Analyse spatiotemporelle des enzymes de déméthylation de l`adn et

advertisement
ANALYSE SPATIOTEMPORELLE DES ENZYMES
DE DÉMÉTHYLATION DE L’ADN ET DES
HISTONES DANS L’EMBRYON BOVIN
Mémoire
FLORENCE PAGÉ-LARIVIÈRE
Maîtrise en biologie cellulaire et moléculaire
Maître ès sciences (M.Sc.)
Québec, Canada
© Florence Pagé-Larivière, 2013
Résumé
Chez les mammifères, le passage d’une génération à une autre nécessite la
reprogrammation du génome. Cette reprogrammation nécessite la déméthylation de l’ADN
parternel et maternel ainsi que celle des lysines des histones suite à la fécondation. Des
familles d’enzymes ont récemment été associées à ces processus : les déaminases,
notamment Aicda (activation-induced cytosine deaminase), et les Tet (Ten-eleven
translocation) désoxygénase, Tet1, Tet2 et Tet3. Plusieurs déméthylases des lysines des
histones (KDM) ont été identifiées au cours des dernières années mais très peu
d’informations sont disponibles à leur sujet, particulièrement en ce qui a trait à l’embryon
bovin. Notre étude s’est attardée à dresser un profil d’expression spatiotemporel de ces
familles d’enzymes lors des différents stades embryonnaires précoces chez la vache. Nous
suggérons que Tet3 participe activement à la déméthylation de l’ADN, possiblement assisté
par Tet2, mais sans Tet1 ni Aicda. Nous montrons également que KDM3A, KDM4A,
KDM4C et KDM5B sont présents à des stades et à des endroits précis de l’embryon
suggérant ainsi un rôle dans certains processus clés du développement embryonnaire. Ces
informations ouvrent la voie à de nouvelles recherches afin de comprendre les
modifications de l’épigénome et de réduire les anomalies épigénétiques rencontrées chez
les animaux issus de certains protocoles de reproduction assistée.
iii
iv
Abstract
In mammals, the transition from one generation to the next requires genomic
reprogramming.
Such epigenetic change is mediated by paternal and maternal DNA
demethylation as well as histone lysines demethylation after fertilization, which is a poorly
understood process. Some family of enzymes have recently been associated to those
process: the deaminases, like Aicda (activation-induced cytosine deaminase), and Tet (Teneleven translocation) dioxygenases, Tet1, Tet2 and Tet3. Many lysine specific histone
demethylases (KDM) have been identified in the past few years but little is known about
their roles in mammalian embryo.
The objective of this study was to develop of a
spatiotemporal expression profile of those proteins at different preimplantation stage of
bovine embryo. We suggest an active participation of Tet3 in DNA methylation, possibly
supported by Tet2 but without Tet1 or Aicda. We also demonstrate the presence and
specific localization of KDM3A, KDM4A, KDM4C and KDM5B which may suggest a
role during the different embryonic stages. This information opens up the possibilities for
further research in order to reduce epigenetic abnormalities associated to assisted
reproduction technologies.
v
vi
Table des matières
RÉSUMÉ .......................................................................................................................................... III
ABSTRACT .......................................................................................................................................V
LISTE DES TABLEAUX................................................................................................................ IX
LISTE DES FIGURES .................................................................................................................... XI
LISTE DES ABRÉVIATIONS .................................................................................................... XIII
AVANT-PROPOS ......................................................................................................................... XV
CHAPITRE 1 .................................................................................................................................... 1
1.1 Introduction générale ............................................................................................................................ 1
CHAPITRE 2 .................................................................................................................................... 3
REVUE DE LITTÉRATURE ........................................................................................................... 3
2. 1 Mise en contexte .................................................................................................................................. 3
2.1.1 Considérations biologiques ................................................................................................................... 5
2.2. Épigénétique ........................................................................................................................................ 7
2.2.1. La chromatine, généralités : ................................................................................................................. 8
2.2.2. Hétérochromatine .............................................................................................................................. 10
2.2.3. Euchromatine ..................................................................................................................................... 11
2.2.4. Gènes à empreinte ............................................................................................................................. 11
2.2.5. Les marques épigénétiques sont sujettes aux changements ............................................................ 12
2.3. Méthylation de l’ADN ......................................................................................................................... 13
2.3.1. Méthyltransférases ............................................................................................................................ 16
2.3.2. La déméthylation de l’ADN ............................................................................................................... 16
2.3.3. Reprogrammation de l’épigénome ................................................................................................... 17
2.3.3.1. Cellules somatiques vs germinales .................................................................................................. 17
2.3.3.2. Reprogrammation lors de la gamétogenèse ................................................................................... 19
2.3.3.3. Reprogrammation lors de la fécondation ....................................................................................... 20
2.3.3.4. Conséquences d’une mauvaise reprogrammation ......................................................................... 21
2.3.4. Déméhylation passive ........................................................................................................................ 22
2.3.5. Déméthylation active ......................................................................................................................... 22
2.4. Les histones ......................................................................................................................................... 26
2.4.1 L’acétylation ....................................................................................................................................... 28
2.4.2 La méthylation ..................................................................................................................................... 31
2.4.3 Déméthylation ..................................................................................................................................... 33
2.4.3.1 KDM1 ................................................................................................................................................ 34
2.4.3.2 KDM2 ................................................................................................................................................ 36
2.4.3.3 KDM3 ................................................................................................................................................ 37
2.4.3.4 KDM4 ................................................................................................................................................ 38
2.4.3.5 KDM5 ................................................................................................................................................ 39
2.3.4.6 KDM6 ................................................................................................................................................ 41
CHAPITRE 3 ................................................................................................................................. 43
3.1 De l’importance de comprendre ces enzymes ..................................................................................... 43
3.2 Objectifs ............................................................................................................................................... 45
3.3 Résumé ................................................................................................................................................ 47
3.3. Article .................................................................................................................................................. 49
RNA extraction and reverse transcription .................................................................................................... 55
Real-time PCR ............................................................................................................................................... 56
Statistical analysis......................................................................................................................................... 57
Immunoblotting ........................................................................................................................................... 57
Immunofluorescence ................................................................................................................................... 58
3.4. Conclusion ........................................................................................................................................... 77
3.5 Bibliographie ........................................................................................................................................ 79
viii
Liste des tableaux
CHAPITRE 2
Tableau 1. Les membres des différentes classes de HAT .................................................. 30
Tableau 2. Les membres des différentes classes de HDAC. .............................................. 30
CHAPITRE 3
Tableau 1. Information on genes studied.. ............................................................................ 52
Tableau 2. List of primers used in real-time PCR experiments ........................................... 56
Tableau 3. Pearson determination coefficients of relative mRNA abundance across embryo
stages, from oocyte to 8-cell. ............................................................................. 70
ix
x
Liste des figures
CHAPITRE 2
Figure 1. Quantification relative et origine des ARNm d’un embryon. ................................. 6
Figure 2. Structure du nucléosome.. ....................................................................................... 9
Figure 3. Cycle de modification de l’épigénome .................................................................. 19
Figure 4. Modifications des cytosines et enzymes associées................................................ 26
Figure 5 Principales méthylations des lysines situées sur les queues N-terminales des
histones H3 et H4.. ........................................................................................................ 33
Figure 6. Les familles de déméthylases des lysines des histones associées à chacune des
principales méthylations.. ............................................................................................. 42
CHAPITRE 3
Figure 1 Immunoblot of AICDA, Tet3, KDM3A, KDM4A KDM4C and KDM5B. ........... 59
Figure. 2 Relative abundance of Tet3 transcripts through early developmental stages. ...... 61
Figure. 3 Immunofluorescence of Tet3 and DNA at different embryo stages……………..61
Figure 4 Immunofluorescence of 5hmC and DNA at different embryo stages. ................... 62
Figure. 5 Relative abundance of KDM3 transcripts through early developmental stages. .. 63
Figure 6. Immunofluorescence of KDM3A and DNA at different embryo stages.............. 64
Figure. 7. Relative abundance of KDM4A transcript through embryo development........... 65
Figure 8. Immunofluorescence of KDM4A and DNA at different embryo stages............... 66
Figure. 9. Relative abundance of KDM4C transcripts through early developmental stages 67
Figure. 10. Immunofluorescence of KDM4C and DNA at different embryo stages. ........... 68
Figure. 11. Immunofluorescence of KDM5B and DNA at different embryo stages. ........... 69
.
xi
xii
Liste des abréviations
2n : diploïde
20G : 2-oxoglutarate
5caC : 5-carboxylcytosine
5fC : 5-formylcytosine
5hmC : 5-hydroxyméthylcytosine
5mC : 5-méthylcytosine
Acétyl-CoA : acétyl-coenzyme A
ADN : acide désoxyribonucléique
Aicda : activation-induced cytosine deaminase
ARNm : acide ribonucléique messager
ATP : adénosine triphosphate
CGP : cellule germinale primordiale
CpG : cytosine-phosphate-guanine
CXXC : domaine contenant 8 cystéines consécutives
Dnmt : DNA methyl transferase
FAD : flavine adénine dinucléotide
FBXL : F-box/leucine rich repeat, F-box vient de la cycline F, première protéine où ce
motif a été identifié
FIV : fécondation in vitro
GP : globule polaire
H1/2/3/4 : histone 1/2/3/4
HAT : histone acétyltransférase
HDAC : histone déacétylase
HOX : homeobox
HP1 : hétérochromatine protéine
IAP : intracisternal A-particule
IGF2 : insulin-like growth factor 2
IGF2R : insulin-like growth factor 2 receptor
Jarid : jumonji AT-rich domain
Jhdm : jumonji histone déméthylase
Jmjd : jumonji domain
K.O. : knock-out
KDM : lysine déméthylase
KMT : lysine méthyltransférase
LSD : lysine-spécifique déméthylase
MBD : methyl binding protein
MCI : masse cellulaire interne
MECP2 : methyl CpG binding protein 2
miARN : micro ARN
MLL : mixed-lineage leukemia
xiii
NAD+ : nicotinamide adénine dinucléotide
NANOG : nommé d’après le mythe celte irlandais Tír na nÓg qui, en gaélique, désigne « la
Terre de l'éternelle jeunesse »
OCT4 : octamer-binding transcription factor 4
PcG : polycomb group
PHD : plant homeobox domain
PRMT : protéin arginine N-methyltransférase
REB : réparation par échange de base
RMT : arginine méthyltransférase
SAM : S-adénosine methionine
TDG : thymine DNA glycosylase
TE : transfert d’embryon
Tet : ten-eleven translocation
TI-RCPq : Transcriptase inverse suivi d'une réaction en chaîne de polymérase quantitative
TrxG : trithorax group
xiv
Avant-propos
Il m’importe d’abord de remercier mon directeur de recherche, Monsieur Marc-André
Sirard, pour l’humanité dont il a fait preuve. Il m’a témoigné confiance et respect, m’a
guidée sans me presser en ne m’encadrant que de balises discrètes. Le temps venu, il m’a
également appuyée financièrement et a ainsi permis l’achèvement de mon projet de
maîtrise.
J’aimerais remercier Isabelle Dufort pour l’apprentissage qu’elle m’a offert des techniques
de biologie moléculaire, principalement en ce qui a trait aux amplifications en chaîne par
polymérase. Je remercie Isabelle Laflamme pour l’enseignement en biologie cellulaire et en
fécondation in vitro de même que pour son amitié. Merci Isabelle pour ces conversations
improvisées et ô combien appréciées. Je remercie les étudiants du laboratoire de MarcAndré Sirard et de Claude Robert pour leurs conseils, leur présence, leur amitié. Plus
spécifiquement, je remercie Maëlla Gohin, stagiaire postdoctorale, Sara-Myriam Scantland,
étudiante au doctorat, Audrey Bunel, étudiante au doctorat, Anne-Laure Nivet, étudiante au
doctorat et Gaël Cagnone, étudiant au doctorat, pour leurs conseils judicieux en matière
d’immunobuvardage, d’amplification en chaîne et de présentation d’affiche.
Finalement, je remercie le Fonds de recherche du Québec – Nature et technologies pour le
support financier pendant mes études de maîtrise.
xv
xvi
Voilà, j’y suis.
À mes parents adorés, à ma sœur bienveillante,
et aux embûches que j’ai rencontrées
xvii
.
xviii
CHAPITRE 1
1.1 Introduction générale
L’ovule est une cellule très complexe. Il contient une multitude de molécules, chacune étant
finement régulée, mais le vaste bagage de connaissance que nous possédons à son sujet ne
suffit toujours pas à saisir la subtilité des mécanismes qui s’y déroulent. Ainsi, nous
sommes encore incapables de déterminer ce qui fait la compétence d’un ovocyte et le rend
apte au développement embryonnaire, non plus sommes-nous capables d’expliquer les
processus moléculaires en jeu suite à la fécondation et pendant les divisions cellulaires
subséquentes. Au cours des premiers stades embryonnaires, la transcription est arrêtée.
L’ovule pallie alors ce manque en formant pendant sa croissance une réserve d’ARNm afin
de répondre aux besoins de l’embryon. Cette réserve s’épuise graduellement jusqu’à ce que
le génome embryonnaire soit activité et que l’embryon puisse à son tour produire ses
propres ARNm. La dépendance absolue de l’embryon face à la réserve ovocytaire implique
que le moindre dysfonctionnement de l’ovocyte ou la moindre perturbation dans la
maturation a des répercussions majeures sur le développement de l’embryon. Aussi, les
nombreuses étapes faisant suite à la fécondation sont critiques au devenir de l’embryon, si
bien que la qualité de l’ovocyte, bien qu’essentielle, ne suffit pas à prémunir contre
l’avortement spontané. En effet, d’autres facteurs, notamment les environnements
nutritionnel, chimique et thermique dans lesquels évolue l’embryon, doivent être en tout
temps optimaux, la moindre perturbation entraînant souvent l’arrêt du développement à un
stade plus ou moins avancé. Depuis quelques années déjà, plusieurs techniques de
reproduction assistée ont fait leur apparition dans l’univers agricole et plus particulièrement
dans celui de l’industrie laitière. La fécondation in vitro (FIV) compte parmi ces techniques
et est largement utilisée à travers le monde, tant chez les animaux que chez l’humain, avec
toutefois des taux de rendement relativement faibles. L’une des explications à ce tiède
succès est l’impossibilité de savoir si l’ovule ponctionné est compétent au développement
1
embryonnaire ou si l’embryon qui se développe in vitro a le potentiel de former un fœtus
viable. Considérant le prix élevé des protocoles FIV et des autres techniques de
reproduction assistée, il est pertinent pour de nombreuses industries de mettre à jour des
outils permettant de différencier les « bons » des « mauvais » ovules. Une seconde
explication tient dans le fait qu’un vase de pétri n’est pas un utérus et que, dans ces
circonstances, les perturbations environnementales sont nettement supérieures dans les
protocoles in vitro que dans les in vivo. Ces perturbations ont, croyons-nous, le potentiel de
nuire au bon développement d’un embryon en en modifiant le métabolisme et le profil
d’expression des gènes. Des recherches ont été menées afin de déterminer pourquoi et
comment la reproduction assistée pouvait affecter le développement d’un embryon. Les
conclusions pointent toutes dans la même direction : l’épigénétique.
2
CHAPITRE 2
REVUE DE LITTÉRATURE
2. 1 Mise en contexte
La croissance de l’industrie laitière à travers le monde au cours des dernières décennies a
eu comme résultante la sélection de vaches offrant en abondance un lait de grande qualité.
Force est toutefois de constater que cette sélection n’est pas sans conséquence et qu’ainsi,
la production laitière accrue s’est soldée par une réduction drastique de la fertilité des
vaches. Plusieurs auteurs suggèrent un étranglement au niveau métabolique opposant la
production de lait et la gestation comme cause à cette diminution. D’autres, principalement
au Brésil où l’industrie laitière est en pleine croissance, regardent du côté du stress
thermique subit par les vaches en période estivale. Devant ce constat qui met en péril la
pérennité des cheptels et de leurs rendements supérieurs, les éleveurs ont de plus en plus
recours à différentes techniques de reproduction assistée. La première utilisée a été la
synchronisation de l’ovulation qui permet de contrôler la très courte période d’oestrus (c.-àd. ovulation), période dont les signes comportementaux et phénotypiques sont difficilement
perceptibles. La seconde, nommée superovulation, permet la génération de plusieurs ovules
en un même cycle qui sont par la suite récupérés par voie naturelle avant ou après la
fécondation. Les développements scientifiques dans le domaine de la reproduction ont
ensuite permis l’élaboration de techniques plus pointues présentant chacune des avantages
et des inconvénients. La plus courante à travers le monde est le transfert d’embryon (TE).
Cette technique se pratique suite à une superovulation et à une insémination artificielle
standard et consiste en un prélèvement intra-utérin des embryons pour les transférer ensuite
dans l’utérus de vaches receveuses « hormonalement » synchronisées à la donneuse. Ceci
permet d’augmenter dans le cheptel la prévalence de traits phénotypiques recherchés en
n’utilisant que les embryons issus de vaches hautement performantes. Les embryons
peuvent également être congelés et cette innovation a permis d’une part le transfert
3
ultérieur d’embryons à des vaches receveuses, principalement lorsque la quantité de
receveuses est moindre que la quantité d’embryons transférables, et d’autre part permis de
faciliter et de réduire les coûts d’import et d’export des animaux d’élevage. Toutefois, les
frais associés à cette technique sont considérables, d’abord à cause des hormones utilisées
pour la superovulation, puis à cause des frais d’expertise médicale et technique inhérents
aux protocoles de transfert. De plus, environ 20% des vaches ne répondent pas aux
traitements hormonaux, entraînant alors des frais inutiles et compromettant la transmission
de leur génome.
Plus récemment, les freins techniques ralentissant l’expansion de la fécondation in vitro
(FIV) ont été levés, si bien que cette technique connaissait entre 2008 et 2009 une
croissance de 12.7% à travers le monde, comparativement au transfert d’embryons qui lui
chutait de 5,6% (IETS, 2011). Cette technique est utile non seulement pour traiter des
problèmes d’infertilité, mais également pour mener différentes recherches en science
fondamentale, pour sélectionner le sexe de l’embryon, pour améliorer la qualité de la
viande et la production laitière de même que pour prémunir les espèces aux populations
précaires d’une extinction définitive. Pour les éleveurs, les avantages de la FIV sont
majeurs en comparaison avec le transfert d’embryons. Premièrement, elle ne requiert pas
nécessairement de superovulation, ce qui évite les injections quotidiennes onéreuses de
FSH (folliculostimulating hormone) pendant les 5-6 jours précédant l’ovulation et,
parallèlement, la perturbation endocrinienne de ces vaches. En utilisant la stimulation
modérée sur 3 jours suivie d’une période de 54 heures sans hormones, une compagnie
québécoise de fécondation in vitro obtient des taux de succès inégalés (60 à 80 %) de par le
monde (Nivet et al., 2012).
Certaine vaches produisent ainsi 100 % d’embryons
transférables de sexe connu (insémination in vitro avec semence sexée). La FIV permet
également de pallier au problème posé par les 20% de vaches qui ne répondent pas au
traitement de superovulation.
La FIV sans la stimulation hormonale donne des taux de succès relativement décevants en
comparaison avec d’autres méthodes de reproduction assistée (32% (IETS) versus 60%
pour l’insémination artificielle (Martinez et al., 2012). De nombreux ovocytes présentent
une absence de développement embryonnaire ou un arrêt précoce, d’autres mènent à la
4
formation d’un fœtus au phénotype ou au métabolisme anormal (Constant et al., 2006; Hori
et al., 2010; Martinez et al., 2012). Chez la femme, la technique est fréquemment utilisée
pour traiter les problèmes d’infertilité. En fécondation in vitro humaine, les contraintes
financières conduisent parfois à l’implantation de plusieurs embryons dans l’utérus dans
l’espoir d’en voir un s’implanter et se développer jusqu’à terme. Toutefois, si plusieurs
protocoles de FIV échouent, d’autres fonctionnent et produisent parfois des grossesses
multiples. Celles-ci sont à la fois dangereuses pour la mère et risquées pour le fœtus. On
observe alors des enfants ayant un temps de gestation raccourci, un plus faible poids à la
naissance et des complications postnatales fréquentes. En 2011, le gouvernement du
Québec annonçait la mise sur pied d’un programme universel de traitement de l’infertilité
humaine incluant notamment des protocoles de FIV, ceci afin de réduire le nombre
d’embryons transférés et, ultimement, le nombre de grossesses multiples. De près de 2000
protocoles de FIV en 2009, le nombre a plus que doublé en 2012 avec des chiffres estimés
à 4400, au Québec uniquement, montrant ainsi la popularité de la FIV subventionnée chez
l’humain. Parallèlement, le taux de grossesses multiples est passé de 30% à 4,5%,
démontrant tristement le pouvoir de l’argent sur les pratiques médicales.
2.1.1 Considérations biologiques
Il est connu que les ovocytes contenus dans les ovaires sont maintenus latents au stade
prophase de la méiose I de la naissance à l’ovulation. Chez la plupart des mammifères, une
stimulation hormonale par la FSH a lieu une fois par cycle sexuel (2 ou 3 chez le bovin) et
amène plusieurs follicules à emprunter la voie du développement, stimulant se faisant
l’ovocyte qu’ils contiennent. Cette maturation transforme le follicule qui prend alors de
l’expansion et se gonfle de liquide folliculaire. L’ovocyte baigne dans ce liquide, entouré
par ses cellules nourricières et protectrices nommées cumulus, et entreprend lui aussi une
phase de mûrissement durant laquelle il entrepose une grande quantité d’ARNm. Cette
réserve servira à combler les besoins protéiques du jeune embryon pendant les premiers
stades de développement alors que la transcription embryonnaire ne sera pas encore
activée. Chez le bovin, l’activation du génome embryonnaire se produit entre les stades 8et 16-cellules, moment à partir duquel l’embryon s’affranchit de la contribution maternelle.
5
La fin de la maturation ovocytaire s’accompagne de l’expulsion d’un premier globule
polaire (GP). La méiose est ensuite à nouveau arrêtée, cette fois au stade métaphase II, et ne
s’achève que suite au signal induit par la fécondation.
