Etude du statut mutationnel EGFR dans l`ADN circulant plasmatique

publicité
UNIVERSITE DE NANTES

FACULTE DE MEDECINE

Année 2014
N°
152
THESE
pour le
DIPLOME D’ETAT DE DOCTEUR EN MEDECINE
D’ETUDES SPECIALISEES DE BIOLOGIE MEDICALE
par
Mehdi Sakka
Né le 04/10/1984 à Hammamet (Tunisie)

Présentée et soutenue publiquement le 23 octobre 2014

Etude du statut mutationnel EGFR dans l’ADN
circulant plasmatique chez douze patients ayant un
cancer pulmonaire non à petites cellules traités par
inhibiteur de tyrosine kinase
Président :
Monsieur le Professeur Jean-Marie BARD
Directeur de thèse : Monsieur le Professeur Marc DENIS
Membres du jury :
Madame le Docteur Acya BIZIEUX
Monsieur le Professeur Stéphane BEZIEAU
Table des matières
Remerciements ....................................................................................................................................... 3
Liste des figures ....................................................................................................................................... 5
Liste des tableaux .................................................................................................................................... 6
Liste des abréviations .............................................................................................................................. 8
Introduction............................................................................................................................................. 9
Première partie : Revue bibliographique .............................................................................................. 10
I.
Cancer pulmonaire en france ........................................................................................................ 10
1.
Epidémiologie ............................................................................................................................ 10
2.
Types histologiques ................................................................................................................... 11
3.
Facteurs de risques du cancer pulmonaire ............................................................................... 12
4.
Classification TNM ..................................................................................................................... 12
5.
Critères d’évaluation RECIST ..................................................................................................... 14
II.
EGFR : découverte, intérêt, type mutation biopsie....................................................................... 15
1.
EGFR : Rôle physiologique ......................................................................................................... 15
2.
EGFR : rôle oncogénique ........................................................................................................... 16
3.
Inhibiteurs de Tyrosine Kinase : erlotinib et gefitinib ............................................................... 17
4.
TKI : Essai de phase III et AMM ................................................................................................. 19
5.
Effets secondaires du gefitinib et de l’erlotinib ........................................................................ 22
6.
AMM en France ......................................................................................................................... 23
7.
Inhibiteur de deuxième génération........................................................................................... 23
8.
Plan cancer et plateformes de biologie moléculaire ................................................................. 23
9.
Techniques de recherche des mutations EGFR dans le tissu biopsié ........................................ 24
10.
Mutation de résistance ......................................................................................................... 24
11.
Inhibiteur de 3ème génération ................................................................................................ 27
III.
Intérêt de la quantification des ADN circulants dans le cancer pulmonaire non à petites
cellules ................................................................................................................................................... 28
1.
Histoire de l’ADN circulant ........................................................................................................ 28
2.
ADN circulant et aspect quantitatif : évaluation pronostique .................................................. 29
IV.
Intérêt de la recherche d’anomalie d’EGFR dans l’ADN circulant ............................................. 34
1.
Avantages par rapport aux biopsies .......................................................................................... 34
2.
Intérêt en cancérologie de la recherche d’anomalie dans l’ADN circulant ............................... 36
3.
Techniques utilisées pour la recherche d’anomalies d’EGFR .................................................... 37
4.
Intérêt pronostique ................................................................................................................... 39
5.
Intérêt dans le suivi du traitement ............................................................................................ 39
1
Deuxième partie : travail réalisé ........................................................................................................... 41
I.
Matériels et méthodes .................................................................................................................. 41
1.
Déroulement de l’étude ............................................................................................................ 41
2.
Critères d’inclusions .................................................................................................................. 41
3.
Critères d’exclusions.................................................................................................................. 41
4.
Recherche de mutations activatrice de l’EGFR : dans le tissu cancéreux ................................. 41
5.
Recherche de mutations activatrice de l’EGFR : dans le plasma............................................... 44
6.
Méthodologie ............................................................................................................................ 45
II.
Résultats ........................................................................................................................................ 46
1.
Caractéristiques des patients .................................................................................................... 46
2.
Altérations du gène EGFR dans l’ADN plasmatique et réponse initiale au traitement ............. 47
3.
Apparition de la mutation de résistance T790M....................................................................... 49
4.
Suivi longitudinal des patients pendant le traitement .............................................................. 49
III.
Discussion .................................................................................................................................. 56
Bibliographie.......................................................................................................................................... 58
2
Remerciements
Je tiens à remercier :
Monsieur le Professeur Jean-Marie BARD
Pour avoir accepté de présider ce jury,
Veuillez trouver ici l’expression de ma reconnaissance.
Monsieur le Professeur Marc DENIS,
Pour m’avoir confié ce travail passionnant,
Pour avoir été patient et m’avoir encadré,
Veuillez trouver ici le témoignage de ma profonde gratitude.
Madame le Docteur Acya BIZIEUX
Pour sa participation dans ce projet,
Pour m’avoir reçu plusieurs fois à la Roche sur Yon,
Veuillez trouver ici l’assurance de mes sincères remerciements.
Monsieur le Professeur Stéphane BEZIEAU
Pour l’honneur que vous me faites de juger ce travail,
Je vous témoigne ma très vive reconnaissance.
Le laboratoire de biochimie et à la plateforme de génétique moléculaire des cancers,
A Audrey Vallée pour tout son travail et son encadrement,
Aux techniciens pour leur aide.
3
A ma famille à qui je dédie cette thèse
A mes parents et à ma sœur,
Pour leur soutien et leurs encouragements,
A Julie,
Qui m’a encouragé dans les moments difficiles et m’a aidé dans la relecture,
Tu es toujours là quand j’ai besoin de toi.
A mes amis
Yassine, Ellie, Kamou, Shadi, nous avons fait un long parcours depuis la Tunisie,
Guillaume, nous arrivons enfin à voir la fin,
A tous mes co-internes nantais pour ces années passées à vos côtés,
A mes co-internes brestois pour leur accueil chaleureux.
4
Liste des figures
FIGURE 1 : EVOLUTION DE L'INCIDENCE DE CANCER PULMONAIRE EN FRANCE DE 1980 A 2013 (1) --------------- 10
FIGURE 2 : COUPE HISTOLOGIQUE D'UN CARCINOME MALPIGHIEN (2) ----------------------------------------------------- 11
FIGURE 3: COUPES HISTOLOGIQUES DE DIFFERENTES FORMES D'ADENOCARCINOME (2) ---------------------------- 11
FIGURE 4 : VOIES DE SIGNALISATION D'EGFR (12) --------------------------------------------------------------------------------- 15
FIGURE 5 : REPARTITION DES ANOMALIES MOLECULAIRES DANS LE CANCER PULMONAIRE (13) ------------------- 16
FIGURE 6 : REPARTITION DES ANOMALIES MOLECULAIRES DANS LE GENE EGFR SUR LES EXONS 18 A 21 (15) -- 17
FIGURE 7 : POURCENTAGE D'ACTIVATION D’EGFR EN FONCTION DU LIGAND EGF ET DU TYPE DE MUTATION
DANS LE TISSU TUMORAL (21) --------------------------------------------------------------------------------------------------- 18
FIGURE 8 : POURCENTAGE D'ACTIVATION D’EGFR EN FONCTION DU LIGAND EGF ET DU TYPE DE MUTATION EN
PRESENCE D'INHIBITEUR DANS LE TISSU TUMORAL (21) --------------------------------------------------------------- 18
FIGURE 9 : COURBES DE KAPLAN MEIER DES DIFFERENTS SOUS-GROUPES COMPARANT LES TRAITEMENTS (26)
-------------------------------------------------------------------------------------------------------------------------------------------- 20
FIGURE 10 : SURVIE SANS PROGRESSION ENTRE GROUPES TRAITES PAR GEFITINIB ET PAR CISPLATINE ASSOCIE
AU DOCETAXEL (27) ---------------------------------------------------------------------------------------------------------------- 21
FIGURE 11 : SURVIE SANS PROGRESSION ENTRE GROUPES TRAITES PAR ERLOTINIB ET PLACEBO (28) ------------ 21
FIGURE 12 : PHOTOGRAPHIE D'UNE FOLLICULITE SOUS ERLOTINIB (35) ---------------------------------------------------- 22
FIGURE 13 : CARTE DES PLATEFORMES DE GENETIQUE MOLECULAIRE DES CANCERS (1) ------------------------------ 24
FIGURE 14 : CRISTALLOGRAPHIE DE L'EGFR ET INTERACTION AVEC L'ERLOTINIB (45) ---------------------------------- 25
FIGURE 15 : CROISSANCE TUMORALE EN FONCTION DE LA CONCENTRATION EN GEFITINIB (47) ------------------ 25
FIGURE 16 : DIAGRAMME DE LA REPARTITION DES RESISTANCES ACQUISES AUX INHIBITEURS DE TYROSINE
KINASE D’APRES CORTOT (57) --------------------------------------------------------------------------------------------------- 26
FIGURE 17 : MECANISMES POSSIBLES DU RELARGAGE DES ADN CIRCULANTS D'ORIGINE TUMORALE (64) ------ 28
FIGURE 18 : COMPARAISON D'ADN CIRCULANT ENTRE SERUM ET PLASMA EN FONCTION DE LA TAILLE
TUMORALE D'ORIGINE HUMAINE (66) ---------------------------------------------------------------------------------------- 29
FIGURE 19 : CONCENTRATION D'ADN CIRCULANT PLASMATIQUE A T0 SELON LES STADES DE CANCER (68) ----- 30
FIGURE 20 : DIFFERENCE DE CONCENTRATION D'ADN ENTRE PLASMA ET SERUM EN FONCTION DU TEMPS
AVANT CENTRIFUGATION (71) --------------------------------------------------------------------------------------------------- 30
FIGURE 21 : DIFFERENCE DE CONCENTRATIONS D'ADN ENTRE DIFFERENTS ANTICOAGULANTS (73)--------------- 31
FIGURE 22 : COURBE ROC DE LA CONCENTRATION D'ADN CIRCULANT POUR LE PRONOSTIC DU CANCER A
20 NG/ML (77)------------------------------------------------------------------------------------------------------------------------ 32
FIGURE 23 : CONCENTRATION D’ADN SELON LE STADE DU CANCER (80) -------------------------------------------------- 32
FIGURE 24 : SURVIE CUMULEE SELON LA CONCENTRATION EN ADN CIRCULANT AVEC UN SEUIL A 49.9 NG/ML
DE HTERT (81) ------------------------------------------------------------------------------------------------------------------------ 33
FIGURE 25 : MODELES EXPLIQUANT LA VARIATION TUMORALES ENTRE LES METASTASES ET LA TUMEUR (82) 34
FIGURE 26 : EVOLUTION DES LIGNEES DANS LES DIFFERENTES SOUS POPULATIONS (83). ---------------------------- 35
FIGURE 27 : BIOPSIES REALISES SUR LA TUMEUR (84) ---------------------------------------------------------------------------- 35
FIGURE 28 : ARBRE PHYLOGENETIQUE DES ANOMALIES RETROUVEES DANS LES DIFFERENTES POPULATIONS
BIOPSIEES (84) ------------------------------------------------------------------------------------------------------------------------ 36
FIGURE 29 : COMPARAISON DE LA DIFFERENCE DE CT OBTENU ENTRE SERUM ET PLASMA (84) -------------------- 36
FIGURE 30 : TECHNIQUE WIP QP POUR LA RECHERCHE D’ANOMALIE EGFR DANS LE PLASMA (91) ----------------- 37
FIGURE 31 : DETECTION DU GENE APC MUTE ET DU GENE KRAS DANS LE SUIVI DU TRAITEMENT DU CANCER
COLO-RECTAL (94) ------------------------------------------------------------------------------------------------------------------- 39
FIGURE 32 : SUIVI DES ANOMALIES EGFR DANS LE PLASMA. ------------------------------------------------------------------- 40
FIGURE 33 : ETAPES DE L’EXTRACTION DE L’ADN SUR LE KIT IPREP----------------------------------------------------------- 42
FIGURE 34 : EXEMPLE DE PCR SPECIFIQUE D’ALLELE POUR LA RECHERCHE DE L858R ---------------------------------- 43
FIGURE 35 : GEL DES FRAGMENTS AMPLIFIES POUR LA RECHERCHE DE DELETION DE L’EXON 19 ------------------- 43
FIGURE 36 : ANOMALIES RECHERCHEES PAR LE KIT THERASCREEN ---------------------------------------------------------- 44
FIGURE 37 : REPARTITION DES PATIENTS SELON LEURS CARACTERISTIQUES ---------------------------------------------- 47
FIGURE 38 : EVOLUTION DU PATIENT 5 ----------------------------------------------------------------------------------------------- 49
5
FIGURE 39 : EVOLUTION DU PATIENT 8 ----------------------------------------------------------------------------------------------- 50
FIGURE 40 : EVOLUTION DU PATIENT 1 ----------------------------------------------------------------------------------------------- 50
FIGURE 41 : EVOLUTION DU PATIENT 2 ----------------------------------------------------------------------------------------------- 51
FIGURE 42 : EVOLUTION DU PATIENT 3 ----------------------------------------------------------------------------------------------- 51
FIGURE 43 : EVOLUTION DU PATIENT 4 ----------------------------------------------------------------------------------------------- 52
FIGURE 44: EVOLUTION DU PATIENT 6 ----------------------------------------------------------------------------------------------- 52
FIGURE 45 : EVOLUTION DU PATIENT 7 ----------------------------------------------------------------------------------------------- 53
FIGURE 46 : EVOLUTION DU PATIENT 9 ----------------------------------------------------------------------------------------------- 53
FIGURE 47 : EVOLUTION DU PATIENT 10 --------------------------------------------------------------------------------------------- 54
FIGURE 48 : EVOLUTION DU PATIENT 11 --------------------------------------------------------------------------------------------- 54
FIGURE 49 : EVOLUTION DU PATIENT 12 --------------------------------------------------------------------------------------------- 55
Liste des tableaux
TABLEAU 1 : INCIDENCE ET MORTALITE DES 5 CANCERS LES PLUS IMPORTANTS EN 2012 (1) ............................ 10
TABLEAU 2 : CLASSIFICATION TNM PAR STADE DE CANCER PULMONAIRE (8) .................................................... 13
TABLEAU 3 : FACTEURS PREDICTIFS DE LA PRESENCE D'UNE MUTATION EGFR CHEZ LES PATIENTS EUROPEENS
(1) ................................................................................................................................................................. 17
TABLEAU 4 : PRINCIPALES TOXICITES LIEES AUX TRAITEMENTS PAR INHIBITEUR DE TYROSINE KINASE (36) ...... 22
TABLEAU 5 : RESULTATS DE LA META-ANALYSE SUR LES TECHNIQUES DE L’EGFR CIRCULANT (92) .................... 38
TABLEAU 6 : SENSIBILITE ET SPECIFICITE DE LA RECHERCHE D’EGFR DANS LE PLASMA PAR RAPPORT A LA
BIOPSIE (31) .................................................................................................................................................. 38
TABLEAU 7 : CARACTERISTIQUES DES 12 PATIENTS ETUDIES ............................................................................... 46
TABLEAU 8: PATIENTS DONT L’ADN PLASMATIQUE A ETE TESTE APRES 1 MOIS DE TRAITEMENT ...................... 48
TABLEAU 9 : PATIENTS DONT L’ADN PLASMATIQUE A ETE TESTE APRES 2 MOIS DE TRAITEMENT ..................... 48
TABLEAU 10 : PATIENT DONT L’ADN PLASMATIQUE A ETE TESTE APRES 4 MOIS DE TRAITEMENT ..................... 48
TABLEAU 11 : RECHERCHE D’ANOMALIE DANS LE PLASMA A LA PREMIERE EVALUATION SELON
LA PROGRESSION DE LA MALADIE................................................................................................................ 49
6
7
Liste des abréviations
ADN : acide désoxyribonucléique
AMM : autorisation de mise sur le marché
Ct : Cycle Threshold ou cycle seuil
EGFR : Epidermal Growth Factor Receptor ou récepteur au facteur de croissance épidermique ou HER1
INCa : institut national du cancer
PCR : Polymerase Chain Reaction ou réaction de polymérisation en chaîne
PP : progression de la maladie
RC : réponse complète
RECIST : Response Evaluation Criteria in Solid Tumours ou critères d’évaluation de réponse aux tumeurs
solides
RP : réponse partielle
RS : réponse stable
TDM : tomodensitométrie
TGFα : Transforming growth factor alpha ou facteur de croissance de transformation alpha
TKI : Tyrosine kinase inhibitor ou inhibiteur de tyrosine kinase
8
Introduction
Le cancer pulmonaire est le quatrième cancer le plus fréquent en France et c’est celui qui a la mortalité
la plus élevée. Depuis le début des années 2000 de nouvelles molécules qui ciblent le récepteur de
l’EGF améliorent la prise en charge de ce type de cancer. Des découvertes récentes ont permis montrer
que ces thérapies ciblées sont efficaces lorsque le tissu cancéreux du patient présente une mutation
activatrice du gène EGFR. Ces altérations sont recherchées en routine dans des plateformes de
génétique moléculaire des cancers.
Depuis quelques années, les biologistes du laboratoire de biochimie du CHU de Nantes, qui font partie
de la plateforme de génétique moléculaire des cancers, s’intéressent à l’ADN retrouvé dans la
circulation sanguine des patients. Ils ont pu montrer que chez la plupart des patients présentant une
mutation du gène EGFR dans leur tumeur, la même mutation était retrouvée dans l’ADN plasmatique.
Il reste maintenant à déterminer l’intérêt de l’analyse de ces « biopsies liquidiennes » chez les patients
en cours de traitement par un inhibiteur de l’EGFR. Cette analyse permet-elle de déterminer
précocement si le patient répond au traitement ? De prédire une rechute clinique du patient ?
D’identifier les mécanismes moléculaires de résistance ?
Pour répondre à ces questions, nous avons analysé les résultats des tests réalisés chez 12 patients
traités par inhibiteur d’EGFR, suivis au CH de La Roche sur Yon et au CHU de Nantes. Ces données
seront présentées et discutées après un rappel des généralités sur le cancer pulmonaire, la découverte
d’EGFR et la mise en place des traitements par inhibiteur de tyrosine kinase, puis l’intérêt de l’ADN
circulant en cancérologie.
9
Première partie : Revue bibliographique
I.
CANCER PULMONAIRE EN FRANCE
1. Epidémiologie
Le cancer pulmonaire est le quatrième cancer le plus fréquent en France, selon les données de l’institut
national du cancer (INCa), avec une incidence de 40 000 cas pour l’année 2012. La survie moyenne à
5 ans est de 15% et c’est le cancer à l’origine du plus grand nombre de décès, avec 30 000 décès en
2012 soit 20% par rapport à l’ensemble des cancers (1) (tableau 1).
Tableau 1 : Incidence et mortalité des 5 cancers les plus importants en 2012 (1)
L’âge moyen du diagnostic est à 65 ans chez les hommes et 64 ans chez les femmes. Dans les deux tiers
des cas, le diagnostic se fait à un stade avancé ce qui explique cette mortalité.
L’incidence est en hausse, essentiellement due à une augmentation de 5.4% par an de l’incidence chez
la femme liée à l’augmentation de la consommation tabagique (figure 1).
Figure 1 : Evolution de l'incidence de cancer pulmonaire en France de 1980 à 2013 (1)
10
2. Types histologiques
Les cancers du poumon sont classés en deux grandes parties : les carcinomes non à petites cellules qui
dérivent des cellules souches de la muqueuse broncho-pulmonaire et les carcinomes à petites cellules.
Les carcinomes non à petites cellules représentent 80 % des cas et sont répartis en deux catégories :
les carcinomes épidermoïdes et les adénocarcinomes.
Les carcinomes épidermoïdes ou malpighiens (figure 2) représentent 30 % des cancers bronchiques
non à petites cellules (CBNPC). Ils surviennent la plupart du temps chez des patients fumeurs.
Figure 2 : coupe histologique d'un carcinome malpighien (2)
Les adénocarcinomes sont en augmentation dans les pays occidentaux en particulier chez la femme (3).
Une nouvelle classification a été proposée en 2011 et devrait être mise dans la prochaine classification
de l’OMS (4). Elle distingue les lésions pré-invasives, les adénocarcinomes à invasion minime et les
adénocarcinomes invasifs. Plusieurs architectures sont distinguées : acinaire, papillaire,
micropapillaire, solide et lépidique (figure 3).
Figure 3: coupes histologiques de différentes formes d'adénocarcinome (2)
A : acinaire, B : papillaire, C : lépidique et D : solide
11
3. Facteurs de risques du cancer pulmonaire
Le principal facteur de risque des cancers broncho-pulmonaires est le tabagisme actif ou passif. Il est
la cause de près de 85 % des cancers broncho-pulmonaires. Des résidus de goudron cancérigènes sont
retrouvés chez les non-fumeurs subissant un tabagisme passif (5).
D’autres facteurs environnementaux ou professionnels sont reconnus cancérogènes comme
l’amiante, le gaz d’échappement des moteurs diesel, le radon, l’arsenic, le nickel, le cobalt, le chrome,
les hydrocarbures polycycliques aromatiques, l’exposition à certains rayonnements ionisants, la silice
et le cadmium (6).
Pour une personne exposée à l’amiante, le risque de cancer broncho-pulmonaire est multiplié par 5
chez un patient non tabagique et multiplié par 50 chez un patient tabagique.
D’autres facteurs semblent impliqués dans le cancer broncho-pulmonaire mais dont leur l’imputabilité
n’est pas totalement démontrée comme pour le cannabis inhalé (7), les antécédents d’irradiation
thoracique pour une maladie de Hodgkin ou un cancer du sein, ou une exposition professionnelle ou
accidentelle aux rayonnements ionisants.
4. Classification TNM
En 2009 est parue la septième édition de la classification des cancers pulmonaires (8) .
La classification TNM repose sur trois paramètres : le T pour la tumeur primitive, le N pour les ganglions
pathologiques et le M pour les métastases. Pour le T, voici la classification









