UNIVERSITY OF CALGARY Colitis-Associated Cancer

UNIVERSITY OF CALGARY
The Role of Myeloid Derived Suppressor Cells in the Interleukin-10 Model of
Colitis-Associated Cancer
by
Manmish Singh Bawa
A THESIS
SUBMITTED TO THE FACULTY OF GRADUATE STUDIES
IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE
DEGREE OF DOCTOR OF PHILOSOPHY
GRADUATE PROGRAM IN GASTROINTESTINAL SCIENCES
CALGARY, ALBERTA
JULY 2015
© Manmish Singh Bawa 2015
Abstract
Chronic inflammation in the colon is a risk factor for developing colorectal
cancers, one of the leading causes of cancer related deaths in Canada. A
hallmark feature of inflammation is the recruitment of leukocytes. Of interest in
this thesis are the heterogenous population of Gr1+/CD11b+ Myeloid Derived
Suppressor Cells (MDSC). These cells are recruited to tumour sites, but have
recently also been shown to be increased during inflammation. A key regulator of
inflammation and leukocyte recruitment to the gut is the innate immune receptor
TLR4. In this thesis we use the IL-10-/- mouse model to examine the role of
MDSC in colitis-associated cancer.
Our preliminary data in an IL-10 TLR4 double knock out mouse revealed an
increased cancer incidence in the absence of TLR4. We hypothesized that
MDSC contributed to cancer development in the IL-10-/- and TLR4 signaling
modulates cancer development through an effect on MDSC function or
recruitment.
Our studies demonstrated enhanced numbers of Gr1+/CD11b+ cells in the colons
of
IL-10-/-
mice.
Characterization
of
these
cells
revealed
an
active
immunosuppressive phenotype demonstrated by activity of NOS II and Arginase
I enzymes and suppression of T-cell proliferation. Pharmacological targeting of
MDSC decreased dysplasia development. Enriching the MDSC pool using
ii
adoptive transfer was associated with enhanced neoplasia development in the
IL-10-/- mice. These data suggest that MDSC contribute to inflammation
associated tumour development.
In the absence of TLR4, IL-10-/- mice recruited increased levels of MDSC to the
colon. MDSC numbers correlated with the levels of cancer development in this
model. TLR4 competence did not affect the immunosuppressive function of
MDSC. We identified MCP-1 and SDF-1 as MDSC chemoattractants.
Examination of colonic tissue demonstrated increased MDSC chemoattractant
expression levels in the absence of TLR4 before tumour development in the IL10 deficient model.
Our data identify a link between TLR4 signaling and MDSC recruitment to the gut
during inflammation and demonstrate that MDSC recruitment drives cancer
development.
iii
Acknowledgements
I would like to acknowledge the love and support of my family that has made it
possible for me to achieve everything that I have. My wonderful parents, Daljit
and Baljinder, have always nurtured and supported me to the best of their ability
and beyond. My brother and my best friend, Gharandip, has been a constant
companion, source of guidance and inspires me to life in service. The love of my
life, Navkiran, who went from being my girlfriend to fiancé and finally, wife, during
the course of my graduate study years, is my reason for being.
I would also like to acknowledge the support of my supervisor, Dr. Donna-Marie
McCafferty. Donna-Marie has provided me with invaluable mentorship and
guidance over the last 6 years. I would like to thank my supervisory committee:
Dr. Joe Davison, Dr. Paul Beck and Dr. Oliver Bathe. Under the combined
supervision of Donna-Marie and my committee, I have expanded my knowledge
of the scientific method and how to put it into practice. It has been a privilege to
be mentored and guided along in my career by these and many other individuals
that I greatly admire.
I would like to thank all members of the McCafferty lab over the years, especially,
Ronald Chan, Dr. Rui Zhang, Dr. Ying Gao, Kelvin Ng and Dr. Maitham Khajah. I
thank Dr. Stephan Urbanski for his great help with my project.
iv
I would like to thank the Queen Elizabeth II graduate scholarships for their
support during my graduate career. Finally, I would like to thank the
Gastrointestinal
Research
Group,
the
Department
of
Physiology
and
Pharmacology and the University of Calgary for providing an excellent
environment to learn, do research, to interact and collaborate other scientists.
v
Dedication
To my wife and family
vi
Table of Contents
Abstract………………………………………………………….……………………….ii
Acknowledgements………………………………………….………………………….iv
Dedication………….………………………………………….………………………...vi
Table of Contents...………………………………………….…………………………vii
List of Tables….....………………………………………….…………………………...x
List of Figures and Illustrations…………………………….………………………….xi
List of Symbols, Abbreviations, Nomenclatures………………………………..….xiv
Chapter 1: Introduction………………………………….…………………………...1
1.1 Inflammation and Cancer in the Gut……….…………………………......2
1.1.1 Colorectal Cancer………………………….………………………….....2
1.1.2 Inflammatory Bowel Disease…..……….…………………………........4
1.1.3 IBD and Cancer in the Colon…..……….…………………………........5
1.2 Myeloid derived suppressor cells…..…….…………………………......11
1.2.1 Introduction to myeloid derived suppressor cells….………………...11
1.2.2 MDSC Recruitment………………………………….………………….12
1.2.3 MDSC Function……………………………………….…………………14
1.3 Interleukin-10 and Toll like receptor 4 deficient model……..…………18
1.3.1 Models of Colitis-associated cancer………………..…………………18
1.3.2 The Interleukin 10 Deficient Mouse………………..……………….…20
1.3.3 Toll like receptor 4………………..……………….…………………….22
1.3.4 IL-10 TLR4 Double Deficient Mouse………………………………….25
1.4 Hypothesis and Objectives……………………………………………….26
Chapter 2: Materials and Methods…………………….………………………….28
vii
2.1 Animals……………..………………..……………….…………………...29
2.2 Evaluation of Inflammation and Cancer….……….…………………….30
2.3 Colon Immunohistochemistry for Gr1+ CD11b+ Cells…...…………….32
2.4 Flow Cytometry Experiments…………………………………………….33
2.5 MDSC Isolation……..………………..……………….…………………...37
2.6 MDSC Function in vitro……………..……………….…………………...38
2.7 Bone Marrow Transplant…………..……………….………………….....41
2.8 Molecular Techniques………………..……………….…………………..41
2.9 Chemotaxis Assays..………………..……………….…………………...45
2.10 Statistical Analysis..………………..……………….…………………...47
Chapter 3: The role of MDSC in the Interleukin-10 deficient mouse….…....48
3.1 Cancer and Gr1+CD11b+ counts in the IL-10 deficient mouse……….49
3.1.1 Colon cancer development is increased in the IL-10 deficient
mouse…………………………………………………………………………...50
3.1.2 Gr1+CD11b+ cell recruitment to the colon is increased in the IL-10
deficient mouse………………………………………………………………...52
3.2 Gr1+CD11b+ cell Function in vitro……………………………...………..58
3.3 MDSC function in vivo…………………………………………………….65
3.3.1 Depleting MDSC in vivo decreases cancer development in the IL-10
deficient mouse………………………………………………………………...65
3.3.2 Adoptive transfer of MDSC in vivo increases cancer development in
the IL-10 deficient mouse……………………………………………………..72
3.4 MDSC in the AOM/DSS Model of Colitis Associated Cancer………...79
Chapter 4: The role of MDSC in the Interleukin 10 Toll Like Receptor 4
double deficient mouse……………………………………………………………..83
4.1 Cancer incidence and MDSC levels in the IL-10 TLR4 double deficient
mouse…………..……………………………………………………………….84
viii
4.1.1 Inflammation and Cancer levels in the IL-10 TLR4 Double Deficient
mouse…………..……………………………………………………………….85
4.1.2 MDSC recruitment in the IL-10 TLR4 double deficient mouse……..87
4.1.3 MDSC and Cancer correlation…………………………………………91
4.2 Other leukocyte population levels in the absence of TLR4 in the IL-10
deficient mouse..……………………………………………………………….95
4.3 MDSC function in the IL-10 TLR4 double deficient mouse………...…99
4.4 TLR4 competence and cancer development…………………………104
Chapter 5: MDSC chemotaxis in vitro and in vivo……………………………111
5.1 Underagarose and Ibidi Chamber Chemotaxis Assays……………..114
5.2 Transwell Chamber Chemotaxis Assay…….………………..............120
5.3 MCP-1 increases MDSC chemotaxis in vivo………………...............127
5.4 Chemoattractant protein and mRNA levels in the IL-10 deficient
mouse………………………………………………………………………….133
Chapter 6: Discussion and Future Directions…………………………………139
References…………………………………………………………………………...156
ix
List of Tables
Table 3-1 Combinations of primary and secondary antibodies used in
Gr1+CD11b+ cell colon immunohistochemistry to check for non-specific
binding…………………………………………………………………………………..54
Table 5-1 The number of migrating MDSC towards chemoattractants in the
underagarose chemotaxis assay…………………………………………………...115
x
List of Figures and Illustrations
Figure 1-1 Comparison of IBD associated and Spontaneous Colon Cancers……8
Figure 1-2 Methods of MDSC-mediated immune suppression……………..…….16
Figure 3-1 Incidence of cancer increases with age in the IL-10 deficient
mouse…………………………………………………………………………………...51
Figure 3-2 Lamina Propria Gr1+CD11b+ cell flow cytometry…………...…………55
Figure 3-3 Representative immunohistochemistry for Gr1+CD11b+ cells in colon
tissue sections………………………………………………………………………....56
Figure 3-4 Gr1+CD11b+ cell colon immunohistochemistry…………………...…...57
Figure 3-5 IL-10 deficient Gr1+CD11b+ cells express arginase I activity………...62
Figure 3-6 IL-10 deficient Gr1+CD11b+ cells have NOS2 Activity………………..63
Figure 3-7 IL-10 deficient Gr1+CD11b+ cells suppress T-cell proliferation………64
Figure 3-8 Low dose chemotherapeutics deplete MDSC in the IL-10 deficient
mouse sections………………………………………………………………………...67
Figure 3-9 Lower MDSC counts are associated with reduced polyp scores in the
IL-10 deficient mouse………………………………………………………………....68
Figure 3-10 Lower MDSC counts are associated with reduced dysplasia scores
in the IL-10 deficient mouse……………………………………………………….....69
Figure 3-11 Lower MDSC counts do not alter macroscopic inflammation in the IL10 deficient mouse….………………………………………………………………....70
Figure 3-12 Lower MDSC counts do not affect histological inflammation in the IL10 deficient mouse….………………………………………………………………....71
Figure 3-13 Adoptive transfer of MDSC does not affect MDSC levels in the
colons of IL-10 deficient mice………………………………………………………...75
Figure 3-14 Adoptive transfer of MDSC increases neoplastic changes in the
colons of IL-10 deficient mice………………………………………………………...76
Figure 3-15 Adoptive transfer of MDSC does not affect inflammation in IL-10
deficient mouse colons………………………………………………………………..77
xi
Figure 3-16 Dysplasia and Gr1+CD11b+ cell counts are increased in the
AOM/DSS model of colitis-associated cancer………………………………...……81
Figure 4-1 TLR4 deficiency increases cancer development and inflammation in