Figure 1. Quantification relative et origine des ARNm d’un embryon. Les ARNm
maternels (bleu) diminuent progressivement avant l’activation du génome embryonnaire,
moment à partir duquel les ARNm embryonnaires (rose) croissent rapidement. (Sirard, MA)
Lors d’un protocole de FIV humaine, les follicules sont ponctionnés dans l’ovaire et les
ovules sont récoltés au stade de métaphase II. La fécondation de même que le
développement précoce se font ensuite en laboratoire dans des milieux de culture
synthétiques mimant le contexte tubaire/utérin. À ces étapes s’ajoute, chez la vache, la
maturation in vitro de l’ovule durant 24 heures dans un milieu exempt des facteurs
folliculaires inhibiteurs (Fair, 2003).
Une autre technique a été mise au point ces dernières années : le clonage. Elle consiste en
l’énucléation d’un ovocyte suivi par le transfert d’un noyau 2n souvent extrait d’une cellule
6
somatique. La perspective de produire des animaux par cette méthode a initialement
soulevé de grands espoirs, entre autres parce qu’elle faisait miroiter la possibilité de créer
des cheptels au sexe et au phénotype prédéfinis, mais ceux-ci ont rapidement été déçus
suite aux nombreux échecs rencontrés. Par exemple, en plus des maigres taux de succès
(moins de 4% chez la vache) (Wilmut et al., 2002), on retrouve chez le bovin et la chèvre le
syndrome du gros veau fœtal (Young et al., 1998) qui se caractérise entre autres par une
hypertrophie de certains organes et un poids trop élevé à la naissance obligeant le recours à
une césarienne. Également, on observe fréquemment une mort précoce, divers troubles
développementaux et des dysfonctions placentaires (Wilmut et al., 2002). Parallèlement,
des observations faites sur des embryons, des fœtus et des rejetons issus de la FIV animale
ont montré que les manipulations extra-utérines avaient des impacts notables sur
l’expression des gènes et, souvent, sur les phénotypes qui leurs étaient associés (Hori et al.,
2010; Su et al., 2011; Wrenzycki et al., 2004). Devant ces ratés, les pistes de réponses aux
nombreuses interrogations soulevées se sont traduites en autant de projets de recherche, si
bien que nous possédons maintenant une nouvelle vision des mécanismes physiologiques et
moléculaires s’opérant dans les gamètes et dans le jeune embryon, une vision beaucoup
plus fine permise par l’émergence de l’épigénétique.
2.2. Épigénétique
L’ovule fécondé est à la base de tout animal : Omne vivum ex ovo comme l’écrivait William
Harvey. Le zygote se divise et chacune des cellules qui en découlent se divise à son tour,
toujours en copiant l’ADN de la cellule mère. Il advient donc que l’entièreté des cellules
d’un animal contient précisément le même génome. Comment expliquer alors qu’une si
grande diversité de types cellulaires puisse exister au sein d’un même individu? La réponse
réside dans le contrôle de l’expression des gènes, domaine de la biologie qu’on nomme
épigénétique.
7
« L’épigénétique ressemble un peu à la façon dont on organise ses papiers à la
maison : on garde à portée de la main ceux que l’on utilise régulièrement, mais on range
les vieux bulletins scolaires dans des boîtes que l’on met au grenier. » Peter Becker
Plus précisément, il s’agit de signaux cellulaires, temporaires ou permanents, directement
apposés sur l’ADN pour les uns et ajoutés aux histones pour les autres afin d’induire ou
d’inhiber la transcription des gènes. Ces modifications épigénétiques sont reconnues par
diverses protéines et permettent de discerner parmi tous les gènes l’information pertinente à
transcrire à un moment précis et pour une cellule donnée (Jenuwein and Allis, 2001). Ces
marques sont regroupées en deux catégories distinctes qui agissent en synergie : des
méthylations sur le 5e carbone des cytosines (5mC) et des modifications posttraductionnelles sur les histones, soit des méthylations, des acétylations, des sumoylations,
des phosphorylations, des ubiquitinations et des ADP-ribosylations. En aucun cas la
séquence nucléotidique n’est modifiée, seul l’environnement chromatinien est affecté. Ces
signaux sont hautement régulés et permettent le recrutement de protéines spécifiques. Ils
peuvent également altérer l’affinité de liaison d’autres protéines. Ainsi, une cellule
épithéliale aura des marques épigénétiques différentes de celles d’une cellule musculaire et
ce sont précisément ces marques qui définissent le profil d’expression génique d’un type de
cellule. Les marques épigénétiques permettent donc la différenciation cellulaire.
2.2.1. La chromatine, généralités :
La chromatine est constituée de nucléotides qui permettent l’encodage des protéines sous la
forme de gènes. La longueur de l’ADN oblige une compaction extrême en plusieurs
niveaux afin que ce double brin soit contenu tout entier dans chaque noyau. L’unité
fondamentale qui se répète sur la chromatine est le nucléosome. Il constitue le premier
niveau de compaction chez les eucaryotes et est formé de l’octamère d’histones, un
agencement de 4 paires de monomères (H2A, H2B, H3, H4) ayant des charges nettes
respectives de +15, +19, +20 et +16 et qui s’ancrent fortement sur l’ADN chargé
négativement (Turner, 2001). Le nucléosome comprend 147 paires de bases enroulées en
une super hélice de 1.7 tour autour d’un octamère d’histones (Luger et al., 1997). Cette
8
structure organisationnelle de la chromatine porte le nom de collier de perles, ou fibre de
11nm (Luger et al., 1997). Chaque monomère contient une queue N-terminale riche en
résidus lysine et arginine. Les niveaux subséquents de compaction sont dus à l’accolement
des nucléosomes entre eux grâce à la queue N-terminale de chacune des histones qui est
chargée positivement et qui peut ainsi interagir avec le corps chargé négativement des
histones adjacentes. Également, un 5e monomère d’histone, H1, intervient pour lier entre
eux les autres monomères et accoler les nucléosomes les uns aux autres. On parle alors de
la fibre de 30nm (Robinson and Rhodes, 2006). Les étapes de compactions suivantes
mènent à la formation des chromosomes. Dans le spermatozoïde toutefois, les molécules de
compactions de l’ADN ne sont majoritairement pas des histones, mais bien des protamines.
Celles-ci sont de petites protéines riches en arginines qui permettent la compaction extrême
de l’ADN dans la tête du spermatozoïde mature. Elles sont retirées suite à la fécondation et
remplacées par des histones (Ecklund and Levine, 1975).
Figure 2. Structure du nucléosome. La chromatine (ligne noire) est enroulée autour d’un
nucléosome constitué de deux copies de H2A, H2B, H3 et H4. En rose l’histone H1 et en
orange la protétine Hétérochromatine 1 (HP1) qui reconnaît le motif H3K9me3. Image
adaptée de Takizawa (Takizawa and Meshorer, 2008).
9
2.2.2. Hétérochromatine
Il existe deux types d’hétérochromatine, soit la constitutive et la facultative (Brown, 1966).
La constitutive est la même dans toutes les cellules d’un organisme et se retrouve dans
certains territoires chromatiniens spécifiques tels que les télomères et les régions
péricentriques et périnucléolaires (Yasmineh and Yunis, 1970). Ces régions contiennent
peu de gènes et sont principalement formées de séquences répétées ainsi que d’éléments
transposables (Pimpinelli and Ripoll, 1986). À l’opposé, l’hétérochromatine facultative est
variable d’une cellule à l’autre et tend à évoluer dans le temps. Elle est dépendante du
développement embryonnaire et fœtal (Brown, 1966) et permet l’expression génique
différentielle d’une cellule à l’autre de même qu’à des moments variés au sein d’une même
cellule. Les deux types d’hétérochromatines portent des marques épigénétiques qui lui sont
propres et sont constituées d’un assemblage de macromolécules qui permettent la
séquestration des séquences régulatrices de la transcription en les rendant inaccessibles à la
machinerie cellulaire transcriptionnelle (Tartof et al., 1989). Un exemple classique
d’hétérochromatine facultative est l’inactivation d’un des chromosomes X chez la femelle
(Barr and Carr, 1962). Le X éteint est hautement enrichi en marques épigénétiques
associées à la répression, telles que H3K27me3 et H3K9me2 (Heard et al., 1997) et est
relocalisé en périphérie du noyau, associé à la lamine.
La famille HP1, Heterochromatine protein 1, doit son nom à sa localisation dans les
télomères et les régions péricentromériques de même qu’à son rôle dans l’établissement et
le maintien du haut degré de condensation de l’ADN dans ces régions non transcrites. Elles
sont ubiquitaires et très conservées de la drosophile au mammifère et les fonctions que nous
lui connaissons ne cessent de se multiplier. Dans l’hétérochromatine, HP1-α et β ont un
domaine de reconnaissance de la lysine 9 méthylée portée par l’histone H3. Cette marque
épigénétique de l’histone est associée à l’inhibition de la transcription et, en s’y ancrant,
HP1α/β renforcent l’inhibition en plus de recruter une méthyltransférase de l’histone H3K9
afin de propager l’inhibition. Une nouvelle fonction de HP1 vient toutefois d’être révélée
avec le membre HP1-γ. Celui-ci est présent non seulement dans l’hétérochromatine mais
également dans l’euchromatine, c’est-à-dire près de certains gènes actifs. Les HP1 peuvent,
à la manière des histones, être modifiées post-traductionnellement afin de faire varier leur
10
localisation et leur fonction. Il a ainsi été montré que HP1-γ, lorsque modifié sur la sérine
83 (Ser83), avait une localisation euchromatinienne et une fonction d’élongation de la
transcription (Lomberk et al., 2006).
2.2.3. Euchromatine
Les régions contenant les gènes exprimés forment l’euchromatine. Il s’agit de régions
considérées « ouvertes » et qui sont moins condensées que l’hétérochromatine afin de
permettre l’accès aux facteurs et à la machinerie de transcription. Des marques
épigénétiques différentes de celles de l’hétérochromatine sont alors présentes sur les
histones et l’ADN afin d’en signaler l’état d’ouverture. Par exemple, les cellules souches
embryonnaires ont des marques épigénétiques induisant la transcription des gènes
spécifiques à la pluripotence, alors que les cellules somatiques ont des marques de
répression au niveau de ces gènes. Ainsi, différents types cellulaires peuvent être définis
selon leur profil épigénétique (Wu and Zhang, 2010).
2.2.4. Gènes à empreinte
Un gène à empreinte est un gène dont les deux allèles sont différemment exprimés et qui ne
répond donc pas aux principes de la génétique mendélienne. Normalement, les allèles
paternel et maternel sont également exprimés et leur régulation est similaire. Dans le cas
des gènes à empreinte, un seul des deux allèles est transcrit alors que l’autre est fermé à la
transcription d’une façon définitive. On dira que leur expression n’est pas aléatoire mais
plutôt dépendante de l’origine (paternelle ou maternelle). Ainsi, pour certains gènes, seul
l’allèle maternel sera exprimé (ex. : H19, insulin-like growth factor-2 receptor (IGF2R))
alors que pour d’autres (ex. : IGF2), seul l’allèle paternel sera transcrit. Les gènes soumis à
un tel contrôle servent principalement au développement embryonnaire et environ 80%
d’entre eux se trouvent regroupés dans l’ADN (cluster). Considérant que les quelque cent
gènes soumis à l’empreinte s’expriment selon un allèle parental défini, ils semblent
11
constituer le principal frein à la parthénogenèse (Kono et al., 2004). Aussi, puisqu’aucune
compensation par l’allèle complémentaire n’est possible, un défaut d’ordre génétique ou
épigénétique dans l’allèle s’exprimant peut résulter en l’absence d’une protéine et,
possiblement, en une maladie liée à l’empreinte. Certaines sont bien connues, notamment
les syndromes de Beckwith-Wiedemann, de Silver-Russell, de Prader-Willi et d’Angelman
(Ideraabdullah et al., 2007; Zeschnigk et al., 2008).
2.2.5. Les marques épigénétiques sont sujettes aux changements
Contrairement à ce qu’on a longtemps cru, les marques épigénétiques sont sujettes à de
nombreux changements, tant additifs que suppressifs. Dans un contexte de cellule
somatique, l’épigénome est relativement stable. Toutefois, des évènements de
reprogrammation de l’épigénome ont lieu dans les cellules germinales au moment de la
gamétogenèse de même que dans le zygote (De La Fuente et al., 2004). Deux groupes de
protéines sont considérés comme étant de fins régulateurs de l’expression des gènes
pendant le développement embryonnaire : Polycomb Group (PcG) et Trithorax Group
(TrxG). Ces complexes synergiques associent plusieurs enzymes de modification de
l’épigénome et agissent à des moments précis afin d’activer ou de réprimer des gènes (Sha
and Boyer, 2008). Ces phénomènes de reprogrammation seront étudiés en détail dans une
prochaine section.
Autrement, lors du développement embryonnaire, les cellules totipotentes se divisent puis,
une fois le stade de morula atteint, elles subissent une première étape de différenciation.
Certaines cellules prendront la voie du trophectoderme, futur tissu extraembryonnaire
auquel le placenta appartient, alors que d’autres formeront la masse cellulaire interne
(MCI), futur embryon. Au fil des mitoses, la spécialisation des cellules s’affinera et, se
faisant, le patron épigénétique se modifiera.
Considérant que les étiquettes épigénétiques sont portées à évoluer, il est nécessaire que
l’épigénome soit modulable, dynamique et flexible (Wu and Zhang, 2010). Aussi, puisque
12
certaines marques doivent être conservées pour la vie entière de la cellule alors que d’autres
doivent être modifiées rapidement, il importe d’avoir un système de distinction entre ces
modes de régulation à courte et longue durée (Wu and Zhang, 2010). Par exemple, les
gènes à empreinte de même que les transposons doivent être éteints pendant tout le
développement et toute la vie de l’organisme. Ces séquences de chromatine sont donc «
fermées » grâce à des méthylations sur l’ADN en des sites spécifiques qui induisent le
recrutement de protéines de fermeture de la chromatine et par des marques sur les histones
qui inhibent durablement l’expression des gènes. À l’opposé, les gènes devant être
exprimés à de nombreuses reprises sont rendus silencieux temporairement par des
modifications post-traductionnelles sur les histones qui permettent la transcription (Wu and
Zhang, 2010). Ainsi, le profil épigénétique global d’une cellule somatique reste toujours
sensiblement le même, avec d’un côté l’hétérochromatine constitutive et facultative et, d’un
autre, l’euchromatine qui subit des modifications mineures constantes.
L’épigénétique peut également être modifiée au cours de la vie d’une cellule due à des
facteurs externes telle l’exposition à certains agents chimiques ou à des rayons solaires, le
stress chronique et l’alimentation. Aussi, si les cancers étaient jusqu’à présent grandement
expliqués par des mutations dans l’ADN, il est maintenant convenu que de nombreux
cancers sont issus d’un dérèglement d’ordre épigénétique (Pedersen and Helin, 2010)
(Catchpole et al., 2011; Hagelkruys et al., 2011; Metzeler et al., 2011) (Yang et al., 2012).
Par exemple, des gènes suppresseurs de tumeur peuvent être inhibés ou, à l’inverse, des
oncogènes peuvent être activés. Le fin contrôle de l’épigénétique est donc crucial.
2.3. Méthylation de l’ADN
La méthylation de l’ADN est une marque épigénétique qui joue un rôle clé dans le contrôle
de l’expression génique et la protection de la séquence codante. Elle permet la régulation de
la transcription des gènes, la modification de la structure de la chromatine, la régulation du
13
développement embryonnaire et le marquage des gènes sujets à l’empreinte parentale.
Aussi, elle prévient les dommages à l’ADN et les réarrangements chromosomiques indus
grâce au niveau de compaction accru qu’elle induit (Robertson, 2005) et prévient
l’expression des transposons (Yoder et al., 1997).
Les patrons de méthylation diffèrent d’un tissu à l’autre, reflétant les fonctions variées et
l’expression différentielle des gènes selon le tissu. Le groupement méthyle provient de la Sadénosine méthionine (SAM) et est ajouté par une méthyltransférase sur le 5e carbone
d’une cytosine (5mC) normalement adjacente à une guanine, un arrangement
dinucléotidique nommé CpG. Il subvient toutefois quelques méthylations sur les cytosines
séparées d’une guanine par une adénine, une thymine ou une autre cytosine dans un
arrangement de type CHG, ou alors sans qu’il n’y ait de guanine, un CHH (Ramsahoye et
al., 2000). Ces sites de méthylation sont rares et se retrouvent principalement dans les
cellules ES (Ramsahoye et al., 2000). Selon Ehrlich (Ehrlich et al., 1982), les dimères C-G
ne sont pas distribués uniformément dans l’ADN des vertébrés : la probabilité de rencontrer
le couple de nucléotides CpG est de 75 à 80% inférieure à ce qui pourrait être attendu si les
lois du hasard étaient respectées. Chez le bovin, ce pourcentage se chiffre à 76.6% (Elsik et
al., 2009). Aussi, toujours selon Ehrlich, entre 70 et 80% des CpG des cellules somatiques
sont méthylés.
Certaines régions de l’ADN sont enrichies en CpG et portent le nom d’îlots CpG. Les îlots
CpG sont des régions d’ADN de plus de 200 paires de bases ayant un contenu en C-G
supérieur à 50%. Cooper et Gerber-Huber ont démontré en 1987 (Gardiner-Garden and
Frommer, 1987) que ces îlots sont abondants dans les régions promotrices de nombreux
gènes, notamment ceux de pluripotence et de gardien cellulaire (housekeeping). On estime
que 60 à 70% des gènes ont des îlots CpG dans leur promoteur proximal. Ces îlots se
retrouvent également dans le corps de certains gènes et pourraient être impliqués dans
l’épissage alternatif en entrainant une pause forcée de l’ARN polymérase II (Malousi et al.,
2008; Shukla et al., 2011). Les méthylations portées sur les cytosines des CpG agissent tels
des signaux de reconnaissance pour les protéines de la famille des Methyl Binding Protein
(MBP). Dans cette famille, on retrouve MBD4 qui joue un rôle dans la réparation de
14
l’ADN, mais aussi MECP2 (Methyl-CpG binding protein 2) et MBD1-3 qui sont associés à
des complexes protéiques comportant entre autres des histones déacétylases et plusieurs
autres protéines de modification de la conformation de la chromatine (Jones et al., 1998)
(Ballestar and Wolffe, 2001). Ces complexes agissent en compactant l’ADN davantage et
en inhibant la transcription (Ballestar and Wolffe, 2001). Les sites promoteurs deviennent
donc inaccessibles à la machinerie de transcription.
La méthylation de l’ADN est globalement associée à la répression de la transcription, mais
certaines nuances s’imposent. Ainsi, l’effet d’une méthylation est davantage lié à son
positionnement dans un gène qu’à une signification répressive intrinsèque. Dans les
gamètes, les patrons de méthylations varient grandement selon qu’il s’agisse d’un ovocyte
ou d’un spermatozoïde. Dans le premier, 40% des CpG sont méthylés et ces méthylations
sont regroupées aux îlots CpG de certains promoteurs tels que ceux des gènes Kcnq1 et
Rlim (Kobayashi et al., 2012). Dans le second, l’ADN est hyperméthylé avec environ 89%
des CpG touchés, mais ces méthylations sont absentes de la plupart des îlots CpG
(Kobayashi et al., 2012). Différents promoteurs et corps de gènes ont été analysés sous
l’angle de la position de leurs méthylations et corrélés à leur niveau d’expression. Il ressort
de cela que, dans les gamètes mâles et femelles, la méthylation du corps du gène est
fortement liée à la transcription (Spearman's ρ = 0.14–0.16, p<1×10−9 et ρ>0.5, p<1×10−9,
respectivement). L’hypothèse veut que la méthylation du corps du gène permette de
protéger la séquence nucléotidique de la dégradation. Toutefois, dans l’ovocyte, les gènes
les plus fortement exprimés ont parfois un promoteur hyperméthylé (Kobayashi et al.,
2012) alors que dans le spermatozoïde, la méthylation du promoteur est associée à un faible
niveau de transcription. Les sites d’initiation de la transcription sont néanmoins
hypométhylés pour tous les promoteurs (Kobayashi et al., 2012).
En somme, il est de plus en plus mis de l’avant que les méthylations portées par l’ADN ont
un rôle relatif à leur positionnement et que, si d’une manière générale, elles sont associées à
l’inactivité transcriptionnelle, elles constituent souvent un prérequis à l’expression d’un
gène.
15
2.3.1. Méthyltransférases
Les méthyltransférases sont connues et étudiées depuis longtemps déjà et différentes
classes ont été établies afin de discerner leurs rôles respectifs. La classe des
méthyltransférases de maintenance a été découverte par Bestor qui, en 1988 (Bestor, 1988),
a caractérisé Dnmt1. Elle agit en phase S du cycle cellulaire menant à la mitose en ajoutant
des groupements méthyles sur le brin néosynthétisé afin que le patron de méthylation
présent sur l’ADN parental soit transmis aux cellules filles. Au niveau embryonnaire, le
maintien des méthylations est nécessaire afin que les transposons et les gènes soumis à
empreinte restent réprimés d’une mitose à l’autre et que les gènes uniquement requis dans
les tout premiers stades s’éteignent aux stades subséquents. La seconde classe de
méthyltransférases inclut les Dnmt qui font la méthylation de novo, c’est-à-dire sans qu’un
patron préexistant ne les guide. Il s’agit de Dnmt3a, Dnmt3b et Dnmt3L, des
méthyltransférases qui sont impliquées principalement dans l’établissement d’un nouveau
patron de méthylation suite à la reprogrammation de la gamétogenèse et de la fécondation.
Dnmt3a et Dnmt3L sont requises pour l’établissement des empreintes sur les gènes à
réprimer dans les lignées germinales (Bourc'his et al., 2001; Kaneda et al., 2004).
2.3.2. La déméthylation de l’ADN
Les méthylations sur l’ADN ont longtemps été perçues comme étant stables et
indélogeables chez les mammifères. Néanmoins, bien que ces marques épigénétiques sur
l’ADN soient plus durables que celles apposées sur les histones, il n’en demeure pas moins
que des mécanismes sont présents dans les cellules afin de permettre le retrait des
méthylations sur la chromatine. Deux vagues de déméthylation majeures ont été identifiées
dans certaines cellules de mammifère. L’une a lieu dans les cellules germinales
primordiales et débute dès la migration vers les crêtes génitales, alors que la seconde se
produit suite à la fécondation de l’ovocyte par le spermatozoïde.