TX : Tumeur qui ne peut être évaluée ou il est démontré la présence de cellules malignes dans
les expectorations ou un lavage bronchique sans visualisation de la tumeur par des examens
endoscopiques ou d’imagerie.
T0 : Il n’y a pas de mise en évidence d’une tumeur primitive.
Tis : Le carcinome est in situ.
T1 : La tumeur fait 3 cm ou moins dans sa plus grande dimension et est entourée par le poumon
ou la plèvre viscérale, sans mise en évidence bronchoscopique d’invasion plus proximale que
la bronchique lobaire.
T1a : La tumeur fait 2 cm ou moins dans sa plus grande dimension.
T1b : La tumeur fait plus de 2 cm sans dépasser 3 cm dans sa plus grande dimension.
T2 : La tumeur fait plus de 3 cm sans dépasser 7 cm dans sa plus grande dimension ou présente
une des caractéristiques suivantes :
o atteinte de la bronche souche à 2 cm ou plus de la carène.
o invasion de la plèvre viscérale.
o présence d’une atélectasie ou d’une pneumopathie obstructive s’étendant à la région.
hilaire sans atteindre l’ensemble du poumon.
T2a : La tumeur fait plus de 3 cm sans dépasser 5 cm dans sa plus grande dimension.
T2b: La tumeur fait plus de 5 cm sans dépasser 7 cm dans sa plus grande dimension.
12


T3 : La tumeur fait plus de 7 cm ou
o envahie directement une des structures suivantes : la paroi thoracique, le
diaphragme, le nerf phrénique, la plèvre médiastinale, pleurale ou pariétale ou le
péricarde.
o la tumeur dans la bronche souche est à moins de 2 cm de la caréna sans l’envahir.
o est associée à une atélectasie ou d’une pneumopathie obstructive du poumon entier
o il y a la présence d’un nodule tumoral distinct dans le même lobe.
T4 : La tumeur quelque soit sa taille envahie directement une des structures suivantes :
médiastin, cœur, grands vaisseaux, trachée, nerf laryngé récurrent, œsophage, corps
vertébral, carène; ou présence d’un nodule tumoral distinct dans un autre lobe du poumon
atteint.
Pour le N : les ganglions lymphatiques régionaux, voici la classification :





NX : les ganglions ne peuvent pas être évalués.
N0 : aucune métastase ganglionnaire lymphatique régionale.
N1 : une ou plusieurs métastases dans les ganglions lymphatiques intrapulmonaires,
péribronchiques ou hilaires latéraux, y compris par envahissement direct.
N2 : métastases dans les ganglions lymphatiques médiastinaux latéraux ou sous-carainaires.
N3 : métastase dans les ganglions lymphatiques médiastinaux controlatéraux, hilaires
controlatéraux, scalènes ou sous-claviculaires latéraux ou controlatéraux.
Pour le M, les métastases à distance, la classification donne :





MX : les métastases à distance n’ont pas pu être évaluées.
M0 : absence de métastase à distance.
M1 : une ou des métastases à distance.
M1a : Au moins un nodule tumoral distinct dans un lobe controlatéral ; tumeur avec nodules
pleuraux ou épanchement pleural (ou péricardique) malin.
M1b : métastase à distance.
Une fois le TNM déterminé, la classification se fait par 4 stades (tableau 2).
Tableau 2 : classification TNM par stade de cancer pulmonaire (8)
13
La classification TNM permet de distinguer différents groupes, plus le stade est élevé moins le
pronostic sera favorable.
5. Critères d’évaluation RECIST
La version 1.1 du RECIST (9) pour Response Evaluation Criteria in Solid Tumours remplace la version
1.0 qui datait de 2000, et permet de définir la taille de tumeur mesurable d’une tumeur solide.
La tumeur est mesurable si la taille est supérieure à 10 mm au scanner, 20 mm à la radiographie
thoracique. Elle n’est pas mesurable si la taille est inférieure à 10 mm.
L’évaluation du traitement devrait se faire de préférence avant quatre semaines après le début du
traitement. Pour le calcul, la somme des diamètres de toutes les lésions est prise en compte, diamètre
mesuré sur le plus grand côté.
Pour l’évaluation des ganglions pathologiques, leurs mesures sont prises en compte si le ganglion dans
son côté le moins important fait plus de 15 mm.
Au maximum cinq lésions cibles sont sélectionnées au total avec un maximum de deux lésions cibles
par organe. La sélection des lésions cibles s’opérera de façon à être représentative de tous les organes
envahis, en choisissant les lésions les plus grandes dans leur plus grande dimension qui de plus,
pourront être suivies tout au long de l'essai avec la méthode utilisée lors de l’examen initial.
C'est la somme des diamètres de ces lésions cibles de plus grand axe pour les lésions, et de plus petit
axe pour les ganglions qui sera suivie au long de l'essai pour évaluer la réponse ou la progression.
Trois types de réponses sont ainsi établis et aident pour le suivi et l’évaluation du traitement :

Réponse complète (RC) correspond à une disparition des cibles et les ganglions
pathologiques doivent avoir une réduction de leur axe inférieur strictement à 10mm.

Réponse partielle (RP) correspond à la réduction de 30% sur la somme des diamètres.

Progression de la maladie correspond à 20% d’augmentation sur la somme des
diamètres et en valeur absolue une augmentation de 5mm.