the IL-10 deficient mouse……………………………………………………………..86
Figure 4-2 TLR4 deficiency does not affect MDSC levels in the bone marrow and
spleen in the IL-10 deficient mouse………………………………………………….89
Figure 4-3 TLR4 deficiency increases MDSC recruitment to the colon in the IL-10
deficient mouse……………………..………………………………………………….90
Figure 4-4 MDSC recruitment correlates with neoplastic changes in the IL-10
deficient mouse model……………..………………………………………………….93
Figure 4-5 TLR4 deficiency does not affect peripheral blood leukocyte levels in
the IL-10 deficient mouse…………..…………………………………………………97
Figure 4-6 MDSC are the only upregulated leukocyte population in the colon in
the absence of TLR4 in the IL-10 deficient mouse….……………………………..98
Figure 4-7 TLR4 does not affect MDSC function in the IL-10 deficient mouse..101
Figure 4-8 TLR4 expression in MDSC in the IL-10 deficient mouse……………103
Figure 4-9 Bone marrow transplants between IL-10 TLR4 double deficient and IL10 deficient mice increase…………..………………………………………………107
Figure 4-10 TLR4 mRNA expression is decreased in the polyps of IL-10 deficient
mice…………………………..………..………………………………………………109
Figure 5-1 Neutrophil and MDSC Underagarose Chemotaxis Assay…………..118
Figure 5-2 MDSC Ibidi Chemotaxis. ..……………………………………………..119
Transwell Chemotaxis Chamber Illustration……………………………...……….122
Figure 5-3 MDSC migrate towards MCP-1 in the Transwell Chemotaxis
Assay…………..………..………………………………………………..…………...123
Figure 5-4 MDSC migration in the Transwell Chemotaxis Assay……..………..124
Figure 5-5 MDSC migrate towards SDF-1 in the Transwell Chemotaxis
Assay.................................................................................................................125
xii
Figure 5-6 TLR4 does not affect MDSC chemotaxis in the IL-10 deficient
mouse…………..................................................................................................126
Figure 5-7 MCP-1 increases MDSC recruitment kinetics in vivo.......................131
Figure 5-8 MDSC recruitment kinetics in the colon in vivo................................132
Figure 5-9 MCP-1 mRNA levels are comparable in the IL-10 deficient mouse in
the absence of TLR4………..………..……………………………………………...135
Figure 5-10 MCP-1 protein levels are significantly increased in in the IL-10
deficient mouse in the absence of TLR4…………………………………………..136
xiii
List of Symbols, Abbreviations, Nomenclatures
AOM
Azoxymethane
APC
Adenomatous polyposis coli
CARD15
Caspase activation and recruitment domain 15
CCR2
Monocyte chemoattractive
chemokine receptor type
CD
Crohn’s Disease
CD11b
Integrin α 1
CD18
Integrin β 2
cDNA
Complimentary DNA
CO2
Carbon dioxide
CpG
Phosphodiester bond between Cytosine and Guanine
CRC
Colorectal Cancer
DNA
Deoxyribonucleic acid
DSS
Dextran sulfate sodium
EDTA
Ethylenediaminetetraacetic acid
FBS
Fetal bovine serum
FITC
Fluorescein isothiocyanate
fMLP
N-formyl-methionyl-leucyl-phenylalanine
GAPDH
Glyceraldehyde 3-phosphate dehydrogenase
GMCSF
Granulocyte macrophage colony stimulating factor
H&E
Hematoxylin and eosin
HBSS
Hank’s Balanced Salt Solution
xiv
protein
receptor,
C-C
HEPES
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
HNPCC
Hereditary nonpolyposis colorectal cancer
IBD
Inflammatory bowel disease
IL
Interleukin
IL-1β
Interleukin 1β
IL-6
Interleukin 6
IL-10
Interleukin 10
IL-10-/-
Interleukin 10 deficient
IL-10-/-TLR4-/-
Interleukin 10 Toll like Receptor 4 double deficient
IL-12
Interleukin 12
IL-23R
Interleukin 23 receptor
L-arg
L-arginine
LPS
Lipopolysaccharide
KC
Keratinocyte chemotactic peptide
Mac-1
Macrophage-1 antigen
MCP-1
Monocyte chemotactic protein 1, CCL2
MCSF
Macrophage colony stimulating factor
MDSC
Myeloid derived suppressor cells
MIP-2
Macrophage inflammatory protein 2, CXCL2
MyD88
Myeloid differentiation primary response gene 88
NF-κB
Nuclear factor κ B
NOD2
Nucleotide-binding oligomerization domain containing 2
xv
NOS2
Nitric oxide synthase 2
OCT
Optimal cutting temperature compound
p53
Protein 53
PBS
Phosphate buffered saline
PCR
Polymerase chain reaction
PE
Phycoerytherin
PGE2
Prostaglandin E2
PMSF
Phenylmethylsulfonyl fluoride
PRR
Pattern recognition receptor
RAG2
Recombination activating gene 2
RANTES
regulated upon activation, normal T-cell expressed and
secreted
RIPA
Radio-immunoprecipitation assay buffer
RNA
Ribonucleic acid
RPMI
Roswell Park Memorial Institute
RT-PCR
Real time polymerase chain reaction
SDF-1
Stromal derived factor 1, CXCL12
SDS
Sodium dodecyl sulfate
TH
T-helper cell
TLR
Toll like receptor
TLR4
Toll like receptor 4
TNF-α
Tumor necrosis factor α
TRIF
TIR-domain-containing adapter-inducing interferon-β
xvi
UC
Ulcerative Colitis
VCl3
Vanadium III chloride
VEGF
Vascular endothelial growth factor
WKYMVm
W-peptide, Trp-Lys-Tyr-Met-Val-Met-NH2
WNT
Wingless-related integration site
xvii
Chapter 1: Introduction
1
1.1 Inflammation and Cancer in the Gut
1.1.1 Colorectal Cancer
Colorectal cancer (CRC) is responsible for approximately 608,000 deaths per
year worldwide (Parkin et al., 2010). Colorectal cancer (CRC) is the third most
common cancer diagnosis and the second leading cause of cancer related death
in Canada (Singh et al., 2012a). In 2012 alone, there were an estimated 23,200
new cases diagnosed and 9,200 deaths from CRC in Canada (Dube, 2012).
According to the Canadian Digestive Health Foundation, the likelihood of a
Canadian developing CRC in their lifetime is 1 in 15 and the estimated lifetime
treatment cost of each patient is $750,000 (http://www.cdhf.ca/en/statistics). This
translates to a cost burden of half a billion dollars annually on the health care
system.
CRC is the formation of malignant neoplasia in the colon, rectum or appendix.
Colon adenocarcinoma is the most common cancer in the gastrointestinal tract
(Kumar, 2010). A combination of molecular events lead normal mucosa to the
development
of
aberrant
crypt
foci,
then
adenomas
and
finally
adenorcarcinomas. Adenomas are benign epithelial derived tumors within the
mucosa that can become carcinomas when glandular tissue invades into the
submucosal space. The development of cancer is the result of the accumulation
of genetic mutations and epigenetic abnormalities, which drive the transformation
of normal epithelia into adenomatous tissue (Kumar, 2010). Three different
2
pathways of genomic instability have been described in CRC: chromosomal
instability, microsatellite instability and CpG island methylator phenotype (Kumar,
2010). Of these, the most common and best-studied pathway is the
chromosomal instability pathway that involves the classic adenoma-carcinoma
APC/β-catenin sequence (Fearon and Vogelstein, 1990; Pino and Chung, 2010;
Vogelstein et al., 1988). The microsatellite instability pathway is found in 15% of
colon cancers and involves the loss of DNA mismatch repair mechanisms
(Boland and Goel, 2010). The CpG island methylator phenotype involves the
hypermethylation of various promotor CpG island loci that leads to the silencing
of key genes (Bae et al., 2013). In advanced stage CRC, these pathways can
often be observed acting in congruence (Remo et al., 2012).
CRCs is a multifactorial disease that can be initiated by many different types
mutations and environmental factors (The Cancer Genome Atlas Network, 2012).
Genetic causes of CRC such as hereditary syndromes, including Lynch
syndrome
(HNPCC)
and
familial
adenomatous
polyposis,
account
for
approximately 20 % of CRC (Patel and Ahnen, 2012). The majority of CRC are
related to lifestyle, rather than a specific underlying condition (Watson and
Collins, 2011). The key predisposing factors in the development of CRC include
advanced age, presence of polyps, familial history, genetics and a history of
inflammatory conditions such as inflammatory bowel disease. A presence of a
combination of these factors can greatly increase the probability of CRC
3
development (Ahmadi et al., 2009). Inflammation is present in colon and many
other cancers regardless of the initiating sequence of events (Mantovani et al.,
2008).
1.1.2 Inflammatory Bowel Disease
Inflammatory bowel disease (IBD) refers to a group of idiopathic chronic
relapsing inflammatory conditions that affect the gastrointestinal tract. The two
most common forms of IBD are ulcerative colitis (UC) and Crohn’s disease (CD).
The incidence of IBD ranges from about 10 to 200 cases per 100,000 individuals
in North America and Europe. IBD is most prevalent in developed and urbanized
nations and the incidence of the disease has been rising in the last half century
(Bouma and Strober, 2003; Molodecky et al., 2012; Rocchi et al., 2012).
The most commonly held hypothesis regarding the development of IBD is that in
a genetically susceptible individual an environmental triggers leads to an
aberrant immune response to a subset of enteric bacteria (Packey and Sartor,
2008). The immune response is overly aggressive and involves the adaptive
immune system, especially T-cells. It is this uncontrolled immune response that
is directly responsible for the mucosal damage that is observed in IBD (Bouma
and Strober, 2003; Sartor, 2006). Genetic susceptibility has been identified as an
important component in the pathogenesis of IBD via single nucleotide
4
polymorphism and candidate gene approaches in humans, and use of transgenic
and knockout mice. Genes with nucleotide polymorphisms related to IBD include
NOD2/CARD15, IL-23R and IL-10 (Hugot et al., 2001; Neuman and Nanau,
2012). Though a critically important component, twin studies have found genetic
susceptibility does not entirely account for the development of IBD (Bouma and
Strober, 2003; Loftus, 2004; Sartor, 2006). The interaction between the gut
immune environment and enteric bacteria and their antigens also plays a key role
in IBD. Inflammation does not develop in many induced and spontaneous models
of IBD in germ free environments (Schultz et al., 1999). In humans, the use of
antibiotics and some probiotic therapies has shown the importance of
commensal bacteria in disease development and recovery (Sartor, 2005; Sartor,
2006). The combination of genetic susceptibility and bacterial antigen stimulation
requires an environmental trigger for onset or relapse of the disease. The
importance of environmental factors was first indicated by the differences in
incidence of IBD across geographic regions, age and time. Potential
environmental triggers include cigarette smoke, stress and diet (Loftus, 2004;
Sartor, 2006).