16
La question du processus de déméthylation demeure un grand mystère. Initialement,
plusieurs proposaient qu’il s’agisse d’un mécanisme passif, mais d’autres observaient
parallèlement des évidences de processus actifs, c’est-à-dire sans réplication de l’ADN pour
diluer les méthylations. Dès 1982, une étude montrait l’existence d’une déméthylation in
vitro en absence de division cellulaire, suggérant alors un mécanisme actif. En 1993, Jost et
al montrait qu’une enzyme maintenant connue sous le nom de TDG (Thymine DNA
glycosylase) permettait la déméthylation active dans des embryons de poule, sans toutefois
pouvoir expliquer le mécanisme moléculaire impliqué (Jost, 1993). Devant quelques
évidences d’un processus actif mais en absence de toute preuve mécanistique, une autre
équipe a observé la déméthylation de l’ADN post-fécondation afin de statuer sur la
passivité ou l’activité du processus. Il a ainsi été constaté dans des cellules embryonnaires
souches (ES) de souris que les gènes de pluripotence OCT4 et NANOG voyaient les CpG
situés sur leur promoteur se déméthyler en absence de toute division cellulaire (Morgan et
al., 2005). Cette observation tendait donc vers la thèse de la déméthylation active de
l’ADN. Nous savons aujourd’hui qu’il se produit, suite à la fécondation, une déméthylation
à la fois active et passive des pronoyaux.
2.3.3. Reprogrammation de l’épigénome
Deux évènements majeurs de reprogrammation ont lieu dans l’existence d’un organisme.
Le premier concerne les cellules germinales au moment de la gamétogenèse, le second se
produit tout juste après la fécondation.
2.3.3.1. Cellules somatiques vs germinales
Deux grandes classes de cellules existent chez un animal : les cellules somatiques et les
cellules germinales.
17
Les cellules somatiques sont des cellules diploïdes qui forment la quasi-totalité d’un
organisme. Elles ont divers degrés de spécialisation, allant de la cellule souche à la cellule
parfaitement différenciée. Aucune d’elle n’a toutefois le potentiel de reformer un nouvel
individu, car des étapes de différenciation ont déjà été franchies. Ainsi, quoiqu’il advienne
à l’ADN d’une cellule somatique, aucune modification ne saura être transmise à la
génération suivante puisque les cellules somatiques ne sont pas des cellules sexuelles. Chez
les animaux, ces cellules sont normalement en phase G0 qui correspond à un stade stable de
non-division. Lorsqu’elles se répliquent, les cellules diploïdes suivent un cycle cellulaire en
4 phases, soit la phase de croissance G1, la phase de synthèse de l’ADN S, la phase de
vérification/prémitose G2 et la phase mitotique M. Cette dernière phase se divise en 4 sousphases, soit la prophase, la métaphase, l’anaphase et la télophase. Par opposition aux
cellules somatiques, les cellules germinales sont celles-là mêmes qui forment les gamètes,
rendant alors leur ADN très vulnérable aux modifications de nature génétique et
épigénétique. Ces cellules sont dites pluripotentes, c’est-à-dire qu’elles ont le potentiel de
former presque tous les types cellulaires. Elles apparaissent dès les premiers stades
embryonnaires au niveau de l’épiblaste du blastocyste et, progressivement, elles migrent
vers les crêtes génitales. Elles s’y divisent abondamment par mitose pour augmenter le
nombre potentiel de gamètes et les cellules filles ainsi produites portent le nom de
gonocytes ou cellules germinales. Chez le mâle, la division des cellules germinales est
continue pendant la vie adulte (Roosen-Runge, 1962). À l’opposé, la femelle nait en
possédant déjà l’entièreté de ses réserves de cellules reproductrices. Celles-ci seront ensuite
soumises à la méiose et formeront finalement des gamètes après maturation et
différenciation cellulaire (Green and Zuckerman, 1951).
18
Figure 3. Cycle de modification de l’épigénome. Les empreintes maternelles (rouge) et
paternelles (bleu) persistent malgré la vague de déméthylation de l’ADN qui suit la
fécondation et elles sont présentes dans les cellules différenciées. Parmi celles-ci, quelques
cellules germinales primordiales (CGP) subissent une deuxième vague de déméthylation de
l’ADN qui efface cette fois les gènes à empreinte. De nouvelles marques sont ensuite
établies pendant la gamétogenèse. Adaptée de Li, , 2011(Li and Sasaki, 2011)
2.3.3.2. Reprogrammation lors de la gamétogenèse
19
Lorsque les cellules germinales primordiales (CGP) entament leur migration vers les crêtes
génitales, leur chromatine est empreinte d’une multitude de marques épigénétiques,
notamment celles inactivant certains gènes à empreinte. Après leur migration vers les crêtes
génitales, les CGP entament une reprogrammation qui affecte tout leur génome : presque
toutes les marques épigénétiques sont retirées, même celles du chromosome X inactivé et
des gènes à empreinte, et il ne subsiste alors que des méthylations partielles sur certains
transposons nommés IAPs pour intracisternal A-particles (Lane et al., 2003; Popp et al.,
2010). Cette reprogrammation permet d’effacer toute trace de différenciation cellulaire et
d’éviter le transfert intergénérationnel (Surani 2001) de modification de la chromatine.
Une fois cette reprogrammation achevée et suite à l’enclenchement de la gamétogenèse, un
nouveau profil épigénétique se met en place afin de donner aux cellules l’épigénome propre
aux gamètes qui devra lui aussi être effacé une fois la fécondation accomplie.
2.3.3.3. Reprogrammation lors de la fécondation
Lors de la fécondation, l’épigénome de type gamète n’est plus approprié et doit être retiré.
L’ovule, qui possède la capacité à reprogrammer l’ADN mâle et le sien, agit activement sur
le génome mâle et passivement sur le sien afin d’en retirer les méthylations. L’ADN
paternel est alors rapidement déméthylé tandis que le maternel, initialement moins méthylé,
se déméthyle progressivement au fil des divisions cellulaires. Cette reprogrammation à la
fois active et passive permet d’atteindre, tout juste avant l’activation du génome
embryonnaire au stade 8-16-cellules, une déméthylation relative du génome. La
reméthylation se fait alors au rythme des différenciations cellulaires et des besoins de
l’embryon afin qu’un patron épigénétique propre au nouvel individu s’inscrive. Il est
toutefois à noter que certaines régions du génome ne sont pas déméthylées lors de la
fécondation. Par exemple, l’hétérochromatine entourant les centromères reste méthylée de
même que les IAP et les gènes à empreinte. Notre compréhension actuelle de la régulation
génique par la méthylation soutient que ces séquences demeurent méthylées pour
augmenter la stabilité des chromosomes, pour empêcher l’expression des rétrotransposons
20
et pour maintenir l’empreinte parentale, respectivement. Il reste cependant beaucoup de
travail à faire afin de comprendre comment la méthylation fonctionne.
2.3.3.4. Conséquences d’une mauvaise reprogrammation
Les conséquences d’une mauvaise reprogrammation ne se résument pas aux syndromes
énumérés dans la section portant sur les gènes à empreinte, elles sont nombreuses et
souvent lourdes de conséquences. Une constatation flagrante de reprogrammation erronée
s’observe lors de tentative de clonage. Puisqu’il s’agit d’un processus forcé plutôt que
naturel, les embryons issus du clonage par transfert de noyau présentent de nombreuses
anomalies épigénétiques telles que des altérations dans l’épigénome des gènes à empreinte
qui sont impliqués dans la croissance fœtale et placentaire (Yang et al., 2005). Des
recherches ont été menées sur ces marques épigénétiques anormales et ont démontré que la
reprogrammation lors du clonage se faisait selon un processus aléatoire impossible à
prévoir et où les gènes déméthylés ne le sont pas toujours complètement ou adéquatement
(Su et al., 2011; Wrenzycki et al., 2004). Les embryons clonés meurent dans la majorité des
cas et très souvent à cause d’anomalies épigénétiques, démontrant l’incapacité de l’ovocyte
à reprogrammer correctement le noyau reçu. On comprend donc que les clones n’ont
d’identique qu’un génome alors que leur épigénome varie grandement (de Montera et al.,
2010). Bien que les problèmes développementaux soient très marqués dans les cas de
clonage, plusieurs perturbations surviennent également lors de FIV. En effet, on rencontre à
l’occasion des syndromes de gros veau foetal suite à des protocoles de FIV standard
(McEvoy et al., 2000). De ce fait, on constate que le développement précoce dans un
contexte in vitro induit suffisamment de perturbations environnementales pour altérer le
processus normal de reprogrammation d’un zygote (Dean et al., 1998; Stojanov and
O'Neill, 2001), particulièrement au niveau des gènes à empreinte. Ces modifications dans
l’ovocyte ou l’embryon perdurent pendant les stades fœtaux et certaines études suggèrent
qu’il pourrait y avoir un lien entre ces « épimutations » et l’émergence de cancer dans
l’organisme mature (Delaval et al., 2006; Niemitz and Feinberg, 2004). On a également
montré que l’alimentation de la mère joue un rôle prépondérant dans le profil épigénétique
de son fœtus. En effet, une diète hypocalorique imposée à une rate prégestante ou en début
21
de gestation produit des blastocystes pourvus d’un nombre de cellules réduit tant dans la
MCI que dans le trophectoderme. Les rejetons présentent une réduction du poids à la
naissance, du taux de croissance postnatal et du ratio poids des organes/poids corporel en
plus d’avoir un comportement significativement plus anxieux (Mahsoudi et al., 2007). Il
appert donc essentiel de comprendre les causes et conséquences de telles anomalies
épigénétiques afin d'augmenter l’efficacité du clonage et de la fécondation in vitro de même
d’améliorer la qualité des embryons fécondés in vitro.
2.3.4. Déméhylation passive
La déméthylation passive de l’ADN maternel se fait par séquestration dans le cytoplasme
de Dnmt1. En n’ayant plus accès à l’ADN en réplication, le brin hémiméthylé ne transfère
pas son patron de méthylation au brin néosynthétisé. Le niveau de méthylation diminue
donc à chaque réplication de l’ADN jusqu’à l’activation du génome embryonnaire au stade
8 cellules chez le bovin. À ce moment, Dnmt1 se relocalise au noyau et permet de copier le
patron de méthylation induit par Dnmt3 lors des mitoses subséquentes (Bestor, 2000). Il en
découle que les cellules filles pourraient avoir des épigénomes différents selon le brin reçu.
2.3.5. Déméthylation active
Chez les plantes, la déméthylation active est possible entre autres grâce à DEMETER1
(Zhu, 2009). DEMETER1 est une enzyme à double fonction : dans un premier temps, elle
reconnaît la cytosine méthylée et y hydrolyse le lien N-glycosydique unissant le squelette
de désoxyribose phosphate et la base méthylée. Puis, dans un second temps, elle agit à titre
de lyase en créant un site apyrimidique pouvant être réparé par une DNA polymérase. Chez
les animaux, aucune glycosylase capable de reconnaître les cytosines méthylées n’a été
22
découverte, ce qui suggère que des enzymes doivent altérer la cytosine ou le groupement
méthyl avant qu’une glycosylase puisse détecter la base à retirer.
Activation-induced cytidine deaminase (Aicda) est une de ces enzymes qui agissent en
modifiant la nature de la cytosine méthylée. Il s’agit d’une déaminase connue depuis
longtemps pour son rôle dans l’hypermutation somatique et le changement de classe des
immunoglobulines au sein des lymphocytes B immatures (Neuberger et al., 2003). Sa
présence a néanmoins été révélée chez la souris dans l’ovocyte, les tissus embryonnaires et
les cellules germinales primordiales (Morgan et al., 2004) de même que dans l’ovule du
poisson zèbre (Rai et al., 2008), ce qui sous-entend une deuxième fonction pour cette
enzyme. Au niveau du génome, le gène Aicda fait partie d’un groupe de gènes de
pluripotence tels Stella et Nanog, gènes qui s’expriment exclusivement dans les zygotes et
les CGP. Un séquençage au bisulfite a mis en évidence que les niveaux de méthylation de
l’ADN des CGP mâles et femelles de souris déficientes en Aicda étaient respectivement 4%
et 13% plus élevés que chez des CGP normaux, ce qui montre que Aicda contribue à la
déméthylation des cellules germinales (Popp et al., 2010). L’activité de Aicda se fait en
retirant le groupement NH2 d’une cytosine méthylée et en y substituant un atome
d’oxygène. La cytosine prend alors la forme d’une thymine et, ce faisant, fait naître un
mésappariement G : T. La base mésappariée est alors reconnue puis retirée par une
glycosylase (Thymine DNA glycosylase chez la souris (TDG) (Morgan et al., 2004) et
Methyl binding protein 4 (MBD4) chez le poisson-zèbre (Rai et al., 2008) qui brise le
double lien carbone unissant la base au corps phosphaté de l’ADN. Une lyase du système
de réparation de l’ADN par excision de base (REB) est ensuite recrutée pour retirer la
pyrimidine, puis le trou est comblé par une ADN polymérase. Par contre, les souris
déficientes en Aicda ne présentent pas de phénotype particulier, hormis des difficultés au
niveau de l’hypermutation somatique dans les lymphocytes B immatures, et demeurent
fertiles. La contribution de Aicda ne serait donc pas essentielle au développement
embryonnaire et fœtal (Muramatsu et al., 2000).
Néanmoins, si Aicda n’est pas essentielle au développement embryonnaire des souris, il a
dernièrement été démontré que TDG l’est. Des souris homozygotes TDG-/- présentaient de
23
graves troubles du développement et mourraient avant la 2e semaine de gestation.
L’enzyme de réparation de l’ADN a donc un rôle crucial dans la survie embryonnaire.
Récemment, un « cinquième nucléotide » a été découvert dans des cellules de Purkinje, la
5-hydrométhylcytosine (5hmC). Lors de sa première observation, ce nucléotide altéré
constituait 0.6% des nucléotides du génome et l’équipe à la base de la découverte a suggéré
qu’il pouvait s’agir d’une voie alternative de déméthylation de l’ADN (Kriaucionis and
Heintz, 2009). Quelques mois plus tard, un autre groupe publiait qu’une protéine identifiée
au début des années 2000 en association avec la méthyltransférase de l’histone H3K4, MLL
(mixed-lineage leukemia) (Ono et al., 2002), dans des cellules de leucémie myéloïde aigüe
possédait l’activité enzymatique dioxygénase et transformait les 5mC en 5hmC (Tahiliani
et al., 2009). Cette enzyme, Ten-eleven translocation 1 (Tet), fait partie d’une famille de
dioxygénases constituée de trois membres – Tet1-3 – aux fonctions similaires mais à
l’expression tissulaire différentielle (Ito, D'Alessio et al . 2010). Elles sont toutes
relativement ubiquitaires, mais Tet1 est nettement plus abondante dans les cellules ES alors
qu’elle est absente de l’embryon préimplantatoire, et Tet3 est abondante dans le très jeune
embryon ainsi que dans les cellules hématopoïétiques. Aussi, la famille Tet est souvent
surexprimée ou mutée dans les cellules cancéreuses (Mercher et al., 2012; Metzeler et al.,
2011; Yang et al., 2012). Ces enzymes portent toutes un domaine en doigts de zinc CXXC
de liaison aux CpG non méthylés et un domaine dioxygénase dépendant de Fe(II)- et 2oxoglutarate (2OG).
L’hydroxylation des 5mC n’est pas reconnue par les protéines possédant un domaine
d’ancrage spécifique à cette modification telles que les familles MBD et Dnmt. Il est ainsi
suggéré que l’hydroxylation rende silencieuse la méthylation, impliquant alors que certains
gènes réprimés par des méthylations sur leurs promoteurs puissent être transcrits (Gu et al.,
2011). Aussi, en considérant que des protéines de structure de la chromatine sont recrutées
sur les CpG méthylés, il est plausible que l’hydroxylation puisse empêcher ce processus et
contribuer à une configuration différente de la chromatine (Thalhammer et al., 2011).
Aussi, dans les cellules en prolifération, on suggère que l’hydroxylation des 5mC facilite la
déméthylation passive lors de la réplication en contrant la liaison de Dnmt1 et la
méthylation conséquente sur le brin néosynthétisé (Salvaing et al., 2012; Tahiliani et al.,
24
2009). La fonction pourrait s’appliquer également aux pronoyaux mâle et femelle. Le
niveau de 5hmC et de 5mC a été analysé dans des zygotes et des embryons de souris avec
comme résultat une corrélation inverse entre les deux marques épigénétiques : le nombre de
5hmC augmentait rapidement dans les pronoyaux paternels de souris alors que celui des
5mC diminuait au même rythme (Gu et al., 2011). Les pronoyaux femelles ne subissaient
pas de changement à cet égard (Gu et al., 2011). Conformément à ces résultats, la
localisation par immunofluorescence a montré que Tet3 était dans le pronoyau mâle des
souris pour être ensuite confiné au cytoplasme. L’importance de Tet3 a finalement été
démontrée par l’impossibilité à générer des souris homozygotes mutantes pour Tet3, cellesci mourant à l’état d’embryon.
L’hydroxylation de la 5mC n’est toutefois pas suffisante à la déméthylation active.
Considérant que la glycosylase TDG est inapte à reconnaître l’hydroxylation, une étape
intermédiaire est requise entre les deux activités enzymatiques. La solution vient de la
famille Tet elle-même qui peut agir sur les 5mC autant que les 5hmC. L’enzyme catalyse
ainsi la transformation de 5hmC en 5-formylcytosine (5fC) et en 5-carboxylcytosine (5caC)
(Ito et al., 2011), deux sous-produits reconnus par TDG. De plus, la très grande rapidité
avec laquelle TDG agit sur eux incite à croire en une nouvelle explication concrète du
processus de déméthylation de l’ADN chez les mammifères (Maiti and Drohat 2011).
25
Figure 4. Modifications des cytosines et enzymes associées. Dnmt ajoute un groupement
méthyle à une cytosine pour former une 5-méthyl-cytosine (mC). Aicda déamine la
cytosine en formant une thymine (T) ou une uridine (U). Tet oxyde de une à trois fois le
groupement méthyle pour former une hydroxyméthylcytosine (hmC), une formylcytosine
(fC) ou une carboxycytosine (caC). L’action successive de Aicda et Tet forme une
hydroxyuridine. Adaptée de Nabel et al . (Nabel et al., 2012)
2.4. Les histones
26
Les nucléosomes sont formés de deux copies des histones H2A, H2B, H3 et H4 et forme un
octamère autour duquel l’ADN s’enroule. Cette structure est conservée chez tous les
eucaryotes et est maintenant considérée comme étant un déterminant crucial, à tous les
niveaux, des gènes et de leurs fonctions (Kornberg and Lorch, 1999). En effet, bien que les
histones soient extrêmement conservées, elles sont sujettes à un nombre impressionnant de
manipulations et de modifications post-transcriptionnelles accomplies par des enzymes, ce
qui leur confère une capacité quasi infinie de variabilité (Turner, 2001). Les modifications
des histones, les variants d’histones et le positionnement des nucléosomes travaillent en
synergie avec la méthylation de l’ADN pour réguler l’expression des gènes et modifier
l’accessibilité des régions promotrices à la machinerie de transcription (Jenuwein and Allis,
2001).
En modulant le degré de compaction de l’ADN, les histones occupent ou libèrent les
promoteurs et jouent ainsi un rôle de gardien de la transcription.
Des études de
cristallographie ont permis de mettre en évidence la queue N-terminale des histones qui est
en quelque sorte un appendice au complexe nucléosomal (Luger et al., 1997) et qui permet
des interactions internucléosomales et protéiques.
Des enzymes ont pour fonction de
modifier post-traductionnellement les queues N-terminales des histones afin de signaler
l’état de la chromatine, d’autre encore agissent en déplaçant ou démantelant
temporairement les nucléosomes. Les modifications des histones semblent se faire selon un
ordre précis où certaines modifications sont préalables à d’autres, créant ainsi le code des
histones
(Strahl
and
Allis,
2000).
Ces
modifications
permettent
une communication complexe et dynamique au sein du noyau et impliquent des interactions
avec la chromatine et les protéines qui y sont associées, des protéines de régulation, des
molécules non-protéiques, des composants du cytosquelette nucléaire et des ions.
Au grand étonnement de plusieurs, il a été observé dans des embryons et des cellules ES
que plusieurs gènes portent des marques épigénétiques bivalentes, c’est-à-dire que leur
signification est opposée, l’une activant la transcription et l’autre la freinant. Plusieurs des
gènes impliqués dans le développement embryonnaire et la différenciation cellulaire sont
touchés par ce chevauchement de signaux. On constate qu’ils sont maintenus dans un état
27
actif et qu’ils sont exprimés, quoique faiblement et à des moments précis (Zhao et al.,
2007).
2.4.1 L’acétylation
Certaines lysines des queues N-terminales des histones sont très conservées et servent de
sites pour des modifications post-traductionnelles. Des groupements acétyles peuvent ainsi
influencer d’une manière électrostatique les interactions entre les histones et l’ADN de par
la charge nette négative qu’ils portent. Ces groupements sont ajoutés par des enzymes de la
famille histones acétyltransférase (HAT) et viennent former la ε-N-acetyl lysine (Kleff et
al., 1995). Le groupement acétyle provient d’un cofacteur, l’acétyl-coenzyme A (acétylCoA) (Marmorstein, 2001). Ces marques épigénétiques sont temporaires et peuvent être
retirées par des histones déacetylases (HDAC) (Kleff et al., 1995).
Les HAT se divisent en deux grandes classes chez les mammifères : la classe A dont les
membres agissent sur les histones après l’assemblage du nucléosome et la classe B dont les
membres sont localisés dans le cytoplasme et acétylent les histones avant leur inclusion
dans la chromatine.
La classe A se subdivise en trois sous-classes : les MYST
(MOZ, Ybf2/Sas3, Sas2 et TIP60), les GNAT (Gcn5 N-Acetyltransférase related) et les
« Autres » dont p300/CBP et ATF-2 font partie. On trouve souvent les HAT liées à des
complexes multimériques. Cette association a des sous-unités de liaison à l’ADN ou
d’interaction protéine-protéine et guide les HAT vers leurs sites d’action.