Réponse stable ne correspond à aucun des autres critères.
Ces critères permettent de standardiser l’évaluation d’un traitement des tumeurs solides et le score
RECIST est utilisé dans un groupe d’études notamment dans le cancer pulmonaire non à petites
cellules.
14
II.
EGFR : DECOUVERTE, INTERET, TYPE MUTATION BIOPSIE
1. EGFR : Rôle physiologique
EGFR est une glycoprotéine transmembranaire constituée d’une chaîne polypeptidique. Il est codé par
le proto-oncogène c-erbB1 qui comporte 188 307 paires de bases et se situe sur le chromosome 7. Le
gène donnera 4 variants de protéines. Le variant 1 contient 28 exons soit 1210 acides aminés. Il
correspond au récepteur à l’EGF ou EGFR et se nomme également HER1 pour Human Epithelial
Receptor.
La partie extracellulaire se divise en 4 domaines : deux domaines de liaison à l’EGF (I et III) et deux
domaines riches en Cystéine (II et IV). Les ligands principaux sont l’EGF et le TGFα.
La partie intracellulaire comporte un domaine de régulation et un domaine tyrosine kinase. L’EGFR fait
partie de la famille des récepteurs à tyrosine kinase. Le récepteur a un rôle dans la transduction du
signal cellulaire (10).
La voie de signalisation se fera en 3 étapes : la première correspond à la fixation du ligand spécifique
au niveau du domaine extracellulaire du récepteur. La deuxième correspond à la formation d’un
dimère avec phosphorylation ATP dépendante de résidus tyrosine dans la partie intracellulaire. La
dernière étape induit l’activation de la voie de signalisation intracellulaire (11).
Les voies de signalisation intracellulaires sont la voie RAS-RAF-MEK-MAPK qui contrôle la transcription
de gènes, la progression du cycle cellulaire de la phase G1 à la phase S et la prolifération cellulaire. La
voie PI3K-Akt active une cascade de signaux anti-apoptotiques via bFGF, HB-EGF, MAPK, PI3K, TGFα et
VEGF (figure 4).
Figure 4 : Voies de signalisation d'EGFR (12)
15
2. EGFR : rôle oncogénique
En 2014, un regroupement de chercheurs oncogénéticiens publie (13) les différentes anomalies
moléculaires que l’on peut retrouver dans le cancer pulmonaire. Les anomalies d’EGFR représentent
près de 11 % des anomalies retrouvées dans la population étudiée (figure 5). Dans 24.4 % aucune
anomalie n’est retrouvée.
Autres anomalies
Figure 5 : Répartition des anomalies moléculaires dans le cancer pulmonaire (13)
Le rôle d’EGFR en cancérologie est connu depuis les années 1980 (14). En cas de dysrégulation de
l’EGFR, une activation importante pourra avoir lieu et entrainera une dimérisation importante et
anormale aboutissant à l’autophosphorylation de son extrémité intracellulaire. La cascade
intracellulaire sera activée et augmentera l’activité tumorale, sa résistance à l’apoptose et sa capacité
d’invasion locale.
Dans le gène EGFR, les altérations sont essentiellement retrouvés dans 4 exons (figure 6), les exons 18
à 21, qui codent pour le domaine à activité tyrosine kinase (15).
Les mutations les plus fréquentes sont dans 60 % des cas les délétions dans l’exon 19 qui vont toujours
du résidu leucine 747 à l’acide glutamique en position 749, dans 25 % des cas la mutation qui remplace
une leucine par une arginine en position 858 (L858R) dans l’exon 21. Les autres mutations sont plus
rares et se trouvent dans les exons 18 à 21.
16
Figure 6 : Répartition des anomalies moléculaires dans le gène EGFR sur les exons 18 à 21 (15)
Les facteurs prédisant la présence d’une mutation de l’EGFR chez des patients européens sont résumés
dans le tableau 3 (1).
Tableau 3 : Facteurs prédictifs de la présence d'une mutation EGFR chez les patients européens (1)
3. Inhibiteurs de Tyrosine Kinase : erlotinib et gefitinib
Dans le milieu des années 90, une surexpression de EGFR en immunohistochimie est retrouvé dans
près de 50% des adénocarcinomes bronchiques (16).
Les premières études datant de 2003 (17) (18) s’intéressent à l’utilisation des inhibiteurs de tyrosine
kinase dans le traitement de l’adénocarcinome dans des essais de phase II chez des patients en
stade IIIb ou IV ayant déjà reçu deux cures de chimiothérapie. Les résultats montrent des baisses de
10 à 15% de la taille de la tumeur. En examinant en détails les résultats, certaines catégories de
17
population semblent avoir de meilleurs résultats : les femmes, les non-fumeurs, les patients d’origines
asiatiques, les patients ayant un adénocarcinome (19).
L’hypothèse d’une variabilité de la cible des EGFR est émise et le séquençage du gène EGFR est alors
réalisé (20) (21). Une activation de la fonction phosphorylation du récepteur est plus importante en
cas de mutation L858R et de délétion dans l’exon 19 par rapport au phénotype sauvage. En ajoutant
l’inhibiteur de tyrosine kinase, l’activation sera freinée plus rapidement et plus efficacement en cas de
mutation L858R et de délétion dans l’exon 19 (figures 7 et 8).
Figure 7 : Pourcentage d'activation d’EGFR en fonction du ligand EGF et du type de mutation dans le
tissu tumoral (21)
Figure 8 : Pourcentage d'activation d’EGFR en fonction du ligand EGF et du type de mutation en
présence d'inhibiteur dans le tissu tumoral (21)
Les mutations somatiques activatrices d’EGFR impliquent L’ATP (adénosine triphosphate) où le site du
domaine de la tyrosine kinase intracellulaire, est aussi le site de liaison des inhibiteurs de tyrosine
kinase comme l’erlotinib et le gefitinib.
L’activation du récepteur se fera par sa dimérisation. Le récepteur sera activé de manière non
contrôlée en cas de mutations activatrices.
18
Une méta-analyse en 2009 par Jackman et al. (22), montre un taux de réponse à 67% chez les patients
traités par inhibiteur de tyrosine kinase qui présentaient une mutation activatrice du gène EGFR. La
survie sans progression était en moyenne de 11.8 mois alors que le taux de réponse chez des patients
avec le gène EGFR sauvage n’était que de 5 %, avec une survie sans progression en moyenne inférieure
à 4 mois.
En première ou seconde ligne, dans le cadre d’essais de phase II, Morita et al. (23) montre un taux de
réponse à 76% chez des patients présentant une mutation activatrice comparé à une réponse à 25 %
chez des patients traités par chimiothérapie et une durée médiane sans progression de 9.7 mois.
Une méta-analyse par Paz-Ares et al. (24) montre une survie sans progression plus longue pour les
patients traités par inhibiteur de tyrosine kinase de 9.8 mois à 13.2 mois contre 5.9 mois par
chimiothérapie. En Espagne, Rosell et al. (25) montre une réponse à 70.2% chez des patients avec
mutations activatrices de l’EGFR.
4. TKI : Essai de phase III et AMM
L’étude IPASS (Iressa Pan-Asia Study) par Mok en 2009 (26) est la première grande étude en Asie à
évaluer la survie sans progression de deux groupes randomisés, un traité par gefitinib et l’autre par
carboplatine. Les résultats montrent une survie meilleure par gefitinib chez les patients mutés EGFR
que chez les patients sauvages EGFR (figure 9).
19
Figure 9 : Courbes de Kaplan Meier des différents sous-groupes comparant les traitements (26)
Groupe A : Ensemble des patients inclus, le groupe traité par gefitinib a une survie plus longue.
Groupe B : Sous-groupes de patients avec anomalie EGFR activatrice, le groupe traité par gefitinib a
une survie encore plus importante.
Groupe C : Sous-groupes de patients n’ayant pas d’anomalie d’EGFR activatrice, la survie est plus
importante avec la chimiothérapie.
Groupe D : Sous-groupes de patients dont le statut d’EGFR est inconnu, la survie est plus importante
avec le gefitinib.
Dans un essai randomisé, multicentrique en phase III Mitsudomi et al. (27), le gefitinib est comparé à
l’utilisation de cisplatine associé au docetaxel en traitement de première intention. Sur les 337
patients, seuls ceux présentant une mutation activatrice du gène EGFR (mutation L858R ou délétion
de l’exon 19) sont sélectionnés (soit 177 patients), et randomisés. La maladie est évaluée par les
critères RECIST. La recherche de mutations du gène EGFR se fait au niveau du tissu tumoral biopsié.
La survie sans progression est plus importante dans le groupe traité par gefitinib avec 9.2 mois que
par le groupe traité par Cisplatine et Docetaxel avec 6.3 mois (figure 10).
20
Figure 10 : Survie sans progression entre groupes traités par gefitinib et par Cisplatine associé au
docétaxel (27)
Dans l’étude de Cappuzzo et al (28), les patients atteints d’un cancer pulmonaire non à petites cellules
reçoivent une chimiothérapie par sels de platine. Les patients qui n’ont pas rechuté sont mis en deux
groupes, un groupe traité par erlotinib et l’autre par placebo. La période sans rechute est
statistiquement plus longue avec erlotinib avec 12.3 semaines contre 11.1 semaines pour le groupe
placebo. Dans les sous-groupes la survie est plus évidente chez des patients présentant une mutation
activatrice d’EGFR (figure 11).
Figure 11 : Survie sans progression entre groupes traités par erlotinib et placébo (28)
Une méta-analyse de cinq études de phase III (29) sur le traitement par inhibiteur de tyrosine kinase,
gefitinib ou erlotinib pour le cancer pulmonaire non à petites cellules, montre que les inhibiteurs de
tyrosine kinase augmentent la survie sans progression avec un hazard ratio à 0.63 comparé à des
placebos.
21
En 2010, Douillard et al. (30) dans un essai de phase III, le taux de réponse pour les patients avec
mutations activatrices de EGFR est de 41.1% chez des patients traités par gefitinib contre 21.1% traités
par Docetaxel.
En 2014, un essai de phase IV de Douillard et al. (31) montre que chez 106 patients avec mutations de
EGFR en première ligne, 69.9% ont une réponse au gefitinib, la survie moyenne sans progression est
de 9.7 mois.
5. Effets secondaires du gefitinib et de l’erlotinib
Plus de 50% des patients traités par erlotinib ou gefitinib ont des effets secondaires cutanés (32).
La cause est l’expression d’EGFR au niveau de la peau et surtout au niveau des kératinocytes et des
glandes sudoripares (33). Les principaux effets secondaires cutanés sont l’éruption acnéiforme, les
télangéctasies, la folliculite (figure 12), l’hyperpigmentation ainsi que le rash cutané (34).
Figure 12 : Photographie d'une folliculite sous erlotinib (35)
Les effets secondaires digestifs sont principalement la diarrhée et dans 6% des cas, elle peut être
sévère (36).
En cas d’effets secondaires importants, le traitement peut être arrêté s’il est inefficace, ou la posologie
doit être diminuée. Des traitements symptomatiques peuvent être utilisés (tableau 4).
Tableau 4 : Principales toxicités liées aux traitements par inhibiteur de tyrosine kinase (36)
22
6. AMM en France
En 2009, le gefitinib (Iressa®, Astra-Zeneca) reçoit l’AMM pour le traitement des patients avec une
forme localement avancée ou métastatique de cancer du poumon non à petites cellules et dont la
tumeur porte une mutation activatrice de l’EGFR.
L’erlotinib (Tarceva®, Roche) a reçu l’AMM en 2005 pour le traitement en seconde ligne et plus des
patients avec une forme localement avancée ou métastatique de cancer du poumon non à petites
cellules. En juin 2012, l’erlotinib a l’AMM en première ligne de traitement des formes localement
avancées ou métastatiques du cancer bronchique non à petites cellules (CBNPC) chez les patients dont
la tumeur présente des mutations activatrices de l’EGFR.
Pour instaurer ces traitements, la recherche de mutations activatrices du gène EGFR doit être réalisée.
7. Inhibiteur de deuxième génération
L’afatinib (Giotrif®, Boehringer Inglheim) est un nouvel inhibiteur de tyrosine kinase. Il a reçu l’AMM
en février 2014 et ses indications sont les mêmes que le gefitnib et l’erlotinib, le cancer pulmonaire
non à petites cellules au stade avancé avec les anomalies activatrices d’EGFR. Son effet a été démontré
dans des études de phase III comparé par rapport à une chimiothérapie classique avec une survie sans
progression de 11 mois par rapport à 5.6 mois (37). Il a une action irréversible sur le site de la tyrosine
kinase se fixant de façon covalente (38).
Il aurait une activité aussi lors de la mutation T790M (39) (40).
Ses effets secondaires seraient identiques à ceux de première génération mais seraient moins
intenses (41). L’afatinib peut, en l’absence de preuve le comparant directement aux autres inhibiteurs
de tyrosine kinase être un traitement de remplacement (42).
8. Plan cancer et plateformes de biologie moléculaire
En 2006, l’INCa a soutenu la génétique moléculaire grâce à la mise en place de plateforme hospitalière
de génétique moléculaire des cancers. Le Plan Cancer en 2010 contribue au financement de ces
projets.
L’objectif de l’INCa est alors :