1.1.3 IBD and Cancer in the Colon
The link between inflammation and cancer development is well established and
has been reported in a number of human diseases and animal models
(Coussens and Werb, 2002; Dalgleish, 2006). Examples of inflammatory
5
conditions leading to cancer development include gastric, liver, prostate and
colon cancers (De Marzo et al., 2007; Fattovich et al., 2004; Parsonnet et al.,
1991). While this relationship is not yet fully understood, it is clear that the
inflamed tissue microenvironment generates the right conditions for the activation
of protumorigenic mechanisms (Dalgleish, 2006). In fact, inflammatory bowel
disease patients are at an increased risk of developing colon cancer (Bernstein
et al., 2001; Bernstein and Nabalamba, 2007; Rhodes and Campbell, 2002;
Rutter et al., 2004). The risk of developing cancer in IBD patients increases with
severity and duration of inflammation (Rutter et al., 2004). In UC patients, the risk
of developing colorectal cancers is 1-3% at 10 years and 18% and 30 years of
disease (Delaunoit et al., 2006; Eaden et al., 2001). One Swedish study reported
an approximate six-fold increase in CRC development in UC patients compared
to that of the general population (Ekbom et al., 1990). The risk of developing
CRC is further increased in patients that develop both inflammatory bowel
disease and primary sclerosing cholangitis (Thackeray et al., 2011). A recent
Danish study suggested that a decreased risk of patients developing IBD related
CRC was due to the availability of better treatment options and management
(Jess et al., 2012). Another recent Danish population based cohort study showed
an increased of 5-year mortality rate in colon cancer patients with a history of IBD
(Ording et al., 2013). These studies suggest a strong link between IBD and
cancer development.
6
CRC tend to follow heterogenous, but largely similar molecular and phenotypic
pathways. While certain differences exist between inflammation associated and
sporadic CRCs, they follow similar phenotypic stages in the transformation of
normal epithelia into adenocarcinomas (Terzic et al., 2010). Inflammation
associated and sporadic cancers also involve the accumulation of similar
mutations and activation of common pathways (Rhodes and Campbell, 2002).
However, the endoscopic features and the timing of specific genetic changes in
IBD-associated colorectal cancer do differ from cancers that arise sporadically
(Figure 1-1). In sporadic cancers, the loss of adenomatous polyposis coli occurs
early and is frequent, whereas p53 mutations occur late and are less frequent. In
contrast, in IBD-associated cancer the loss of adenomatous polyposis coli
function generally occurs late and is infrequent, whereas p53 mutations occur
early and are more frequent (Terzic et al., 2010). IBD associated cancers are
often poorly differentiated and may be raised minimally above the surrounding
mucosa, whereas sporadic cancers tend to be well differentiated and polypoid.
(Delaunoit et al., 2006).
7
Figure 1-1 Comparison of IBD associated and Spontaneous Colon Cancers
This figure adapted from a review in Gastroenterology by Terzic et al, shows the
differences in progression mechanisms between colitis associated and
spontaneously occurring colon cancers (Terzic et al., 2010). Mutations in the
adenomatous polyposis coli, 61" nisms between colitis associated and
spontaneously occurring colon cancers ncers
lei followed by adenoma and
carcinoma formation. In colitis associated cancer chronic inflammation promotes
tumor development by activating proliferation and anti-apoptotic pathways in
premalignant pathways.
8
While it was earlier proposed that the increased cancer development in IBD
patients was directly caused by the genetic defects that predisposed them to IBD,
there is now convincing evidence that the cancer risk is acquired and caused by
the inflammation (Rhodes, 1996; Rhodes and Campbell, 2002). For example, a
large Swedish epidemiological study found no significant increase in the risk of
colorectal cancer in first-degree relatives of IBD patients (Ekbom et al., 1990). In
UC patients, the development of cancer has generally found to be localized to
inflamed areas, except in rectal inflammation (Ekbom et al., 1990). A recent
study of neoplastic colon polyps found that adenoma size correlates well with the
degree of inflammation in the bowel (Bilinski et al., 2012). Inflammatory status
also correlates with the DNA methylation in colon mucosa, which is thought to
contribute to cancer development by gene silencing (Saito et al., 2011). A better
correlation still, is observed between cancer and inflamed sites in CD, even in the
small bowel where cancers are otherwise rare (Church et al., 1985; Collier et al.,
1985). A similar incidental and spatial correlation between inflammation and
cancer has been reported in various animal models. Of special interest is the
colitis-cancer association in the cotton-top tamarin. This new world primate
universally develops colitis in captivity that is indistinguishable from UC in
humans. Many of the monkeys also go on to develop colon cancer, but cancer
has never been reported before the development of inflammation (Chalifoux and
Bronson, 1981). A recent Illinois case-controlled study identified inflammation as
9
an independent risk factor for colon cancer development in UC patients (Rubin et
al., 2013).
Inflammation has been linked to cancer development through numerous and
varied mechanisms (Kumar, 2010; Kundu and Surh, 2008). Cancer development
and growth can be driven by inflammation at every stage. Inflammation can
induce malignant cell transformation through genomic instability and epigenetic
changes caused by oxidative damage by reactive oxygen and nitrogen species
(Bertram, 2000; Costa et al., 2014; Rios-Arrabal et al., 2013). Cancer cell survival
can be enhanced through increased proliferation and decreased apoptosis of
transformed cells through expression of cytokines and activation of related
pathways such as tumor necrosis factor α and tumor growth factor to(Atsumi et
al., 2014; Seamons et al., 2013; Setia et al., 2013). Inflammation can help tumors
grow by escaping immune surveillance and increased vascularization through
production of pro-angiogenic factors (Gabrilovich and Nagaraj, 2009; Kong et al.,
2013). Metastasis can be enhanced through increased contact between cancer
and stromal cells as well increased mesenchymal to epithelial transition and
angiogenesis (Fuxe and Karlsson, 2012).
A key characteristic shared by both inflammatory and cancerous conditions is the
presence of leukocytes. Leukocytes produce factors such as radical species and
10
cytokines
that
largely
drive
cancer
development
in
the
inflammatory
microenvironment. Leukocytes involved in the innate and adaptive immune
systems participate in the progression of IBD and colon cancers (Goldszmid and
Trinchieri, 2012). Leukocytes can both limit and promote the progression of
inflammation and cancer. A large body of work has identified inflammationassociated pathways in leukocytes as playing a key role in cancer development
as well (Ben-Neriah and Karin, 2011; Demaria et al., 2010). For example,
seminal work by Greten et al shows that the IκK B molecule expressed in the
NFmo pathway links inflammation with cancer development in the colon (Greten
et al., 2004). One leukocyte population that has been shown to play important
roles in both inflammatory and cancerous conditions is the myeloid derived
suppressor cell (Ostrand-Rosenberg and Sinha, 2009).
1.2 Myeloid derived suppressor cells
1.2.1 Introduction to myeloid derived suppressor cells
Myeloid derived suppressor cells (MDSC) are a group of heterogenous cells of
myeloid lineage with numerous pro-tumorigenic effects. The defining murine
phenotype of MDSC is the expression of Gr-1, a glycophosphatidylinositol linked
membrane protein and CD11b (Ly-40), a transmembrane protein that pairs with
CD18 to form the Mac-1 integrin and an ability to suppress the immune system
(Dolcetti et al., 2008; Kusmartsev and Gabrilovich, 2006). MDSC consist of
“immature” macrophages, monocytes and dendritic cells, which have been
11
shown to play key role in tumor immune evasion, growth and progression. The
normal hematopoiesis process of myeloid cells is disturbed and the immature
cells are recruited out of the bone marrow leading to their peripheral
accumulation. In the normal mouse, about 20-30 % of bone marrow cells and 24 % of splenocytes are in an immature state and are Gr-1+ CD11b+. A marked
increase in systemic levels of MDSC, up to 50% of all splenocytes, is observed in
various mouse models of cancer (Kusmartsev and Gabrilovich, 2003;
Kusmartsev and Gabrilovich, 2006; Kusmartsev et al., 2000). Peripheral blood
levels of MDSC have been found to be increased in human cancer patients and
to correlate with metastatic tumor burden and cancer stage in a number of
human cancers including colon and breast cancer (Almand et al., 2001; DiazMontero et al., 2008). Two recent studies have focused on the clinical
significance of MDSC specifically in colorectal carcinomas. These studies report
that MDSC levels in the periphery and at the tumor site of CRC patients correlate
closely with disease state as well as nodal and distant metastasis (Sun et al.,
2012; Zhang et al., 2013).
1.2.2 MDSC Recruitment
MDSC numbers have been shown to be systemically upregulated in various
models of infectious and inflammatory models such as ovalbumin challenge,
polymicrobial sepsis and toxoplasmosis (Bronte et al., 1998; Kusmartsev and
Gabrilovich, 2006; Mencacci et al., 2002). MDSC expansion during inflammation
12
has generally been found to be lower than in neoplastic conditions and transient
(Gabrilovich and Nagaraj, 2009). Systemic levels of MDSC are increased in
cancer models, the key location of action for MDSC is believed to be the tumor
site where they are actively recruited (Dolcetti et al., 2008; Sawanobori et al.,
2008). Peripheral accumulation of MDSC via disruption of myelopoiesis and
recruitment is believed to be triggered by tumor derived soluble factors (Bronte et
al., 2006). Tumor resection has been shown to completely normalize
myelopoiesis and peripheral MDSC levels in numerous models (Salvadori et al.,
2000; Sinha et al., 2005). Among the many tumor derived factors, vascular
endothelial growth factor (VEGF) has received particular attention in its ability to
cause the accumulation of MDSC (Dolcetti et al., 2008). VEGF has been shown
to be responsible for recruitment of MDSC into the spleen and periphery in a
transgenic mouse model with spontaneously occurring mammary carcinoma
(Melani et al., 2003). Another study showed the ability of VEGF specifically
derived from the tumor to inhibit proper dendritic cell maturation and cause
MDSC accumulation (Gabrilovich et al., 1998). Interestingly, MDSC also produce
VEGF
and
further
increase
its
bioavailability
by
expressing
matrix
metalloproteinase 9 (Yang et al., 2004). The ability of tumors to interfere with the
colony stimulating factor network, especially the functions of granulocyte
macrophage colony stimulating factor (GMCSF) and macrophage colony
stimulating factor (MCSF), may also be important in MDSC accumulation
(Dolcetti et al., 2008; Hamilton, 2002; Menetrier-Caux et al., 1998; Rossner et al.,
13
2005).
Both
monocyte
chemotactic
protein-1
(MCP-1,
CCL2)
and
its
corresponding receptor, CCR2, were found to be critically important in the
migration of MDSC to the spleen and tumor site in a number of cancer models
(Boelte et al., 2011; Huang et al., 2007). As aforementioned, non-tumor
inflammatory responses, like those to antigen challenge or parasitic infection, are
also capable of upregulating MDSC. Sinha et al. have reported the importance of
the pro-inflammatory cytokines interleukin-1β, IL-6 and prostaglandin E2 in
MDSC accumulation (Cheng et al., 2011; Obermajer et al., 2011a; Sinha et al.,
2007b; Tu et al., 2008). These molecules are produced in inflammation well
before any signs of related cancer and therefore Sinha et al. have hypothesized
that inflammation may drive cancer development through the induction of MDSC,
which diminish immune surveillance against pre-malignant and malignant cells
(Obermajer et al., 2012; Sinha et al., 2007b). While work in recent years has
helped recognize a number of factors that may be important in the accumulation
and recruitment of MDSC, no clear pathway has been elucidated that explains
this process (Dolcetti et al., 2008; Kusmartsev and Gabrilovich, 2006). MDSC
recruitment has not been studied specifically in CRC models.
1.2.3 MDSC Function
MDSC are involved in tumor immune evasion and progression processes both
systemically and locally at the site of the tumor. They are capable of suppressing
the function of various anti-tumor immune cells (Dolcetti et al., 2008; Kusmartsev
14
and Gabrilovich, 2006). MDSC have been shown to inhibit tumor specific and
non-specific T-cells by inducing anergy or deletion. T-cells require L-arginine for
their proper function and proliferation (Raber et al., 2012; Rodriguez et al., 2010).