28
Tableau 1. Histone acétyltransférases
Classe
Sous-classe
A
GNAT
MYST
Membres
Phénotype -/-
GCN5L
m.e. J10.5
PCAF
viable
Tip60 et MOF
m.e. J3.5
HBOI,
-
MORF, MOZ,
-
CLOCK,
-
NCOAT,
MOF
Autres
B
Hat1
P300/CBP,
m.e. J11.5
TFIIIC,
-
ACTR/SRC-I,
-
ATF-2
-
HAT1
-
Tableau 1. Les membres des différentes classes de HAT chez les mammifères et le
phénotype associé à la déplétion homozygote du gène. m.e. J: mort embryonnaire au jour X
postfécondation. NAD+ : nicotinamide adénine dinucléotide (Lemoine and Younes, 2010;
Voss and Thomas, 2009).
29
Tableau 2. Histone déacétylases
Classe
I
Iia
Substrat
Zn2+
Zn2+
IIb
Zn2+
III
NAD+
Membres
Phénotype -/-
HDAC1
m.e. J10.5
HDAC2
mort post-natale
HDAC3
m.e. J9.5
HDAC8
-
HDAC4
viable, troubles cartilagineux
HDAC5
viable, troubles cardiaques
HDAC7
m.e.
HDAC9
viable, troubles cardiaques
HDAC6
viable
HDAC10
-
SIRT1-7
-
IV
Zn2+
HDAC11
-
Tableau 2. Les membres des différentes classes de HDAC chez les mammifères et le
phénotype associé à la déplétion homozygote du gène. m.e. J: mort embryonnaire au jour X
postfécondation. NAD+ : nicotinamide adénine dinucléotide (Lemoine and Younes, 2010;
Voss and Thomas, 2009).
Les déacétylases des histones sont très nombreuses – dix-huit identifiées chez l’humain – et
sont regroupées en quatre classes qui reflètent à la fois leur localisation cellulaire, leur
homologie avec les HDAC de levure et leur activité enzymatique (Lemoine and Younes,
2010). Les classes I, II et IV sont dépendantes du zinc pour exercer leur activité catalytique
alors que la classe III, aussi appelée sirtuine, est dépendante du dinucléotide nicotinamide
adénine (NAD+).
Depuis la découverte des HAT et des HDAC, le ratio acétylation/déacétylation des histones
a été démontré comme jouant un rôle prépondérant dans la régulation de l’expression des
30
gènes. Les effets des acétylations sont multiples (Efroni et al., 2008). Premièrement,
puisque les groupements acétyles sont chargés négativement, ils neutralisent les charges
positives portées par l’histone (Allfrey et al., 1964). De ce fait, l’affinité ADN-nucléosome
est réduite et le déplacement des histones est facilité, libérant l’accès aux facteurs de
transcription et à l’ARN polymérase II (Mathis et al., 1978). Des complexes de remodelage
de la chromatine ATPasiques tel que SWI/SNF doivent cependant être recrutés par les
lysines acétylées car ce sont ces enzymes qui s’associent sur l’ADN et qui permettent le
déplacement des nucléosomes (Cote et al., 1994). Une fois la transcription terminée, des
histones déacétylases retirent les groupements acétyles afin de rendre ces sites à nouveau
inaccessibles. Deuxièmement, l’acétylation des histones peut inhiber l’enchevêtrement des
nucléosomes en des structures complexes de compaction de l’ADN. L’effet de l’acétylation
peut donc rendre le promoteur et le site d’initiation de la transcription accessible à la
machinerie de transcription. Toutefois, quelques exceptions existent où l’acétylation est
associée à la répression plutôt qu’à l’activation d’un gène, notamment les lysines H4K8 et
H4K16 chez la levure (Lennartsson and Ekwall, 2009). Cette fonction en apparence
contradictoire avec l’effet électrostatique de l’acétylation sur l’affinité nucléosome-ADN
s’explique par le recrutement de protéines aux actions diverses qui sont recrutées en
fonction des marques épigénétiques présentes (Gu and Roeder, 1997). Les sites
d’acétylation connus à ce jour ont été déterminés par Bjerling et al . en 2002 (Bjerling et al.,
2002) en utilisant comme modèle eucaryote la levure Schizosaccharomyces pombe. Il s’agit
des lysines K5, K8, K12 et K16 de l’histone H4 et des lysines K9, K14, K18 et K23 de
l’histone H3.
2.4.2 La méthylation
Contrairement aux acétylations, les groupements méthyles ne portent pas de charges et
n’ont donc aucun impact sur les interactions électrostatiques entre les histones et l’ADN.
En revanche, ces groupements ont une grande influence puisqu’ils sont reconnus par des
31
protéines portant des domaines chromo (chromatin modification organizer), tudor, MBT
(malignant brain tumor) et PHD (plant homeobox domain) en plus de modifier les sites
reconnus par d’autres protéines. Ainsi, selon le positionnement de l’histone méthylée par
rapport au gène, la lysine ou l’arginine modifiée et l’enzyme qui entre en jeu, la
méthylation peut favoriser ou réprimer la transcription d’un gène (Martin and Zhang,
2005).
Les lysines sont méthylées par des KMT (lysine méthyltransférases) qui possèdent presque
toutes un domaine SET (su(var)3-9, enhancer-of-zest, trithorax) conservé. Il est maintenant
connu que la méthylation de H3K4, H3K36 et H3K79 est associée à une activité
transcriptionnelle alors que celle sur H3K9, H3K27 et H4K20 est plutôt liée à la répression.
Dans l’embryon, de nombreuses méthyltransférases spécifiques de H3K4 assurent
l’expression des gènes de développement, notamment MLL 1 et 2 (mixed lineage
leukemia) qui maintiennent l’expression des gènes Hox (Milne et al., 2002). Ces gènes de
pluripotence doivent tout de même être éteints le moment venu. Ainsi, le Polycomb group
repressive complex 2 (PRC2) regroupe des KMT telles que Suz12, Eed et Ezh2 qui,
ensemble, catalysent la triméthylation de H3K27 afin de promouvoir la condensation de la
chromatine et de permettre la poursuite de l’embryogenèse. Aussi, la méthyltransférase G9a
est présente dans l’embryon afin de triméthyler H3K9 et d’induire la formation
d’hétérochromatine facultative au niveau des gènes de pluripotence, notamment OCT3/4
(Feldman et al., 2006).
Les méthyltransférases des arginines (RMT), à la différence des KMT, n’ont pas pour
unique cible les histones. Elles peuvent en effet agir sur différentes protéines de la
transduction des signaux, de la prolifération cellulaire, de la réparation de l’ADN et de la
maturation des ARN (Bedford and Richard, 2005). On regroupe ces méthyltransférases
dans la famille des protéines arginine N-methyltransferases (PRMT). PRMT1, PRMT2 et
PRMT4, en exerçant leur fonction catalytique, agissent comme coactivateurs de la
transcription alors que PRMT5 agit comme répresseur.
32
Figure 5 Principales méthylations des lysines situées sur les queues N-terminales des
histones H3 et H4. Les chiffres inscrits dans le corps des queues des histones correspondent
aux acides aminés méthylés sur les résidus lysine (K) et les points de couleur correspondent
à la fonction de chaque méthylation. Adapté de Nima Mosammaparast, 2010
(Mosammaparast and Shi, 2010).
2.4.3 Déméthylation
L’énergie requise pour défaire le lien N-CH3 est très grande puisqu’il est
thermodynamiquement très stable. Ainsi, jusqu’à tout récemment, la méthylation des
histones était considérée comme une marque épigénétique indélébile. En 2004 toutefois, ce
postulat tomba grâce à la découverte chez la levure de la première vraie déméthylase,
Lysine Specific Demethylase 1 (Shi et al., 2004) (LSD1 ou KDM1A selon la nouvelle
nomenclature (Allis et al., 2007; Shi et al., 2004). Les limitations de cette amine oxydase,
33
dont le site catalytique ne permet que de retirer les mono- et les diméthylations, ont
entretenu l’idée que la haute stabilité des méthylations rendait impossible le retrait des
triméthylations et que cette marque était donc non-modifiable. En 2006, une autre équipe a
néanmoins découvert une déméthylase appartenant à une autre classe d’enzyme et qui
pouvait retirer les triméthylations. Celle-ci portait un domaine catalytique Jumonji en Cterminal et fut baptisée Jumonji histone demethylase 1, ou Jhdm1. D’autres protéines
contenant le même domaine catalytique ont par la suite été identifiées. Finalement, une
troisième classe de déméthylases des histones a été révélée en 2006 avec la découverte de
Jarid1, dont le nom provient de son domaine de liaison à l’ADN riche en AT. Une nouvelle
nomenclature a regroupé ces enzymes sous l’acronyme KDM, soit lysine déméthylase.
2.4.3.1 KDM1
KDM1A est une amine oxydase dépendante du cofacteur FAD (flavin adenine
dinucleotide) et est hautement conservée de la levure à l’humain (Shi et al., 2004). Elle agit
à la fois sur H3K4me2/me1 et sur H3K9me2/me1. Toujours selon les travaux de Shi et al,
la déméthylation se produit par l’oxydation du lien Nɛ-CH3, transformant alors la lysine
méthylée en méthyllysine imine et le cofacteur FAD en FADH2. L’hydrolyse de la
méthyllysine imine permet ensuite la déméthylation par la libération du sous-produit
formaldéhyde. En 2009, LSD2/KDM1B, une seconde amine oxydase dépendante de FAD,
a été identifiée grâce à une très forte homologie avec KDM1A (Karytinos et al., 2009).
Il a été démontré que la sous-unité amine oxydase de ces enzymes se liait à un complexe
répresseur des histones déacétylases (HDAC) et qu’elle exerçait ensuite une activité
déméthylase sur les lysines mono- et diméthylées H3K4 (Shi et al., 2004). Puisque
H3K4me2 est associé à la transcription des gènes, son retrait par KDM1A est un signe de
répression de la transcription. À l’opposé, puisque H3K9me2 est lié à la répression des
gènes, sa déméthylation par KDM1A est activatrice de la transcription (Metzger et al.,
2005). Quelques années plus tard et grâce à une très grande homologie, LSD2 a été
découverte chez la levure (Opel et al., 2007).
34
KDM1A est essentielle à la survie embryonnaire, comme l’ont démontré Wang et al dans
deux études portant sur cette enzyme (Wang et al., 2007) (Wang et al., 2009). En effet, les
souris déficientes en KDM1A qu’ils ont générées mourraient à un stade embryonnaire
précoce et les cellules ES déficientes en KDM1A présentaient des problèmes de croissance
et de différenciation cellulaire. Sans expliquer les liens entre le développement
embryonnaire et l’enzyme, ces études mettent à tout le moins l’emphase sur le rôle critique
de KDM1A dans certaines fonctions critiques du développement. Des réponses ont par la
suite été fournies par d’autres auteurs qui ont associé KDM1A à de nombreux facteurs de
transcription. Parmi ces facteurs de transcription, notons GFI1/1B (growth-factor
independent 1 and 1B), OCT4, RBPJ (recombination signal binding protein for
immunoglobulin kappa J region), ZEB1 (zinc finger E-box-binding homeobox 1), TAL1
(T-cell acute lymphocytic leukemia protein 1), PRDM1 (PR domain zinc finger protein 1),
TLX (human homologue of Drosophila tailless), AR (androgen receptor) et p53
(revue,(Pedersen and Helin, 2010)). Puisque plusieurs de ces facteurs de transcription sont
impliqués dans le développement embryonnaire, l’importance de KDM1A dans la
régulation d’une vaste gamme de processus cellulaires est maintenant établie et comprise.
McGraw et al a, en 2007, étudié le patron d’expression de KDM1A dans plusieurs stades
embryonnaires préimplantatoires chez le bovin. Ils ont observé une forte présence d’ARNm
dans le stade GV suivit d’une constante diminution jusqu’à atteindre un niveau très faible
au stade 8-cellules, moment à partir duquel la transcription embryonnaire reprend chez le
bovin et permet à KDM1A d’être à nouveau transcrite et présente fortement au stade
blastocyste, du moins sous forme d’ARNm. Shao et al ont proposé en 2008 (Shao et al.,
2008) que la présence de KDM1A au stade blastocyste permette la différenciation cellulaire
en déméthylant H3K4me sur le promoteur de Oct4. Cette déméthylation induirait la
répression de l’expression de Oct4, un gène de pluripotence, et permettrait à la cellule de
prendre la voie de la différenciation.
Alors que KDM1A est impliquée dans la régulation de l’expression d’une multitude de
gènes dans de nombreux organes, KDM1B est uniquement exprimée dans les ovocytes et
les glandes intestinales (Ciccone et al., 2009). En utilisant le système de recombinaison
cre/LoxP, David N. Ciccone (Ciccone et al., 2009) a produit des souris déficientes en
35
KDM1B. Celles-ci présentaient un phénotype de létalité causé par un marquage erroné des
gènes à empreinte maternels. Les ovocytes issus de femelles déficientes en KDM1 ne
parvenaient pas à faire la méthylation adéquate de l’ADN au niveau de plusieurs gènes à
empreinte ce qui induisait une expression biallèlique de ce gène dans les embryons et
conduisaient à une mort embryonnaire précoce.
2.4.3.2 KDM2
JHDM1/KDM2 est un sous-groupe de déméthylases des histones appartenant à la large
famille des protéines à domaine Jumonji et contient deux membres : KDM2A et KDM2B.
Ce sous-groupe est hautement conservé de la levure à l’humain et contient, en plus du
domaine Jumonji, des domaines additionnels impliqués dans divers processus cellulaires :
CXXC zinc-finger domain, impliqué dans la liaison à l’ADN, un domaine PHD (plant
homeobox domain) impliqué dans les interactions protéine-protéine dont celle avec les
histones, un domaine de localisation nucléaire NoLS (nucleolar localization signal) et un
domaine F-box et riche en leucines (LRRs), qui doit d’ailleurs à cette déméthylase le nom
alternatif de FBXL11 (Tsukada et al., 2006). Découverte en 2006 par l’équipe de Tsukada
et al, KDM2A est la première déméthylase des triméthylations des lysines des histones à
être identifiée. La même équipe a également mis en évidence l’existence chez l’humain et
la souris de JHDM1B/FBXL10 grâce à la grande homologie qui les unit. Toutefois, si
Tsukada et al leur avait initialement conféré une spécificité pour H3K36me2/me1, Cloos et
al (Cloos et al., 2006) leur ont quelques mois plus tard attribué une seconde fonction, soit
celle de déméthylase des H3K4me3/me2. Dans tous les cas, la déméthylation de
H3K36me2/1 et de H3K4me3/me2 impliquent une répression de la transcription.
Conformément à cette répression, l’enzyme est associée à l’hétérochromatine alors qu’elle
en maintient la stabilité en se liant à HP1. Elle tiendrait également un rôle crucial dans le
silence transcriptionnel des gènes satellites et centromériques (Frescas et al., 2008).
Quant à KDM2B, la même équipe publiait en 2007 dans Nature que la présence du
domaine CXXC en doigt de zinc permettait sa liaison à l’ADN ribosomal et que son
domaine JmjC réprimait ces gènes localisés près du nucléole en déméthylant H3K4me3.
36
Puisque la synthèse d’ARNr est intimement liée à la croissance cellulaire, la forte
expression de KDM2B inhibe la croissance et la prolifération cellulaire (Frescas et al.,
2007).
2.4.3.3 KDM3
La sous-classe des KDM3 appartient à la grande famille Jumonji et contient trois membres
qui peuvent déméthyler H3K9 mono- et diméthylée chez l’humain (Yamane et al., 2006).
Puisque la méthylation de H3K9 est associée à la répression transcriptionnelle, l’action de
KDM3A est considérée être activatrice de la transcription. Son implication a été démontrée
dans la spermatogénèse chez la souris alors qu’une déficience homozygote du gène rendait
impossible la transcription de la protéine protamine 1 (PRM1) et de la protéine de transition
1 (TPNP1), résultant en une incapacité à condenser la chromatine et en une stérilité
associée (Okada et al., 2007). D’autres déficiences de KDM3A ont été faites en 2012 afin
d’étudier les rôles de l’enzyme au niveau du développement embryonnaire. Il a ainsi été
observé que ces cellules KDM3-/- restaient bloquées au stade d’endoderme primitif plutôt
que de continuer leur différenciation vers un endoderme pariétal. Ceci s’expliquerait par le
fait que KDM3A, de par sa fonction de déméthylase de H3K9me2, est un régulateur positif
de gènes spécifiques à la différenciation des cellules de l’endoderme, entre autres de Dab2,
FoxQ1 et Pdlim4. Ainsi, en permettant l’expression ou non de gènes de différenciation,
KDM3A jouerait un rôle dans la destinée des cellules (Herzog, Josseaux et al 2012).
KDM3A est aussi impliquée dans le développement des myocytes, dans la réponse
hypoxique et dans le métabolisme énergétique. Loh (Loh et al., 2007) a montré que les
cellules humaines K.O. pour ce gène perdaient leur pluripotence et se différenciaient. Une
hypothèse expliquant cette différenciation pourrait être fournie par une étude faite sur des
cellules mammaires cancéreuses humaines. Il a en effet été montré que KDM3A était
surexprimée dans ces cellules et qu’elle agissait en déméthylant H3K9me2 sur le promoteur
de HOXA1. Ce gène est normalement exprimé pendant le développement embryonnaire et
permet la différenciation cellulaire. Dans une cellule cancéreuse, HOXA1 stimule la
transcription de la cycline D1 impliquée dans la phase G1/S du cycle cellulaire(Cho et al.,
2012), d’où implication dans le cancer. McGraw a analysé, en 2007, les quantités d’ARNm
37
contenues dans chacun des stades embryonnaires précoces chez le bovin grâce à des qPCR.
Il a ainsi pu constater que l’ovocyte bovin accumulait une grande quantité de cet ARNm
pendant sa maturation, que les niveaux étaient faibles au stade 8-cellules, moment du MET,
et qu’il remontait considérablement au stade blastocyste, suggérant un possible rôle
pendant ces stades (McGraw et al., 2007).
La fonction de KM3B n’a été mise en évidence qu’en 2012. Il s’agit d’une déméthylase
spécifique à H3K9me2 qui contrôle l’expression du gène LIM domain only 372 protein 2
(lmo2), un régulateur transcriptionnel essentiel à l’érythropoïèse (Kim, Kim et al 2012).
KDM3C a initialement été nommée Thyroid hormone receptor-interacting protein 8
(TRIP8) puisqu’elle y a été identifiée comme coactivateur interagissant avec le récepteur
aux androgènes. Nous savons maintenant qu’elle est impliquée dans le développement des
testicules en activant un marqueur de la stéroïdogenèse, p450c17, via la transcription de
SF-1 (Kim et al., 2010).
2.4.3.4 KDM4
Il y a quatre protéines membres de la famille KDM4 chez les mammifères :
KDM4A/JHDM3A/JMJD2A,
KDM4B/JHDM3B/JMJD2B,
KDM4C/JHDM3C/JMJD2C/GASC1 (gene amplified in squamous cell carcinoma 1) et
KDM4D/JHDM3D/JMJD2D. Cette famille catalyse la déméthylation de H3K9me3 et de
H3k36me3 (Cloos et al., 2006). Plus récemment, on a observé une activité de KDM4A sur
H1.4K26me3/me2 (Trojer et al., 2009). Considérant que H3K9me3 et H1.4K26me2 sont
des marques reconnues par Heterochromatin protein 1 (HP1) et sont donc liées à la
répression de la transcription, leur déméthylation influe sur l’expression des gènes. Ainsi, la
surexpression de cette famille de déméthylases entraîne la délocalisation de HP1 et le recul
de l’hétérochromatine, ce qui est en accord avec son rôle antagoniste de l’hétérochromatine
(Klose et al., 2006; Trojer et al., 2009). KDM4A, lorsque inactivée dans des drosophiles a,
chez le mâle uniquement, entraîné une réduction de l’espérance de vie et des défauts
phénotypiques aux ailes (Lorbeck et al., 2010). Dans une lignée cellulaire cancéreuse
38
humaine (U2OS), KDM4A permet de contrôler les évènements de réparation de l’ADN en
occupant les sites d’ancrage des enzymes de réparation. Mallette et al ont en effet observé
que H4K20me2, le site reconnu par 53BP1 lorsqu’une cassure double brin survient dans
l’ADN, est ubiquitaire et qu’il devait être masqué en permanence afin d’éviter une
réparation continuelle de l’ADN. Considérant que KDM4A se lie à H4K20me2 avec une
plus grande affinité que 53BP1, elle masque le site lorsqu’aucune réparation n’est
nécessaire mais doit être poly-ubiquitinée par RNF8/RNF168 puis dégradée dans le
protéasome lorsqu’une cassure survient. H4K20me2 devient alors exposée et p53BP1 peut
s’y lier (Mallette et al., 2012). Dans une lignée cancéreuse de prostate, de colon et dans des
cellules directement prélevées dans une tumeur de côlon humaine, il a été noté que
l’expression de KDM4A était accrue.
KDM4C est hautement conservée de la levure à l’humain. Étonnamment, elle agit à la fois
sur
H3K9me3,
marque
de
répression,
et
sur
H3K36me3,
marque
d’activité
transcriptionnelle (Klose et al., 2007a). Une étude menée par Yuin-Han Loh et al en 2007 a
démontré que cette protéine était cruciale au maintien de la pluripotence de cellules
humaines cultivées in vitro (Loh et al., 2007). Plus récemment, Jianle Wang a découvert
que cette protéine était exprimée pendant le développement préimplantatoire des souris,
principalement entre les stades 2 et 8 cellules (Wang et al., 2010). Les embryons exempts
de cette déméthylase et activés parthenogénétiquement en MII cessaient leur croissance
avant le stade blastocyste, suggérant ainsi le rôle essentiel de KDM4C dans le
développement embryonnaire. Ils ont également observé qu’elle est associée à l’expression
normale des gènes de prolifération Myc et Klf4 et des gènes de pluripotence OCT4 et Sox2.
Ce dérèglement serait à l’origine de l’arrêt développemental dans les embryons déficients
en KDM4C (Wang et al., 2010).
