Telechargé par delphine.bretonniere

Techniques modernes d'identification

publicité
 LES TECHNIQUES MODERNES D’IDENTIFICATION Progrès technologique s: résultats plus rapides, plus précis avec des manipulations réduites Méthodes traditionnelles = base de la formation. Parfois les seules applicables et servent de référence ou de contrôle mais dépense notable de temps, de milieux et de matériel. 1-­‐ Les méthodes standardisées Intérêt pratique : Ø économie Ø gain de place Ø possibilité d’automatisation Intérêt scientifique : Ø précision o
nombre de tests supérieurs o
identification des biotypes o utilisation dans les enquêtes épidémiologiques Ø fiabilité o choix judicieux des milieux et des divers substrats o préparation standardisée et mise au point minutieuse des modalités techniques Ø traitement numérique des résultats avec obtention d’un code Ø traitement informatique des résultats Principe des méthodes standardisées (galeries d’identification) microméthodes classiques o
premières commercialisées o
plus utilisées o
exploitent les réactions biochimiques consacrées o
exemples : Entérotubes, API 20E, API 20A, API Staph microméthodes enzymatiques o
o
réactions originales mise au point spécialement modalités de lecture très diversifiées (colorations spontanées, indirectes, fluorescence) o
exemple : API Strep, API ZYM microméthodes auxanographiques o
o
possibilités d’assimilation de différents nutriments (sucres, acides aminés, acides organiques) lecture d’une croissance positive (trouble) ou négative (limpide) -­‐ exemple : API 20 CAUX Galerie d’identification sur milieux en tube Exemples de dispositifs commercialisés : Ø API System Ø Entérotube Roche Système API 20E https://www.youtube.com/watch?v=qfs2bByiYXU&index=5&list=PLvcJHpFIkrqj1Hz5aYraRBWA0_IEDMtCA https://www.youtube.com/watch?v=1wuGuOlFZlo&list=PLvcJHpFIkrqj1Hz5aYraRBWA0_IEDMtCA&index=6 https://www.youtube.com/watch?v=g-­‐hkZCPTf4o Règles générales d’emploi -­‐ Examen microscopique et tests d’orientation préliminaires -­‐ mode opératoire doit correspondre à la méthode choisie (notice technique) -­‐ suspension doit être effectuée dans le milieu approprié indiqué par le fabricant -­‐ souches pures -­‐ suspensions pas trop denses Limites d’utilisation -­‐ toujours appliquer la rigueur des techniques microbiologiques de base -­‐ étude de quelques familles microbiennes 2-­‐ Les méthodes automatisées Toutes les études d’antibiogramme sont actuellement automatisables Automates d’identification Ils se différencient par : Ø degré d’automatisation -­‐ durée d’incubation o incubation classique (12 à 18 h) o
incubation semi-­‐rapide (8 h) o incubation en 4 à 5 h Ø gamme des applications possibles Ø nombre d’analyses effectuées Ø degré d’informatisation des résultats Exemples : MICROLOG/ BIOLOG : -­‐ identification de 2000 espèces microbiennes (bactéries, levures et moisissures) -­‐ identification basée sur la respiration en présence de 95 sources de carbone -­‐ utilisation de plaques de titration de 96 puits -­‐ visualisation de la croissance et de la respiration qui va réduire le violet de tétrazolium d’incolore à la couleur pourpre -­‐ comparaison des résultats à une banque de données -­‐ durée de l’analyse de 4-­‐6 h à 16-­‐24 h BIOLOG GEN 3 http://www.youtube.com/watch?v=opgzzaWsbnU Technologie d’identification Biolog 3e génération pour les bactéries Avantages inédits ! -­‐ Pas de coloration de Gram -­‐ Pas de pré-­‐tests ni de tests supplémentaires nécessaires -­‐ Une seule et unique plaque pour les bactéries Gram+ et Gram-­‐ -­‐ Préparation très simple en moins d’une minute -­‐ Plus de 1000 espèces disponibles dans la banque de données 3-­‐ Les méthodes immunologiques et de biologie moléculaire Contrôles en alimentaire => identifier les microorganismes potentiellement pathogènes et/ou leurs dérivés toxiques dans les aliments * germes hautement pathogènes : absence dans le produit * autres germes, le risque est