De créer des plateformes permettant de réaliser les recherches d’altérations génétiques
(somatiques) à visée sanitaire
D’organiser un maillage territorial permettant à tous les patients français de bénéficier de ces
tests.
23
Il existe aujourd’hui 28 plateformes (figure 13), avec au moins une plateforme par région
administrative. Les tests sont financés par des enveloppes spécifiques de l’INCa, puis le relai est pris
par la DGOS.
Figure 13 : Carte des plateformes de génétique moléculaire des cancers (1)
9. Techniques de recherche des mutations EGFR dans le tissu biopsié
En 2010 (43), un questionnaire a été envoyé aux 43 laboratoires qui pratiquaient la recherche
d’anomalie moléculaire du gène EGFR. Sur les 28 questionnaires retournés, le nombre de patients
présentant une anomalie EGFR variait entre 7 et 13%. Différentes techniques sont utilisées. Des
techniques comme le séquençage systématique (technique de Sanger), éventuellement précédé d’un
criblage per analyse des courbes de fusion à haute résolution. Des techniques un peu plus ciblées
comme le pyroséquençage qui permet d’analyser les régions les plus souvent altérées. Des techniques
très ciblées, destinés à rechercher spécifiquement des altérations précises.
Les avantages du séquençage des 4 exons sont de détecter toutes les anomalies et même de nouvelles
mutations non connues. Les avantages de techniques ciblées comme pour la PCR spécifique d’allèle
sont une sensibilité plus importante et une analyse plus rapide (44).
10.Mutation de résistance
En 2005, Kobayashi (45) décrit un patient qui avait une mutation par délétion dans l’exon 19 du gène
EGFR puis, ayant reçu un traitement par gefitinib était en rechute. Une nouvelle biopsie est réalisée et
le domaine de la tyrosine kinase (exon 18 à exon 21) est séquencé. Une seconde mutation chez ce
24
patient est identifiée, il s’agit de la T790M sur l’exon 20. La cristallographie montre que cette mutation
empêche l’inhibiteur de tyrosine kinase, l’erlotinib d’accéder au site de la tyrosine kinase et donc
annule l’inhibition (figure 14).
Figure 14 : cristallographie de l'EGFR et interaction avec l'erlotinib (45)
A : erlotinib qui agit sur le site de la tyrosine kinase
B : mutation T790M empêche l’erlotinib d’accéder au site
Cette observation est confirmée par Toyooka (46), en analysant de manière de manière rétrospective
les tumeurs et en retrouvant deux patients qui présentaient une mutation L858R mais aussi la
mutation T790M. Le traitement s’était avéré inefficace pour un des deux patients traité par gefitinib
et le cancer était plus agressif.
In vitro des lignées cellulaires présentaient la mutation T790M sont moins sensibles aux inhibiteurs
comme le gefitinib (figure 15) (47).
Figure 15 : croissance tumorale en fonction de la concentration en gefitinib (47)
H3255 : lignée avec L858R en vert
H2030 : lignée avec EGFR sauvage en noir
H1975 : lignée avec L858R et T790M en rouge
25
La mutation de résistance T790M est rare chez les patients dès le diagnostic à l’état naïf. Dans une
compilation de 7 études où la mutation T790M était recherchée, elle était retrouvée chez 4 patients
sur 845 soit moins de 0.47 % (48).
D’autres études montrent par la suite (49), que la résistance qui est recherchée dans le tissu tumoral
chez des patients en rechute est retrouvée dans 50% des cas. Kosaka et al. retrouvent chez 7 patients
sur 14 après séquençage des exons 18 à 21 à partir d’une nouvelle biopsie, la mutation T790M (50).
Une autre mutation est incriminée dans la résistance (51), la mutation D716Y sur l’exon 19.
Une fois la mutation de résistance retrouvée, changer d’inhibiteur de tyrosine kinase, passer du
gefitinib à l’erlotinib ou l’inverse ne permet pas de retrouver l’efficacité du traitement (52) (53) (54).
L’amplification de MET est retrouvée de manière plus fréquente en association avec la résistance
T790M (55).
Jackman et al. (56) propose de différencier résistance primaire aux inhibiteur de tyrosine kinase et
résistance secondaire. La résistance primaire serait un échec du traitement, se traduisant soit par une
stabilité ou soit par une progression de la maladie. La résistance secondaire ou acquise serait due à
l’acquisition d’un mécanisme moléculaire permettant l’échappement au traitement. Les critères sont
la présence d’une mutation activatrice d’EGFR associée à une sensibilité aux inhibiteurs de tyrosine
kinase, un traitement par inhibiteur de tyrosine kinase utilisé en monothérapie, une progression de la
maladie malgré le traitement par TKI et enfin pas d’utilisation de chimiothérapie.
Dans plus de la moitié des cas (57), l’acquisition de résistance aux inhibiteurs de tyrosine kinase est
due à l’acquisition de la mutation T790M qui représente plus de 90% des mutations de résistance sur
l’EGFR.
Mais d’autres anomalies acquises peuvent provoquer cette résistance comme l’amplification de MET
ou de HER2 (figure 16). Bean et al. montre que l’amplification de MET, un proto-oncogène donne un
échappement thérapeutique aux patients traités par inhibiteur de tyrosine kinase (58).
Inconnu
Amplification
Met
T790M
Amplification HER 2
Figure 16 : Diagramme de la répartition des résistances acquises aux inhibiteurs de tyrosine
kinase d’après Cortot (57)
26
11. Inhibiteur de 3ème génération
De nouveaux traitements inhibiteur de tyrosine kinase sont en cours de développement et apportent
un espoir pour les patients qui ont une résistance T790M (59). L’AZD9291, agit au niveau du site de la
tyrosine kinase et a une affinité plus forte en présence de la mutation T790M (60). Il s’inscrit dans une
nouvelle thérapeutique efficace en cas de résistance au traitement par inhibiteur de tyrosine
kinase (61).
27
III.
INTERET DE LA QUANTIFICATION DES ADN CIRCULANTS DANS
LE CANCER PULMONAIRE NON A PETITES CELLULES
1. Histoire de l’ADN circulant
Les ADN circulants sont découverts en 1948 par Mandel (62). Les ADN circulants d’origine tumorale
ont été mis en évidence dès la fin des années 1990 dans les différents cancers.
Dans la circulation sanguine, une grande proportion de l’ADN circulant vient des cellules normales de
l’organisme. Plusieurs mécanismes sont envisageables : nécrose ou apoptose « physiologique » des
cellules de tissus normaux (y compris les cellules sanguines), ou destruction intervenant au niveau d’un
foyer inflammatoire.
Les mêmes mécanismes sont proposés pour l’ADN circulant d’origine tumorale (figure 17). En plus, il
peut être envisagé un passage de cellules tumorales dans la circulation sanguine. Ces cellules seraient
ensuite détruites, libérant leur ADN. Une dernière hypothèse suggère un relargage direct d’ADN dans
la circulation sanguine par la cellule tumorale (63).
Figure 17 : mécanismes possibles du relargage des ADN circulants d'origine tumorale (64)
Les mécanismes de relargage de l’ADN tumoral dans la circulation sont la destruction de la cellule par
apoptose ou nécrose ou le relargage de la cellule tumorale entière dans la circulation. L’ADN tumoral
se présentera sous forme de fragments dans la circulation (65).
28
2. ADN circulant et aspect quantitatif : évaluation pronostique
Une étude avec le gène KRAS chez des souris xénogreffées avec des cellules tumorales humaines
montre que l’ADN sauvage de souris contamine plus l’ADN circulant quand le prélèvement est réalisé
sur sérum que sur tube avec anticoagulant EDTA. La concentration en ADN d’origine tumorale est plus
importante avec la volume de la tumeur (figure 18) (66).
Figure 18 : comparaison d'ADN circulant entre sérum et plasma en fonction de la taille tumorale
d'origine humaine (66)
Sérum en blanc et plasma et en noir
Chez l’homme, la concentration en ADN circulant a une valeur pronostic, plus la concentration est
importante avant tout traitement plus la survie sera courte (67). La quantification de l’ADN circulant
grâce au gène de la β-actine montre une concentration plus élevée chez les patients atteints d’un
cancer pulmonaire non à petites cellules par rapport à des patients sains (68). Cette augmentation
apparaît des stades précoces de la maladie (figure 19).
29
Figure 19 : concentration d'ADN circulant plasmatique à T0 selon les stades de cancer (68)
De nombreuses études montrent une concentration plus élevée d’ADN circulant dans le sérum que
dans le plasma chez des sujets sains chez des sujets atteints de cancer (69). Cette augmentation est
due au processus de coagulation dans le tube au moment de la séparation entre le culot globulaire et
le sérum. Les globules blancs relâchent ainsi leur ADN et contaminent l’ADN circulant (70). La
concentration en ADN (mesurée en quantifiant le gène de la β-Globine) est ainsi plus augmentée dans
le sérum de personnes saines que dans leur plasma (figure20). La conservation à température
ambiante augmente cette concentration par rapport à un stockage à +4°C (71)
Figure 20 : différence de concentration d'ADN entre plasma et sérum en fonction du temps avant
centrifugation (71)
Il existe une grande hétérogénéité sur les méthodes d’extraction, sur les cohortes, et le type de
prélèvement sanguin : plasma ou sérum. Le choix du plasma pour étudier l’ADN circulant tumorale est
mieux que le sérum afin d’éviter les contaminations par l’ADN des globules blancs au moment de la
formation du caillot.
30
Des efforts de standardisation se mettent en place notamment en 2013 avec El Messaoudi et al. (72).
L’héparinate de lithium peut inhiber la réaction de PCR (66) et est déconseillé pour les analyses de
biologie moléculaire. L’utilisation comme anticoagulant de EDTA permet une meilleure conservation
de l’ADN, la quantification de gène de β-globuline reste stable dans les heures qui séparent le
prélèvement et la centrifugation. La contamination par les globules blancs est moindre (figure 21) (73).
Figure 21 : différence de concentrations d'ADN entre différents anticoagulants (73)
En abscisse, heures après le prélèvement
EDTA en rond plein, héparinate de lithium en triangle, citrate en rond clair.
La séparation entre le culot globulaire et le plasma doit être le plus tôt possible, dès la deuxième heure
il y a une augmentation de l’ADN circulant (74). La conservation de l’échantillon avant centrifugation
est préférable à +4°C mais n’est pas démontré. La centrifugation doit être faite dans les 4 heures. Après
centrifugation il est conseillé de garder le plasma à -20°C ou -80°C, de ne pas décongeler plus de deux
fois le plasma (72).
Il n’existe pas de corrélation avec l’âge, le statut tabagique ou le type histologique (75). Par contre la
concentration en ADN circulants ne permet de prédire la réponse au traitement (76). La concentration
en ADN circulant est plus élevée chez les patients en progression ou stables.
L’étude de patients atteints d’un cancer pulmonaire non à petites cellules a pu mettre en évidence que
la concentration en ADN circulants se trouve augmentée par rapport à une population contrôle (77).
Elles peuvent aller de 0 à plus de 1000 ng/mL avec une moyenne à 180 ng/mL chez des patients atteints
de cancers pulmonaire contre une moyenne à 30ng/mL chez des sujets contrôles.
Les fragments d’ADN circulant d’origine tumorale peuvent être utilisés et le pourcentage d’ADN
d’origine tumorale peut varier de 10 à 90% selon les échantillons (78). La concentration en ADN
circulant mutant ne représente qu’une petite partie de l’ADN circulant total moins de 0.01% (79).
La quantification de l’ADN circulant est déterminée par amplification du gène de cycline D1. Utilisé
comme marqueur diagnostic, un seuil à 20 ng/mL d’ADN circulants montre que la probabilité d’avoir
un cancer pulmonaire est de 71% quand le test est positif (77) avec une aire sous la courbe ROC de
0.88 (figure 22).
31
Figure 22 : courbe ROC de la concentration d'ADN circulant pour le pronostic du cancer à
20 ng/mL (77)
Il existe des différences de concentration en ADN tumoral au moment du diagnostic entre les différents
stades sur près de 14 types de cancers (figure 23) (80).
Figure 23 : Concentration d’ADN selon le stade du cancer (80)
Pour le suivi du cancer pulmonaire non à petite cellules aux stades III et IV, l’étude de Sirera et al. (81)
utilise la human telomerase reverse transcriptase hTERT dosé par PCR dans le plasma pour quantifier
l’ADN circulant et le comparer aux variations cliniques. Une concentration faible hTERT à t0 donne un
32
temps sans progression plus long par rapport à une concentration plus forte. La concentration ne
préjuge pas du nombre de métastases et ne peut être utilisé dans le suivi du cancer (figure 24).
Figure 24 : survie cumulée selon la concentration en ADN circulant avec un seuil à 49.9 ng/mL de
hTERT (81)
33
IV.
INTERET DE LA RECHERCHE D’ANOMALIE D’EGFR DANS L’ADN
CIRCULANT
1. Avantages par rapport aux biopsies
Aspects techniques et logistiques :
L’un des avantages le plus évident est la faisabilité du prélèvement sanguin, la « biopsie liquide »
comparé à la biopsie de tissu. Cette facilité peut permettre de procéder à un suivi tout au long du
traitement (75).
Lors de biopsie, la qualité du prélèvement ne permet pas d’avoir assez de tissu tumoral pour avoir des
résultats fiables. La concentration en cellules cancéreuses doit souvent dépasser les 10 %.
Enfin le délai d’acheminement du bloc d’inclusion vers le laboratoire de biologie moléculaire peut être
trop long par rapport à la prise en charge du patient. Devant une suspicion de masse tumorale, le
patient sera adressé à un anesthésiste puis à un radiologue ou à un pneumologue pour réaliser la
biopsie qui permettra le diagnostic histologique de cancer. L’anatomo-pathologiste recevra les
prélèvements et pourra mettre du temps à répondre à la question posée. Ensuite il adressa le
prélèvement au laboratoire de biologie moléculaire. Toutes ces différentes étapes entraînent un délai
qui pourra retarder la détection d’anomalies d’EGFR et donc la mise en place d’un traitement adapté.
On peut facilement imaginer qu’un prélèvement sanguin parviendra directement donc plus
rapidement au laboratoire de biologie moléculaire, et donc devrait pouvoir être analysé plus vite
qu’une biopsie.