2.4.3.5 KDM5
La sous-classe des KDM5 inclut 4 membres, KDM5A-D. Contrairement aux autres
déméthylases des histones, cette sous-classe regroupe des enzymes ayant un site de liaison
à l’ADN riche en AT (ARID) ce que lui a valu le nom initial de JARID1 (JumonjiC39
containing ARID), ainsi qu’un domaine en doigt de zinc et deux ou trois domaines PHD
(plant homeobox domain) impliqués dans les interactions protéine-protéine. Les KDM5 ont
toutes trois la même cible enzymatique, H3K4me2/3. Cette marque épigénétique est
associée à la transcription et on la retrouve sur les promoteurs des gènes actifs et au site
d’initiation de la transcription où elle sert d’ancrage aux éléments de la machinerie de
transcription. Aussi, lors du développement embryonnaire, sa présence est largement accrue
sur les promoteurs des groupes de gènes Hox afin d’en maintenir l’ouverture, débordant
même sur les régions cédantes (Chambeyron and Bickmore, 2004).
En retirant les groupements méthyles de H3K4me3, la sous-classe des KDM5 répriment la
transcription. Les membres les mieux décrits de cette famille sont KDM5A et KDM5B.
Toutes deux sont associées au contrôle du cycle cellulaire alors qu’elles retirent les
marques activatrices de la transcription sur des gènes hautement actifs destinés à poursuivre
le cycle cellulaire. Elles agissent aussi directement et indirectement sur pRB (protéine
rétinoblastome), l’une des protéines contrôlant la transition G1/S, afin de prévenir le
passage en phase S. Il a ainsi été démontré que la déméthylation de H3K4me3 via KDM5A
ou KDM5B inhibait l’expression des gènes ciblés par pRB, soit des gènes de synthèse de
l’ADN (Chicas et al., 2012) et de prolifération.
Seiler a montré récemment que KDM5A est recruté sur les sites de cassures double brin
induites par des rayons ionisants. Elles y répriment la transcription des gènes situés dans la
zone de cassure pendant la réparation de l’ADN par les protéines de réparation par
recombinaison homologue (Seiler et al., 2011).
KDM5B est impliquée dans la différenciation cellulaire. Une étude a démontré que sa
surexpression dans des cellules souches embryonnaires de souris empêchait la
différenciation de ces cellules (Dey et al., 2008) en inhibant la transcription de gène de
différenciation. Toutefois, si on lui attribue une action répressive de la transcription, il a
récemment été montré qu’elle agissait également en activant les gènes de renouvellement
des cellules souches embryonnaires (Xie et al., 2011). Aussi, la même équipe a montré que
KDM5B pouvait lier H3K36me3 située dans les régions codantes de gènes de
40
renouvellement cellulaire et était alors associé à l’activation de la transcription. Cette
activation serait alors indirecte et consisterait en la réduction des initiations de la
transcription cryptiques afin de maximiser la formation d’un transcrit entier. Cette nouvelle
fonction expliquerait en partie l’association observée par plusieurs entre KDM5B et
certains cancers. KDM5B permettrait donc la prolifération des cellules souches tout en
réprimant la différenciation. L’importance de KDM5B est mise en évidence par la nonviabilité des souris KDM5B-/- qui ne franchissent pas le stade embryonnaire précoce
(Catchpole et al., 2011). Son expression, du moins dans les cellules souches embryonnaires
de souris et d’humain, est régulée par Nanog et Oct4, deux facteurs de transcription clé de
la pluripotence et du développement embryonnaire (Dey et al., 2008).
L’expression de KDM5A pendant les premiers stades embryonnaires permet d’inhiber la
transcription des gènes Hox (Christensen et al., 2007). Les étapes de différenciation sont
caractérisées par une délocalisation de KDM5A et une augmentation du niveau de
méthylation de H3K4 sur ces sites. Les souris KDM5A-/- sont viables malgré un phénotype
comportemental et hématopoïétique modifié, ce qui suggère la présence de mécanismes de
compensation, notamment via KDM5B (Klose et al., 2007b). KDM5A et KDM5B agissent
également d’une façon indépendante de la différenciation, entre autres en participant à la
fonction mitochondriale par un contrôle de l’expression des gènes mitochondriaux ou en
retirant les triméthylation de H3K4 sur les séquences codantes des gènes afin d’en prévenir
la transcription cryptique (Xie et al., 2011).
2.3.4.6 KDM6
La famille KDM6 englobe, chez les mammifères, les protéines KDM6A/UTX
(ubiquitously
transcribed
X
chromosome
tetraticopeptide
repeat
protein)
et
KDM6B/JMJD3, toutes deux déméthylases de H3K27me3, ainsi que UTY, à qui aucune
fonction de déméthylation n’a pu être attribuée (Christensen et al., 2007). KDM6A et
KDM6B sont impliquées dans la régulation des gènes HOX dans les cellules de
mammifères in vitro (Agger et al., 2007). Aussi, leur présence dans le complexe protéique
méthyltransférase de H3K4, MLL, rappelle la bivalence des marques épigénétiques dans
l’embryon. KDM6B est davantage transcrite en réponse à certains stress cellulaire par
exemple dans les macrophages activés, et lors de la différenciation cellulaire.
41
Une récente étude menée chez le porc a démontré que les niveaux globaux de H3K27me3
diminuent des stades 1- à 4-cellules, moment de l’activation du génome embryonnaire,
corrélés à une augmentation de la présence de KDM6B/JMJD3 et UTX (Gao et al., 2010).
Figure 6. Les familles de déméthylases des lysines des histones associées à chacune des
principales méthylations. Les chiffres inscrits dans le corps des queues des histones
correspondent aux acides aminés méthylés sur les résidus lysine (K) et les points de couleur
correspondent à la fonction de chaque méthylation. Adapté de Nima Mosammaparast,
2010 (Mosammaparast and Shi, 2010).
42
CHAPITRE 3
3.1 De l’importance de comprendre ces enzymes
Comment expliquer que certains ovules parviennent à se développer alors que d’autres
n’atteignent pas le premier clivage? Les différentes étapes de développement d’un embryon
sont marquées par une ribambelle d’activations et d’inhibitions de gènes toutes dépendantes
les unes des autres et ayant des fonctions majeures sur le devenir du fœtus. Cette
modulation de l’expression des gènes est assujettie au contrôle exercé par les enzymes de
méthylation/déméthylation de l’ADN ainsi que de modification post-traductionnelle des
histones. Ces enzymes, dont nous commençons tout juste à concevoir l’importance,
requièrent des conditions environnementales optimales pendant toute la maturation
ovocytaire et le développement embryonnaire pour agir correctement. La nouvelle
compréhension que nous apportent ces enzymes au sujet des processus moléculaires en
cours dans l’embryon ajoute un niveau de compréhension aux échecs souvent rencontrés
lors de protocole de fécondation in vitro. Il est possible de modifier l’expression des
enzymes régulatrices de la transcription avec des miARN, mais cette méthode est complexe
à réaliser et s’applique difficilement à une large échelle. Ainsi, si plutôt que de manipuler
les embryons pour en ajuster l’expression de certaines enzymes, nous pouvions nous baser
sur un profil épigénétique propice à un plein développement de l’embryon pour distinguer
les « bons » des « mauvais » embryons, nous pourrions sauver temps et argent en plus de
réduire grandement les troubles postnataux.
43
44
3.2 Objectifs
En analysant les niveaux d’expression relative d’enzymes de modification de l’épigénome à
différents stades embryonnaires, nous obtenons un portrait plus précis des mécanismes mis
en jeu à chaque instant et pouvons conclure sur le rôle potentiel de chacune d’elles.
Toutefois, la réserve d’ARNm que forme l’ovocyte pendant sa maturation biaise
grandement les cartes puisque nous ignorons dans quelle mesure les ARNm emmagasinés
seront traduits ou dégradés. Nous savons chez la souris qu’une large proportion – 25 % en
identité et 60% en quantité– des ARNm maternels chez la souris sont dégradés au moment
de la reprise de la méiose, c’est-à-dire avant d’être traduits (Bachvarova, De Leon et al .
1985), et que cette dégradation se poursuit suite à la fécondation pour atteindre, au stade 2cellules, un taux de 90%. Chez le bovin, une diminution de la réserve d’ARNm similaire à
celle observée chez la souris se produit pendant les trois premiers jours postfécondation
avec une dégradation atteignant 67% entre les stades ovocytes et 8-cellules. Par contre,
nous ignorons si cette diminution est liée à une dégradation des ARNm, à une traduction, à
une déadénylation partielle suivie d’une mise en réserve particulière ou à un mélange de ces
trois possibilités. Dans ces conditions particulières, il devient périlleux d’affirmer que, pour
un gène donné, la diminution de la quantité relative d’ARNm observée entre deux stades
embryonnaires est corrélée à l’augmentation équivalente de la forme protéique. Afin de
contourner cette limitation, nous avons cherché à valider les résultats obtenus en TI-RCPq
en confirmant la présence protéique. La méthode utilisée, l’immunofluorescence, nous a
permis d’observer certaines protéines intéressantes et de les localiser dans l’ovocyte et
l’embryon, donnant ainsi des pistes supplémentaires quant à leurs rôles et à leurs périodes
d’activité. Par exemple, une présence très diffuse d’une protéine dans le cytoplasme
suggère qu’elle n’agit pas à ce stade alors qu’une relocalisation au noyau au stade suivant
laisse penser qu’elle entre en action à ce moment. À l’inverse, une protéine affichant une
localisation nucléaire très définie dans les pronoyaux pour ensuite disparaître au stade
suivant indique probablement une action très ciblée à un stade précis.
45
46
3.3 Résumé
Mise en contexte : La fécondation chez les bovins entraîne de profonds bouleversements au
niveau de l’épigénome, tant à ce qui a trait aux méthylations de l’ADN qu’aux
modifications post-traductionnelles des histones, notamment la méthylation des lysines.
Ces changements sont d’une importance fondamentale puisqu’ils permettent l’activation
des gènes de pluripotence et redonnent au génome son plein potentiel d’expression génique.
Néanmoins, bien que nous soyons au fait du caractère fondamental de ce processus dans le
bon développement d’un individu, nous ignorons encore les mécanismes qui le gouvernent.
Aucune déméthylase de l’ADN n’a été identifiée à ce jour chez les mammifères, mais
certaines enzymes ont été observées chez le poisson-zèbre et chez la souris et nous portent
à croire que la déméthylation se ferait par un mécanisme indirect de modification de la base
méthylée ou du groupement méthyle avant d’être réparée par un système de réparation de
l’ADN. Ces enzymes sont Aicda et la famille des Tet hydrogénases. Le rôle de ces enzymes
semble diverger d’une espèce à l’autre et n’est pas encore clairement défini chez les
mammifères. Les histones ont pour leur part des déméthylases qui leurs sont associées dont
les déméthylases des lysines des histones, les KDM, qui nous ont intéressées dans le cadre
de cette étude. Les KDM se déclinent en de multiples familles ayant chacune une activité
catalytique spécifique à une ou plusieurs lysines méthylées. Leur profil d’expression chez
les mammifères n’est pas clairement établi. Objectif : Nous nous sommes donc attardés à
dresser un profil d’expression spatiotemporelle pour chacune de ces enzymes afin de mieux
comprendre les mécanismes moléculaires impliqués suite à la fécondation et pendant les
premiers stades embryonnaires chez le bovin. Méthode : Des ovocytes et des embryons à
différents stades préimplantatoires ont été récoltés suite à un protocole de fécondation in
vitro. L’ARN a été extrait, transcrit par réversion en cDNA et amplifié par TI-RCPq pour
les gènes Aicda, Tet1, Tet2, Tet3, KDM3A, KDM4A, KDM4C et KDM5B. D’autres
embryons aux mêmes stades ont été récoltés et la localisation protéique des gènes étudiés a
été évaluée. Résultats: L’hydroxylase Tet3 est présente dans les premiers stades
embryonnaires, contrairement à Tet1 et à la déaminase Aicda. Les déméthylases des lysines
des histones KDM3A, KDM4A et KDM4C sont exprimées avant et après l’activation du
génome embryonnaire alors que KDM5B est principalement exprimée au stade blastocyste.
47
Conclusion: La déméthylation de l’ADN suite à la fécondation chez le bovin n’est pas faite
par Aicda ni Tet1 mais probablement par Tet3, potentiellement aidé de Tet2. La
déméthylation des histones inclue la participation des déméthylases KDM3A, KDM4A,
KDM4C et KDM5B.
48
3.3. Article
Spatiotemporal expression of DNA demethylation enzymes and histone
demethylases in bovine embryo
Florence Pagé-Larivière, Marc-André Sirard
Centre de recherche en biologie de la reproduction, Université Laval, Québec, Canada
49
Abstract
Context: Fertilization in bovine causes profound changes in the epigenetic profile that
affect both DNA methylation patterns and post-translational histone modifications. These
dynamic changes have a great potential for activating pluripotency genes and unfolding
certain chromatin regions to recruit different transcription factors. Surprisingly, while the
fundamental function of epigenetic remodeling is well understood, the bases of the process
are still unknown. Recent developments in epigenetics suggest a multi-step demethylation
process that would imply the prior modification of the methylated cytosine or methyl group
followed by a DNA repair mechanism implicating enzymes as Aicda and Tet dioxygenase.
From one species to the other, their functions seem to differ and are not yet well
characterized in mammals. Histones have, for their part, many associated and specific
lysine demethylases (KDM). KDMs are classified into many subfamilies depending on
their catalytic activity and lysine specificity. Their expression profile in large mammals is
not well characterized. Objective: Drawing a spatiotemporal expression profile for each of
the genes studied to increase our understanding of the molecular interactions following
fertilization in early bovine embryo stages. Method: Bovine oocytes and embryos at
various preimplantation stages were collected following in vitro fertilization protocol. Total
RNA for Aicda, Tet1, Tet2, Tet3, KDM3A, KDM4A, KDM4C and KDM5B was extracted,
reverse transcribed into cDNA and amplified by real-time PCR. Other embryo pools were
collected and protein localization of the genes studied was characterized. Results: Tet3
dioxygenase was present in the very first embryo stages, in contrast to Tet1 and Aicda.
Histone demethylases KDM3A, KDM4A and KDM4C were expressed before and after
embryonic genome activation while KDM5B was mainly expressed during the blastocyst
period. Conclusion: DNA demethylation following fertilization in bovine is not
accomplished by Aicda but most probably by TET3. Histone demethylation is carried out
by, among others, KDM3A, KDM4A and KDM4C, which could act in sequence to
demethylate histones prior to DNA demethylation of the female chromosomes
50
Introduction
The hours following fertilization are the most critical steps of a new life. In mammals, this
period is marked by the complete reprogramming of the parental epigenome that confers
totipotency to zygote (Reik et al., 2001). During these first embryo stages, the embryonic
genome is silent and transcription is stopped. The absence of transcription is offset by a
stock of transcripts produced in growing oocytes. Throughout cells cleavage, this reserve
gradually diminishes due both to degradation and translation. The complete dependence of
embryo on oocyte stock of transcripts suggests that the tiniest oocyte dysfunction or the
slightest disturbance in oocyte maturation process may be critical for embryo development,
causing early or late abortion, fetal malformation and post-natal diseases.
Epigenetic modifications consist in molecular marks affixed upon DNA and histone tails in
a permanent or transitive manner to induce or inhibit gene expression. The fundamental
role of epigenetic marks is to regulate gene expression in each cell and determine its
functional specificity. Modifications are recognized by specific effector proteins which
modify chromatin configuration in a permissive or repressive way, according to epigenetic
marks (Couture and Trievel, 2006).
The process of DNA methylation in mammals and the enzymes involved remain
unresolved (Nabel et al., 2012). Nevertheless, it is known that, in mice, epigenetic
reprogramming capacity is maintained from oocyte to the 2-cell embryo, suggesting a
persistent presence of reprogramming enzyme at these stages (Bui et al., 2008; Egli et al.,
2007; Egli et al., 2009; Yang et al., 2010). Some studies on zebrafish and mouse suggest a
role for Activation-induced cytidine deaminase (Aicda), a deaminase that could take out the
amine group of the methylated cytosine to create a uridine-guanine mismatch that is further
repaired by the base excision repair system (BER) and replace by an un-methylated
cytosine (Cortazar et al., 2011; Rai et al., 2008). Other studies in mouse indicate that a
newly discovered family of enzymes, the Ten-eleven translocation (Tet) dioxygenase, can
hydroxylate the methyl group to counteract the recognition of the methyl group by effector
proteins (Couture and Trievel, 2006). It is also established that BER system is involved in
51
the
replacement
of
methylated
cytosine
(Cortazar
et
al.,
2011).
Histone lysine demethylases (KDM) are better characterized in comparison with protein
involved in DNA demethylation. Previous experiments performed in our lab identified a
few KDMs present in bovine oocyte (McGraw et al., 2007) and classified their profile into
three groups. The first group represents genes that are both maternally and embryonically
transcribed and includes KDM3A. The second consists in genes that are preferentially
transcribed from the oocyte genome and poorly transcribed by embryo. The third group
owns genes barely present before MET that get highly expressed thereafter, suggesting a
low or null participation of the protein in the first developmental stages. KDM5B was one
of those genes. Several new KDMs are potentially present or involved in early lysine
demethylation and have not been characterized in bovine embryos: KDM3A, KDM4A,
KDM4C and KDM5B.
The aim of our study was to determine which epigenetic modifying enzymes are present in
early stage bovine embryos and to analyse their kinetics and cellular localization to assess
their potential role in reprogramming both male and female gametes. Using qPCR and
immnunohistochemistry, the correspondence between mRNA expression/presence and
protein expression of Tet3, KDM3A, KDM4A, KDM4C and KDM5B during early
developmental stages (oocyte to blastocyst) was established.
Table 1 Information on genes studied. Principal functions and K.O phenotypes of genes
studied. PRM1 : protamine 1; TPNP1 : transition protein 1; ARID : AT-rich interacting
domain; C5HC2 : C5HC2 zinc-finger domain; TUDOR, Tudor domain; Jarid: Jumonji
domain–ARID-containing protein; JmjC, Jumonji C domain; JmjN, Jumonji N
domain; PHD : plant homeobox domain, CXXC-type zinc-finger binding domain; Cys-rich
: cysteine-rich region, methylcytosine dioxygenase catalytic domain; DSBH: doublestranded β-helixo, methylcytosine dioxygenase catalytic domain, metal binding; APOBEC:
apolipoprotein B mRNA-editing, enzyme-catalytic, polypeptide-like.
52
Names
Relevant information
KDM3A
Demethylates H3K9 me1/me2 and is
linked to gene expression. Overexpressed
by OCT4. Regulates pluripotency gene
such as NANOG and Sox2. Regulates
HOXA1 expression. Essential to PRM1
and TPNP1 synthesis.
Demethylates H3K9me3, H1.4K26me2
and H4K20me2. Binds H4K20me2 and
prevents undue recruitment of 53BP1, a
DNA repair protein. Must be degraded
when DNA break occurs at the linkage
site. Limits heterochromatin expansion
and overexpression causes HP1 removal.
Demethylate H3K9me3
H3k36me3.
Essential to maintain
pluripotency.
Regulate proliferation
genes (Myc, Klf4) and pluripotency genes
(OCT4, Sox2).
JMJD1A
JHDM2A
KDM4A
JMJD2A
JHDM3A
KDM4C
JDMJ2C
JHDM3C
KDM5B
Jarid1B
Tet1
Tet2
Tet3
Aicda
Protein
domains
JmjC
JmjN
JmjC
2 TUDOR
PHD
JmjN
JmjC
2 TUDOR
PHD
JmjN
Demethylates H3K4me3/2 and
are
JmjC
associated with gene repression. Binds
Arid
pRB and its gene targets to counteract
3 PHD
G1/S checkpoint of cell
C5HC2
CXXC
Hydroxylates 5meC into 5hmC. Mostly Cys-rich
present in ESC.
DSBH
3 NLS
Hydroxylates 5meC into 5hmC. Critical
regulator
of
self-renewal
and Cys-rich
differentiation of hematopoietic stem cells DSBH
(HSCs)
CXXC
Hydroxylates 5meC into 5hmC, 5fC or
Cys-rich
5caC. Mostly present in early embryo.
DSBH
Cytidine
Deaminates 5mC into 5mU. Creates
immunoglobulin diversity and class deaminase
switch. Also present in ES where it
APOBECdeaminates 5mC and helps DNA
demethylation process.
like
Phenotype -/-
Male sterility, obesity
Heart failure
Lethal at early embryo
stage
Lethal at early embryo
stage
Small body size(Dawlaty
et al., 2011)
Spontaneous
myeloid
leukemia (Ko et al.,
2011)
Neonatal lethality(Gu et
al., 2011)
Normal
53
Material and Methods
Oocyte collection and in vitro maturation. The procedure for producing bovine embryos
from slaughterhouse oocytes was essentially the same as published before (Cagnone et al.,
2012). Briefly, 3- to 6mm healthy follicles from dairy cow ovaries were aspirated to collect
cumulus-oocyte complexes (COCs). After several washes in HEPES-buffered Tyrode
lactate solution (TLH), COCs were selected based on their visible quality – i.e., minimum
of 3-4 layers of cumulus cells surrounding the oocyte and absence of dark spots in the
cytoplasm – and matured in group of ten in 50µl drops of maturation buffer under mineral
oil for 24h at 39°C in a humidity saturated atmosphere, under 5% CO2.
The maturation
medium was TCM-199 supplemented with 10% fetal bovine serum, 0.1 μg/ml folliclestimulating hormone (Folltropin V; Bioniche), 0.33 mM pyruvic acid, and 50 μg/ml
gentamycin.