fonction de leur importance numérique : dénombrements inférieurs à certains seuils seront tolérés ⇒ techniques spécifiques pouvant fournir des résultats quantitatifs + méthodes rapides et de moindre coût Critères idéaux des techniques en bactériologie alimentaire : -­‐ haute spécificité -­‐ haute sensibilité -­‐ quantification des résultats -­‐ bref délai de réalisation -­‐ automatisation -­‐ faible coût Les premières méthodes * dénombrement sur milieux gélosés puis identification * utilisation de milieux sélectifs, de milieux chromogéniques techniques les plus fiables et considérées comme méthodes de référence. Pb : manipulations longues, laborieuses, pouvant nécessiter des étapes d’enrichissement (Salmonella, Listeria) MILIEUX CHROMOGENES reposent sur les même principes que les milieux traditionnels avec, en plus, la mise en évidence de réactions enzymatiques bactériennes par l'hydrolyse de substrats spécifiques : les substrats CHROMOGENES. o premier brevet est déposé en 1979 par Alain Rambach milieu chromogène pour la détection d’E. coli. o 1990: intégration dans les méthodes normatives 4 classes de composants chromogènes et fluorogènes: o colorants fluorescents o indicateurs pH fluorescents o indicateurs redox o substrats d’enzymes Avantages et inconvénients: o une autre approche de l’identification (caractérisation au niveau de l’espèce, voire du sérotype) o contrainte de l’activité enzymatique o rapidité et facilité de lecture des boîtes de milieu de culture o prix plus élevé o reconnaissance normative et réglementaire ð identification présomptive de la bactérie ou de la levure ð détection et dénombrement des microorganismes Milieu Baird-­‐Parker Composition du milieu BCP (pH 6.8) Réactions antigènes-­‐anticorps Détection directe d’une bactérie dans un mélange complexe Ac polyclonaux ou monoclonaux (ACM) dirigés contre des antigènes (Ag) de surface des bactéries Préférence aux ACM (affinité plus importante, stabilité dans la production) Ø Détection de la réaction Ag/Ac par: o Observation d’un précipité en milieu gélosé (immunodiffusion, électrosynérèse) sensibilité faible o Agglutination de particules sensibilisées (microbilles de latex, globules rouges, bactéries dont la paroi est riche en protéine A qui fixent les IgG par leur partie Fc) en présence de l’Ag correspondant on a une agglutination visible à l’œil nu. o Couplage des Ac à des molécules servant de marqueur o Augmentation de la sensibilité Ø Radioisotopes (sensibilité maximum, contraignants) Ø Molécules fluorescentes (isothyocyanate de fluorescéine, rhodamine) Ø Enzymes (péroxydase, b-­‐galactosidase) : sensibilité, souplesse, automatisation possible ð ELISA (« Enzyme Linked Immunosorbent Assay ») Exemples : ELISA permettant de détecter les Listeria, les Salmonella Salmonella Ø agglutination (Ac polyclonaux spécifiques de LPS): détection 108 bactéries/ml Ø immunofluorescence indirecte (Ac polyclonaux spécifiques de LPS): détection 105 à 106 bactéries/ml mais présence de réactions faussement positives Ø ACM IgA dirigé contre un Ag flagellaire commun à de nombreuses Salmonella détection dans des cultures mixtes ou des échantillons d’aliments de 106 bactéries/g Ø demande une préparation des extraits flagellaires par chauffage (1h à 100°C) et centrifugation Ø essais sur bactéries entières négatifs Dans tous les cas, besoin d’une phase d’enrichissement d’une durée d’au moins 24 heures pour atteindre le seuil de détection DuPontTM Lateral Flow System The DuPontTMLateral Flow System is a simple and inexpensive alternative to traditional culture methods for routinely screening foods for pathogens. Clear, rapid results Using a unique combination of antibodies and highly engineered colloidal gold conjugate coated on the surface of a membrane, the DuPontTM Lateral Flow System yields clear, reliable results—which are available much faster than conventional, culture-­‐based testing. After a few simple steps of