3. Prédiction des gènes

publicité
3. Prédiction des gènes
•  Tous les gènes se terminent sur un codon stop
•  Un algorithme simple de prédiction de gènes
•  À la recherche des codons start et stop
•  Prédiction de tous les gènes d’une séquence
•  Comment améliorer la qualité des prédictions ?
•  L’algorithme de Boyer-Moore
•  Index et arbre des suffixes
•  Des méthodes probabilistes à la rescousse
•  Comment évaluer la qualité de prédiction des méthodes ?
•  La prédiction de gènes dans les génomes eucaryotes
François
Rechenmann
BIOINFORMATIQUE : GÉNOMES ET ALGORITHMES
Recherche d’un triplet donné
TAG
ATTGCTTACTAGAATCGTACGGGTACGTAAATCGTATTCCGAT
2
Recherche d’un triplet donné
TAG
ATTGCTTACTAGAATCGTACGGGTACGTAAATCGTATTCCGAT
3
Recherche d’un triplet donné
TAG
ATTGCTTACTAGAATCGTACGGGTACGTAAATCGTATTCCGAT
4
Recherche d’un triplet donné
TAG
ATTGCTTACTAGAATCGTACGGGTACGTAAATCGTATTCCGAT
5
Recherche d’un triplet donné
TAG
ATTGCTTACTAGAATCGTACGGGTACGTAAATCGTATTCCGAT
Nombe de comparaisons dans le cas le plus
défavorable pour la recherche d’un codon stop
= longueur de la séquence
Pour les 3 codons stop
= 3 * longueur de la séquence
6
Codons stop
T
TGA
ou
A
TAG
G
ou
TAA
7
G
A
A
La fonction NextStopCodon
Function NextStopCodon (index: integer) returns integer
if index + 2 ≤ lengthSequence
then
repeat
if Sequence [index] = “T”
then
if Sequence [index+1] = “A”
then if sequence [index+2] = “G” or sequence [index+2] = “A”
then return index
else if
else index ← index + 2
Sequence [index+1] = “G” and sequence [index+2] = “A”
then return index
else index ← index + 2
else index ← index + 3
until index ≥ lengthSequence - 2
return 0
else return 0
end NextStopCodon
8
Téléchargement
Random flashcards
Ce que beaucoup devaient savoir

0 Cartes Jule EDOH

Le lapin

5 Cartes Christine Tourangeau

aaaaaaaaaaaaaaaa

4 Cartes Beniani Ilyes

découpe grammaticale

0 Cartes Beniani Ilyes

Créer des cartes mémoire