In vitro fertilization. After maturation, expanded COCs were washed twice in TLH
solution and transferred in groups of five to 48µl drops of in vitro fertilization (IVF)
medium under mineral oil. The IVF medium was composed of stock Tyrode lactate
solution supplemented with 0.6% fatty acid-free bovine serum albumin (BSA), 0.2 mM
pyruvic acid, 10 μg/ml heparin, and 50 μg/ml gentamycin. To each droplet, 2 μl of PHE (1
mM hypotaurine, 2 mM penicillamine, 250 mM epinephrine) was added to stimulate sperm
motility. The spermatozoa used consisted of a cryopreserved mixture of ejaculates from
five bulls (Centre d'Insémination Artificielle du Québec, St.-Hyacinthe, QC, Canada). The
spermatozoa were thawed in 37°C water for 1 min, put on a discontinuous Percoll gradient
(2 ml of 45% Percoll over 2 ml of 90% Percoll), and centrifuged at 700 × g for 30 min at
26°C. After discarding the supernatant, live spermatozoa were counted on a hemacytometer
to obtain a concentration of 106 cells/ml and re-suspended in IVF medium. Finally, 2 μl of
the sperm suspension (final concentration = 4.104 cells/ml) was added to each IVF droplet
containing the matured COCs, and incubated in a humidified atmosphere at 38.5°C under
5% CO2 for 16–18 h.
In vitro culture. For embryo culture, a three-step modified synthetic oviduct fluid culture
system containing minimum essential medium, essential and nonessential amino acids, 0.5
54
mM glycyl-glutamine, and 0.4% fatty acid-free BSA under embryo-tested mineral oil
(M8410, Sigma Aldrich (Saint-Louis, MO) was used. The embryo culture dishes were
incubated at 38.5°C with 6.5% CO2, 5% O2, and 88.5% N2 in 100% humidity. Briefly, after
fertilization, presumptive zygotes were mechanically denuded and washed three times in
TLH supplemented with fatty acid-free BSA and were placed in groups of 10 in 10-μl
droplets of synthetic oviduct fluid 1 (SOF1) with nonessential amino acids (1×) and 3 μM
EDTA. Embryos were transferred to new 10-μl droplets of SOF2 containing nonessential
(1×) and essential (0.5×) amino acids 72 h post fertilization and once again 120 h post
fertilization in 20-μl droplets of SOF3 containing nonessential (1×) and essential (1×)
amino acids. Media was replaced three times to prevent toxicity due to ammonium
accumulation and nutrient depletion caused respectively by amino acid degradation and
embryo metabolism. The glucose concentrations used in SOF1, SOF2, and SOF3 were
respectively 0.2, 0.5, and 1.0 mM. Blastocyst development was assessed at Day 7 post
fertilization. Non hatched blastocysts were transferred, washed three times in PBS,
collected in groups of 10 in small volumes of PBS into 0.5-ml microtubes, and stored at
−80°C until RNA extraction.
RNA extraction and reverse transcription
Total RNA from each replicate was extracted and purified using the PicoPure RNA
Isolation Kit (Life Science). After DNase digestion (Qiagen, Netherland), quality and
concentration of extracted RNA was assessed by bioanalyzer (Agilent). All extracted
samples showed good quality with an RNA integrity number >7.5. One picogram of in
vitro-transcribed green fluorescent protein (GFP) RNA was added before extraction as a
technical external control for RNA extraction and RT. The measured amounts of GFP in
each pool at the end of the real-time PCR validate and measure the efficiency of the
extraction and RT for each pool extracted, and this quantitative value was used to correct
the levels of the other genes measured in these pools. Three pools of 10 oocytes or embryos
of each stage were used for extraction. In brief, the RNA extracted from each pool was
precipitated with isopropanol and linear acrylamide and the pellets were washed with 75%
ethanol. These dried pellets were re-suspended in water containing oligo-dT primers,
55
heated for 5 min at 65 °C to destabilize RNA secondary structures, and chilled on ice before
the addition of the Omniscript Reverse Transcriptase (Qiagen, Netherland) components.
The RT reactions were performed at 37 °C for 2 h. For a detailed procedure, see (Vigneault
et al., 2004). Oligo-dT primers were used instead of random hexamers to measure the
polyadenylated form of the mRNAs studied, which are related to the population of mRNAs
susceptible to be translated into the corresponding protein.
Real-time PCR
The primers for Tet2, Tet3, Aicda, KDM3A, KDM4A, KDM4C and KDM5B amplification
were designed with IDT PrimerQuestSM software using sequences from the National Center
for Biotechnology Information (NCBI). Primers used and annealing temperature are listed
in Table 2. For detailed LightCycler procedure and quantification, refer to (Vigneault et al.,
2004).
Table 2 List of primers used in real-time PCR experiments
Names
Primer sequences
KDM3A
Up 5′-GTGGGTTTGGAGTGTGTGTG-3’ Low 5′-TGTCTTCCTTTGAGGCTGGT-3’
Up 5’-GTGTTCAGCCAATGCCCTGGAA-3’
Low 5’-AGCCTTACCACCTCACACTGGT-3’
Up 5’- TGGTTCACCTTTGGCAGACGAA
Low 5’- ATTTCTCTTGCACCGGGCACAT
Up 5’-TAGAGGTGCTGTGTCCTCGAT-3’
Low 5’-TGACACACGCAGACTCTCATC-3’
Up 5’- TGCAGACTGCCATTGCCATTGA-3’
Low 5’- AAAGGATGGGTGCTCTTCAGGA-3’
Up 5’-CACAAAGTACACGAGGCTGGCA-3’
Low 5’-TCTTTCTCACGGGCTCTCTCGG-3’
Up 5’ – AAACGAGGTGGCGCTTGAACAT-3’
Low 5’ – TGCAGCTGCTCATCTTGAGGAA-3’
Up 5’- TGGACAGCCTCTTGAAGAAGCAGAG-3’
Low-5’- TCCCAGTCAGAGATGTAGCGAA-3’
KDM4A
KDM4C
KDM5B
Tet3
Tet2
Tet1
Aicda
56
T°annealing
(°C)
60
60
59
60
58
59
58
60
Statistical analysis
The level of mRNA for each gene subjected to statistical analysis was normalized using the
GFP external control (McGraw et al., 2007; Vigneault et al., 2004). The value obtained for
each gene, within each pool of cDNA, was divided by the value obtained for GFP in the
same cDNA pool. Statistical analysis was performed using Prism software (version 5.02,
Graph Pad software Inc.) Relative mRNA abundance for a given gene was measured and
compared between embryo stages from GV to 8-cell using Pearson test.
We only
considered those stages and omit blastocyst to compare maternal origin mRNA before
embryonic genome activation. Pearson correlations were based on a significance level of
0.05.
Immunoblotting
Immunoblotting was performed on bovine tissue to ensure the specificity of antibodies,
except for KDM5B that was tested on HepG2 cell lysate because of its low expression level
in other bovine tissue. Bovine tissues were directly lysed in 2×Laemmli buffer (Laemmli,
1970), resolved on standard 8% SDS-PAGE gels and transferred onto nitrocellulose
membranes (Osmonics, Minnetonka, MN) using a semi-dry transfer apparatus following
the Tris/CAPS discontinuous buffer protocol from Bio-Rad (BioRad Laboratories, CA,
USA). The transfer was performed at 400 mA/cm2 for 1h at room temperature. Membrane
blotting was performed as followed: the membrane was blocked in blocking solution
composed of 5% of ECL Block (GE Healthcare Bio-Sciences Corp., NJ, USA.) in TBS-T
0,1% for 90 min at room temperature and then incubated with first antibody overnight at
4 °C. Membranes were washed three times for 15 min with TBS-T 0.1%, and incubated with
secondary antibody (goat anti-rabbit IgG (H+L) HRP conjugate (Molecular Probes,
Invitrogen, NM, USA) for KDM4A, KDM4C and Tet3 and goat anti-mouse IgG (H+L)
HRP conjugated (Molecular Probes, Invitrogen, NM, USA) for KDM5B, and diluted 1:100 000 in 4% non-fat dry milk in TBS-Tween (0,1%). The membranes were washed three
times with TBS-T (0.05%) and revealed with ECL Advance Western Blotting Detection kit
from Amersham (GE Healthcare Bio-Sciences Corp., NJ, USA). First antibody dilutions
57
were 1:100, 1:500, 1:200, 1:200 and 1:500 for Tet3, KDM3A, KDM4A, KDM4C and
KDM5B, respectively. Tet3 (#GTX121453) antibody was from GeneTex (San Antonio,
TX), 5hmC (#ab106918, not tested in immunoblot but used in immunofluorescence) and
KDM5B (#ab56759) antibodies were from Abcam (Cambridge, UK), KDM3A
(#AV32911) was from Sigma Aldrich (Saint-Louis, MO), KDM4A (#5328) was purchased
from Cell Signaling (Danvers, MA) and KDM4C (bs-5934R) was from Bioss (MA, USA).
Immunofluorescence
GV- and MII-stage oocytes, 2-, 4- and 8-cell embryos as well as blastocysts were fixed in
4% paraformaldehyde (PFA)/PBS for 10 min at room temperature, washed several times in
TBS-T (0,1%) and then permeabilized in 1% Triton X-100/TBS-T for 1h. Tissues were
washed again in TBS-T then antigens were blocked in 5% non-fat dry milk/TBS-T for 1h at
room temperature. First antibodies were added to fresh blocking solution according to
those concentrations: 1:1000, 1:2000, 1:1000, 1:1000, 1:500 and 1:250 for Tet3, 5hmC,
KDM3A, KDM4A, KDM4C and KDM5B, respectively.
Samples were incubated
overnight at 4°C in antibody solution, than washed in TBS-T several times. The secondary
antibody (CFTM 555 Goat anti-rabbit/goat anti-mouse,Sigma Aldrich (Saint-Louis, MO),
corresponding to the specie of the first antibody) was diluted at 1:2000 in freshly made
blocking solution. Samples were incubated for 45 min followed by four washes of 15min
in TBS-T, and incubated in DAPI 1:1000 for nuclear staining. Samples were mounted on
slides with 9 µl of PBS.
RESULTS
KDM3A, KDM4A and KDM5 were selected in accordance to previous work in our lab
(McGraw et al., 2007). We also selected KDM4C based on mRNA expression database of
microarray in bovine oocyte. Other histones demethylases are present at the GV stage but
the lack of functional antibody limited our investigation.
58
Immunoblots
First, antibody specificity in bovine tissues was demonstrated on immunoblots (Figure. 1).
All the antibodies presented were positive for the protein in bovine tissue. A contaminating
band located at 62kDa was present on immunoblots of KDM4C and KDM5B and
corresponds to BSA (bovine serum albumin), epitopes of which are recognized by many
antibodies.
Figure 1 Immunoblot of AICDA, Tet3, KDM3A, KDM4A KDM4C and KDM5B
performed on 25 bovine oocytes, 50 bovine oocytes, 10 µg of bovine ovary lysate, 10 µg of
bovine oviduct lysate, 10 µg of bovine ovary lysate and 15 µg of HepG2 lysates,
respectively.
59
Aicda and TET1
Using real-time PCR, it was impossible to detect any Tet1 or Aicda transcripts in our
samples. To confirm these results, immunofluorescence and western blot protocols were
performed. Unfortunately, no Tet1 antibody was available for bovine tissue. Surprisingly,
immunoblot revealed a weak band suggesting the presence of some Aicda protein (Figure
1) despite the undetected mRNA. Analysis of oocytes from small follicles failed to reveal
mRNA as well (results not shown).
TET3
Real-time-PCR experiments for Tet3 at different embryo stages showed an mRNA profile
similar to genes of maternal origin (Figure. 2). The peak level of mRNA quantification was
reached at the GV and 2-cell stages and continuously decreased from there to MET. At the
8-cell-stage, mRNA was barely detectable and remained low at the blastocyst stage. From
GV to the 8-cell stage, the Pearson determination coefficient was 0,3901 (p-value 0,0299).
Immunofluorescence pictures of Tet3 support that tendency (Figure. 3). At the GV stage,
Tet3 localization was diffuse in the cytoplasm and showed low predominance in the
nucleus. At the MII stage, Tet3 seemed to be relocate into the nucleus and was closely
associated to chromatin, which is condensed at that precise moment. Interestingly, an
unexpected pattern appeared at the pronucleus stage. Tet3 was present throughout the
paternal pronucleus, with two spots intensely colored but was also present in the maternal
pronucleus in the form of a condensed spot. The protein was then excluded from the
nucleus at the 2-cell stage and was no longer present at the 8-cell stage.
Immunofluorescence of 5hmC showed a similar pattern (Figure. 4). The GV stage was
labelled by two punctuate spots in the nucleus and a single spot in the maternal pronucleus.
5hmC was spread out in the paternal pronucleus and was maintained at later stages.
60
TET3
125
100
75
50
25
st
la
B
ce
ll
8-
ce
ll
4-
ce
ll
2-
G
V
0
Figure. 2 Relative abundance of Tet3 transcripts through early developmental stages.
Figure. 3 Immunofluorescence of Tet3 (red) and DNA (blue) at different embryo stages.
61
Figure 4 Immunofluorescence of 5hmC (red) and DNA (blue) at different embryo stages.
KDM3A
As revealed by RT-qPCR analyses, KDM3A mRNA was stored in oocytes before final
maturation. The maternal stock gradually decreased until MET, which was followed by
embryonic expression of the gene (Figure. 5). The decrease during the early stages was
validated by a determination coefficient of r2 = 0,7408. This coefficient was based on GV
to 8-cell stages and means that almost 75% of the variation in mRNA abundance may be
explained by the progression of embryo in normal development. Post-MET gene expression
increased and became similar to GV stage abundance, which is in agreement with results
obtained by McGraw (2007).
KDM3A was present at all embryo stages studied and localized into the nucleus, except
during GV where it was also partially present in the cytoplasm (Figure 6). Soon after
62
fertilization, its presence was restricted to the male pronucleus but became ubiquitous at
subsequent stages.
KDM3A
100
75
50
25
la
st
B
8ce
ll
4ce
ll
2ce
ll
G
V
0
Figure. 5 Relative abundance of KDM3 transcripts through early developmental stages.
63
GV
4-cell
PRONUCLEUS
8-cell
2-cell
BLASTOCYST
Figure 6. Immunofluorescence of KDM3A (red) and DNA (blue) at different
embryo stages.
64
KDM4A
Similarly to KDM3A, KDM4A mRNA pattern corresponded to genes of both maternal and
embryonic origin. KDM4A mRNA transcripts accumulated in GV oocytes and were for
the most part lost during later cleavage stages (Figure. 7). However, transcription was
reinitiated in the embryo after MET and allowed mRNA to reach levels similar to those
observed at the GV stage. The mRNA profile from GV to 8-cell embryo was described by
a Pearson determination coefficient of 0.6231 (double-tailed p-value of 0.0023).
Immunofluorescence experiments of KDM4A showed its exclusively nuclear presence
throughout the bovine preimplantation stages. At GV- and MII- stages, the protein strictly
co-localized with DAPI. In subsequent stages, the labelling is diffused in nucleus (Figure.
8).
KDM4A
125
100
75
50
25
la
st
B
8ce
ll
4ce
ll
2ce
ll
G
V
0
Figure. 7. Relative abundance of KDM4A transcript through embryo development.
65
GV
4 CELLS
MII
8 CELLS
2 CELLS
BLASTOCYST
Figure 8. Immunofluorescence of KDM4A (red) and DNA (blue) at different embryo
stages.
66
KDM4C
Both KDM4C protein localization and transcripts pattern in early embryo stages were very
different from the KDM3A and KDM4A patterns. First, as opposed to KDM3A and
KDM4A, KDM4C was weakly present before MET. Second, faint nuclear labelling of
KDM4C protein was detected in oocyte followed by a very specific punctuate labelling in
both pronuclei (Figure. 10). The particularity of this labelling localization was enhanced by
the presence of two distinct dots in each of the pronuclei. As maternal and paternal DNA
are replicated before fusion, the two dots in each pronucleus suggest binding to the two
alleles of a same locus. During this pre-MET period, the mRNA abundance was
characterized by a Pearson coefficient of correlation of 0,5915.
After MET, both
transcripts and protein levels were upregulated (Figure. 9).
KDM4C
150
125
100
75
50
25
la
st
B
8ce
ll
4ce
ll
2ce
ll
G
V
0
Figure. 9. Relative abundance of KDM4C transcripts through early developmental stages.
67
Figure. 10. Immunofluorescence of KDM4C (red) and DNA (blue) at different embryo
stages.
KDM5B
No KDM5B mRNA transcript was detected at any of the stages studied before MET
(results not shown). Later during development, the relative transcript level was significantly
higher in blastocyst than in 8-cell embryo. This profile indicates that KDM5B could be
more important in the embryo during or after MET than in the first cells cleavage.
Immunofluorescences analyses showed absence or weak presence of the protein from
pronucleus stage to 4-cell embryo that is markedly increased at 8-cell stage (Figure. 11).
The pronounced staining in oocyte despite the weak mRNA abundance could be explained
by the residual protein presence from earlier maturation stage or the translation of the
residual mRNA.
68
Figure. 11. Immunofluorescence of KDM5B (red) and DNA (blue) at different embryo
stages.
69
Table 3 Pearson determination coefficients of relative mRNA abundance across embryo
stages, from oocyte to 8-cell.
P value (2 tailed)
Tet3
Pearson determination
coefficient (r2)
0,3901
Tet2
0,6481
0,0016
KDM3A
0,7408
0,0003
KDM4A
0,6231
0,0023
KDM4C
0,5915
0,0035
Genes
0,0299
DISCUSSION
Our results demonstrate that nor Aicda, neither Tet1 seem to be involved in DNA
demethylation following fertilization. This function would, at least in part, be initiated by
hydroxylation activity of Tet3 dioxygenase on methylated cytosine. This study also
demonstrates that many histone demethylases act at different key moments during bovine
development. Those key moments are GV, pronucleus – before maternal and paternal
genome fusion –, maternal to embryo transition at the 8-cell stage and the first
differentiation step at the blastocyst stage.
Tet3
For parternal DNA, fertilization is the starting point of a myriad of rapid and coordinated
modifications, of which protamine replacement by maternal histones is the very first step.
After DNA decondensation, cytosine demethylation is activated. In mammals, thymine
DNA glycosylase (TDG) and methyl binding domain 4 (Mbd4) are the main glycosylases.
The essential role of TDG in embryo development has been shown in mice while its
absence (TDG null mice) was associated with epigenetic aberrations on development genes
70
(Cortazar et al., 2011). Nevertheless, nor TDG neither other mammal glycosylase presented
affinity for 5mC. Activation-induced cytidine deaminase (Aicda) is one of these enzymes
that modifies methylated cytosine and enhanced their affinity for glycosylase. Aicda is
well-known deaminase that has first been identified in immature B lymphocyte playing a
central role in immunoglobulin class changes and somatic hypermutation (Neuberger et al.,
2003). It is now accepted that Aicda is present in oocytes, embryonic tissues and primordial
germ cells in mouse (PGC) as well as in zebrafish oocyte. This gene is part of a
pluripotency genes cluster that includes Stella, Nanog and CPG restricted genes (Morgan et
al., 2004). It was expected that Aicda could contribute to epigenome reprogramming but
null mice for Aicda do not present any particular phenotype except for immunoglobulin
production and are still fertile (Muramatsu et al., 2000). Thus, Aicda contribution would
not be essential to embryonic and fetal development in mice (Muramatsu et al., 2000). In
bovine, the very low expression level of Aicda at each embryonic stage combined with the
absence of immunofluorescence signal support the inactivity of Aicda in the epigenetic
reprogramming process following fertilization in this species.
Another enzyme family that acts on methylated cytosine is Ten-eleven translocation (Tet).
This family is composed of 3 dioxygenases (Tet1 to 3) that hydroxylate the methyl group to
form 5-hydroxymetylcytosine (5hmC). A second and third hydroxylation is then possible to
respectively form 5-formylcytosine (5fC) (Pfaffeneder et al., 2011) and 5-carboxylcytosine
(5caC) (He et al., 2011). Even though mammalian glycosylase recognizes 5hmC, 5fC and
5caC have higher turnover rates. 5-hydroxymethyluridine, formed by the combined activity
of deaminase and dioxygenase, is also rapidly metabolized by glycosylase.
Not all members of the Tet family participate in demethylation in the embryo, as shown by
our mRNA abundance study. Only Tet2 and Tet3 were detectable in early embryo with a
predominance of Tet3 (1:100). In accordance with a previous study in bovine (Wossidlo et
al., 2011), we suggest that Tet3 is one of the major actors of the reprogramming process,
and that Tet2 is not. Furthermore, it has been shown that the normal demethylation process
71
of the Oct4 and Nanog genes is compromised in the male pronucleus of Tet3 -/- mice,
where its methylation level was similar to the female allele of these genes (Gu et al., 2011)
(Iqbal et al., 2011). This underscores the importance of Tet3 in active demethylation
following fertilization and suggests its special role in epigenome reprogramming in mice.
Based on immunofluorescence labelling, Tet3 was present in oocyte in the form of two
distinct dots maintained until late pronocleus stage. We found a similar labelling with
5hmC antibody. We consequently concluded that some targeted locus might be actively
demethylated in the maternal pronucleus. The paternal genome seems to be more sensitive
to Tet3 hydroxylation as the labelling was diffuse rather than specific. To explain the nonactive demethylation of maternal pronucleus in mice, Nakamura et al. (Nakamura et al.,
2012) have proposed a protective effect of Stella on H3K9me2 (Nakamura et al., 2012).
This epigenetic mark is tightly associated with methylated cytosines and must be removed
to allow cytosine demethylation. Considering that H3K9me2 is more specifically localized
in maternal pronucleus (Nakamura et al., 2012), it has been shown that Stella protects
H3K9me2 from demethylation and, therefore, prevents cytosine demethylation. Nakamura
et al. also showed the very low level of H3K9me2 in the male pronucleus except for two
specific dots. Knowing that over 80% of imprinted genes are grouped into DNA clusters
(Reik et al., 2001), it is proposed that those two dots could correspond to some of those
imprinted genes clusters whose methylation must be conserved. In addition, Wossidlo et al.
(Wossidlo et al., 2011) recently observed that, in bovine as well as in mouse and rabbit, the
male pronucleus was globally marked with 5hmC while maternal pronucleus was mainly
marked with 5mC. In that perspective, we propose that Tet3 would be the very first enzyme
of the active demethylation process in the bovine embryo and acts early in the male
pronucleus. Female pronucleus demethylation would follow a passive process that implies
the exclusion of methylation enzymes from the nuclei to avoid de novo methylation on the
newly synthesized DNA strand. Considering that a large majority of maternal genome
methylation sites remain stable during early embryo development (Smith et al., 2012), the
absence of active DNA demethylation process is therefore possible in mice.