Hétérogénéité tumorale :
Des variations entre les cellules tumorales peuvent se présenter entre le site de la tumeur et les
métastases. Différents clones peuvent métastasaient de façon indépendante (figure 25).
Figure 25 : Modèles expliquant la variation tumorales entre les métastases et la tumeur (82)
La tumeur peut aussi avoir un grand nombre de variations liée à la pression de sélection de
l’environnement (figure 26) (82).
34
Figure 26 : Evolution des lignées dans les différentes sous populations (83).
La biopsie d’un tissu tumoral et son analyse d’anomalie somatique en biologie moléculaire peut
présenter un défaut : le tissu tumoral est hétérogène.
Gerlinger et al. montre (83) que dans le cas d’un cancer du rein métastasiques, différentes biopsies
sont réalisées (figure 27) et l’analyse de ces différents fragments montre une anomalie communes la
délétion du gène suppresseur de tumeur von Hippel-Lindau (VHL) dans les 9 biopsies réalisées mais
que chaqu’une des biopsies possèdent d’autres anomalies acquises au cours du processus de
carcinogenèse.
Figure 27 : Biopsies réalisés sur la tumeur (84)
Les auteurs ont établi un lien entre les différentes anomalies et en ont fait un arbre phylogénétique.
L’anomalie VHL était la plus précoce puis d’autres anomalies surviennent sur différentes cellules et au
final il existe un grand nombre de sous populations tumorales (figure 28). En ne faisait qu’une seule
biopsie, près de 67 % des anomalies ne seraient pas retrouvées.
35
Figure 28 : Arbre phylogénétique des anomalies retrouvées dans les différentes populations
biopsiées (84)
2. Intérêt en cancérologie de la recherche d’anomalie dans l’ADN
circulant
Pour la détection du gène EGFR dans le sang circulant, l’étude réalisée à Nantes (84) montre que la
différence de Ct pour la mutation L858R ou la délétion de l’exon 19 est moindre avec l’utilisation du
plasma que du sérum. La diminution de sensibilité avec le sérum est due à la contamination par les
globules blancs. Le Ct du contrôle est donc moins élevé ce qui élève le delta entre le Ct contrôle et Ct
de la mutation (figure 29). Cette étude montre la faisabilité de rechercher les anomalies spécifiques
d’EGFR dans l’ADN circulant.
Figure 29 : Comparaison de la différence de Ct obtenu entre sérum et plasma (84)
36
3. Techniques utilisées pour la recherche d’anomalies d’EGFR
Des études ont cherché des anomalies de l’EGFR au niveau des ADN circulants. Diverses techniques
sont utilisées, celle utilisée au CHU de Nantes avec le kit Therascreen® qui utilise le principe de la PCR
spécifique d’allèle grâce à la technologie ARMS pour Scorpion Amplification Refractory Mutation
System. C’est aussi la plus fréquemment utilisé. Ces résultats ont donné une sensibilité et une
spécificité à 100 % (85). Les principales études qui ont utilisé cette technique sont celle de Douillard et
al. en 2014 (31), celle de Bai en 2012 (86), celle de Goto en 2012 de l’étude IPASS (87).
D’autres techniques sont utilisées comme la DHPLC (denaturing high performance liquide
chromatography) utilisé par Bai plus tôt en 2009, la PCR digitale par Yung en 2009 (88) et par Oxnard
en 2014 (89). Nakumara et al. (90) développe d’une nouvelle méthode d’analyse d’EGFR avec le QP
système (quenching probe system) pour détection L858R et des délétions de l’exon 19 dans le tissu et
le plasma. La technique se fait en 2 étapes : le WIP et le QP (figure 30). Le WIP (Wild inhibitor Nucleic
acid) séquence complémentaire de la délétion bloque l’amplification chez le type sauvage ; et le QP
fait une émission de fluorescence quand il est hybridé. La vérification du fonctionnement de la
méthode se fait avec plasmides. Il retrouve 44 % de correspondance avec l’ADN avec les délétions de
l’exon 19 par rapport aux biopsies.
Figure 30 : Technique WIP QP pour la recherche d’anomalie EGFR dans le plasma (91)
De grandes différences existent entre ces techniques. Une méta-analyse (91) s’est efforcée de
déterminer les sensibilités et les spécificités de la recherche d’anomalie d’EGFR dans le plasma par
rapport à la biopsie (tableau 5). La sensibilité est en moyenne pour tous types de techniques
confondues de 0.674 (0.517 - 0.800) et la spécificité de 0.935 (0.888 - 0.963) (tableau 5). La sensibilité
est importante, puisque le risque est de ne pas détecter de mutation dans l’ADN circulant alors que
l’altération est présente dans la tumeur. Mais la spécificité est probablement plus importante encore,
37
car retrouver une mutation si elle n’est pas présente dans la tumeur va conduire à la mise en place
d’un traitement ciblé dont le patient ne bénéficiera pas.
Tableau 5 : Résultats de la méta-analyse sur les techniques de l’EGFR circulant (92)
ARMS : Scorpion Amplification Refractory Mutation System
DHPLC : denaturing high performance liquide chromatography
HRM : high resolution melting
Sensibilité
Spécificité
ARMS
0.525 (0.357-0.688)
0.947
DHPLC
0.658 (0.369-0.849)
0.854 (0.783-0.904)
HRM
0.887 (0.402-0.989)
0.736 (0.042-0.994)
En 2014, dans l’essai de phase IV du gefitinib, Douillard et al. (31) montrent que chez 106 patients
avec mutations d’EGFR en première ligne, 69.9 % ont une réponse au gefitinib, la survie moyenne sans
progression est de 9.7 mois. La recherche d’EGFR dans l’ADN circulant montre une bonne
spécificité (99.8 %) (Tableau 6). C’est la plus grosse série actuellement rapportée à ce jour sur l’EGFR
circulant dans un essai clinique.
Tableau 6 : Sensibilité et spécificité de la recherche d’EGFR dans le plasma par rapport à la
biopsie (31)
38
4. Intérêt pronostique
Nygaard et al. (92) trouvent pour KRAS muté un marqueur de mauvais pronostic dans le cancer du
poumon dans le plasma avec une réduction de l’espérance de vie avec 4.5 mois pour les patients chez
qui on retrouve la mutation dans le plasma par rapport à ceux KRAS sauvages avec 9.5 mois.
Rosell et al. en 2012 (93) dans un essai de phase III de l’erlotinib versus une chimiothérapie standard
dans deux groupes randomisés dans une population européenne. Il cherche les anomalies de l’EGFR
dans le tissu biopsié et dans le sérum. Les anomalies d’EGFR apportent une survie plus importante
quand ils sont retrouvés dans sérum du groupe erlotinib avec 10.7 mois par rapport au groupe
chimiothérapie 4.2 mois. Le hazard ratio est de 0.25 en faveur de l’erlotinib. Goto dans l’étude IPASS
(87) retrouve un hazard ratio à 0.29.
5. Intérêt dans le suivi du traitement
Diaz et al. (94) cherchent dans le suivi du cancer colo-rectal l’intérêt des ADN circulants. Ce modèle
permet de voir la pression exercée par le traitement par anticorps monoclonal anti EGFR fait
disparaître la concentration en mutations du gène APC présent dans la tumeur au moment du
diagnostic. Puis un échappement du traitement et dans la biopsie liquidienne le gène KRAS se trouve
muté et une amplification de MET est détecté alors qu’ils étaient sauvage sur la biopsie tissulaire
(figure 31). La recherche en continu des mutants dans le sang peut prévenir des échappements au
traitement.
Figure 31 : Détection du gène APC muté et du gène KRAS dans le suivi du traitement du cancer
colo-rectal (94)
La diminution tumorale est corrélée à la disparition de la mutation APC dans le sang. Une
augmentation et la présence de KRAS muté intervient après progression tumorale
Punnoose et al. (95) présente une série de 41 patients chez qui ils ont évaluaient le suivi de patients
traités et ont mis en évidence une diminution de la masse tumorale évaluée par PET TDM et la
décroissance des cellules tumorales circulantes.
L’équipe de Nantes cherche à monitorer EGFR dans l’ADN circulant au cours d’un traitement par
inhibiteur de tyrosine kinase dans un case report en 2014 (96). Dans le premier cas, on voit la
39
disparition de la délétion dans l’exon 19 dans l’ADN circulant en même temps que la régression de la
maladie au scanner. La progression de la maladie correspond à la réapparition de la délétion 19 dans
le sang. Dans le deuxième cas, on voit une disparition de la mutation L858R avec régression tumorale
puis dans deuxième temps l’apparition de la mutation de résistance T790M est concomitante dans un
échappement thérapeutique (figure 32).
Figure 32 : Suivi des anomalies EGFR dans le plasma.
Nous allons présenter dans la deuxième partie du travail réalisé sur le statut d’EGFR dans l’ADN
circulant, un nombre plus important de patients atteints d’un cancer pulmonaire non à petites cellules.
40
Deuxième partie : travail réalisé
I.
MATERIELS ET METHODES
1. Déroulement de l’étude
Les patients inclus dans l’étude ont eu leurs prélèvements entre la période d’aout 2012 à fin juillet
2014. Deux centres ont participés à l’étude, le service d’oncologie médicale du centre hospitalouniversitaire de Nantes et le service de pneumologie du centre hospitalier de la Roche sur Yon.
2. Critères d’inclusions
Les patients étaient atteints d’un cancer pulmonaire non à petites présentant une altération d’EGFR
(délétion exon 19 ou mutation L858R) dans leur tumeur.
Avant tout traitement, un prélèvement sanguin devait avoir été réalisé pour rechercher les anomalies
d’EGFR. Le patient devait être ensuite traité en première intention par inhibiteur sélectif de la tyrosine
kinase d’EGFR.
3. Critères d’exclusions
Les raisons d’exclusion de l’étude de certains patients ont été le nombre insuffisant, inférieur à 2, de
prélèvement sanguins pour la recherche de mutations activatrices d’EGFR dans le suivi du
traitement.
Un traitement par chimiothérapie en première intention excluait le patient.
Une recherche négative dans le plasma à T0 alors que la recherche de mutations était positive dans
le tissu biopsié excluait le patient.
4. Recherche de mutations activatrice de l’EGFR : dans le tissu
cancéreux
Les patients inclus dans l’étude ont reçu pour le diagnostic de cancer pulmonaire une biopsie avec
examen histologique. Les prélèvements ont été reçus et analysés au laboratoire d’anatomo-pathologie
qui a affirmé l’origine cancéreuse du prélèvement et qui a recherché l’expression de TTF-1 en
immunohistochimie. Les sections ont été coupées dans un bloc de paraffine. Les régions riches en
cellules tumorales ont été marquées par l’anatomo-pathologiste par une coloration d’hématoxyline et
d’éosine de 3 µm d’épaisseur. Le laboratoire d’anatomo-pathologie a ensuite transmis des lames au
laboratoire de biochimie du CHU de Nantes.
41
La paraffine a été éliminée par immersion des lames dans le toluène (5 minutes), puis de l’éthanol
(3 minutes puis 2 minutes).
A l’aide d’un scalpel, la partie la plus riche en cellules tumorales est macrodisséquée et déposée dans
une solution contenant de la protéinase K. La lyse dure pendant 12 heures à 56°C.
L’extraction de l’ADN (figure 33) est réalisé à l’aide du kit iPrep® ChargeSwitch Forensic (Invitrogen)
sur l’automate iPrep. Le kit utilise des billes magnétiques chargées positivement pour fixer l’ADN qui
dans un premier temps sera chargé négativement à pH acide. L’élution se fera à pH basique.
4-Séparation des
billes et du liquide
1-Lyse de l’échantillon
Aimant
2-L’ADN se fixe aux
billes magnétiques à
pH<6.0
3-Séparation
magnétique des billes
dans le cône
5-Les billes
magnétiques sont
lavées (pH=7)
6-L’ADN purifié est
élué à pH>8.5
Aimant
Figure 33 : Etapes de l’extraction de l’ADN sur le kit iPrep
La concentration en ADN est ensuite quantifiée par spectrophotométrie (Nanodrop®) et normalisée à
5 ng/µL avec de l’eau pure. L’extrait d’ADN est conservé à +4°C en attendant l’amplification.
Les recherches ont porté sur les principales mutations activatrices de l’EGFR : la mutation L858R et les
délétions de l’exon 19 et la mutation de résistance T790M.
La recherche de la mutation L858R est réalisée par PCR par recherche spécifique d’allèle. Deux amorces
nucléotidiques sont utilisées avec des variations en extrémité 3’ qui rend spécifique chaque allèle :
l’allèle sauvage 858L avec le primer TCAAGATCACAGATTTGGGCT et l’allèle mutant 858R
TCAAGATATCACAGATTTGGGCG et un primer commun 21 AS CATCCTCCCCTGCATGTGTTAAAC. On
utilise un contrôle négatif avec de l’ADN génomique et un contrôle positif muté L858R. La préparation
du mix PCR se fait salle blanche. En pièce pré-PCR on mélange les réactifs. L’amplification est réalisée
dans un thermocycleur par RotorGene RQG (Qiagen), avec le mix LC480 SYBR-Green (Roche). Le mix
contient 10µL de master mix fourni, 0.5µL de chaque primer et 9µL de l’échantillon. Les conditions du
RotorGene étaient pendant 10 minutes à 95°C, puis 45 cycles d’amplification avec une dénaturation
pendant 10 secondes à 95°C, une hybridation à 65°C pendant 15 secondes et une amplification à 72°C
pendant 20 secondes. Le cycle seuil ou cycle threshold (Ct) était établi pour une intensitéde
fluorescence de 0.05 unités. La valeur du Ct était déterminée pour le contrôle sauvage 858L et pour le
mutant 858R et la différence de Ct (ΔCt) était calculée. Le seuil de Ct pour la recherche positive de la
mutation L858R dans le tissu devait être inférieur à 5 (figure 34).
42
Figure 34 : Exemple de PCR spécifique d’allèle pour la recherche de L858R
Le Ct de la PCR 858L est à 23.18, le Ct de la PCR mutée 21R est à 25.13. Le delta Ct est donc 1.95 soit
inférieur à 5. Le tissu présente donc des cellules tumorales avec une mutation L858R
La recherche de délétions de l’exon 19 se faisait par l’analyse de la taille des fragments. Pour la PCR,
les amorces nucléotidiques utilisées étaient le 19S GTCTTCCTTCTCTCTCTGTCATAG et le
19AS CCACACAGCAAAGCAGAAACTCAC. Après amplification, les amplicons ont été analysés sur gel de
polyacrylamide. La migration avait lieu pendant 1h à 100V. Le fragment sauvage d’EGFR contenait
147 paires de bases. Les délétions de l’exon 19 se traduisaient par des fragments de plus petite taille,
migrant plus vite, ainsi que des hétéroduplexes, migrant moins loin (figure 35).
Hétéroduplexes
ADN sauvage/ADN
délété
ADN sauvage non
délété
ADN
délété
Figure 35 : Gel des fragments amplifiés pour la recherche de délétion de l’exon 19
43
5. Recherche de mutations activatrice de l’EGFR : dans le plasma