As shown in figure 1-2B, this process is dependent on the generation of radical
species and L-arginine metabolism by the enzymes arginase 1 and nitric oxide
synthase 2 (Dolcetti et al., 2008). MDSC also systemically inhibit natural killer
cells via downregulation of perforin, and alpha-galactosylceramide-activated
(anti-metastatic) natural killer T cells (Liu et al., 2007; Yanagisawa et al., 2006).
The mechanism by which MDSC can induce antigen specific tolerance in CD8+ T
cells has been described (Nagaraj et al., 2007). MDSC induce nitration of the
tyrosine residues in the CD8 and T cell receptor complex in these cells, thereby
inhibiting their ability to bind to specific peptide-major histocompatibility complex
and respond to specific antigens (Figure 1-2A). The ability to respond to nonspecific stimulation in these CD8+ T cells remains functional. The nitration
process is likely induced by release of reactive oxygen species and peroxinitrite
during direct cell-to-cell contact (Nagaraj et al., 2007). MDSC also create a
favourable microenvironment for tumor progression (Dolcetti et al., 2008;
Kusmartsev and Gabrilovich, 2006). This is largely accomplished by the
expression of a number of proangiogenic and prometastatic molecules such as
VEGF, matrix metaloproteinases and basic fibroblast growth factor (Dolcetti et al.,
2008). VEGF is a potent angiogenic and vasculogenic agent that has been linked
to poor prognosis in a number of cancers (Patan, 2004).
15
Figure 1-2 Methods of MDSC-mediated immune suppression
This figure, adapted from Nature Reviews Immunology by Gabrilovich and
Nagaraj, shows the key mechanisms used by MDSC to suppress the immune
system (Gabrilovich and Nagaraj, 2009). (A) In the periphery MDSC disrupt the
function of tumor antigen specific CD8+ T-cells by binding with CD8+ cells in an
antigen-specific manner and then disrupt the T-cell’s function by releasing radical
oxygen and nitrogen species into the local microenvironment. (B) At the tumor
site, MDSC are able to suppress the immune system in a non-specific manner by
disrupting T-cell function by L-arginine depletion via arginase I and nitric oxide
synthase II enzymes, as well as the generation of radical nitrogen species.
16
MDSC have been implicated in tumor refractoriness to anti-VEGF treatment,
most likely due to their ability to both produce VEGF and to enhance its
bioavailability by preventing breakdown (Shojaei et al., 2007). Interestingly, Yang
et al. showed the ability of MDSC to enhance vascular density and maturation as
well as decreased necrosis when directly injected into tumors and also that some
of the MDSC themselves were directly incorporated into the endothelium (Yang
et al., 2004).
MDSC are thought to have a regulatory role in inflammation by limiting the
inflammatory response via the same immunosuppressive mechanisms that make
them pro-tumorigenic (Dolcetti et al., 2008; Gabrilovich and Nagaraj, 2009). A
large body of work in recent years has shown the increased levels and a positive
immunosuppressive role for MDSC in inflammation related conditions ranging
from hepatitis and airway infections to trauma and sepsis (Arora et al., 2011;
Cheng et al., 2011; Hegde et al., 2011; Makarenkova et al., 2006; Rodriguez et
al., 2010; Sander et al., 2010). An immunosuppressive role has been proposed
for MDSC in two different models of colitis (Haile et al., 2008; Singh et al., 2012b).
Haile et al. also reported increased MDSC levels the peripheral blood of IBD
patients and suggested an immunoregulatory role for MDSC in IBD (Haile et al.,
2008). Many mechanisms of action of MDSC in inflammation and cancer models
have been reported recently, but much work remains to be done to study and
17
confirm their role in specific cancers. The goal of this project is to study the role
of these cells in an animal model of IBD and related cancer.
1.3 Interleukin-10 and Toll like receptor 4 deficient model
1.3.1 Models of Colitis associated cancer
Much of the recent progress in our understanding of IBD and colon cancer can
be attributed to the development of various animal models. A number of inducible
and spontaneously occurring models have been developed to study both
conditions, each with its own strengths and weaknesses (Kanneganti et al., 2011;
Strober and Fuss, 2006; Wirtz and Neurath, 2007). Mouse models of IBD can be
divided into three groups based on the defect in mucosal immunity that would be
considered the key to the onset of inflammation: (1) defects in epithelial integrity,
(2) defects in innate immunity and (3) defects in adaptive immunity. Chemically
induced models of IBD tend to cause severe inflammation via defects in barrier
function of the epithelial layer. Spontaneously occurring models of IBD are based
on genetic defects that can affect any of the aforementioned criteria for disease
onset (Strober and Fuss, 2006; Wirtz et al., 2007; Wirtz and Neurath, 2007). Like
the human disease, not all models of colitis reliably develop cancer. A number of
spontaneous and inducible models of colitis-associated cancer have been
developed (Kanneganti et al., 2011). There are essentially three types of colitisassociated cancer mouse models: (1) a tumor suppressor gene knockout
combined with an inflammation inducing chemical or infectious agent, (2)
18
chemical or infection induced inflammation which is often combined with a
carcinogen to accelerate cancer development and (3) genetic knockouts that
develop inflammation and cancer, but may also be combined with a carcinogen.
Common tumor suppressor gene and inflammation inducing combinations
include DSS treatment of with genetic knockouts such as p53 deficient and APCmin mice (Fujii et al., 2004; Tanaka et al., 2006). Cancer development mutations
such as RAG2 can also be combined with infectious models such as
Helicobacter hepaticus to induce inflammation-associated cancer (Erdman et al.,
2003). Inducible models include chronic doses of inflammation causing agents
such as carrageenan and dextran sulfate sodium (DSS) (Okayasu et al., 2002;
Tobacman, 2001). These models can take a long time to develop neoplasia, but
combining with doses of carcinogens such as axozymethane (AOM) and 1,2dimethylhydrazine can speed up cancer developmen (Kohno et al., 2005; Tanaka
et al., 2003). The spontaneously occurring models of colitis-associated cancer
involve mutations in key inflammatory and/or cancer pathways. The antiinflammatory cytokine interleukin-10 deficient mouse develops a CD like
inflammation and adenocarcinomas (Zhang et al., 2007b). Mice deficient in Gα M,
a g-protein signal transduction molecule, develop a UC like colitis and related
carcinoma (Rudolph et al., 1995). Other spontaneously occurring models of
colitis-associated cancer include, T-cell receptor βcell receptor eously occurring
models of colitis-associated cancer include, Tted carcinoma playText>(Zhang et
al., (Erdman et al., 2003; Kado et al., 2001). Recently, IL-10 and tumor necrosis
19
factor double deficient mouse has been described as developing a UC like
inflammation and associated cancer (Hale and Greer, 2012). While a number of
animal models of IBD related cancer have been developed, there is no
prototypical animal model that can simulate every aspect of the human disease
and each model has its own advantages and disadvantages. We are interested
in the IL-10 deficient mouse model as the cancer arises from a chronic
inflammatory driven by bacterial antigen, much like clinical IBD.
1.3.2 The Interleukin 10 Deficient Mouse
The interleukin-10 knockout (IL-10-/-) mouse is a spontaneously developing
model of IBD due to an aberrant immune response to normal enteric antigens
(Kuhn et al., 1993; Rennick et al., 1995; Strober and Fuss, 2006). The loss of
interleukin-10, an anti-inflammatory cytokine, leads to the development of severe
enterocolitis characterized by massive mucosal infiltration by lymphocytes, and
activated macrophages and neutrophils, mucosal lesions, abnormal mucosal
architecture, thickening of the mucosal wall and even the thickening of the
muscle layer in severely inflamed animals (Rennick et al., 1995; Strober and
Fuss, 2006). The inflammation in these animals generally becomes apparent at
the age of 8-12 weeks due to weight loss and predominantly affects the colon
(Zhang et al., 2007b). The lack of IL-10 does not affect the normal development
of T and B lymphocytes (Rennick et al., 1995). This model is dependent on
20
bacterial antigen stimulation because the inflammation can be altered in specific
pathogen free environments and avoided entirely in a germ free environment
(Rennick et al., 1995; Strober and Fuss, 2006). IL-10 is an anti-inflammatory
cytokines with potent suppressor effects on TH1 cells and macrophage effector
functions. A number of in vitro studies have established the ability of IL-10 to
inhibit the production of inflammatory cytokine such as IL-12 and Tumor necrosis
factor α (TNF-α), suppress the expression of various co-stimulatory molecules,
inhibit T-cell proliferation and even polarize T-cell differentiation towards
regulatory T-cells (Kuhn et al., 1993; Moore et al., 2001; Rennick et al., 1995;
Strober and Fuss, 2006). The development of IBD in IL-10 deficient mice is likely
due to the lack of IL-10 production by T-cells because a very comparable
phenotype is observed in T-cell specific IL-10 knockout animals. Anti-IL-10
antibody treatment and IL-10 receptor β chain knockouts also have similar
disease development as IL-10 knockout animals (Roers et al., 2004; Wirtz and
Neurath, 2007). Neutralizing antibody treatment against any one of the cytokines
that are modulated by IL-10, such as TNF-α, does not have any significant
ablating effect on the disease in IL-10-/- animals. IL-10 cytokine treatment on the
other hand has an ameliorating effect in IL-10 deficient mice (Rennick et al.,
1995). Polymorphisms in the IL-10 gene have been related to both UC and CD
development in a number of studies (Andersen et al., 2010; Fernandez et al.,
2005; Zhu et al., 2013). Recently, polymorphisms in the IL-10 gene and IL-10
receptor gene have been linked to a severe form early onset IBD (Glocker et al.,
21
2009; Kotlarz et al., 2012; Moran et al., 2013). In these patients, the lack of IL-10
or IL-10 receptor is likely important in myeloid derived cells, as a hematopoietic
stem cell transplant is often curative (Engelhardt et al., 2013).
The IL-10 deficient mouse model is a good model for studying IBD-associated
cancer because it highly correlates with the human disease. The spontaneous
occurrence of inflammation due to an uncontrolled immune response that is
driven by bacterial antigen stimulation simulates the manner in which clinical IBD
develops. Histologically and immunologically, this model resembles Crohn’s
Disease, where discrete areas of inflammation are spread among normal
mucosa and are believed to occur due to a TH1 cytokine and TH17 cytokine
profiles (Rennick et al., 1995; Sartor, 2006; Strober and Fuss, 2006; Wirtz and
Neurath, 2007; Zhang et al., 2007b). Cancer incidence in the IL-10 deficient
mouse increases over time, as is the case in IBD patients (Rutter et al., 2004).
MDSC have also recently been linked to inflammation in the IL-10 deficient
mouse (Singh et al., 2012b).