72
KDM3A
The presence of KDM3A in every embryo stage studied corroborates real-time PCR results
and suggests a broad involvement of the enzyme in the epigenetic remodeling process.
KDM3A demethylates H3K9me2, an epigenetic mark associated with DNA methylation
and, thus, gene repression. Therefore, the removal of this epigenetic mark implies DNA
demethylation and further gene activation. This idea is supported by the peculiar
localization of KDM3A that has been observed in both pronuclei. Indeed, the exclusion of
KDM3A from the female pronucleus has been noticed, which suggests that this exclusion
could be linked to passive rather than active demethylation of the female pronucleus.
Unfortunately, it was not observed in all samples and should be considered as a hypothesis.
As previously seen in mouse, Stella was mainly present in the maternal pronucleus and, by
binding H3K9me2, could prevent cytosine demethylation. More specifically, binding of
Stella to H3K9me2 could interfere with KDM3A binding and thereby protect this
epigenetic mark from demethylation.
In addition to its possible role at the moment of male pronucleus demethylation, KDM3A
was still present after MET, suggesting additional functions. Real-time PCR results showed
a very low mRNA level between the 2- to 8-cell stages and immunofluorescence data
suggested a similar trend at the protein level. Considering the study of Loh et al. (Loh et al.,
2007) in which KDM3A knock-out embryos were unable to differentiate and were stuck at
the primordial endoderm stage, it is believed that the demethylase activity of KDM3A on
H3K9me2/me1 allows the transcription of genes involved in differentiation and contributes
to define cell identity.
73
KDM4A
KDM4A has several functions in early development. First, by removing one methyl mark
from H3K9me3 and from H1.4K26me3/me2, (Trojer et al., 2009) which are associated
with heterochromatin, KDM4A antagonizes heterochromatin expansion. Moreover, when
highly expressed, the protein has the potential of making heterochromatin regress due to
delocalization of HP1, a protein associated with H3K9me3. Pursuing this further, KDM4A
expression can be associated with embryonic genome activation, the moment when a new
epigenetic profile is installed. For this purpose, KDM4A could allow some genes, such as
pluripotency genes, to stay in a permissive state and could also prevent heterochromatin
expansion. In addition to these two epigenetic targets, the demethylase recognizes
H3K36me3 (Cloos et al., 2006). This epigenetic mark is associated with gene transcription
while its removal leads to transcriptional downregulation. Nevertheless, genes where the
epigenetic state of histones changes from H3K36me3 to H3K36me2 stay in an open
chromatin state. KDM4A is consequently associated with active genes and is present
throughout
embryo
development.
KDM4C
KDM4C is a demethylase specific to H3K9me3 and H3K36me3. In mice, its expression is
exclusively embryonic and is first detected at the 2-cell stage. In contrast, bovine
expression of KDM4C is both maternal and embryonic. At the pronucleus stage, precise
localization of the protein suggests a role for the enzyme in activating some key genes. It
has already been demonstrated in mice that KDM4C allows transcriptional regulation of the
major pluripotency genes OCT4, NAGOG and SOX2, as well as that of the cellular
proliferation genes Myc and Klf4. Subsequent embryo stages were characterized by the
disappearance of the protein until embryonic genome activation at the late 8-cell stage.
Considering the very defined localization of the KDM4C protein in the pronucleus, this
74
enzyme could act at that early stage to activate some of the proliferation and pluripotency
genes.
KDM5B
We have shown that KDM5B was present in oocyte even though its mRNA was weakly
abundant before MET and that it was significantly upregulated past the 8-cell embryo.
KDM5B demethylates H3K4me3 and H3K36me3 and consequently plays a role in
transcription inhibition (Dey et al., 2008). This enzyme has been defined as an inducer of
proliferation genes rather than pluripotency genes because of its activity on HOX gene
promoters and its stimulation of proliferation genes in embryonic stem cells (Dey et al.,
2008). More specifically, studies have shown that KDM5B was directly implicated in cell
cycle control by acting on pRB, one of the main checkpoints in the G1/S transition of the
cell cycle (Chicas et al., 2012). Additionally, it has been shown that KDM5B increases the
transcription or proliferative genes in embryonic stem cells and contribute to minimize
cryptic transcription.
By inhibiting inappropriate initiation of transcription, KDM5B
maximizes the total number of correct transcription events and, consequently, upregulated
the transcription of target genes (Xie et al., 2011). A previous study on bovine embryo has
shown that mRNA level of KDM5B was significantly lower in oocyte and pre-MET
embryo stages than at the 8-cell stage and post-MET stages (McGraw et al., 2007).
However, our immunofluorescence results clearly show a nuclear localization of KDM5B
in oocyte despite the limited transcriptional activity in fully grown oocytes. This presumed
function is in agreement with observations in mice where a high expression level of
KDM5B is measured in testis, more specifically in spermatogonia achieving meiosis
(Madsen et al., 2003). In fact, when KDM5B is under-expressed, spermatogonias are
unable to correctly process meiosis. In ovary, KDM5B expression is significantly weaker
than in spermatogonia, but could still play a significant function, similar to that in
spermatogonia (Madsen et al., 2003). Nevertheless, protein abundance from MII to 8-cell
stage was almost null. The numerous functions of the protein also include inhibition of
cellular differentiation. Upregulation of the gene following MET as well as nuclear
localization of the protein from that stage to blastocyst support this assumption.
75
Interestingly, in blastocyst, KDM5B was almost exclusively observed in inner cell mass as
revealed by immunofluorescence analyses. Knowing that these cells, in contrast to
trophectoblast cells, are still pluripotent, KDM5B presence corroborates the studies
showing the anti-differentiation and anti-proliferation effect of that enzyme. In summary,
our results suggest that KDM5B predominance in inner cell mass cells would be the
reflection of the proliferative and weakly differentiated state of these cells.
In conclusion, analysis of transcript abundance and protein expression of several factors
involved in epigenetic remodeling highlights the fact that factors involved in epigenetic
remodeling are present at different levels in oocyte and early embryo stages. For many of
the genes studied, namely Tet3, KDM3A and KDM4A, important maternal transcripts
reserves were observed in the oocyte and were translated throughout embryonic
development. Except for Tet3 whose expression was limited to oocyte genome, embryonic
genome activation refuels transcript abundance of those genes. For KDM4C, maternal
accumulation of transcripts was not clearly correlated to protein presence before MET but,
similarly to other genes studied, embryonic genome activation upregulated its transcription
and increased translation. Finally, KDM5B was absent from pre-MET embryo stages but
was upregulated in the blastocyst period, around the time that the embryonic pattern of
epigenetic modification is implanted. Although further characterization is required, this
study has set firm foundations for the involvement and comprehension of specific
chromatin remodeling and regulation genes in oocyte and embryo development.
76
3.4. Conclusion
Le remodelage de l’épigénome suite à la fécondation chez les mammifères est aussi
important pour le développement de l’embryon qu’il est intrigant pour les chercheurs. Les
immenses lacunes qui entourent nos bribes de connaissances dans le domaine font l’objet,
depuis quelques années, d’intenses recherches.
Toutefois, bien que l’intérêt pour ce champs de recherche soit immense, les nombreuses
difficultés techniques inhérentes au travail sur les embryons rendent périlleuse l’obtention
de résultats concluants. En effet, les embryons, par opposition aux lignées cellulaires,
offrent peu de matériel sur lequel travailler : le nombre d’échantillon est faible, la quantité
de matériel contenu dans chacun est limitée et le prix est élevé. L’étude des embryons
d’origine bovine ajoute au défi technique du fait que peu d’anticorps commerciaux sont
adaptés à cet animal. Une analyse plus poussée des différentes enzymes de modification de
l’épigénome serait donc possible dans un contexte où l’abondance d’ovocytes ne serait pas
limitante et où les anticorps seraient spécialement conçus pour l’espèce étudiée.
Malgré ces difficultés, beaucoup de travail peut être accompli. Il serait notamment pertinent
d’utiliser des ARN interférents dirigés contre Tet3 et de mesurer le taux et la localisation
des 5hmC en absence de la protéine à différents stades embryonnaires. Ceci permettrait
d’établir si la présence de Tet3 est requise pour la survie et le développement de l’embryon
bovin ainsi que de déterminer sur quels sites principaux elle agit. Aussi, puisque les étapes
subséquentes à l’hydroxylation des 5mC par Tet3 semblent impliquer la réparation par le
système BER, il serait intéressant d’étudier l’expression et la localisation des enzymes
impliquées dans cette voie de réparation afin de valider leur cooccurrence avec Tet3.
77
78
3.5 Bibliographie
Agger, K., Cloos, P.A., Christensen, J., Pasini, D., Rose, S., Rappsilber, J., Issaeva, I.,
Canaani, E., Salcini, A.E., and Helin, K. (2007). UTX and JMJD3 are histone H3K27
demethylases involved in HOX gene regulation and development. Nature 449, 731-734.
Allfrey, V.G., Faulkner, R., and Mirsky, A.E. (1964). Acetylation and Methylation of
Histones and Their Possible Role in the Regulation of Rna Synthesis. Proc Natl Acad Sci U
S A 51, 786-794.
Allis, C.D., Berger, S.L., Cote, J., Dent, S., Jenuwien, T., Kouzarides, T., Pillus, L.,
Reinberg, D., Shi, Y., Shiekhattar, R., et al. (2007). New nomenclature for chromatinmodifying enzymes. Cell 131, 633-636.
Ballestar, E., and Wolffe, A.P. (2001). Methyl-CpG-binding proteins. Targeting specific
gene repression. Eur J Biochem 268, 1-6.
Barr, M.L., and Carr, D.H. (1962). Correlations between Sex Chromatin and Sex
Chromosomes. Acta Cytol 6, 34-&.
Bedford, M.T., and Richard, S. (2005). Arginine methylation an emerging regulator of
protein function. Mol Cell 18, 263-272.
Bestor, T. (1988). Structure of mammalian DNA methyltransferase as deduced from the
inferred amino acid sequence and direct studies of the protein. Biochem Soc Trans 16, 944947.
Bestor, T.H. (2000). The DNA methyltransferases of mammals. Hum Mol Genet 9, 23952402.
Bjerling, P., Silverstein, R.A., Thon, G., Caudy, A., Grewal, S., and Ekwall, K. (2002).
Functional divergence between histone deacetylases in fission yeast by distinct cellular
localization and in vivo specificity. Mol Cell Biol 22, 2170-2181.
Bourc'his, D., Xu, G.L., Lin, C.S., Bollman, B., and Bestor, T.H. (2001). Dnmt3L and the
establishment of maternal genomic imprints. Science 294, 2536-2539.
Brown, S.W. (1966). Heterochromatin. Science 151, 417-425.
Bui, H.T., Wakayama, S., Kishigami, S., Kim, J.H., Van Thuan, N., and Wakayama, T.
(2008). The cytoplasm of mouse germinal vesicle stage oocytes can enhance somatic cell
nuclear reprogramming. Development 135, 3935-3945.
Cagnone, G.L., Dufort, I., Vigneault, C., and Sirard, M.A. (2012). Differential gene
expression profile in bovine blastocysts resulting from hyperglycemia exposure during
early cleavage stages. Biol Reprod 86, 50.
Catchpole, S., Spencer-Dene, B., Hall, D., Santangelo, S., Rosewell, I., Guenatri, M.,
Beatson, R., Scibetta, A.G., Burchell, J.M., and Taylor-Papadimitriou, J. (2011). PLU1/JARID1B/KDM5B is required for embryonic survival and contributes to cell
proliferation in the mammary gland and in ER+ breast cancer cells. Int J Oncol 38, 12671277.
Chambeyron, S., and Bickmore, W.A. (2004). Chromatin decondensation and nuclear
reorganization of the HoxB locus upon induction of transcription. Genes Dev 18, 11191130.
Chicas, A., Kapoor, A., Wang, X., Aksoy, O., Evertts, A.G., Zhang, M.Q., Garcia, B.A.,
Bernstein, E., and Lowe, S.W. (2012). H3K4 demethylation by Jarid1a and Jarid1b
contributes to retinoblastoma-mediated gene silencing during cellular senescence. Proc Natl
Acad Sci U S A.
79
Cho, H.S., Toyokawa, G., Daigo, Y., Hayami, S., Masuda, K., Ikawa, N., Yamane, Y.,
Maejima, K., Tsunoda, T., Field, H.I., et al. (2012). The JmjC domain-containing histone
demethylase KDM3A is a positive regulator of the G(1) /S transition in cancer cells via
transcriptional regulation of the HOXA1 gene. Int J Cancer 131, E179-189.
Christensen, J., Agger, K., Cloos, P.A., Pasini, D., Rose, S., Sennels, L., Rappsilber, J.,
Hansen, K.H., Salcini, A.E., and Helin, K. (2007). RBP2 belongs to a family of
demethylases, specific for tri-and dimethylated lysine 4 on histone 3. Cell 128, 1063-1076.
Ciccone, D.N., Su, H., Hevi, S., Gay, F., Lei, H., Bajko, J., Xu, G., Li, E., and Chen, T.
(2009). KDM1B is a histone H3K4 demethylase required to establish maternal genomic
imprints. Nature 461, 415-418.
Cloos, P.A., Christensen, J., Agger, K., Maiolica, A., Rappsilber, J., Antal, T., Hansen,
K.H., and Helin, K. (2006). The putative oncogene GASC1 demethylates tri- and
dimethylated lysine 9 on histone H3. Nature 442, 307-311.
Constant, F., Guillomot, M., Heyman, Y., Vignon, X., Laigre, P., Servely, J.L., Renard,
J.P., and Chavatte-Palmer, P. (2006). Large offspring or large placenta syndrome?
Morphometric analysis of late gestation bovine placentomes from somatic nuclear transfer
pregnancies complicated by hydrallantois. Biol Reprod 75, 122-130.
Cortazar, D., Kunz, C., Selfridge, J., Lettieri, T., Saito, Y., MacDougall, E., Wirz, A.,
Schuermann, D., Jacobs, A.L., Siegrist, F., et al. (2011). Embryonic lethal phenotype
reveals a function of TDG in maintaining epigenetic stability. Nature 470, 419-423.
Cote, J., Quinn, J., Workman, J.L., and Peterson, C.L. (1994). Stimulation of GAL4
derivative binding to nucleosomal DNA by the yeast SWI/SNF complex. Science 265, 5360.
Couture, J.F., and Trievel, R.C. (2006). Histone-modifying enzymes: encrypting an
enigmatic epigenetic code. Curr Opin Struct Biol 16, 753-760.
Dawlaty, M.M., Ganz, K., Powell, B.E., Hu, Y.C., Markoulaki, S., Cheng, A.W., Gao, Q.,
Kim, J., Choi, S.W., Page, D.C., et al. (2011). Tet1 is dispensable for maintaining
pluripotency and its loss is compatible with embryonic and postnatal development. Cell
Stem Cell 9, 166-175.
De La Fuente, R., Viveiros, M.M., Burns, K.H., Adashi, E.Y., Matzuk, M.M., and Eppig,
J.J. (2004). Major chromatin remodeling in the germinal vesicle (GV) of mammalian
oocytes is dispensable for global transcriptional silencing but required for centromeric
heterochromatin function. Dev Biol 275, 447-458.
de Montera, B., El Zeihery, D., Muller, S., Jammes, H., Brem, G., Reichenbach, H.D.,
Scheipl, F., Chavatte-Palmer, P., Zakhartchenko, V., Schmitz, O.J., et al. (2010).
Quantification of leukocyte genomic 5-methylcytosine levels reveals epigenetic plasticity
in healthy adult cloned cattle. Cell Reprogram 12, 175-181.
Dean, W., Bowden, L., Aitchison, A., Klose, J., Moore, T., Meneses, J.J., Reik, W., and
Feil, R. (1998). Altered imprinted gene methylation and expression in completely ES cellderived mouse fetuses: association with aberrant phenotypes. Development 125, 22732282.
Delaval, K., Wagschal, A., and Feil, R. (2006). Epigenetic deregulation of imprinting in
congenital diseases of aberrant growth. Bioessays 28, 453-459.
Dey, B.K., Stalker, L., Schnerch, A., Bhatia, M., Taylor-Papidimitriou, J., and Wynder, C.
(2008). The histone demethylase KDM5b/JARID1b plays a role in cell fate decisions by
blocking terminal differentiation. Mol Cell Biol 28, 5312-5327.
80
Ecklund, P.S., and Levine, L. (1975). Mouse sperm basic nuclear protein. Electrophoretic
characterization and fate after fertilization. J Cell Biol 66, 251-262.
Efroni, S., Duttagupta, R., Cheng, J., Dehghani, H., Hoeppner, D.J., Dash, C., Bazett-Jones,
D.P., Le Grice, S., McKay, R.D., Buetow, K.H., et al. (2008). Global transcription in
pluripotent embryonic stem cells. Cell Stem Cell 2, 437-447.
Egli, D., Rosains, J., Birkhoff, G., and Eggan, K. (2007). Developmental reprogramming
after chromosome transfer into mitotic mouse zygotes. Nature 447, 679-685.
Egli, D., Sandler, V.M., Shinohara, M.L., Cantor, H., and Eggan, K. (2009).
Reprogramming after chromosome transfer into mouse blastomeres. Curr Biol 19, 14031409.
Ehrlich, M., Gama-Sosa, M.A., Huang, L.H., Midgett, R.M., Kuo, K.C., McCune, R.A.,
and Gehrke, C. (1982). Amount and distribution of 5-methylcytosine in human DNA from
different types of tissues of cells. Nucleic Acids Res 10, 2709-2721.
Elsik, C.G., Tellam, R.L., Worley, K.C., Gibbs, R.A., Muzny, D.M., Weinstock, G.M.,
Adelson, D.L., Eichler, E.E., Elnitski, L., Guigo, R., et al. (2009). The genome sequence of
taurine cattle: a window to ruminant biology and evolution. Science 324, 522-528.
Fair, T. (2003). Follicular oocyte growth and acquisition of developmental competence.
Anim Reprod Sci 78, 203-216.
Feldman, N., Gerson, A., Fang, J., Li, E., Zhang, Y., Shinkai, Y., Cedar, H., and Bergman,
Y. (2006). G9a-mediated irreversible epigenetic inactivation of Oct-3/4 during early
embryogenesis. Nature Cell Biology 8, 188-194.
Frescas, D., Guardavaccaro, D., Bassermann, F., Koyama-Nasu, R., and Pagano, M.
(2007). JHDM1B/FBXL10 is a nucleolar protein that represses transcription of ribosomal
RNA genes. Nature 450, 309-313.
Frescas, D., Guardavaccaro, D., Kuchay, S.M., Kato, H., Poleshko, A., Basrur, V.,
Elenitoba-Johnson, K.S., Katz, R.A., and Pagano, M. (2008). KDM2A represses
transcription of centromeric satellite repeats and maintains the heterochromatic state. Cell
Cycle 7, 3539-3547.
Gao, Y., Hyttel, P., and Hall, V.J. (2010). Regulation of H3K27me3 and H3K4me3 during
early porcine embryonic development. Mol Reprod Dev 77, 540-549.
Gardiner-Garden, M., and Frommer, M. (1987). CpG islands in vertebrate genomes. J Mol
Biol 196, 261-282.
Green, S.H., and Zuckerman, S. (1951). Quantitative aspects of the growth of the human
ovum and follicle. J Anat 85, 373-375.
Gu, T.P., Guo, F., Yang, H., Wu, H.P., Xu, G.F., Liu, W., Xie, Z.G., Shi, L., He, X., Jin,
S.G., et al. (2011). The role of Tet3 DNA dioxygenase in epigenetic reprogramming by
oocytes. Nature 477, 606-610.
Gu, W., and Roeder, R.G. (1997). Activation of p53 sequence-specific DNA binding by
acetylation of the p53 C-terminal domain. Cell 90, 595-606.
Hagelkruys, A., Sawicka, A., Rennmayr, M., and Seiser, C. (2011). The biology of HDAC
in cancer: the nuclear and epigenetic components. Handb Exp Pharmacol 206, 13-37.
He, Y.F., Li, B.Z., Li, Z., Liu, P., Wang, Y., Tang, Q., Ding, J., Jia, Y., Chen, Z., Li, L., et
al. (2011). Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in
mammalian DNA. Science 333, 1303-1307.
Heard, E., Clerc, P., and Avner, P. (1997). X-chromosome inactivation in mammals. Annu
Rev Genet 31, 571-610.
81
Hori, N., Nagai, M., Hirayama, M., Hirai, T., Matsuda, K., Hayashi, M., Tanaka, T.,
Ozawa, T., and Horike, S. (2010). Aberrant CpG methylation of the imprinting control
region KvDMR1 detected in assisted reproductive technology-produced calves and
pathogenesis of large offspring syndrome. Anim Reprod Sci 122, 303-312.
Ideraabdullah, F.Y., Kim, K., Pomp, D., Moran, J.L., Beier, D., and de Villena, F.P. (2007).
Rescue of the mouse DDK syndrome by parent-of-origin-dependent modifiers. Biol Reprod
76, 286-293.
Iqbal, K., Jin, S.G., Pfeifer, G.P., and Szabo, P.E. (2011). Reprogramming of the paternal
genome upon fertilization involves genome-wide oxidation of 5-methylcytosine. Proc Natl
Acad Sci U S A 108, 3642-3647.
Ito, S., Shen, L., Dai, Q., Wu, S.C., Collins, L.B., Swenberg, J.A., He, C., and Zhang, Y.
(2011). Tet proteins can convert 5-methylcytosine to 5-formylcytosine and 5carboxylcytosine. Science 333, 1300-1303.
Jenuwein, T., and Allis, C.D. (2001). Translating the histone code. Science 293, 10741080.
Jones, P.L., Veenstra, G.J., Wade, P.A., Vermaak, D., Kass, S.U., Landsberger, N.,
Strouboulis, J., and Wolffe, A.P. (1998). Methylated DNA and MeCP2 recruit histone
deacetylase to repress transcription. Nat Genet 19, 187-191.
Jost, J.P. (1993). Nuclear extracts of chicken embryos promote an active demethylation of
DNA by excision repair of 5-methyldeoxycytidine. Proc Natl Acad Sci U S A 90, 46844688.
Kaneda, M., Okano, M., Hata, K., Sado, T., Tsujimoto, N., Li, E., and Sasaki, H. (2004).