La recherche de mutation de l’EGFR dans le sang, la biopsie liquide, était à demander sur un bon de
demande spécifique dans le cadre de notre étude. Seule l’anomalie retrouvée sur la biopsie était
recherchée dans le plasma, ainsi que la mutation T790M.
Pour le pré-analytique, le sang devait être récupérer sur EDTA prélevé pendant la consultation, puis
adressé au laboratoire pour être centrifugé dans les 4 heures suivant le prélèvement à 2.000 g,
pendant 10 minutes.
Le plasma était ensuite congelé dans notre laboratoire à -20°C et conservé à -20°C pour être extrait en
série.
L’extraction se faisait sur l’automate iPrep® avec le kit iPrep Purelink virus®. A partir de 400µL de
plasma, 20µL ou 40µL d’ADN sont élués.
Le kit Therascreen® EGFR RGQ PCR certifié CE® utilise le principe de la PCR spécifique d’allèle. Il détecte
les 29 mutations les plus fréquentes dont 19 délétions de l’exon 19 et la mutation L858R répartis en
plusieurs mélanges réactionnels. La mutation de résistance T790M est aussi recherchée.
Figure 36 : Anomalies recherchées par le kit Therascreen
Deux technologies sont utilisées dans le kit Therascreen®. La première ARMS, système de mutation
réfractaire par amplification, qui possède une Taq ADN polymérase capable de distinguer un
appariement parfait d’un mésappariement en 3’ des amorces de PCR. En cas d’appariement en 3’,
l’amplification se fait même si la séquence est minoritaire dans l’échantillon. En cas de
mésappariement, une faible amplification se fera en bruit de fond. La seconde technologie est
l’utilisation des Scorpions qui sont constitués d’une amorce de PCR liée à une sonde qui contient un
fluorophore et un quencher. En cas de liaison entre la sonde et l’amplicon, le fluorophore séparé du
quencher émettra une fluorescence plus importante.
44
Le kit contient aussi un témoin positif, un témoin négatif, un mélange réactionnel test contrôle marqué
FAM qui amplifie une région de l’exon 2 non connue pour avoir des mutations. Les autres tests
contiennent des sondes Scorpions distinguant ADN sauvage et ADN muté avec un témoin interne
marqué HEX. Le témoin interne sert à détecter des inhibiteurs de PCR et doit être positif pour valider
la technique.
Les seuils de détections des deltas de Ct sont à 12 pour L858R et les délétions de l’exon 19. Pour la
mutation T790M le seuil de détection est un delta de Ct à 8.
Les patients lors de leur entrée dans le protocole d’étude ont signé un consentement faisant état de
leur accord pour entreprendre des recherches de mutations somatiques dans leur sang.
6. Méthodologie
Les données cliniques et radiologiques ont été recueillies auprès des cliniciens dans leur dossier clinicobiologique. Les informations cliniques sur l’âge, le sexe, le statut tabagique ont été recueillis.
Les informations de l’anatomo-pathologie avec le type histologique de tumeur et la présence de TTF- 1
réalisé en immuno-histochimie dans les laboratoires d’anatomo-pathologie ont été recueillies.
Les informations scannographiques dans le suivi du patient ont été intégrées et à l’aide des cliniciens
et des radiologues, et le score RECIST a pu être établi.
Le type de traitement et la durée a été aussi intégrée.
Lors de la première évaluation, les patients ont eu une deuxième recherche d’anomalie d’EGFR dans
le sang ainsi qu’un scanner qui a précédé leur première visite de contrôle.
Tous ces éléments ont été synthétisés pour chaque patient sous forme d’une frise chronologique
pour voir l’évolution du patient sous traitement.
Une évaluation au premier temps après le début de traitement puis tout le long du suivi a été faite
pour voir l’intérêt du test du statut mutationnel sur l’évolution tumorale sur les critères RECIST.
Un test de Fisher a été réalisé pour comparer à la première évaluation les résultats obtenus pour la
recherche d’anomalie d’EGFR et le statut au scanner.
45
II.
RESULTATS
1. Caractéristiques des patients
Dans le cadre de l’étude, 12 patients ont été suivis. Les caractéristiques de ces patients sont notées
dans le tableau 7
Tableau 7 : Caractéristiques des 12 patients étudiés
Age
Sexe
Fumeur
Hôpital
Histologi
e
TNM
Stade
Métastas
es
Traiteme
nt
Anomalie
Age
Sexe
Fumeur
Hôpital
Histologi
e
TNM
Stade
Métastas
es
Traiteme
nt
Anomalie
Patient 1
Patient 2
Patient 3
Patient 4
Patient 5
Patient 6
82
F
NON
LRY
adénocarcino
me TTF1+
63
F
NON
LRY
adénocarcino
me TTF1+
55
F
NON
LRY
adénocarcino
me TTF1+
74
M
NON
LRY
adénocarcino
me TTF1+
59
M
Fumeur
LRY
adénocarcino
me TTF1+
74
F
NON
LRY
adénocarcino
me TTF1+
T1N2M1
Stade IV
Os
T4NxM1
Stade IV
Os
T4N2M1
Stade IV
Poumon, Foie
T2N3M1
Stade IV
Plèvre
T2N2M1
Stade IV
Cerveau
T4N3M1
Stade IV
Cerveau,
Surrénale,
Plèvre
Iressa
Tarceva
Tarceva
Tarceva
Iressa
Iressa
L858R
Del19
L858R
L858R
Del19
Del19
Patient 7
Patient 8
Patient 9
Patient 10
Patient 11
Patient 12
74
M
NON
LRY
adénocarcino
me TTF1+
64
M
NON
Nantes
adénocarcino
me TTF1+
79
F
NON
Nantes
Adénocarcino
me TTF1+
76
F
NON
Nantes
adénocarcino
me TTF1+
46
F
NON
Nantes
adénocarcino
me TTF1+
66
F
Fumeur
LRY
adénocarcino
me TTF1+
T3N2M1
Stade IV
Poumon,
Surrénale
T2N1M1
Stade IV
Pleurésie
Vessie
T4N2M1
Stade IV
Pleurésie,
surrénales
cérébrales
T1N1M1
Stade IV
Plèvre
T2N2M1
Stade IV
Cerveau
Iressa
Tarceva
Iressa
Iressa
Tarceva
Iressa
Del19
Del19
Del19
Del19
L858R
Del19
T2N3M1
Stade IV
Foie, Os
La moyenne d’âge était de 67,7 ans, 8 patients était de sexe féminin, 4 masculins. Sur les 12 patients
seuls deux avaient été fumeurs. Huit patients ont été suivis au Centre Hospitalier de la Roche sur Yon,
quatre au Centre Hospitalo-Universitaire de Nantes.
L’analyse histologique avait rapporté pour tous les patients un adénocarcinome TTF-1 positif. Au
moment du diagnostic les patients étaient au stade métastasique avec un stade IV.
46
Pour 8 patients, la mutation initiale retrouvée dans la biopsie était la délétion de l’exon 19, pour 4
patients la mutation L858R. Les patients pour 7 d’entre eux ont été traités par Iressa, 5 par Tarceva en
1ère intention (figure 37).
9
8
8
8
Nombre de patients
8
7
7
6
5
5
4
4
4
4
3
2
2
1
0
LRY
Nantes Hommes Femmes Fumeur
gefitinib erlotinib
Iressa Tarceva
L858R
Dél 19
Catégories des patients
Figure 37 : Répartition des patients selon leurs caractéristiques
Pour la première évaluation après l’instauration du traitement, le scanner pour 7 patients montre une
réponse partielle avec plus de 30% de réduction de la masse tumorale selon les critères RECIST. Trois
patients avaient une réponse stable, deux avec une progression de la maladie avec augmentation de
20% de la masse tumorale ou de 5mm en valeur absolue.
2. Altérations du gène EGFR dans l’ADN plasmatique et réponse
initiale au traitement
Le premier objectif était de déterminer s’il existait un lien entre la réponse clinique et le résultat du
premier test moléculaire réalisé.
Pour neuf patients, la première évaluation moléculaire a été faite à 1 mois après le début du
traitement (tableau 8)
47
Tableau 8: Patients dont l’ADN plasmatique a été testé après 1 mois de traitement
Patient n°
1
Anomalie EGFR
Négatif
2
Négatif
4
Positif
5
6
Négatif
Positif
Négatif
8
Négatif
9
Négatif
11
Négatif
12
Evolution
TDM
Progression
Réponse
partielle
Réponse
stable
Réponse
stable
Progression
Réponse
partielle
Réponse
stable
Réponse
partielle
Réponse
partielle
Deux patients ont eu leur premier prélèvement sanguin 2 mois après le début du traitement (tableau 9)
Tableau 9 : Patients dont l’ADN plasmatique a été testé après 2 mois de traitement
Patient n°
Anomalie EGFR
3
7
Positif
Négatif
Evolution
TDM
RS
RP
Enfin, un patient a eu sa première évaluation plus tardivement, 4 mois après le début du
traitement (tableau 10)
Tableau 10 : Patient dont l’ADN plasmatique a été testé après 4 mois de traitement
Patient n°
Anomalie EGFR
10
Positif
Evolution
TDM
RP
La recherche d’anomalie d’EGFR au cours de la première évaluation (soit lors leur du deuxième
prélèvement sanguin) a été positive chez 4 patients (4/12 ; 33.3 %). Parmi les 6 patients répondeurs,
1 seul présentait une mutation dans le plasma (1/6 ; 16.7 %), alors que dans le groupe des malades
stables ou progresseurs, la mutation activatrice d’EGFR était retrouvée chez 3 patients
(3/6; 50 %) (Tableau 11).
Il n’existe pas de différence significative entre les groupes répondeurs et le groupe stable ou
progresseur (p= 0.54) par rapport au statut mutationnel d’après le test exact de Fisher.
48
Tableau 11 : recherche d’anomalie dans le plasma à la première évaluation selon la progression de la
maladie
1ere
évaluation
TDM RP
TDM RS ou
PP
PCR
Négative
PCR
Positive
5
1
3
3
3. Apparition de la mutation de résistance T790M
Sur les 12 patients, 4 patients ont présenté la mutation de résistance T790M dans le plasma. Le patient
1 au bout de 16 mois de traitement par gefitinib, le patient 2 au bout de 14 mois de traitement par
erlotinib puis 4 mois de chimiothérapie, le patient 5 après 13 mois de traitement par gefitinib et enfin
le patient 6 avant le traitement par gefitinib.
Le patient 2 qui avait la mutation T790M à 18 mois et était traité par chimiothérapie a eu une
disparition de la mutation lors du prélèvement à 24mois.
4. Suivi longitudinal des patients pendant le traitement
Les 12 patients ont fait l’objet de recherches d’altérations dans l’ADN circulant pendant leur
traitement. Ces histoires étant toutes différentes, chaque patient est présenté indépendamment des
autres.
Le patient 5 présentait une délétion dans l’exon 19. Il fût traité par gefitinib. A M3, la délétion disparaît
et la réponse reste stable (diminution de 22%). La réponse à M6 était partielle, la délétion n’était
toujours pas détectée. A M13 apparaissait la délétion ainsi que la mutation T790M. Le patient était en
progression de la maladie. La mutation n’était pas retrouvée un mois plus tard. Le gefitinib fût arrêté
pour une corticothérapie. La masse tumorale diminue rapidement. Le patient décédera d’une
pneumopathie infectieuse.
Figure 38 : évolution du patient 5
49
Figure 39 : évolution du patient 8
Le patient 8 présentait une délétion dans l’exon 19. Il fût traité par erlotinib. A M3 la délétion était
encore présente. A M4 la délétion disparaît et la maladie est en réponse partielle. La maladie reste
stable à M7 et la délétion n’est plus détectée.
Figure 40 : évolution du patient 1
Le patient avait une mutation L858R dans la biopsie et dans le plasma à M5 qui disparait à M6 soit 1
mois après l’instauration du traitement par gefitinib. Le gefitinib est arrêté 1 mois devant une embolie
pulmonaire. Le score RECIST restait stable et à M16 la mutation L858R était présente à nouveau avec
l’apparition d’une deuxième mutation, la T790M mutation de résistance. Le traitement par gefitinib
était arrêté pour des soins de conforts et le patient décédera à M20.
50
Figure 41 : évolution du patient 2
Le patient 2 présentait une délétion dans l’exon 19 qui est retrouvé dans le plasma à T0. Il fût traité
par erlotinib et la délétion disparaît dans le plasma à M4 avec une réponse partielle au traitement
d’après les critères RECIST. La délétion réapparaît à M12 avec un score RECIST stable. Le traitement
par erlotinib est stoppé à M14 et remplaçait par radiothérapie et chimiothérapie par Gemzar. Une
deuxième réponse partielle a lieu entre M14 et M17. La délétion restait présente à M18 avec
l’apparition de la mutation de résistance T790M. La progression tumorale a lieu entre M19 et M24. La
délétion restait présente à M24, la T790M disparaissait sur ce même prélèvement.
Figure 42 : évolution du patient 3
Le patient 3 est présentait une mutation L858R et fût traité par erlotinib. La mutation restait présente
entre M2 et M6 avec une stabilité de la tumeur (diminution de 24% entre M1 et M4). Le traitement
par erlotinib est arrêté à M8 pour des soins de conforts et le patient décède à M10.
51
Figure 43 : évolution du patient 4
Le patient 4 présentait une mutation L858R et fût traité par erlotinib. La mutation persistait à M4 sur
2 autres prélèvements. Entre M3 et M4 la maladie restait stable (diminution de 25%). Le traitement
par erlotinib fût arrêté à M4 pour des soins de conforts et le patient décédera à M5.
Figure 44: évolution du patient 6
Le patient 6 présentait une délétion dans l’exon 19. Il fût traité par gefitinib. La mutation de résistance
absente dans la biopsie était retrouvée à M1 dans le plasma. La délétion ne disparaît pas et la masse
tumorale est stable. Le gefitinib est arrêté pour la chimiothérapie. Le patient décèdera à M7
52
Figure 45 : évolution du patient 7
Le patient 7 présentait une délétion dans l’exon 19. Il fût traité par gefitinib. La délétion disparaît et la
maladie est en réponse partielle à M4. A M6 la réponse reste stable, la délétion n’est toujours pas
détectable. Le traitement est changé pour une chimiothérapie. Le patient décédera à M9.
Figure 46 : évolution du patient 9
Le patient 9 présentait une délétion dans l’exon 19. Il fût traité par gefitinib. A M3 la délétion disparaît
et la masse tumorale reste stable. A M8 la délétion réapparaît et avec une masse tumorale stable. A
M9 elle disparaît. A M16, la maladie progresse et la délétion réapparaît. A M20 la délétion disparaît
mais la maladie continue à progresser.
53
Figure 47 : évolution du patient 10
Le patient 9 présentait une délétion dans l’exon 19. Il fût traité par gefitinib. La délétion reste présente
à M6 et la maladie est en réponse partielle. La maladie reste stable à M9 puis progresse à M13 sans
qu’on ait de prélèvement. A M14 le patient décèdera.
Figure 48 : évolution du patient 11
Le patient 11 présentait une mutation L858R. Il fût traité par erlotinib. La mutation disparaît à M3 et
la maladie évaluée à M5 montre une réponse partielle.
54
Figure 49 : évolution du patient 12
Le patient présentait une délétion dans l’exon 19. Il fût traité par gefitinib A M3 et M6 la délétion n’est
pas retrouvée et l’évaluation de la maladie montre une réponse partielle. La maladie reste stable
ensuite, le gefitinib est arrêté à M11 pour des soins de confort et le patient décèdera à M13.
55
III.
DISCUSSION
La découverte des anomalies d’EGFR et des inhibiteurs de tyrosine kinase ont modifié la prise en charge