1.3.3 Toll like receptor 4
Luminal bacterial antigens drive the pathogenesis of IBD and related colon
cancer in both humans and animals (Hajishengallis et al., 2012; Tjalsma et al.,
2012). In order to detect foreign antigens, the body uses sensory receptors
22
known as pattern recognition receptors. Pattern recognition receptors, such as
the toll like receptor (TLR) family, have evolved to identify evolutionarily
conserved molecular patterns in microbes, known as microbial-associated
molecular patterns (Medzhitov and Janeway, 1999). Thirteen TLRs, which are
members of the interleukin 1 family of receptors, have been discovered and they
detect a variety of bacterial derived antigens ranging from flagellin to bacterial
DNA. All TLRs are transmembrane proteins, with some residing on the surface of
intracellular compartments. Stimulation of TLRs via their appropriate ligands
results in the activation of a potent immune response, generally mediated by the
adaptor molecule that is associated with all but one of the TLRs, Myeloid
differentiation primary response gene 88 (MyD88). MyD88 activation leads to the
activation of the nuclear factor κ B (NF-κB) pathway that causes production of
pro-inflammatory cytokines and changes in surface protein expression (Fukata
and Abreu, 2007; Fukata and Abreu, 2008; Takeda and Akira, 2004).
Toll like receptor 4 (TLR4), which senses lipolysaccharide from the outer
membrane of gram negative bacteria, was the first TLR to be discovered and is
the best studied pattern recognition receptor, but its role in both intestinal
inflammation and in related cancers remains controversial (Abreu et al., 2005;
Fukata and Abreu, 2007; Zhang et al., 2007a). The intracellular events following
the stimulation of TLR4 involves multiple mechanisms. In addition to MyD88
mediated NF-κB pathway, a second pathway mediated by TIR-domain
23
containing adapter-inducing interferon-β (TRIF) is also activated. The TRIF
pathway leads to the nuclear localization of interferon regulatory factor 3 (IRF-3),
which mainly causes the increased transcription of α and β interferons that are
important in the induction of the immune response. This pathway can also further
activate the NF-κB pathway, independent of MyD88 in a relatively delayed
fashion (Takeda and Akira, 2004). Normally TLR4 signaling is downregulated in
the epithelia following birth, which may reflect a tolerance mechanism to luminal
colonization, however expression is modulated in epithelia and lamina propria
cells in chronic inflammation and in malignancy (Abreu et al., 2005). Since TLRs
play such an important role in mediating the immune response, it was initially
postulated that suppressing either TLR4 or MyD88 function would decrease
inflammation and alleviate IBD symptoms, but generally the reverse has been
reported (Fukata et al., 2005). In the dextran sodium sulfate (DSS) induced
model of colitis, TLR4 deficient mice undergo increased weight loss and rectal
bleeding as well as increased susceptibility to bacterial translocation. The
bacterial translocation is explained by the lack of a potent immune response in
colon, which leads to decreased bacterial clearance. The increased bleeding
may be caused by increased apoptosis accompanied by the loss of epithelial
proliferation for which TLR4 is partially responsible (Abreu et al., 2005; Fukata
and Abreu, 2007). These data taken together, suggest a critically important
homeostatic role for TLR-4 that may be more important than its pro-inflammatory
24
role in the pathogenesis of IBD (Fukata and Abreu, 2007; Gonzalez-Navajas et
al., 2010; Rakoff-Nahoum and Medzhitov, 2009; Zhang et al., 2007a).
1.3.4 IL-10 TLR4 Double Deficient Mouse
Our laboratory has developed a novel IL-10 TLR4 double deficient mouse.
Previous work from our lab shows that IL-10 TLR-4 double deficient mouse has
greatly increased incidence of cancer. This is associated with a small increase in
inflammation. In our hands, IL-10 knockouts develop adenocarcinoma in about
20% of mice at 6 months of age. We have found that 50% of double deficient
mice develop cancer by just 3 months of age (Zhang et al., 2007a). The role of
TLR-4 in the pathogenesis of inflammation-associated cancer remains unclear.
While we report an increased incidence of cancer in absence of TLR-4 in the IL10 deficient model, others have reported a decrease in the induced chronic DSS
and AOM model of colitis-associated cancer (Fukata et al., 2007). This is
especially interesting, considering Greten et al. found that the main NF-κB
pathway, which is activated by a number of mechanisms including TLR-4, in
myeloid derived leukocytes is important for the growth and progression of the
cancer in the same induced chronic DSS and azoxymethane model. They
concluded this after finding that knocking out the main NF-κB pathway
specifically in myeloid cells caused the average size of the tumor to be much
decreased compared to controls (Greten et al., 2004). Alternations in the NF-κB
25
in signaling pathway, which would alter chemokine levels and affect leukocyte
recruitment, appears to be very important for inflammation associated cancer
development (Greten et al., 2004). We have found that IL-10 TLR-4 double
deficient mice have significant changes in the message levels of various
chemokines, including RANTES (regulated upon activation, normal T-cell
expressed and secreted) and Macrophage inflammatory protein-1r, as compared
to IL-10 deficient mice (Zhang et al., 2007a). Interestingly, our preliminary data
showed that recruitment of MDSC into the colon is increased in IL-10 deficient
mice as compared to wild type counterparts. MDSC recruitment was further
increased IL-10 TLR4 double deficient as compared to IL-10 deficient mice.
1.4 Hypothesis and Objectives
Inflammatory bowel disease is a key driver of colorectal cancers. Inflammatory
pathways in both epithelial cells and leukocytes are associated with colon cancer
initiation and development. MDSC are a protumorigenic cell type, whose
peripheral recruitment correlates with colon cancer progression. MDSC have also
been linked to inflammation in the gut, but their role remains unclear. We have
found increased recruitment of MDSC of IL-10 deficient mouse model of colitisassociated cancer. MDSC recruitment is further increased in the IL-10 TLR4
double deficient mouse, which has a much-increased incidence of cancer. The
study of MDSC in colon cancer in warranted due to their presence in high
numbers
and
immunosuppressive
properties,
26
despite
their
potentially
immunosuppressive role in inflammation. The regulation and recruitment
mechanisms involved are important and potential targets for therapeutic
manipulation.
The hypothesis for the work presented in this thesis is that myeloid derived
suppressor cells exacerbate cancer development in colitis-associated cancer and
TLR4, an important regulator of intestinal homeostasis and leukocyte recruitment,
regulates recruitment and/or function of myeloid derived suppressor cells in the
gut.
Objectives:
Ø To determine the role of MDSC in cancer development in the IL-10
deficient model
Ø To determine whether TLR4 regulates cancer development and MDSC
recruitment in the IL-10 deficient mouse model
Ø To determine if TLR4 modulates MDSC function
Ø To identify MDSC chemoattractants in vitro and in vivo
27
Chapter 2: Materials and Methods
28
2.1 Animals
All experiments were approved by the Animal Care Committee of the University
of Calgary and conform to the guidelines established by the Canadian Council for
Animal Care. Mice were bred and housed in a specific pathogen-free
environment on standard chow diet at the University of Calgary. IL-10-deficient
(IL-10-/-) mice were generated by gene targeting in embryonic stem cells as
previously described by Kuhn et al. on the 129SvEv background (Kuhn et al.,
1993). IL-10 deficient mice were originally obtained from Dr. R Fedorek
(University of Alberta, Canada). Mice deficient in IL-10 and TLR4 were generated
from IL-10-/- mice heterozygous for TLR4 (IL-10-/- TLR4+/-). TLR4 deficient mice
(Jackson Labs, Bay Harbour, USA) on the C57BL/10ScN background were
backcrossed for a minimum of 8 generations onto the IL-10-/- 129SvEv
background before breeding heterozygotes (IL-10-/- TLR4+/-). All mice were
genotyped for IL-10 and TLR4 by PCR analysis for genomic DNA purified from
tail biopsies with the DNeasy tissue kit (Qiagen, Germany). Following PCR, the
amplified DNA was separated by gel electrophoresis run in a 1.5% agarose gel
with ethidium bromide and visualized under ultraviolet light. The IL-10-/- sense
primer was GCCTTCAGTATAAAAGGGGGACC and the anti-sense primer was
GTGGGRGCAGTTATTGTCTTCCCG. The TLR4-/- sense primer sense primer
was GCAAGTTTCTATATG the anti-sense primer was CCTCCATTTCCAATA. IL10-/- TLR4-/- breeding pairs and IL-10-/- TLR4+/+ breeding pairs were set up. Age
29
and sex matched mice housed in the same facilities were used in all
experiments.
2.2 Evaluation of Inflammation and Cancer
Mice were sacrificed by cervical dislocation. Hyperplasia and inflammation were
evaluated macroscopically in excised colons. Rolled excised mouse colons were
fixed in 10% formalin solution or frozen in optimal cutting temperature compound
(OCT, VWR, West Chester, USA). Formalin fixed sections were dehydrated
using graded alcohol immersions and embedded in paraffin wax. Colon sections
(5-8μm) were hydrated and labeled with hematoxilyn and eosin (H&E). Dysplasia
and inflammation were evaluated histologically in H&E labeled sections. Paraffin
sections were used to evaluate morphology and evaluate dysplasia. OCT frozen
sections were used for experiments where we had to both evaluate dysplasia
and do immunohistochemistry for MDSC levels.
Ø Macroscopic analysis of hyperplasia
Mucosal hyperplasia in the colon was assessed macroscopically in excised
colons via a previously published scoring system (Zhang et al., 2007b). Polyp
scores were assigned according to the number of polyps observed with a score
30
of 0 for none, 1 for one to three individual polyps, 2 for three to six individual
polyps and 3 for six or more polyps, merged polyps or raised plaques.
Ø Macroscopic evaluation of Colonic Inflammation
Inflammation was assessed macroscopically in excised colons via a previously
published scoring system (Zhang et al., 2007b). The presence of each of the
following variables was given a score of 1: erythema, edema, diarrhea, stricture,
hemorrhage, adhesions and ulceration. Bowel wall thickness was measured in
millimeters and added to the score.
Ø Histological analysis of Dysplasia
Dysplasia was evaluated histologically in colon sections by a pathologist, Dr.
Stephan Urbanski (Alberta Health Services), and myself in a blinded fashion
using a previously published scoring system based on changes in crypt
architecture, epithelial dysplasia, presence of submucosal invasion and serosal
adhesions (Zhang et al., 2007b). Crypts were given a score of 0 for normal, 1 for
goblet cell depletion, 2 for branching, irregular, dilate lumen or back-to-back
glands and 3 for complex budding and crypt reforming. Epithelia were given a
score of 0 for normal, 1 for hyperplasia or aberrant crypt foci, 2 for low-grade
dysplasia defined as nuclear enlargement, mild hyperchromatism, nuclear
31
crowding with stratification and 3 for high-grade dysplasia defined as nuclear
stratification, prominent hyperchromatism, pleomorphism, loss of nuclear polarity.
Submucosal invasion and serosal adhesions were scored as 1 each when
present. Adenocarcinoma was defined as submucosal invasion by highly
dysplastic crypts.
Ø Histological evaluation of Colonic Inflammation
Colitis was scored histologically in a blinded manner based on a previously
published scoring system based on the level of damage to the normal mucosa
(Zhang et al., 2007b). Scores were based on damage to normal mucosal
architecture (0-3, based on severity), degree of cellular infiltration (0-3, based on
severity), extent of muscle thickening (0-3, based on severity), loss of goblet cells
(1) and presence of crypt abscesses (1).