Essential role for de novo DNA methyltransferase Dnmt3a in paternal and maternal
imprinting. Nature 429, 900-903.
Karytinos, A., Forneris, F., Profumo, A., Ciossani, G., Battaglioli, E., Binda, C., and
Mattevi, A. (2009). A novel mammalian flavin-dependent histone demethylase. J Biol
Chem 284, 17775-17782.
Kim, S.M., Kim, J.Y., Choe, N.W., Cho, I.H., Kim, J.R., Kim, D.W., Seol, J.E., Lee, S.E.,
Kook, H., Nam, K.I., et al. (2010). Regulation of mouse steroidogenesis by WHISTLE and
JMJD1C through histone methylation balance. Nucleic Acids Res 38, 6389-6403.
Kleff, S., Andrulis, E.D., Anderson, C.W., and Sternglanz, R. (1995). Identification of a
gene encoding a yeast histone H4 acetyltransferase. J Biol Chem 270, 24674-24677.
Klose, R.J., Gardner, K.E., Liang, G., Erdjument-Bromage, H., Tempst, P., and Zhang, Y.
(2007a). Demethylation of histone H3K36 and H3K9 by Rph1: a vestige of an H3K9
methylation system in Saccharomyces cerevisiae? Mol Cell Biol 27, 3951-3961.
Klose, R.J., Yamane, K., Bae, Y., Zhang, D., Erdjument-Bromage, H., Tempst, P., Wong,
J., and Zhang, Y. (2006). The transcriptional repressor JHDM3A demethylates trimethyl
histone H3 lysine 9 and lysine 36. Nature 442, 312-316.
Klose, R.J., Yan, Q., Tothova, Z., Yamane, K., Erdjument-Bromage, H., Tempst, P.,
Gilliland, D.G., Zhang, Y., and Kaelin, W.G., Jr. (2007b). The retinoblastoma binding
protein RBP2 is an H3K4 demethylase. Cell 128, 889-900.
Ko, M., Bandukwala, H.S., An, J., Lamperti, E.D., Thompson, E.C., Hastie, R.,
Tsangaratou, A., Rajewsky, K., Koralov, S.B., and Rao, A. (2011). Ten-ElevenTranslocation 2 (TET2) negatively regulates homeostasis and differentiation of
hematopoietic stem cells in mice. Proc Natl Acad Sci U S A 108, 14566-14571.
Kobayashi, H., Sakurai, T., Imai, M., Takahashi, N., Fukuda, A., Yayoi, O., Sato, S.,
Nakabayashi, K., Hata, K., Sotomaru, Y., et al. (2012). Contribution of intragenic DNA
82
methylation in mouse gametic DNA methylomes to establish oocyte-specific heritable
marks. PLoS Genet 8, e1002440.
Kono, T., Obata, Y., and Ogawa, H. (2004). [Prevention of parthenogenesis by genomic
imprinting in mammals]. Tanpakushitsu Kakusan Koso 49, 2123-2130.
Kornberg, R.D., and Lorch, Y.L. (1999). Twenty-five years of the nucleosome,
fundamental particle of the eukaryote chromosome. Cell 98, 285-294.
Kriaucionis, S., and Heintz, N. (2009). The nuclear DNA base 5-hydroxymethylcytosine is
present in Purkinje neurons and the brain. Science 324, 929-930.
Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227, 680-685.
Lane, N., Dean, W., Erhardt, S., Hajkova, P., Surani, A., Walter, J., and Reik, W. (2003).
Resistance of IAPs to methylation reprogramming may provide a mechanism for epigenetic
inheritance in the mouse. Genesis 35, 88-93.
Lemoine, M., and Younes, A. (2010). Histone deacetylase inhibitors in the treatment of
lymphoma. Discov Med 10, 462-470.
Lennartsson, A., and Ekwall, K. (2009). Histone modification patterns and epigenetic
codes. Biochim Biophys Acta 1790, 863-868.
Li, Y., and Sasaki, H. (2011). Genomic imprinting in mammals: its life cycle, molecular
mechanisms and reprogramming. Cell Res 21, 466-473.
Loh, Y.H., Zhang, W., Chen, X., George, J., and Ng, H.H. (2007). Jmjd1a and Jmjd2c
histone H3 Lys 9 demethylases regulate self-renewal in embryonic stem cells. Genes Dev
21, 2545-2557.
Lomberk, G., Wallrath, L., and Urrutia, R. (2006). The Heterochromatin Protein 1 family.
Genome Biol 7, 228.
Lorbeck, M.T., Singh, N., Zervos, A., Dhatta, M., Lapchenko, M., Yang, C., and Elefant, F.
(2010). The histone demethylase Dmel\Kdm4A controls genes required for life span and
male-specific sex determination in Drosophila. Gene 450, 8-17.
Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997).
Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251-260.
Madsen, B., Tarsounas, M., Burchell, J.M., Hall, D., Poulsom, R., and TaylorPapadimitriou, J. (2003). PLU-1, a transcriptional repressor and putative testis-cancer
antigen, has a specific expression and localisation pattern during meiosis. Chromosoma
112, 124-132.
Mahsoudi, B., Li, A., and O'Neill, C. (2007). Assessment of the long-term and
transgenerational consequences of perturbing preimplantation embryo development in
mice. Biol Reprod 77, 889-896.
Mallette, F.A., Mattiroli, F., Cui, G., Young, L.C., Hendzel, M.J., Mer, G., Sixma, T.K.,
and Richard, S. (2012). RNF8- and RNF168-dependent degradation of KDM4A/JMJD2A
triggers 53BP1 recruitment to DNA damage sites. EMBO J 31, 1865-1878.
Malousi, A., Maglaveras, N., and Kouidou, S. (2008). Intronic CpG content and alternative
splicing in human genes containing a single cassette exon. Epigenetics 3, 69-73.
Marmorstein, R. (2001). Structure of histone acetyltransferases. J Mol Biol 311, 433-444.
Martin, C., and Zhang, Y. (2005). The diverse functions of histone lysine methylation. Nat
Rev Mol Cell Biol 6, 838-849.
Martinez, M.F., de Nava, G., Demmers, K.J., Tutt, D., Rodriguez Sabarros, M., Smaill, B.,
Corti, M., and Juengel, J. (2012). Intravaginal progesterone devices in synchronization
protocols for artificial insemination in beef heifers. Reprod Domest Anim 47, 230-237.
83
Mathis, D.J., Oudet, P., Wasylyk, B., and Chambon, P. (1978). Effect of histone acetylation
on structure and in vitro transcription of chromatin. Nucleic Acids Res 5, 3523-3547.
McEvoy, T.G., Sinclair, K.D., Young, L.E., Wilmut, I., and Robinson, J.J. (2000). Large
offspring syndrome and other consequences of ruminant embryo culture in vitro: relevance
to blastocyst culture in human ART. Hum Fertil (Camb) 3, 238-246.
McGraw, S., Vigneault, C., and Sirard, M.A. (2007). Temporal expression of factors
involved in chromatin remodeling and in gene regulation during early bovine in vitro
embryo development. Reproduction 133, 597-608.
Mercher, T., Quivoron, C., Couronne, L., Bastard, C., Vainchenker, W., and Bernard, O.A.
(2012). TET2, a tumor suppressor in hematological disorders. Biochim Biophys Acta 1825,
173-177.
Metzeler, K.H., Maharry, K., Radmacher, M.D., Mrozek, K., Margeson, D., Becker, H.,
Curfman, J., Holland, K.B., Schwind, S., Whitman, S.P., et al. (2011). TET2 mutations
improve the new European LeukemiaNet risk classification of acute myeloid leukemia: a
Cancer and Leukemia Group B study. J Clin Oncol 29, 1373-1381.
Metzger, E., Wissmann, M., Yin, N., Muller, J.M., Schneider, R., Peters, A.H., Gunther, T.,
Buettner, R., and Schule, R. (2005). LSD1 demethylates repressive histone marks to
promote androgen-receptor-dependent transcription. Nature 437, 436-439.
Milne, T.A., Briggs, S.D., Brock, H.W., Martin, M.E., Gibbs, D., Allis, C.D., and Hess,
J.L. (2002). MLL targets SET domain methyltransferase activity to Hox gene promoters.
Mol Cell 10, 1107-1117.
Morgan, H.D., Dean, W., Coker, H.A., Reik, W., and Petersen-Mahrt, S.K. (2004).
Activation-induced cytidine deaminase deaminates 5-methylcytosine in DNA and is
expressed in pluripotent tissues: implications for epigenetic reprogramming. J Biol Chem
279, 52353-52360.
Morgan, H.D., Santos, F., Green, K., Dean, W., and Reik, W. (2005). Epigenetic
reprogramming in mammals. Hum Mol Genet 14 Spec No 1, R47-58.
Mosammaparast, N., and Shi, Y. (2010). Reversal of histone methylation: biochemical and
molecular mechanisms of histone demethylases. Annu Rev Biochem 79, 155-179.
Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., and Honjo, T.
(2000). Class switch recombination and hypermutation require activation-induced cytidine
deaminase (AID), a potential RNA editing enzyme. Cell 102, 553-563.
Nabel, C.S., Manning, S.A., and Kohli, R.M. (2012). The curious chemical biology of
cytosine: deamination, methylation, and oxidation as modulators of genomic potential.
ACS Chem Biol 7, 20-30.
Nakamura, T., Liu, Y.J., Nakashima, H., Umehara, H., Inoue, K., Matoba, S., Tachibana,
M., Ogura, A., Shinkai, Y., and Nakano, T. (2012). PGC7 binds histone H3K9me2 to
protect against conversion of 5mC to 5hmC in early embryos. Nature 486, 415-419.
Neuberger, M.S., Harris, R.S., Di Noia, J., and Petersen-Mahrt, S.K. (2003). Immunity
through DNA deamination. Trends Biochem Sci 28, 305-312.
Niemitz, E.L., and Feinberg, A.P. (2004). Epigenetics and assisted reproductive
technology: a call for investigation. Am J Hum Genet 74, 599-609.
Nivet, A.L., Bunel, A., Labrecque, R., Belanger, J., Vigneault, C., Blondin, P., and Sirard,
M.A. (2012). FSH withdrawal improves developmental competence of oocytes in the
bovine model. Reproduction 143, 165-171.
84
Okada, Y., Scott, G., Ray, M.K., Mishina, Y., and Zhang, Y. (2007). Histone demethylase
JHDM2A is critical for Tnp1 and Prm1 transcription and spermatogenesis. Nature 450,
119-123.
Ono, R., Taki, T., Taketani, T., Taniwaki, M., Kobayashi, H., and Hayashi, Y. (2002).
LCX, leukemia-associated protein with a CXXC domain, is fused to MLL in acute myeloid
leukemia with trilineage dysplasia having t(10;11)(q22;q23). Cancer Res 62, 4075-4080.
Opel, M., Lando, D., Bonilla, C., Trewick, S.C., Boukaba, A., Walfridsson, J., Cauwood, J.,
Werler, P.J., Carr, A.M., Kouzarides, T., et al. (2007). Genome-wide studies of histone
demethylation catalysed by the fission yeast homologues of mammalian LSD1. PLoS One
2, e386.
Pedersen, M.T., and Helin, K. (2010). Histone demethylases in development and disease.
Trends Cell Biol 20, 662-671.
Pfaffeneder, T., Hackner, B., Truss, M., Munzel, M., Muller, M., Deiml, C.A., Hagemeier,
C., and Carell, T. (2011). The discovery of 5-formylcytosine in embryonic stem cell DNA.
Angew Chem Int Ed Engl 50, 7008-7012.
Pimpinelli, S., and Ripoll, P. (1986). Nonrandom segregation of centromeres following
mitotic recombination in Drosophila melanogaster. Proc Natl Acad Sci U S A 83, 39003903.
Popp, C., Dean, W., Feng, S., Cokus, S.J., Andrews, S., Pellegrini, M., Jacobsen, S.E., and
Reik, W. (2010). Genome-wide erasure of DNA methylation in mouse primordial germ
cells is affected by AID deficiency. Nature 463, 1101-1105.
Rai, K., Huggins, I.J., James, S.R., Karpf, A.R., Jones, D.A., and Cairns, B.R. (2008). DNA
demethylation in zebrafish involves the coupling of a deaminase, a glycosylase, and
gadd45. Cell 135, 1201-1212.
Ramsahoye, B.H., Biniszkiewicz, D., Lyko, F., Clark, V., Bird, A.P., and Jaenisch, R.
(2000). Non-CpG methylation is prevalent in embryonic stem cells and may be mediated
by DNA methyltransferase 3a. Proc Natl Acad Sci U S A 97, 5237-5242.
Reik, W., Dean, W., and Walter, J. (2001). Epigenetic reprogramming in mammalian
development. Science 293, 1089-1093.
Robertson, K.D. (2005). DNA methylation and human disease. Nat Rev Genet 6, 597-610.
Robinson, P.J., and Rhodes, D. (2006). Structure of the '30 nm' chromatin fibre: a key role
for the linker histone. Curr Opin Struct Biol 16, 336-343.
Roosen-Runge, E.C. (1962). The process of spermatogenesis in mammals. Biol Rev Camb
Philos Soc 37, 343-377.
Salvaing, J., Aguirre-Lavin, T., Boulesteix, C., Lehmann, G., Debey, P., and Beaujean, N.
(2012). 5-Methylcytosine and 5-hydroxymethylcytosine spatiotemporal profiles in the
mouse zygote. PLoS One 7, e38156.
Seiler, D.M., Rouquette, J., Schmid, V.J., Strickfaden, H., Ottmann, C., Drexler, G.A.,
Mazurek, B., Greubel, C., Hable, V., Dollinger, G., et al. (2011). Double-strand breakinduced transcriptional silencing is associated with loss of tri-methylation at H3K4.
Chromosome Res 19, 883-899.
Sha, K., and Boyer, L.A. (2008). The chromatin signature of pluripotent cells.
Shao, G.B., Ding, H.M., and Gong, A.H. (2008). Role of histone methylation in zygotic
genome activation in the preimplantation mouse embryo. In Vitro Cell Dev Biol Anim 44,
115-120.
85
Shi, Y., Lan, F., Matson, C., Mulligan, P., Whetstine, J.R., Cole, P.A., and Casero, R.A.
(2004). Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell
119, 941-953.
Shukla, S., Kavak, E., Gregory, M., Imashimizu, M., Shutinoski, B., Kashlev, M.,
Oberdoerffer, P., Sandberg, R., and Oberdoerffer, S. (2011). CTCF-promoted RNA
polymerase II pausing links DNA methylation to splicing. Nature 479, 74-79.
Smith, Z.D., Chan, M.M., Mikkelsen, T.S., Gu, H., Gnirke, A., Regev, A., and Meissner, A.
(2012). A unique regulatory phase of DNA methylation in the early mammalian embryo.
Nature 484, 339-344.
Stojanov, T., and O'Neill, C. (2001). In vitro fertilization causes epigenetic modifications to
the onset of gene expression from the zygotic genome in mice. Biol Reprod 64, 696-705.
Strahl, B.D., and Allis, C.D. (2000). The language of covalent histone modifications.
Nature 403, 41-45.
Su, J.M., Wang, Y.S., Liu, Q., Yang, B., Wu, Y.Y., Luo, Y., Hu, G.D., and Zhang, Y.
(2011). Aberrant mRNA expression and DNA methylation levels of imprinted genes in
cloned transgenic calves that died of large offspring syndrome. Livest Sci 141, 24-35.
Tahiliani, M., Koh, K.P., Shen, Y., Pastor, W.A., Bandukwala, H., Brudno, Y., Agarwal,
S., Iyer, L.M., Liu, D.R., Aravind, L., et al. (2009). Conversion of 5-methylcytosine to 5hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science 324, 930-935.
Takizawa, T., and Meshorer, E. (2008). Chromatin and nuclear architecture in the nervous
system. Trends Neurosci 31, 343-352.
Tartof, K.D., Bishop, C., Jones, M., Hobbs, C.A., and Locke, J. (1989). Towards an
understanding of position effect variegation. Dev Genet 10, 162-176.
Thalhammer, A., Hansen, A.S., El-Sagheer, A.H., Brown, T., and Schofield, C.J. (2011).
Hydroxylation of methylated CpG dinucleotides reverses stabilisation of DNA duplexes by
cytosine 5-methylation. Chem Commun (Camb) 47, 5325-5327.
Trojer, P., Zhang, J., Yonezawa, M., Schmidt, A., Zheng, H., Jenuwein, T., and Reinberg,
D. (2009). Dynamic Histone H1 Isotype 4 Methylation and Demethylation by Histone
Lysine Methyltransferase G9a/KMT1C and the Jumonji Domain-containing JMJD2/KDM4
Proteins. J Biol Chem 284, 8395-8405.
Tsukada, Y., Fang, J., Erdjument-Bromage, H., Warren, M.E., Borchers, C.H., Tempst, P.,
and Zhang, Y. (2006). Histone demethylation by a family of JmjC domain-containing
proteins. Nature 439, 811-816.
Turner, B.M. (2001). Chromatin and gene regulation : mechanisms in epigenetics (Oxford,
Blackwell Science).
Vigneault, C., McGraw, S., Massicotte, L., and Sirard, M.A. (2004). Transcription factor
expression patterns in bovine in vitro-derived embryos prior to maternal-zygotic transition.
Biol Reprod 70, 1701-1709.
Voss, A.K., and Thomas, T. (2009). MYST family histone acetyltransferases take center
stage in stem cells and development. Bioessays 31, 1050-1061.
Wang, J., Hevi, S., Kurash, J.K., Lei, H., Gay, F., Bajko, J., Su, H., Sun, W., Chang, H.,
Xu, G., et al. (2009). The lysine demethylase LSD1 (KDM1) is required for maintenance of
global DNA methylation. Nat Genet 41, 125-129.
Wang, J., Scully, K., Zhu, X., Cai, L., Zhang, J., Prefontaine, G.G., Krones, A., Ohgi, K.A.,
Zhu, P., Garcia-Bassets, I., et al. (2007). Opposing LSD1 complexes function in
developmental gene activation and repression programmes. Nature 446, 882-887.
86
Wang, J., Zhang, M., Zhang, Y., Kou, Z., Han, Z., Chen, D.Y., Sun, Q.Y., and Gao, S.
(2010). The histone demethylase JMJD2C is stage-specifically expressed in
preimplantation mouse embryos and is required for embryonic development. Biol Reprod
82, 105-111.
Wilmut, I., Beaujean, N., de Sousa, P.A., Dinnyes, A., King, T.J., Paterson, L.A., Wells,
D.N., and Young, L.E. (2002). Somatic cell nuclear transfer. Nature 419, 583-586.
Wossidlo, M., Nakamura, T., Lepikhov, K., Marques, C.J., Zakhartchenko, V., Boiani, M.,
Arand, J., Nakano, T., Reik, W., and Walter, J. (2011). 5-Hydroxymethylcytosine in the
mammalian zygote is linked with epigenetic reprogramming. Nat Commun 2, 241.
Wrenzycki, C., Herrmann, D., Lucas-Hahn, A., Lemme, E., Korsawe, K., and Niemann, H.
(2004). Gene expression patterns in in vitro-produced and somatic nuclear transfer-derived
preimplantation bovine embryos: relationship to the large offspring syndrome? Anim
Reprod Sci 82-3, 593-603.
Wu, S.C., and Zhang, Y. (2010). Active DNA demethylation: many roads lead to Rome.
Nat Rev Mol Cell Biol 11, 607-620.
Xie, L., Pelz, C., Wang, W., Bashar, A., Varlamova, O., Shadle, S., and Impey, S. (2011).
KDM5B regulates embryonic stem cell self-renewal and represses cryptic intragenic
transcription. EMBO J 30, 1473-1484.
Yamane, K., Toumazou, C., Tsukada, Y., Erdjument-Bromage, H., Tempst, P., Wong, J.,
and Zhang, Y. (2006). JHDM2A, a JmjC-containing H3K9 demethylase, facilitates
transcription activation by androgen receptor. Cell 125, 483-495.
Yang, H., Liu, Y., Bai, F., Zhang, J.Y., Ma, S.H., Liu, J., Xu, Z.D., Zhu, H.G., Ling, Z.Q.,
Ye, D., et al. (2012). Tumor development is associated with decrease of TET gene
expression and 5-methylcytosine hydroxylation. Oncogene.
Yang, H., Shi, L., Zhang, S., Ling, J., Jiang, J., and Li, J. (2010). High-efficiency somatic
reprogramming induced by intact MII oocytes. Cell Res 20, 1034-1042.
Yang, L., Chavatte-Palmer, P., Kubota, C., O'Neill, M., Hoagland, T., Renard, J.P., Taneja,
M., Yang, X., and Tian, X.C. (2005). Expression of imprinted genes is aberrant in deceased
newborn cloned calves and relatively normal in surviving adult clones. Mol Reprod Dev
71, 431-438.
Yasmineh, W.G., and Yunis, J.J. (1970). Localization of mouse satellite DNA in
constitutive heterochromatin. Exp Cell Res 59, 69-75.
Yoder, J.A., Walsh, C.P., and Bestor, T.H. (1997). Cytosine methylation and the ecology of
intragenomic parasites. Trends Genet 13, 335-340.
Young, L.E., Sinclair, K.D., and Wilmut, I. (1998). Large offspring syndrome in cattle and
sheep. Rev Reprod 3, 155-163.
Zeschnigk, M., Albrecht, B., Buiting, K., Kanber, D., Eggermann, T., Binder, G., Gromoll,
J., Prott, E.C., Seland, S., and Horsthemke, B. (2008). IGF2/H19 hypomethylation in
Silver-Russell syndrome and isolated hemihypoplasia. Eur J Hum Genet 16, 328-334.
Zhao, X.D., Han, X., Chew, J.L., Liu, J., Chiu, K.P., Choo, A., Orlov, Y.L., Sung, W.K.,
Shahab, A., Kuznetsov, V.A., et al. (2007). Whole-genome mapping of histone H3 Lys4
and 27 trimethylations reveals distinct genomic compartments in human embryonic stem
cells. Cell Stem Cell 1, 286-298.
Zhu, J.K. (2009). Active DNA demethylation mediated by DNA glycosylases. Annu Rev
Genet 43, 143-166.
87
Téléchargement