thérapeutique du cancer pulmonaire non à petites cellules. Le traitement du cancer s’est personnalisé
et les plateformes de biologie moléculaire sont indispensables pour cette prise en charge (97).
L’ADN circulant utilisé à titre qualitatif comme marqueur de suivi du traitement est encore peu utilisé.
Peu d’études ont commencé à évaluer ce nouveau marqueur et celles qui l’ont fait utilisent des
techniques différentes avec des sensibilités variées (75) . Le kit Therascreen® est souvent utilisé car il
est facile d’accès en routine et présente une très bonne sensibilité dans le tissu biopsié (85) et dans le
plasma. La méta-analyse du Luo et al. montre aussi ces différentes techniques avec des seuils de
sensibilités différentes (91). Des efforts pour dans un premier temps d’homogénéiser le préanalytique (72) permettent de pouvoir comparer ces différents résultats.
Notre étude s’est portée sur un petit échantillon de patients. La difficulté d’avoir un plus grand nombre
de patients est lié au protocole d’avoir un échantillon sanguin au moment du diagnostic. Seuls deux
centres ont suivi ce protocole, le CH de la Roche sur Yon et le CHU de Nantes. Une autre difficulté était
d’avoir des prélèvements sanguins à des temps différents d’un patient à un autre. Aucun protocole
n’était établie et la consultation se faisait selon l’état du patient, ce qui peut être un biais. Notre groupe
est donc assez hétérogène.
Chez certains patients il existe une corrélation entre le statut mutationnel et l’évolution de la maladie.
Les patients 2, 5, 7, 8, 11 et 12 ont une disparition de l’anomalie d’EGFR dans le plasma associée à une
réponse partielle objectivée sur la masse tumorale.
Pour les patients 3, 4, 6 l’anomalie EGFR reste présente dans le plasma et la masse tumorale reste
stable. Pour les patients 8 et 12 dans un deuxième temps, la tumeur est stable ou en progression et
l’anomalie EGFR réapparaît dans le plasma. La détection précoce de l’anomalie dans le plasma pourrait
nous anticiper un échec du traitement.
Par contre chez les 3 derniers patients, les patients 1, 9 et 10 la corrélation entre le statut EGFR et la
réponse au traitement est moins évidente. Le patient 1 a la mutation L858R qui disparaît dans le
plasma alors que la réponse au traitement est stable. Il manque peut être un point entre la disparition
de la mutation et la réapparition dans le plasma. Le patient 9 a la délétion de l’exon 19 qui disparaît
puis réapparaît dans le plasma sans lien évident avec l’évolution de la masse tumorale. Le patient 10 a
dans un premier une réponse partielle au traitement mais la délétion de l’exon 19 reste présente. Un
point supplémentaire nous aurait peut être donné plus d’informations entre le nadir de la masse
tumorale et la progression qui a précédé son décès.
Ces exemples soulignent la difficulté à obtenir des résultats objectifs pour conclure au statut d’EGFR
dans le plasma dans le suivi du cancer pulmonaire non à petites cellules traités par inhibiteur de
tyrosine kinase. Des cohortes plus importantes sont à mettre en place avec des protocoles bien établis.
La mutation de résistance au traitement par inhibiteur de tyrosine kinase a été détecté chez les
patients 1, 5 et 6 pendant le traitement par inhbiteur de tyrosine kinase et qui ont eu leur traitement
rapidement arrêté devant l’inefficacité de ce dernier. Le patient 5 qui était déjà sous chimiothérapie
au moment de l’apparition de la mutation T790M n’a plus été traité par inhibiteur de tyrosine kinase.
La détection dans le plasma de la mutation T790M permettrait d’arrêter le traitement et de le changer
pour une chimiothérapie. Les inhibiteurs de 3ème génération pourraient être utilisés et avec la meilleure
affinité qu’ils ont en présence de T790M, l’efficacité anti-tumorale serait plus importante (59).
56
Cependant l’échappement aux inhibiteurs de tyrosine kinase n’est pas toujours expliqué par
l’apparition de la mutation T790M comme c’est le cas pour les patients 3, 4, 6 et 9. D’autres anomalies
sur d’autres gènes peuvent expliquer l’échappement du traitement (57). Ces anomalies ne sont pas
encore étudiées sur l’ADN circulant en routine et les développer pour prévenir les rechutes.
Les biopsies liquides représentent des avantages par rapport à la biopsie tissulaire car elles sont faciles
à réaliser, elles sont faciles à répéter et le résultat est rendu rapidement. Elles s’abrogent de
l’hétérogéneiété des biopsies tumorales.
Cette étude nous apporte des tendances sur le rôle que pourrait avoir le statut d’EGFR. Marqueur de
suivi d’un traitement par inhibiteur de tyrosine kinase, il pourrait nous renseigner précocement sur
l’évolution tumorale. La détection précoce dans le plasma de la mutation T790M peut inciter le
clinicien à arrêter plus rapidement le traitement par inhibiteur de tyrosine kinase. Des études avec des
effectifs plus importants, un protocole plus structuré et plus homogène et sur une période plus longue
pourraient répondre à ces tendances.
57
Bibliographie
1.
INCa. Mutations de l’EGFR dans le cancer du poumon : mise en évidence d’une cible moléculaire
permettant un accès spécifique aux thérapies ciblées - Publications - Institut National Du Cancer
[Internet]. 2010 [cité 1 sept 2014]. Disponible sur: http://www.e-cancer.fr/publications/71soins/554-mutations-de-legfr-dans-le-cancer-du-poumon-mise-en-evidence-dune-ciblemoleculaire-permettant-un-acces-specifique-aux-therapies-ciblees
2.
Lantuéjoul S, Salameire D, Brambilla E. Classification histologique des cancers bronchopulmonaires non à petites cellules. Rev Mal Respir Actual. sept 2011;3(4):295‑301.
3.
Travis WD, Travis LB, Devesa SS. Lung cancer. Cancer. 1 janv 1995;75(1 Suppl):191‑202.
4.
Travis WD, Brambilla E, Noguchi M, Nicholson AG, Geisinger KR, Yatabe Y, et al. International
association for the study of lung cancer/american thoracic society/european respiratory society
international multidisciplinary classification of lung adenocarcinoma. J Thorac Oncol Off Publ Int
Assoc Study Lung Cancer. févr 2011;6(2):244‑85.
5.
Wirth N, Bohadana A, Spinosa A, Martinet Y. Les pathologies respiratoires liées au tabagisme
passif. Rev Mal Respir. juin 2009;26(6):667‑78.
6.
Quoix E, Lemarié E. Épidémiologie du cancer bronchique primitif : aspects classiques et
nouveautés. Rev Mal Respir. oct 2011;28(8):1048‑58.
7.
Han B, Gfroerer JC, Colliver JD. Associations between duration of illicit drug use and health
conditions: results from the 2005-2007 national surveys on drug use and health. Ann Epidemiol.
avr 2010;20(4):289‑97.
8.
Goldstraw P, Crowley J, Chansky K, Giroux DJ, Groome PA, Rami-Porta R, et al. The IASLC Lung
Cancer Staging Project: proposals for the revision of the TNM stage groupings in the forthcoming
(seventh) edition of the TNM Classification of malignant tumours. J Thorac Oncol Off Publ Int
Assoc Study Lung Cancer. août 2007;2(8):706‑14.
9.
Eisenhauer EA, Therasse P, Bogaerts J, Schwartz LH, Sargent D, Ford R, et al. New response
evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer Oxf Engl
1990. janv 2009;45(2):228‑47.
10.
Yarden Y. The EGFR family and its ligands in human cancer. signalling mechanisms and
therapeutic opportunities. Eur J Cancer Oxf Engl 1990. sept 2001;37 Suppl 4:S3‑8.
11.
Peters S, Betticher DC. [The role of EGFR in non-small cell lung carcinoma]. Rev Médicale Suisse.
20 mai 2009;5(204):1096‑8, 1100‑1.
12.
Ciardiello F, Tortora G. EGFR Antagonists in Cancer Treatment. N Engl J Med. 13 mars
2008;358(11):1160‑74.
13.
Cancer Genome Atlas Research Network. Comprehensive molecular profiling of lung
adenocarcinoma. Nature. 31 juill 2014;511(7511):543‑50.
58
14.
Masui H, Kawamoto T, Sato JD, Wolf B, Sato G, Mendelsohn J. Growth inhibition of human tumor
cells in athymic mice by anti-epidermal growth factor receptor monoclonal antibodies. Cancer
Res. mars 1984;44(3):1002‑7.
15.
Sharma SV, Bell DW, Settleman J, Haber DA. Epidermal growth factor receptor mutations in lung
cancer. Nat Rev Cancer. mars 2007;7(3):169‑81.
16.
Salomon DS, Brandt R, Ciardiello F, Normanno N. Epidermal growth factor-related peptides and
their receptors in human malignancies. Crit Rev Oncol Hematol. 1 juill 1995;19(3):183‑232.
17.
Fukuoka M, Yano S, Giaccone G, Tamura T, Nakagawa K, Douillard J-Y, et al. Multi-Institutional
Randomized Phase II Trial of Gefitinib for Previously Treated Patients With Advanced Non–SmallCell Lung Cancer. J Clin Oncol. 15 juin 2003;21(12):2237‑46.
18.
Kris MG, Natale RB, Herbst RS, et al. Efficacy of gefitinib, an inhibitor of the epidermal growth
factor receptor tyrosine kinase, in symptomatic patients with non–small cell lung cancer: A
randomized trial. JAMA. 22 oct 2003;290(16):2149‑58.
19.
Shepherd FA, Rodrigues Pereira J, Ciuleanu T, Tan EH, Hirsh V, Thongprasert S, et al. Erlotinib in
Previously Treated Non–Small-Cell Lung Cancer. N Engl J Med. 14 juill 2005;353(2):123‑32.
20.
Paez JG, Jänne PA, Lee JC, Tracy S, Greulich H, Gabriel S, et al. EGFR mutations in lung cancer:
correlation with clinical response to gefitinib therapy. Science. 4 juin 2004;304(5676):1497‑500.
21.
Lynch TJ, Bell DW, Sordella R, Gurubhagavatula S, Okimoto RA, Brannigan BW, et al. Activating
Mutations in the Epidermal Growth Factor Receptor Underlying Responsiveness of Non–SmallCell Lung Cancer to Gefitinib. N Engl J Med. 20 mai 2004;350(21):2129‑39.
22.
Jackman DM, Miller VA, Cioffredi L-A, Yeap BY, Jänne PA, Riely GJ, et al. Impact of Epidermal
Growth Factor Receptor and KRAS Mutations on Clinical Outcomes in Previously Untreated Non–
Small Cell Lung Cancer Patients: Results of an Online Tumor Registry of Clinical Trials. Clin Cancer
Res. 15 août 2009;15(16):5267‑73.
23.
Morita S, Okamoto I, Kobayashi K, Yamazaki K, Asahina H, Inoue A, et al. Combined survival
analysis of prospective clinical trials of gefitinib for non-small cell lung cancer with EGFR
mutations. Clin Cancer Res Off J Am Assoc Cancer Res. 1 juill 2009;15(13):4493‑8.
24.
Paz-Ares L, Soulières D, Melezínek I, Moecks J, Keil L, Mok T, et al. Clinical outcomes in non-smallcell lung cancer patients with EGFR mutations: pooled analysis. J Cell Mol Med. janv 2010;14(12):51‑69.
25.
Rosell R, Moran T, Queralt C, Porta R, Cardenal F, Camps C, et al. Screening for epidermal growth
factor receptor mutations in lung cancer. N Engl J Med. 3 sept 2009;361(10):958‑67.
26.
Mok TS, Wu Y-L, Thongprasert S, Yang C-H, Chu D-T, Saijo N, et al. Gefitinib or carboplatinpaclitaxel in pulmonary adenocarcinoma. N Engl J Med. 3 sept 2009;361(10):947‑57.
27.
Mitsudomi T, Morita S, Yatabe Y, Negoro S, Okamoto I, Tsurutani J, et al. Gefitinib versus cisplatin
plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal
growth factor receptor (WJTOG3405): an open label, randomised phase 3 trial. Lancet Oncol. févr
2010;11(2):121‑8.
59
28.
Cappuzzo F, Ciuleanu T, Stelmakh L, Cicenas S, Szczésna A, Juhász E, et al. Erlotinib as
maintenance treatment in advanced non-small-cell lung cancer: a multicentre, randomised,
placebo-controlled phase 3 study. Lancet Oncol. juin 2010;11(6):521‑9.
29.
Chen X, Liu Y, Røe OD, Qian Y, Guo R, Zhu L, et al. Gefitinib or Erlotinib as Maintenance Therapy
in Patients with Advanced Stage Non-Small Cell Lung Cancer: A Systematic Review. PLoS ONE. 21
mars 2013;8(3):e59314.
30.
Douillard J-Y, Shepherd FA, Hirsh V, Mok T, Socinski MA, Gervais R, et al. Molecular Predictors of
Outcome With Gefitinib and Docetaxel in Previously Treated Non–Small-Cell Lung Cancer: Data
From the Randomized Phase III INTEREST Trial. J Clin Oncol. 2 oct 2010;28(5):744‑52.
31.
Douillard J-Y, Ostoros G, Cobo M, Ciuleanu T, McCormack R, Webster A, et al. First-line gefitinib
in Caucasian EGFR mutation-positive NSCLC patients: a phase-IV, open-label, single-arm study.
Br J Cancer. 7 janv 2014;110(1):55‑62.
32.
Ricciardi S, Tomao S, de Marinis F. Toxicity of targeted therapy in non-small-cell lung cancer
management. Clin Lung Cancer. janv 2009;10(1):28‑35.
33.
Agero ALC, Dusza SW, Benvenuto-Andrade C, Busam KJ, Myskowski P, Halpern AC. Dermatologic
side effects associated with the epidermal growth factor receptor inhibitors. J Am Acad Dermatol.
oct 2006;55(4):657‑70.
34.
Pérez-Soler R, Delord JP, Halpern A, Kelly K, Krueger J, Sureda BM, et al. HER1/EGFR inhibitorassociated rash: future directions for management and investigation outcomes from the
HER1/EGFR inhibitor rash management forum. The Oncologist. mai 2005;10(5):345‑56.
35.
Robert C, Soria J-C, Spatz A, Le Cesne A, Malka D, Pautier P, et al. Cutaneous side-effects of kinase
inhibitors and blocking antibodies. Lancet Oncol. juill 2005;6(7):491‑500.
36.
Castel M, Pathak A, Despas F, Mazières J. [Adverse effects of new biological therapies for nonsmall-cell bronchial cancer]. Presse Médicale Paris Fr 1983. avr 2011;40(4 Pt 1):415‑9.
37.
Wu Y-L, Zhou C, Hu C-P, Feng J, Lu S, Huang Y, et al. Afatinib versus cisplatin plus gemcitabine for
first-line treatment of Asian patients with advanced non-small-cell lung cancer harbouring EGFR
mutations (LUX-Lung 6): an open-label, randomised phase 3 trial. Lancet Oncol. févr
2014;15(2):213‑22.
38.
Prim N, Fore M, Mennecier B. L’afatinib (BIBW 2992). Rev Pneumol Clin [Internet]. [cité 21 sept
2014]; Disponible sur: http://www.sciencedirect.com/science/article/pii/S0761841714000479
39.
Li D, Ambrogio L, Shimamura T, Kubo S, Takahashi M, Chirieac L, et al. BIBW2992, an irreversible
EGFR/HER2 inhibitor highly effective in preclinical lung cancer models. Oncogene. 7 août
2008;27(34):4702‑11.
40.
Kwak EL, Sordella R, Bell DW, Godin-Heymann N, Okimoto RA, Brannigan BW, et al. Irreversible
inhibitors of the EGF receptor may circumvent acquired resistance to gefitinib. Proc Natl Acad Sci
U S A. 24 mai 2005;102(21):7665‑70.
41.
Yang JC-H, Hirsh V, Schuler M, Yamamoto N, O’Byrne KJ, Mok TSK, et al. Symptom control and
quality of life in LUX-Lung 3: a phase III study of afatinib or cisplatin/pemetrexed in patients with
advanced lung adenocarcinoma with EGFR mutations. J Clin Oncol Off J Am Soc Clin Oncol. 20
sept 2013;31(27):3342‑50.
60
42.