2.3 Colon Immunohistochemistry for Gr1+ CD11b+ Cells
To identify Gr1+CD11b+ cells in the colon we used immunohistochemistry in OCT
frozen sections. This protocol was developed with the help of Dr. Pina Colarruso
of the Live Cell Imaging facility at the University of Calgary. Entire colons were
rolled and frozen in OCT. Cryosections (5-8 μ5) were fixed in cold acetone for 1
hour and incubated overnight at 4°C with 2μg/ml FITC conjugated rat anti-
32
mouse Gr1 antibody (clone RB6-8C5, eBioscience, Sand Diego, USA). Next,
sections were incubated for 1 hour with 1% anti-rat Alexa488 anti-body to
enhance the FITC signal. Sections were blocked with 10% normal rat serum for 1
hour and incubated overnight at 4°C with 2ug/ml PE conjugated rat anti-mouse
CD11b antibody (clone M1/70, eBioscience, Sand Diego, USA). There was a 1X
PBS wash step repeated 3 times between each step. Appropriate combinations
of rat anti-mouse and rat isotype antibodies were used to control against nonspecific binding (Please see chapter 3.2 for more detail). Double labeled cells
were counted following imaging of whole tissue sections on an Olympus IX70
inverted epi-fluorescence microscope (Olympus, Centre Valley, USA). Images
were recorded with QImaging Retiga Exi 12-bit CCD camera (model 32-00558A150, QImaging, Surrey, Canada) and Volocity software (versions 4-6, Perkin
Elmer, Waltham, USA). The total area of mucosal and submucosal tissue was
determined using serial H&E stained tissue sections. Double positive cells were
quantified and standardized per unit area (st2) of the mucosa and sub mucosa.
2.4 Flow Cytometry Experiments
All flow cytometry experiments were conducted with an Attune Acoustic Focusing
Cytometer (Life Technologies, Burlington, Canada) in the Flow Cytometry Core
Facility, University of Calgary. Results were analyzed with Attune Cytometric
Software (Life Technologies, Burlington, Canada).
33
Ø Flow Cytometry of Lamina Propria Gr-1+ CD11b+ MDSCs
Flow cytometry was used to quantify Gr1+CD11b+ cells in the lamina propria of
colon tissue. Excised entire colons were cut into 5 mm pieces. These pieces
were washed five times with 20 mM HEPES HBSS solution by gentle stirring.
Colon pieces were subjected to EDTA digestion to remove epithelium by gently
stirring at 37°C in 20 ml of 5 mM EDTA 10% FBS HBSS solution for 15 minutes
(4X). Next, tissues were gently stirred at 37°C in 20ml 100 units of activity/ml
Collagenase Type II (Invitrogen, Grand Island, USA) in Complete RPMI for 1
hour. The collagenase digestion process that breaks down the mucosa into
individual cells was repeated for a total of 3 times with lamina propria cells
(supernatant) being collected and washed in Complete RPMI 1640 between
digestions. After the last diegestion, cells were resuspended in 1X PBS and 1 x
106 cells were incubated with either 2x10-7 μg of FITC conjugated isotype (IgG2a,
eBioscience, Sand Diego, USA) antibody, PE conjugated isotype (IgG2a,
eBioscience, Sand Diego, USA) antibody, FITC conjugated rat anti-mouse Gr-1
antibody (clone RB6-8C5, eBioscience, Sand Diego, USA), PE conjugated rat
anti-mouse CD11b antibody (clone M1/70, eBioscience, Sand Diego, USA) or
both FITC conjugated Gr1 and PE conjugated CD11b antibodies. Flow cytometry
analysis was performed to determine the percentage of Gr1+CD11b+ cells. The
percentage of double positive cells was determined in the population gated for
granulocytes and monocytes in the side and forward scatter plot.
34
Ø Flow Cytometry of Bone Marrow Gr-1+ CD11b+ MDSC
Bone marrow cells were isolated by flushing of excised femur and tibia bones
with 1X PBS and washed. Cells were labeled as previously described and flow
cytometry analysis for the percentage of MDSC was performed.
Ø Flow Cytometry of Gr-1+ CD11b+ MDSC Splenocytes
Excised spleens were washed in 1X HBSS and mechanically disrupted in
complete RPMI. A single cell suspension was obtained with a 100 μm cell
strainer. Cells were labeled as previously described and flow cytometry analysis
for the percentage of MDSC was performed.
Ø Total and Differential White Blood Cell Counts
Blood was collected from anesthetized mice via cardiac injection. 50 μl of blood
was added to 440 μo of 3% acetic acid and 10 μo of 5% crystal violet solution.
This solution was used to count the total number of white blood cells using a
hemocytometer. Two droplets of blood were placed on a slide and a second slide
was used to smear the blood across the first slide. Blood smears were stained
using Hemacolor Harleco Kit (EMD Science, Missisauga, Canada). A total of 100
35
white blood cells were counted in a random manner on each slide and
categorized into granulycyte, monocyte or lymphocyte like cells.
Ø Lamina Propria Cell Leukocyte Differential
Colonic lamina propria cells were isolated as previously described. 1 x 106 cells
were each incubated with either 2x10-7 7g of CD4 (T-cells, Clone GK1.5), CD19
(B-cells, Clone eBio1D3), CD11c (dendritic cells. Clone eBio1D3), F4/80
(monocytes, Clone BM8) or isotype (IgG2aI and IgG2bn) antibodies (eBioscience,
St Louis, USA). Gr1+CD11b+ cell flow cytometry was performed as previously
described. The percentage of each cell type was determined by flow cytometry
analysis with appropriate forward/side scatter plot gating for each population.
Ø TLR4+ MDSC Flow Cytometry
Gr1+CD11b+ cells were isolated from the bone marrow of IL-10-/- and IL-10-/TLR4-/- mice and Gr1+CD11b+ cells flow cytometry was performed as previously
described. Cells were also labeled with allophycocyanin attached anti-mouse
TLR4 antibody (Clone MTS-510, eBioscience, San Diego, USA) or triple labeled
with anti-mouse Gr1, CD11b and TLR4 antibodies. Triple positive cells were
determined by looking for TLR4+ cells in the population gated through
Gr1+CD11b+ cells.
36
2.5 MDSC Isolation
Ø Bone Marrow derived Gr1+CD11b+ cell Isolation
Gr1+CD11b+ cells were isolated from the bone marrow of 6-month-old IL-10-/mice via percoll density gradient centrifugation as previously described
(Kusmartsev et al., 2000). Briefly, femurs and tibiae of mice were removed and
the marrow was washed out with 1X PBS. Gradient layers (2 ml each) of 100 %
percoll with cells, 70 % percoll, 60 % percoll, 50 % percoll and 1X HBSS were
centrifuged at 1800 x g for 30 minutes. Cells were collected from the interface
between the 50 % and 60 % and washed with 1X PBS. Using flow cytometry
analysis, we determined that Gr1+CD11b+ cell purity in isolates varied between
82-95 %.
Ø Spleen derived Gr1+/CD11b+ Cell Isolation
Gr1+CD11b+ cell isolation using the percoll gradient density centrifugation as
described yielded a low purity of cells. We used a Myeloid-Derived suppressor
cell isolation kit (Miltenyi Biotech, Cologne, Germany) to obtain a purer
population as previously described (Brudecki et al., 2012). MDSC are a
heterogenous group of cells with a number of sub-populations within them, which
differ in function and phenotype (Gabrilovich and Nagaraj, 2009). The Gr1
epitope is found in both Ly-6G and Ly-6C glycoproteins. This kit allows for the
isolation of either polymorphonuclear Gr-1
37
high
+
Ly-6G and mononuclear Gr-
1
1
dim
dim
–
Ly-6G myeloid cells. We chose to isolate and study mononuclear Gr–
Ly-6G myeloid cells from the spleen because mononuclear cells were
the majority in MDSC isolated from the bone marrow. Briefly, splenocytes
were isolated by mechanical digestion of spleens and incubated with Ly-6G
Biotin and anti-biotin microbeads. Labelled cells were passed through magnetic
MACS columns and negative cells were collected. Collected cells were incubated
with anti-Gr1 biotin and streptavidin microbeads. Anti-Gr1 labeled cells were
passed through MACS columns and positive cells were collected. Flow cytometry
analysis of isolated cells showed greater than 92 % purity of Gr1+CD11b+ cells.
MDSC Function in vitro
Functional activity of Gr1+CD11b+ cells isolated from the bone marrow and
spleen was measured in cells isolated from 3-month-old mice.
Ø Arginase I Activity Assay
Gr1+CD11b+ cells isolated from the bone marrow or spleen were tested for
arginase I activity by measuring the production of L-ornithine and urea from Larginine (Rodriguez et al., 2004). Gr1+CD11b+ cells (5 x 105) were lysed in RIPA
buffer (Radio-immunoprecipitation assay buffer, Sigma Aldrich, St. Louis, USA)
for two hours. Cell lysates were added to 25 μl of Tris-HCl (50 mM; pH 7.5)
38
containing 10 mM MnCl2. This mixture was heated at 55–60°C for 10 min to
activate the arginase I enzyme. Next, a solution containing 150 μl carbonate
buffer (100mM; Sigma Aldrich, St. Louis, USA) and 50μl L-Arginine (100mM,
Sigma Aldrich, St. Louis, USA) was added and incubated at 37°C for 20 min. The
hydrolysis reaction from L-Arginine to urea was detected with diacetyl monoxime
(Sigma Aldrich, St. Louis, USA) by spectrophotometry (540nm) following
incubation at 95°C for 10 min. A standard curve for urea (Sigma Aldrich, St. Louis,
USA) was used to convert absorbance values into μa urea. RIPA buffer was
used as a negative control. Hepatocyte cell lysates, which are known to express
high levels of arginase I enzyme, were used as a positive control.
Ø Nitrite measurement
Nitric oxide is produced from L-arginine by the nitric oxide synthase 2 (NOS2)
enzyme. This reaction forms nitrates and nitrites as stable end products. The
Griess reaction was used to measure total nitrite levels in Gr1+CD11b+ cell
supernatants as an indication of nitric oxide synthase activity, after reduction of
nitrates to nitrites as previously described (Miranda et al., 2001). The Griess
reaction assay was performed using a kit according to manufacturer’s
instructions (Invitrogen, Grand Island, USA). Briefly, Gr1+CD11b+ cells, isolated
from the bone marrow or spleen, were cultured in 10% FBS (Invitrogen, Grand
Island, USA) 2% PenStrep (Sigma Aldrich, St. Louis, USA) DMEM medium
39
(Invitrogen, Grand Island, USA) for 18 hours at 37°C. In 96 well plates, triplicate
samples of sodium nitrate standards (100 μ.) or supernatant (100 μr) from 5 x
105 cultured Gr1+CD11b+ cells were studied. Vanadium III chloride (VCl3, Sigma
Aldrich, St. Louis, USA) solution (80μo of 400 mg VCl3 in 50 mL of 1M HCl) was
added to each well to reduce nitrates to nitrites followed by the Griess reagent
(20 μr). Griess reagents are sulphanilic acid, which reacts with nitrites to form a
diazonium salt, and N-alpha-naphthyl-etheylenediamine, which reacts with the
diazonium salt and changes colour to pink. The plate was incubated at 37°C for 1
h and before the colourimetric changes were read at 550 nm using a
spectrometer.
Ø T-cell Proliferation Suppression
Gr1+CD11b+ cells (1 x 105) isolated from the bone marrow or spleen were
cultured in RPMI 1640 with CD4+ T-cells (5 x 105) isolated from spleens by T-cell
enrichment kit (BD Biosciences, San Jose, USA) and stained with CFSE dye
(Invitrogen, Grand Island, USA). T-cells proliferation was stimulated with 1 μg/ml
anti-CD3 (Clone SPV-T3b, Invitrogen, Grand Island, USA) and 500 ng/ml antiCD28 (Clone 37.51.1, Invitrogen, Grand Island, USA) antibody for 72 hours.
