGTGAGACTACTA
AGAGGCATGGCCCCAACGGTACACGACTCAGTATCCATGCTCTTGACCTTGTAGAGAACA
CGCGTATTTACAGCCAGTGGGAGATGTTAGACTCATGGTGTGTTACACAATGGTTTTTAA
ATTTTGTAATGAATTCCTAGAATTAAACCAGATTGGAGCAATTACGGGGTGACCTTATGA
GAAACTGCATGTGGGCTATGGGAGGGGTTGGTCCCTGGTCATGTGCCCCTTCGCAGCTGA
AGTGGAGAGGGTGTCATCTAGCGCAATTGAAGGATCATCTGAAGGGGCAAATTCTTTTGA
ATTGTTACATCATGCTGGAACCTGCAAAAAATACTTTTTCTAATGAGGAGAGAAAATATA
TGTATTTTTATATAATATCTAAAGTTATATTTCAGATGTAATGTTTTCTTTGCAAAGTAT
TGTAAATTATATTTGTGCTATAGTATTTGATTCAAAATATTTAAAAATGTCTTGCTGTTG
ACATATTTAATGTTTTAAATGTACAGACATATTTAACTGGTGCACTTTGTAAATTCCCTG
GGGAAAACTTGCAGCTAAGGAGGGGAAAAAAATGTTGTTTCCTAATAAATGATCCAGTAT
ATTTCTTCGTTC
UE 1 – CCB
Page 30 sur 30
Téléchargement
Explore flashcards