Popat S, Mok T, Yang JC-H, Wu Y-L, Lungershausen J, Stammberger U, et al. Afatinib in the
treatment of EGFR mutation-positive NSCLC--a network meta-analysis. Lung Cancer Amst Neth.
août 2014;85(2):230‑8.
43.
Denis M-G. [Searching for EGFR: current practices]. Rev Pneumol Clin. juin 2011;67 Suppl 1:S5‑8.
44.
Ellison G, Zhu G, Moulis A, Dearden S, Speake G, McCormack R. EGFR mutation testing in lung
cancer: a review of available methods and their use for analysis of tumour tissue and cytology
samples. J Clin Pathol. févr 2013;66(2):79‑89.
45.
Kobayashi S, Boggon TJ, Dayaram T, Jänne PA, Kocher O, Meyerson M, et al. EGFR Mutation and
Resistance of Non–Small-Cell Lung Cancer to Gefitinib. N Engl J Med. 24 févr 2005;352(8):786‑92.
46.
Toyooka S, Kiura K, Mitsudomi T. EGFR mutation and response of lung cancer to gefitinib. N Engl
J Med. 19 mai 2005;352(20):2136; author reply 2136.
47.
Pao W, Miller VA, Politi KA, Riely GJ, Somwar R, Zakowski MF, et al. Acquired Resistance of Lung
Adenocarcinomas to Gefitinib or Erlotinib Is Associated with a Second Mutation in the EGFR
Kinase Domain. PLoS Med. 22 févr 2005;2(3):e73.
48.
Ma C, Wei S, Song Y. T790M and acquired resistance of EGFR TKI: a literature review of clinical
reports. J Thorac Dis. mars 2011;3(1):10‑8.
49.
Costa DB, Nguyen K-SH, Cho BC, Sequist LV, Jackman DM, Riely GJ, et al. Effects of erlotinib in
EGFR mutated non-small cell lung cancers with resistance to gefitinib. Clin Cancer Res Off J Am
Assoc Cancer Res. 1 nov 2008;14(21):7060‑7.
50.
Kosaka T, Yatabe Y, Endoh H, Yoshida K, Hida T, Tsuboi M, et al. Analysis of epidermal growth
factor receptor gene mutation in patients with non-small cell lung cancer and acquired resistance
to gefitinib. Clin Cancer Res Off J Am Assoc Cancer Res. 1 oct 2006;12(19):5764‑9.
51.
Balak MN, Gong Y, Riely GJ, Somwar R, Li AR, Zakowski MF, et al. Novel D761Y and common
secondary T790M mutations in epidermal growth factor receptor-mutant lung adenocarcinomas
with acquired resistance to kinase inhibitors. Clin Cancer Res Off J Am Assoc Cancer Res. 1 nov
2006;12(21):6494‑501.
52.
Costa DB, Schumer ST, Tenen DG, Kobayashi S. Differential responses to erlotinib in epidermal
growth factor receptor (EGFR)-mutated lung cancers with acquired resistance to gefitinib
carrying the L747S or T790M secondary mutations. J Clin Oncol Off J Am Soc Clin Oncol. 1 mars
2008;26(7):1182‑4; author reply 1184‑6.
53.
Viswanathan A, Pillot G, Govindan R. Lack of response to erlotinib after progression on gefitinib
in patients with advanced non-small cell lung cancer. Lung Cancer Amst Neth. déc
2005;50(3):417‑8.
54.
Garfield D. Lack of response to erlotinib after progression on gefitinib in patients with advanced
non-small cell lung cancer. Lung Cancer Amst Neth. juin 2006;52(3):373.
55.
Turke AB, Zejnullahu K, Wu Y-L, Song Y, Dias-Santagata D, Lifshits E, et al. Preexistence and clonal
selection of MET amplification in EGFR mutant NSCLC. Cancer Cell. 19 janv 2010;17(1):77‑88.
61
56.
Jackman D, Pao W, Riely GJ, Engelman JA, Kris MG, Jänne PA, et al. Clinical definition of acquired
resistance to epidermal growth factor receptor tyrosine kinase inhibitors in non-small-cell lung
cancer. J Clin Oncol Off J Am Soc Clin Oncol. 10 janv 2010;28(2):357‑60.
57.
Cortot AB, Jänne PA. Molecular mechanisms of resistance in epidermal growth factor receptormutant lung adenocarcinomas. Eur Respir Rev Off J Eur Respir Soc. sept 2014;23(133):356‑66.
58.
Bean J, Brennan C, Shih J-Y, Riely G, Viale A, Wang L, et al. MET amplification occurs with or
without T790M mutations in EGFR mutant lung tumors with acquired resistance to gefitinib or
erlotinib. Proc Natl Acad Sci U S A. 26 déc 2007;104(52):20932‑7.
59.
Akkermans R. Third-generation EGFR-TKIs—a new hope for NSCLC. Lancet Respir Med. juill
2014;2(7):520.
60.
Cross DAE, Ashton SE, Ghiorghiu S, Eberlein C, Nebhan CA, Spitzler PJ, et al. AZD9291, an
Irreversible EGFR TKI, Overcomes T790M-Mediated Resistance to EGFR Inhibitors in Lung Cancer.
Cancer Discov. sept 2014;4(9):1046‑61.
61.
Rolfo C, Giovannetti E, Hong DS, Bivona T, Raez LE, Bronte G, et al. Novel therapeutic strategies
for patients with NSCLC that do not respond to treatment with EGFR inhibitors. Cancer Treat Rev.
sept 2014;40(8):990‑1004.
62.
Mandel P. MP. Les acides nucléiques du plasma sanguin chez l’homme. Compte Rendu de
l’Academie des Sciences 142:241–243; 1948.
63.
Esposito A, Bardelli A, Criscitiello C, Colombo N, Gelao L, Fumagalli L, et al. Monitoring tumorderived cell-free DNA in patients with solid tumors: clinical perspectives and research
opportunities. Cancer Treat Rev. juin 2014;40(5):648‑55.
64.
Schwarzenbach H, Hoon DSB, Pantel K. Cell-free nucleic acids as biomarkers in cancer patients.
Nat Rev Cancer. juin 2011;11(6):426‑37.
65.
Gormally E, Caboux E, Vineis P, Hainaut P. Circulating free DNA in plasma or serum as biomarker
of carcinogenesis: Practical aspects and biological significance. Mutat Res Mutat Res. mai
2007;635(2–3):105‑17.
66.
Thierry AR, Mouliere F, Gongora C, Ollier J, Robert B, Ychou M, et al. Origin and quantification of
circulating DNA in mice with human colorectal cancer xenografts. Nucleic Acids Res. 10 janv
2010;38(18):6159‑75.
67.
Sozzi G, Conte D, Mariani L, Lo Vullo S, Roz L, Lombardo C, et al. Analysis of circulating tumor DNA
in plasma at diagnosis and during follow-up of lung cancer patients. Cancer Res. 15 juin
2001;61(12):4675‑8.
68.
Yoon K-A, Park S, Lee SH, Kim JH, Lee JS. Comparison of Circulating Plasma DNA Levels between
Lung Cancer Patients and Healthy Controls. J Mol Diagn JMD. mai 2009;11(3):182‑5.
69.
Lee T-H, Montalvo L, Chrebtow V, Busch MP. Quantitation of genomic DNA in plasma and serum
samples: higher concentrations of genomic DNA found in serum than in plasma. Transfusion
(Paris). 1 févr 2001;41(2):276‑82.
62
70.
Umetani N, Hiramatsu S, Hoon DS b. Higher Amount of Free Circulating DNA in Serum than in
Plasma Is Not Mainly Caused by Contaminated Extraneous DNA during Separation. Ann N Y Acad
Sci. 1 sept 2006;1075(1):299‑307.
71.
Jung M, Klotzek S, Lewandowski M, Fleischhacker M, Jung K. Changes in Concentration of DNA in
Serum and Plasma during Storage of Blood Samples. Clin Chem. 6 janv 2003;49(6):1028‑9.
72.
El Messaoudi S, Rolet F, Mouliere F, Thierry AR. Circulating cell free DNA: Preanalytical
considerations. Clin Chim Acta Int J Clin Chem. 23 sept 2013;424:222‑30.
73.
Lam NYL, Rainer TH, Chiu RWK, Lo YMD. EDTA Is a Better Anticoagulant than Heparin or Citrate
for Delayed Blood Processing for Plasma DNA Analysis. Clin Chem. 1 janv 2004;50(1):256‑7.
74.
Xue X, Teare MD, Holen I, Zhu YM, Woll PJ. Optimizing the yield and utility of circulating cell-free
DNA from plasma and serum. Clin Chim Acta. 27 juin 2009;404(2):100‑4.
75.
Vallée A. Apports potentiels de l’ADN circulant pour la prise en charge des cancers bronchiques
non à petites cellules. Corresp En Onco-Théranostic. déc 2013;(3).
76.
Kumar S, Guleria R, Singh V, Bharti AC, Mohan A, Das BC. Efficacy of circulating plasma DNA as a
diagnostic tool for advanced non-small cell lung cancer and its predictive utility for survival and
response to chemotherapy. Lung Cancer. nov 2010;70(2):211‑7.
77.
Catarino R, Coelho A, Araújo A, Gomes M, Nogueira A, Lopes C, et al. Circulating DNA: diagnostic
tool and predictive marker for overall survival of NSCLC patients. PloS One. 2012;7(6):e38559.
78.
Jahr S, Hentze H, Englisch S, Hardt D, Fackelmayer FO, Hesch RD, et al. DNA fragments in the
blood plasma of cancer patients: quantitations and evidence for their origin from apoptotic and
necrotic cells. Cancer Res. 15 févr 2001;61(4):1659‑65.
79.
Diehl F, Li M, Dressman D, He Y, Shen D, Szabo S, et al. Detection and quantification of mutations
in the plasma of patients with colorectal tumors. Proc Natl Acad Sci U S A. 8 nov
2005;102(45):16368‑73.
80.
Bettegowda C, Sausen M, Leary RJ, Kinde I, Wang Y, Agrawal N, et al. Detection of circulating
tumor DNA in early- and late-stage human malignancies. Sci Transl Med. 19 févr
2014;6(224):224ra24.
81.
Sirera R, Bremnes RM, Cabrera A, Jantus-Lewintre E, Sanmartín E, Blasco A, et al. Circulating DNA
is a useful prognostic factor in patients with advanced non-small cell lung cancer. J Thorac Oncol
Off Publ Int Assoc Study Lung Cancer. févr 2011;6(2):286‑90.
82.
Greaves M, Maley CC. Clonal evolution in cancer. Nature. 19 janv 2012;481(7381):306‑13.
83.
Gerlinger M, Rowan AJ, Horswell S, Larkin J, Endesfelder D, Gronroos E, et al. Intratumor
Heterogeneity and Branched Evolution Revealed by Multiregion Sequencing. N Engl J Med. 7
mars 2012;366(10):883‑92.
84.
Vallée A, Marcq M, Bizieux A, Kouri CE, Lacroix H, Bennouna J, et al. Plasma is a better source of
tumor-derived circulating cell-free DNA than serum for the detection of EGFR alterations in lung
tumor patients. Lung Cancer Amst Neth. nov 2013;82(2):373‑4.
63
85.
Vallée A, Le Loupp A-G, Denis MG. Efficiency of the Therascreen® RGQ PCR kit for the detection
of EGFR mutations in non-small cell lung carcinomas. Clin Chim Acta Int J Clin Chem. 15 févr
2014;429:8‑11.
86.
Bai H, Wang Z, Chen K, Zhao J, Lee JJ, Wang S, et al. Influence of chemotherapy on EGFR mutation
status among patients with non-small-cell lung cancer. J Clin Oncol Off J Am Soc Clin Oncol. 1 sept
2012;30(25):3077‑83.
87.
Goto K, Ichinose Y, Ohe Y, Yamamoto N, Negoro S, Nishio K, et al. Epidermal growth factor
receptor mutation status in circulating free DNA in serum: from IPASS, a phase III study of
gefitinib or carboplatin/paclitaxel in non-small cell lung cancer. J Thorac Oncol Off Publ Int Assoc
Study Lung Cancer. janv 2012;7(1):115‑21.
88.
Yung TKF, Chan KCA, Mok TSK, Tong J, To K-F, Lo YMD. Single-molecule detection of epidermal
growth factor receptor mutations in plasma by microfluidics digital PCR in non-small cell lung
cancer patients. Clin Cancer Res Off J Am Assoc Cancer Res. 15 mars 2009;15(6):2076‑84.
89.
Oxnard GR, Paweletz CP, Kuang Y, Mach SL, O’Connell A, Messineo MM, et al. Noninvasive
detection of response and resistance in EGFR-mutant lung cancer using quantitative nextgeneration genotyping of cell-free plasma DNA. Clin Cancer Res Off J Am Assoc Cancer Res. 15
mars 2014;20(6):1698‑705.
90.
Nakamura T, Sueoka-Aragane N, Iwanaga K, Sato A, Komiya K, Kobayashi N, et al. Application of
a highly sensitive detection system for epidermal growth factor receptor mutations in plasma
DNA. J Thorac Oncol Off Publ Int Assoc Study Lung Cancer. sept 2012;7(9):1369‑81.
91.
Luo J, Shen L, Zheng D. Diagnostic value of circulating free DNA for the detection of EGFR
mutation status in NSCLC: a systematic review and meta-analysis. Sci Rep [Internet]. 9 sept 2014
[cité
20
sept
2014];4.
Disponible
sur:
http://www.nature.com/srep/2014/140903/srep06269/full/srep06269.html
92.
Nygaard AD, Garm Spindler K-L, Pallisgaard N, Andersen RF, Jakobsen A. The prognostic value of
KRAS mutated plasma DNA in advanced non-small cell lung cancer. Lung Cancer Amst Neth. mars
2013;79(3):312‑7.
93.
Rosell R, Carcereny E, Gervais R, Vergnenegre A, Massuti B, Felip E, et al. Erlotinib versus standard
chemotherapy as first-line treatment for European patients with advanced EGFR mutationpositive non-small-cell lung cancer (EURTAC): a multicentre, open-label, randomised phase 3
trial. Lancet Oncol. mars 2012;13(3):239‑46.
94.
Diaz LA, Bardelli A. Liquid Biopsies: Genotyping Circulating Tumor DNA. J Clin Oncol. 21 janv
2014;JCO.2012.45.2011.
95.
Punnoose EA, Atwal S, Liu W, Raja R, Fine BM, Hughes BGM, et al. Evaluation of circulating tumor
cells and circulating tumor DNA in non-small cell lung cancer: association with clinical endpoints
in a phase II clinical trial of pertuzumab and erlotinib. Clin Cancer Res Off J Am Assoc Cancer Res.
15 avr 2012;18(8):2391‑401.
96.
Marcq M, Vallee A, Bizieux A, Denis MG. Detection of EGFR Mutations in the Plasma of Patients
with Lung Adenocarcinoma for Real-Time Monitoring of Therapeutic Response to Tyrosine Kinase
Inhibitors? J Thorac Oncol. juill 2014;9(7):e49‑50.
97.
Merlin J-L. Les inhibiteurs de tyrosine kinase en oncologie. Lett Pharmacol. 2008;22(2):51‑62.
64
Université de Nantes
Année de soutenance : 2014
Faculté de médecine
___________________________________________________________________
Auteur : Mehdi SAKKA
Titre du mémoire de thèse :
Etude du statut mutationnel EGFR dans l’ADN circulant plasmatique chez
douze patients ayant un cancer pulmonaire non à petites cellules traités par
inhibiteur de tyrosine kinase
___________________________________________________________________
Résumé de la thèse :
Le cancer pulmonaire est l’un des plus fréquents en France et celui qui fait le plus de
victimes par an. De nouvelles molécules, inhibiteurs de tyrosine kinase, ont reçu l’AMM ces
dernières années quand la tumeur présente une anomalie moléculaire activatrice du gène
EGFR. La recherche dans l’ADN circulant de l’anomalie EGFR par des biopsies liquides qui
était présente dans leur tumeur chez 12 patients en stade IV du CHU de Nantes et du CH de
La Roche sur Yon a été faite dans le cadre du suivi de leur traitement. Les résultats montrent
une tendance pour l’intérêt pronostique avec la réapparition de l’anomalie chez un certain
nombre de patients en même temps que la rechute du cancer. La détection précoce de la
mutation T790M peut permettre aussi d’anticiper un échappement du traitement. Une cohorte
plus grande pourrait confirmer ces résultats.

Mots-clés : Cancer pulmonaire non à petites cellules, EGFR, Inhibiteur de tyrosine kinase,
gefitinib, erlotinib, ADN circulant, biopsies liquides.
Jury :
Président :
Monsieur le Professeur Jean-Marie BARD, PU-PH, biochimie générale
et biochimie appliquée, faculté de Pharmacie (Nantes)
Directeur de thèse : Monsieur le Professeur Marc DENIS, PU-PH, chef de service de
biochimie, faculté de Médecine (Nantes)
Membres du jury :
Madame le Docteur Acya BIZIEUX, PH, Oncologie médicale, (La
Roche sur Yon)
Monsieur le Professeur Stéphane BEZIEAU, PU-PH, chef de service
de génétique médicale, faculté de Médecine (Nantes)
Adresse de l’auteur :
24 rue de Siam
29200 Brest
Téléchargement
Explore flashcards