CFSE is equally divided between the daughter cells of proliferating cells, thereby
lowering the total amount of dye in daughter cell. The ability of MDSC to
40
suppress T-cell proliferation was determined by flow cytometry analysis for the
percentage of CFSE low cells. Unstimulated T-cells were used as controls.
2.7 Bone Marrow Transplant
In order to study the role of TLR4 within leukocytes on cancer development we
generated chimeric mice. Bone marrow chimeric mice were generated as
previously described (Carvalho-Tavares et al., 2000). IL-10-/- and IL-10-/- TLR4-/mice at 3 months of age were irradiated with two doses of 5 Gy y th
twGammacell,
137
Cs γ-irradiation source, Nordion International, Kanata, Canada)
given three hours apart. Bone marrow was collected from donor IL-10-/- and IL10-/- TLR4-/- mice as previously described. Two hours after irradiation, the
recipient mice were injected with 8 x 106 donor bone marrow cells from the
opposite genotype via tail vein. Control mice were irradiated and then injected
with bone marrow cells from donor mice of the same genotype. Donor mice were
all males and recipients were all females to allow us to confirm that the transplant
was successful. Irradiated mice were given 2% neomycin (Sigma Aldrich, St
Louis, USA) in drinking water for 2 weeks. Mice were sacrificed at 6 months of
age and inflammation and cancer development were evaluated as previously
described.
2.8 Molecular Techniques
41
Ø Real time PCR
TLR4, MCP-1 and SDF-1 message levels were determined in mouse colon
tissue from ileo-cecal junction and distal colon by real time polymerase chain
reaction as previously described (Zhang et al., 2007b). Briefly, total RNA was
isolated from colon tissues using QIAzol (Qiagen Science, Missisauga, Canada).
The RNA was further purified using Deoxyribonuclease Message Clean kit
(Genhunter Corporation, Brookline, USA) according to manufacturer instructions.
Total RNA was determined by measuring absorbance at 260 nm. Complimentary
DNA (cDNA) was generated amplified using standard polymerase chain reaction
(Ayala-Torres et al., 2000).
Primers and probes for mouse TLR4, MCP-1 (CCL2) and SDF-1 (CXCL12) were
purchased from Applied Bioscience (Life Technologies, Burlington, Canada).
Three replicates of cDNA (1:5 diluted) were amplified using the ABI Prism
7900HT Sequence Detection System (Life Technologies, Burlington, Canada).
The amplification reaction mixture contained 5 μl of cDNA, 5 μ of probe and
primer mix and 2X Universal Master Mix (Life Technologies, Burlington, Canada).
GAPDH was included as an internal control to normalize for varying quantity of
cDNA, using 20X GAPDH Mix (Life Technologies, Burlington, Canada).
Thermocycler parameters were 50°C for 2 min, 95°C for 10 min, 40 cycles of
95°C for 15 s and 60°C for 1 min. The results were analyzed using Applied
42
Biosystems RQ manager (Life Technologies, Burlington, Canada).
Ø Western Blot
In order to determine the levels of TLR4, MCP-1 and SDF-1 protein in mouse
colons, western blots were performed as previously described (Khajah et al.,
2013). 50 mg of excised colon tissue was lysed in RIPA buffer with 1:100
mamalian protease inhibitor cocktail (Sigma Aldrich, St Louis, USA). The
supernatant was added to equal volume 2X SDS lysis buffer plus 100 μb PMSF,
100 μP Na3VO4, 10 μ 10F Aprotinin/Leupeptin, and 10 μ0 pepstatin. The
samples were boiled for 10 minutes at 90°C and lysates were loaded into 10%
sodium dodecyl sulfate-epolyacrylamide (SDS-PAGE) gel. After electrophoresis
at constant voltage of 100V for 1 hour, proteins were transferred to a
nitrocellulose membrane and were blocked with 5% milk for 1 hour. TLR4 (Clone
267518), MCP-1 (Clone 123616) and SDF-1 (Clone 79018) anti-mouse
antibodies were purchased from R&D Systems, Minneapolis, USA. The
membrane was incubated overnight at 4°C with 1/1000 anti-mouse antibody in
5% mlik. The next day, the membrane was washed and incubated for 1 hour with
1/10,000 dilution of anti-rabbit HRP-conjugated secondary antibody. The
membrane was developed with super signal enhanced chemiluminescence and
visualized with Kodak x-ray film. Bands were semi-quantitatively analyzed by
43
measuring density over β-actin using ImageJ (National Institutes of Health,
Bethesda, USA).
Ø Immunoprecipitation
We were unable to visualize any protein bands for SDF-1 via western blot. To
increase the SDF-1 protein for western blot we used immnoprecipitation-western
blot technique. SDF-1 protein was pulled down using an immunoprecipitation kit
according to manufacturer’s instructions (Cell Signaling Technologies, Danvers,
USA). Whole excised colons were lysed in RIPA buffer with 1:100 mamalian
protease inhibitor cocktail. 200 μc of lysed tissue was added to 200 il. 200 cktail.
A agarose beads slurry. After a one hour incubation at 4°C the mixture was
centrifuged and the supernatant was collected. 200μl of the supernantant was
incubated with 1:1000 anti-mouse SDF-1 antibody at 4°C overnight. The next day,
20μl of 50% Protein A agarose beads slurry (Cell Signaling Technologies) was
added to the supernatant and incubated at with gentle rocking for 3 hours at 4°C.
After 30 seconds of microcentrifugation, the pellet was washed 5 times with
500μl of the lysis buffer. The pellet was resuspended in 20μl of 3X SDS sample
buffer, heated at 95°C for 5 minutes and microcentrifuged. 30μl of the sample
was run through the western blot protocol as previously described.
2.9 Chemotaxis Assays
44
We studied MDSC chemotaxis in vitro in three different assays. MDSC were
isolated from the bone marrow of IL-10-/- and IL-10-/- TLR4-/- mice using percoll
density gradient centrifugation as previously described. Chemoattractants
included WKYMVm (an fMLP like peptide, Phoenix Pharmaceuticals, Burlingame,
USA), KC (keratinocyte chemotactic peptide, R&D Systems, Minneapolis, USA),
MIP-2 (macrophage inflammatory protein 2, CXCL2, R&D Systems, Minneapolis,
USA), MCP-1 (monocyte chemotactic protein, CCL2, R&D Systems, Minneapolis,
USA), SDF-1 (stromal derived factor 1, CXCL12, R&D Systems, Minneapolis,
USA), Prostaglandin E2 (R&D Systems, Minneapolis, USA), IL-6 (R&D Systems,
Minneapolis, USA), VEGF (R&D Systems, Minneapolis, USA) and IL-1&D S&D
Systems, Minneapolis, USA).
Ø Underagarose Chemotaxis Assay
Underagarose assay for MDSC cell migration was performed as previously
described (Heit and Kubes, 2003). Briefly, 1.2% agarose gels were poured in
small petri dishes. Three equidistant wells were formed in-line 2.5 mm apart in
the gel. Cells were placed in the outer two holes with chemoattractant in the
middle and incubated in 5% CO2 at 37°C for 4 hours. Migrant cells were reported
by counting the number of cells moving towards the chemoattract well minus the
cells moving randomly out of the chamber in the opposite direction using a Zeiss
Axiovert 135 microscope.
45
Ø Ibidi Chemotaxis Assay
The ibidi chemotaxis assay was performed according to the manufacturer’s
instructions as previously described (Zantl and Horn, 2011). Briefly, 3 x 102 cells
are placed in a small slit between two reservoirs in the proprietary ibidi μ
bchemotaxis chamber. The chemoattractant was placed in one of the large
reservoirs. The movement of cells in the slit was observed using a Zeiss Axiotron
100 inverted microscope by time-lapse photography at one-minute intervals for
16 hours. The number of chemotactic cells was determined by subtracting the
number of cells with net movement vector away from the reservoir with
chemoattractant from the cells with net movement vector towards it.
Ø Transwell Chemotaxis Assay
Transwell chemotaxis assay was performed using Corning Transwell plates
(Corning Incorporated, Lowell, USA) that contain two chambers as previously
described by us (Schicho et al., 2010). Briefly, 5 x 105 cells were placed in 100 μ
1 of complete RPMI with 10% FBS in the upper chamber, which has 8 μi pores
at its bottom surface. The lower chamber had the chemoattractant in 250 μi of
complete RPMI with 10% FBS. Loaded transwell plates were placed in 5% CO2
at 37°C for 3 hours. Lower chambers containing only 10% FBS complete RPMI
46
were used as controls. Same chemoattracant concentration in both upper and
lower chambers was used as a control to test chemokinesis. Cells that migrated
to the lower chamber were considered chemotactic. In order to confirm that
migrating cells were MDSC, migrating cells were transferred onto slides using a
cytospin. Slides were stained with anti-mouse Gr1 and CD11b antibodies and
MDSC were counted as previously described via immunohistochemistry.
2.10 Statistical Analysis
Figures were generated and statistical analysis was performed using Graphpad
Prism software (Version 4-5, Graphpad Software Inc, La Jolla, USA). Data are
expressed as Mean ± Standard Error of Mean. Statistical significance was
determined between two groups by Student’s T-test (two tailed) or by one-way
ANOVA with Bonferroni’s correction for three for more groups. A P value less
than 0.05 was considered statistically significant.
47
Chapter 3: The role of MDSC in the Interleukin-10 deficient mouse
48
Summary
The following experiments show that MDSC play a key role in the progression of
colitis associated cancer in the IL-10 deficient mouse model. First, the presence
of
Gr1+CD11b+
cells
in
IL-10
deficient
colons
is
established
via
immunohistochemistry and flow cytometry analysis. Second, the activity of key Larginine metabolism pathways and the ability to suppress T-cell proliferation is
shown in Gr1+CD11b+ cells isolated from IL-10 deficient mice. The Gr1 and
CD11b markers as well as the immunosuppressive phenotype confirm that these
cells are MDSC. Finally, we show that the pharmacological depletion of MDSC in
vivo decreases neoplastic changes and the adoptive transfer of MDSC in vivo
increases neoplastic changes in the IL-10 deficient mouse. Together these
experiments establish an important protumorigenic role of MDSC in the IL-10
deficient mouse model of colitis-associated cancer.
3.1 Cancer and Gr1+CD11b+ counts in the IL-10 deficient mouse
This section aims to establish cancer levels and MDSC counts in the colons of
IL-10 deficient mice. Adenocarcinoma incidence was studied in colon sections
with the help of a blinded pathologist. MDSC levels in the colon were studied
using immunohistochemistry in colon sections and flow cytometry analysis of
lamina propria cells.
49
3.1.1 Colon cancer development is increased in the IL-10 deficient mouse
Cancer development was studied in hematoxylin and eosin labeled colon
sections by a blinded pathologist, Dr. Stephan Urbanski of Alberta Health
Services and Dr. Rui Zhang. Adenocarcinoma was described as submucosal
invasion by highly dysplastic crypts. Histological analysis by a trained observer
using H&E labeled slides is the definitive method of evaluating dysplasia and
cancer development. Other methodologies such as polyp scoring and various
blood tests can only indicate the possibility of neoplasia. Dr. Rui Zhang
demonstrated the increasing incidence of adenocarcinoma formation in IL-10
deficient mice as they age (Figure 3-1). In our hands, IL-10-/- mice on the
129SvEv background have a 12% incidence of colitis-associated cancer at 3
months of age. The incidence of cancer increases to 20% at 6 months of age. No
cancer is observed at 1.5 months (6 weeks) of age.