preparation, the sample wicks up the test strip by capillary action. Within 10 minutes, if the target pathogen is present in the sample, two red lines are formed. If not, only the control line—which lets you know that the test has worked correctly—appears. The test can detect 1 colony forming unit (cfu) in 25 grams of sample. Full product line Tests and media are available for Salmonella, Listeria and E. coli O157 (including 0157:H7). Test strips have a long shelf and can be stored at room temperature, saving valuable refrigerated storage space in your laboratory. The DuPontTM Lateral Flow Systems have been certified as Performance Tested methods by AOAC Research Institute. Détection de toxines synthétisées par les bactéries et pouvant être responsables de TIA Ø Soit production de toxines dans les aliments (toxines botuliniques, entérotoxines de staphylocoques) Ø Soit synthèse dans le tube digestif (entérotoxine de Clostridium perfringens) Exemples : tests pour détecter les entérotoxines de staphylocoques o immunodiffusion (sensibilité : 100ng/ml) o radio-­‐immunologie et ELISA avec ACM ou Ac polyclonaux (sensibilité : 1ng/ml) Techniques d’hybridation nucléique Spécificité : complémentarité de 2 chaînes d’ADN ou d’ARN Principe : hybridation d’une sonde (segment AN connu) avec une cible d’une bactérie à identifier. Sonde : o fragment d’ADN chromosomique, d’ADN cloné ou un oligonucléotide de synthèse o correspond à un gène ou une partie de gène particulier (gène de virulence codant pour une toxine, caractère d’antibiorésistance...) o les sondes longues sont plus spécifiques et plus sensibles que les sondes courtes. Le degré de spécificité est aussi fonction des conditions d’hybridation, de lavages. Pour la détermination de l’espèce bactérienne => sondes ADN dirigées contre les ARNr. Les ARNr 16S sont présents à plus de 100 000 copies par bactérie ð bonne sensibilité de la méthode ð très conservés au sein d’une même espèce Révélation des hybrides sondes-­‐acide nucléique cible s’effectue par un marqueur incorporé dans la structure de la sonde : -­‐ radioisotope -­‐ fluorochrome -­‐ composé reconnu spécifiquement par un autre (biotine-­‐streptavidine) -­‐ composé permettant la reconnaissance par des anticorps (sulfonate...) -­‐ enzyme (peroxydase, phosphatase alcaline) Systèmes de détection indirecte (avec streptavidine ou avec anticorps couplés à des enzymes) => amplification de la réaction Systèmes avec radioisotopes : « sondes chaudes » => plus sensibles que les sondes « froides » (20 à 50 fois plus) Avantages des sondes « froides » : stabilité et utilisation dans des laboratoires non spécialisés Une des techniques les plus employées : hybridation sur filtre -­‐ immobilisation de l’ADN cible sur une membrane (nylon, cellulose) -­‐ puis hybridation avec sonde Existe plusieurs voies de préparation de l’ADN cible : -­‐ purification d’ADN d’une souche bactérienne => identification bactériologique -­‐ extraction d’ADN directement de colonies bactériennes (hybridation sur colonies) => identification + numération -­‐ extraction et purification d’ADN d’un échantillon biologique =>identification directe de certaines bactéries dans le prélèvement Sensibilité des techniques : 105 – 106 bactéries par ml => nécessite une étape d’enrichissement Exemple : Gene Track System -­‐ étape d’enrichissement de 48h -­‐ étape d’hybridation de 4h Résultats faussement négatifs : 10% pour le kit Listeria Gene Track System GeneQuence: http://www.neogen.com/FoodSafety/pdf/GQ_Catalog.pdf Technique PCR (Polymerase Chain Reaction) = technique d’amplification de gènes Amorces -­‐ 2 amorces oligonucléotidiques distantes d’une centaine à quelques kilobases, l’une complémentaire du brin ADN+, l’autre du brin ADN -­‐ avec les extrémités 3’ en regard -­‐ longueur # 20 nucléotides -­‐ choix des amorces détermine le niveau de spécificité ADN polymèrase -­‐ Taq polymèrase : thermostable (T°Copt = 72°C) extraite de Thermus aquaticus (bactérie thermophile) 1 erreur toutes les 2500 bases Déroulement / Cycle : 1-­‐ dénaturation à 95°C, 1 à 2 min. 2-­‐ hybridation des amorces à 50-­‐55°C, 1 à 2 min. 3-­‐ extension de l’amorce à 72°C, 2 à 3 min. Au bout de 30 cycles => taux d’amplification théorique est de 109 Détection du fragment amplifié : visualisation directe après électrophorèse en gel d’agarose et par hybridation avec une sonde d’acide nucléique Sensibilité : détection d’un microorganisme présent dans un échantillon dans un délai de quelques heures Problèmes : contaminations éventuelles en cours de manipulation pas de différence entre bactéries mortes et vivantes Genomic DNA isolated from Helicobacter pylori strain J99. Bacterial DNA copy number is determined by real time PCR using the Roche Light Cycler using H. pylori vacA m region primers. The PCR assay was performed using the following primers: vacA s region specific, vacA m region specific, cagA specific, and 16s rRNA species specific. Gene and primer Primer Sequence (5'-­‐3') Amplicon Size (bp) vacA s region VA1F ATGGAAATACAACAAACACAC 259/286 VA1R CTGCTTGAATGCGCCAAAC vacA m region HPMGF CACAGCCACTTTCAATAACGA 401/476 HPMGR CGTCAAAATAATTCCAAGGG cagA CagAF TTGACCAACAACCACAAACCGAAG 183 CagAR CTTCCCTTAATTGCGAGATTCC 16s rRNA JW21F GCGACCTGCTGGAACATTAC 139 JW22R CGTTAGCTGCATTGGAGA METAGENOMIQUE EN INDUSTRIE ALIMENTAIRE Principe: -­‐ extraction de la totalité de l’ADN des micro-­‐organismes présents dans l’échantillon -­‐ amplification de l’ADN codant pour l’ARN 16S -­‐ séquençage haut débit et traitement des résultats par bio-­‐informatique Sensibilité: -­‐ en une seule analyse, identification de plusieurs milliers de micro-­‐ organismes présents au sein d’une denrée alimentaire, sans passer par une étape de culture -­‐ mise en évidence des VNC -­‐ profondeur d’analyse est de 104 UFC/g -­‐ donne un aperçu de la proportion des espèces en présence -­‐ possible de discriminer les bactéries vivantes des bactéries mortes Permet de répondre aux questions suivantes: -­‐ Pourquoi mon lot n’est-­‐il pas conforme? -­‐ Quelles sont les bactéries responsables de l’altération de mon produit ? -­‐ Comment évolue la flore microbienne au cours de la conservation de mon produit ? -­‐ Comment évolue la flore microbienne lors de la fermentation d’un produit fermenté ? -­‐ Puis je prolonger la durée de vie de mon produit ? -­‐ Quel sera l’influence d’un changement de formulation ou de conditionnement sur la composition et l’évolution de la flore microbienne ? -­‐ Quel sera l’effet de l’utilisation d’une flore de bio-­‐préservation ? Lardons nature : Mise en évidence des bactéries d’altération Ifip (institut du porc) 650 €HT 2 à 3 semaines • Le but est d’identifier les micro-­‐organismes responsables de l’altération de lardons nature grâce à l’analyse métagénomique d’un produit conforme et d’un produit non conforme. • Dans le produit non conforme, presque 90% de la flore bactérienne se compose de Leuconostoc carnosum, L. gasicomitatum et L. mesenteroides, bactéries souvent responsables d’altérations sur produits de charcuterie (gonflement, aspect collant, odeur aigre). Ce genre bactérien ne représente que 24% de la flore bactérienne du produit conforme, largement dominée par Lactobacillus sakei et Lactobacillus curvatus/graminis (70% de la flore bactérienne). Ce constat n’aurait pas pu se faire en utilisant les méthodes traditionnelles d’analyse par culture. Conclusion : -­‐ éventail de techniques permettant une identification rapide de germes à partir de mélanges complexes avec une grande sensibilité et une spécificité élevées -­‐ nécessite souvent une étape d’enrichissement -­‐ coût des réactifs et des équipements (fait appel à des prestataires ou à des plateformes techniques) ð choix d’une technique pour un usage industriel doit donc évaluer les performances et les coûts de chacune en fonction des besoins réels 
Téléchargement
Explore flashcards