50
Incidence of Adenocarcinoma (%)
25
20
15
10
5
0
1.5 Months
3 Months
6 Months
Figure 3-1 Incidence of cancer increases with age in the IL-10 deficient
mouse
This figure illustrates the incidence of colon adenocarcinoma as a percentage in
IL-10 deficient mice raised in a specific pathogen free environment at 1.5, 3 and
6 months of age. These data were generated by Dr. Rui Zhang. n>10
51
3.1.2 Gr1+CD11b+ cell recruitment to the colon is increased in the IL-10
deficient mouse
Our next step was to determine whether Gr1+CD11b+ were recruited to the
colons of IL-10 deficient mice. Colon tissue was harvested from IL-10-/- mice at 3
and 6 months of age. The levels of Gr1+CD11b+ cells in mouse colons were
determined via immunohistochemistry in colon sections and flow cytometry
analysis of cells isolated from the colonic lamina propria.
The percentage of Gr1+CD11b+ cells in the lamina propria determined by flow
cytometry analysis following EDTA and collagenase digestion of colon tissues.
The EDTA digestion helps remove the epithelial layer and the collagenase
digestion is used to break down the lamina propria tissue into individual cells.
Isolated cells were labeled with Gr1 and CD11b antibodies. The double positive
analysis was performed on cells gated for granulocyte and monocyte size and
density in the forward and side scatter plot. Non-specific binding was controlled
using isotype antibodies. The percentage of Gr1+CD11b+ cells increases from
0.51 ± 0.40% in wild type mice to 3.0 ± 0.50% in IL-10-/- mice at 3 months of age
(Figure 3-4). This difference is further increased at 6 months from 0.15 ± 0.01%
to 4.4 ± 1.3%.
Immunohistochemistry for Gr1+CD11b+ cells was performed on frozen sections of
rolled wild type and IL-10-/- colons. Sections were labeled first with Gr1 antibody,
52
followed by a secondary plus blocking step and then with CD11b antibody. This
protocol was designed with the help of Dr. Rui Zhang and Dr. Pina Colarusso,
the head of the Live cell imaging facility at the University of Calgary. Non-specific
binding was checked using combinations of isotype control antibody and the two
primary antibodies. As shown in table 3-1, all combinations of isotype, Gr1 and
CD11b antibodies were tried to check against non-specific binding. The isotypes
only showed limited background staining (Figure 3-3A). Double positive cells
(golden colour) were counted in each section histologically (Figure 3-3D). The
area of the mucosa was determined histologically using hematoxylin and eosin
labeled sections and data were expressed as double positive cells per unit area
of mucosa to control for size variance between sections. The number of
Gr1+CD11b+
cells
per
unit
area
of
mucosa
( μ (2 )
determined
by
immunohistochemistry were significantly increased in the IL-10-/- mouse (21.3 ±
5.3, n=6) as compared to wild type mice (2.4 ± 2.0, n=5) at 3 months of age
(Figure 3-3). The number of Gr1+CD11b+ cells/ce2 in IL-10 deficient mice were
further increased to 95.6 ± 18.8 at 6 months of age (n=6).
53
Table 3-1 Combinations of primary and secondary antibodies used in
Gr1+CD11b+ cell colon immunohistochemistry to check for non-specific
binding
1st Antibody
2nd Antibody
Gr-1 (FITC)
CD11b (PE)
ISO-FITC
CD11b (PE)
Gr-1 (FITC)
ISO-PE
ISO-FITC
ISO-PE
Both flow cytometry and immunohistochemistry analysis each have advantages
and disadvantages. Lamina propria cell isolation and flow cytometry analysis can
be performed within a day and it is easier to control for non-specific binding.
Immunohistochemistry takes longer, especially in the case of double labeling,
and checking against non-specific binding requires weeks if not months of work.
Immunohistochemistry offers the advantage of allowing visualization of both the
exact location of labeled cells in the mucosa as well as that of hematoxylin and
eosin labeled sections for evaluation of inflammation and cancer.
These data established the presence of Gr1+CD11b+ cells in the colons of IL-10
deficient mice. The levels of Gr1+CD11b+ cells increase with age and correlate
with the development of cancer.
54
Gr1+CD11b+ Cells
in Colon LP (%)
8
*
6
4
*
2
0
WT
IL-10-/-
3 Months
WT
IL-10-/-
6 Months
Figure 3-2 Lamina Propria Gr1+CD11b+ cell flow cytometry
This figure illustrates the percentage of Gr1+CD11b+ cells in the colonic lamina
propria of wild type and IL-10 deficient mice at 3 and 6 months of age. The
percentage of Gr1+CD11b+ cells was determined by flow cytometry analysis of
lamina propria cells isolated by EDTA and collagenase digestions. WT n = 2, IL10-/- n = 5, * indicates significant increase (P<0.05) from WT, One-way ANOVA
followed by Bonferroni’s Post test
55
A
B
______
5μm
______
5μm
C
D
______
5μm
______
5μm
Figure 3-3 Representative immunohistochemistry for Gr1+CD11b+ cells in
colon tissue sections
This figure shows representative immuhistochemically stained serial colon
sections from a 3-month-old IL-10 deficient mouse (400X). (A) Double staining
with FITC and PE IgG2b isotypes shows only limited background staining. (B)
Staining with anti-Gr1 (FITC) antibody shows positive cells in green. (C) Staining
with anti-CD11b (PE) antibody shows positive cells in amber. (D) Double staining
with anti-Gr1 (FITC) and anti-CD11b (PE) antibodies shows double positive cells
in gold.
56
Gr1+CD11b+ Cell Count
/Unit Area of Mucosa
*
120
90
60
*
30
0
WT
3 months
6 months
IL-10-/-
Figure 3-4 Gr1+CD11b+ cell colon immunohistochemistry
This figure illustrates the number of Gr1+CD11b+ cells per unit area of mucosa
(μm2) in colonic sections from non-inflamed wild type (129SvEv) and 3 and 6
month old IL-10 deficient mice.
The number of Gr1+CD11b+ cells was
determined via immunohistochemistry of colon sections.
significant
increase (p<0.05) from WT, One-way ANOVA followed by
Bonferroni’s Post test
n ≥ 6, * indicates
57
3.2 Gr1+CD11b+ cell Function in vitro
Having established the presence of Gr1+CD11b+ cells in the colons of IL-10
deficient mice, we next wanted to establish the presence of immunosuppressive
pathways identified in literature to confirm these cells were suppressive. Arginase
I
and
NOS2
enzyme
activities
have
been
identified
as
key
MDSC
immunosuppressive pathways and are used as identifiers of immunosuppressive
activity (Dolcetti et al., 2008). We used three in vitro assays to test whether the
Gr1+CD11b+ cells in the IL-10-/- model were immunosuppressive. Gr1+CD11b+
cells were isolated from the bone marrow of IL-10 deficient mice at 6 months of
age via percoll density gradient centrifugation with purities greater than 80% as
determined by flow cytometry analysis. Gr1+CD11b+ cells were isolated from the
spleen following mechanical digestion via a proprietary magnetic bead based
isolation kit with purities greater than 90% as determined by flow cytometry
analysis.
Arginase I activity was studied in cell lysates from 5 x 105 MDSC by measuring
the catalysis of L-arginine by arginase I into L-ornithine and urea. Arginase I
activity in bone marrow derived IL-10 deficient Gr1+CD11b+ cells (6.9 ± 2.1 x 10-3
μ3) was significantly increased from vehicle controls (8.7 ± 3.1 x 10-4 μ4)
(Figure 3-5). Spleen derived IL-10-/- Gr1+CD11b+ cells exhibited further increased
arginase I activity (0.20 ± 0.30 μ.). Liver tissue (0.26 ± 0.018 μ.) was used as a
positive control.
58
Nitric oxide, an indicator for NOS2 acitivity, has a short half-life and is quickly
broken down into nitrates and nitrites. Nitrate and nitrite production was
measured by Griess reaction (Beda and Nedospasov, 2005). Nitrites were
measured in the supernatant of 5 x 105 MDSC. Nitrates were first reduced to
nitrites using Vanadium (III) Chloride. Nitrite production was greater in the bone
marrow derived IL-10 deficient Gr1+CD11b+ cell supernatant (9.0 ± 0.34 μ.) than
in vehicle controls (8.4 ± 1.0 x 10-2 μ2) (Figure 3-6). Spleen derived Gr1+CD11b+
cells exhibited further increased NOS2 activity (12.4 ± 0.57 μ.). Sodium nitrate
(14.7 ± 0.67 μ.) was used as a positive control.
So far, we had established the presence of immunosuppressive pathways in
Gr1+CD11b+ cells. In order to directly assess their immunosuppressive capability
we performed a T-cell proliferation suppression assay. Gr1+CD11b+ cell were coincubated with T-cells to determine whether they could prohibit proliferation. 5 x
105 T-cells were loaded with CFSE dye, proliferation was induced by CD3 and
CD28 antibodies and detected by flow cytomery analysis for low CFSE level cells.
Co-incubation was performed with 1 x 105 Gr1+CD11b+ cells. Stimulating CD4+
splenocytes with CD3 and CD28 antibodies increased proliferation detected by
flow cytometry from 1.2 ± 0.20 % to 36.1 ± 2.1 %. Co-incubation of CD4+ cells
with bone marrow derived Gr1+CD11b+ cells decreased proliferation to 24.5 ±
1.9% and was further reduced by spleen derived Gr1+CD11b+ cells (Figure 3-7).
59
The in vitro data reported here is generated from MDSC derived from the spleens
and the bone marrow of mice. Ideally, we would have liked to the study the
function of MDSC function in cells isolated from the colon. We were unable to
accomplish this because of the difficulty involved in isolating a pure population
from the colon. Percoll gradient centrifugation and the Miltenye magnetic beads
isolation kit both produced cell purities below 60% when applied to cells isolated
from colonic lamina propria. We were able to obtain usable numbers of MDSC
from colonic lamina propria cell suspensions via fluorescence activated cell
sorting (FACS) technique. FACS works in a similar manner to the flow cytometry
analysis described earlier, but has the added advantage of selectively sorting out
cells that match size, density and fluorescence criteria. The disadvantages of this
technique are high cost and low yield. To isolate Gr1+CD11b+ cells via FACS, we
first had to isolate lamina propria cells from the colon by EDTA and collagenase
digestion and then label all of the isolated tens of millions of cells with Gr1 and
CD11b antibodies. This process takes approximately 8 hour. After 5 hours of
FACS sorting of these labeled cells, we only obtained approximately 1 x 105
Gr1+CD11b+ cells. This process did not generate enough cells to allow for
extensive studies.
We were unable to evaluate MDSC function in vitro in cells derived from the
colon, but some alternative methodologies are available to explore this in future
60
experiments. A combination of flow cytometry, to identify Gr1+CD11b+ cells, and
fluorescent in situ hybridization (FISH), to identify the expression of specific
nucleic acid sequences, could be used to identify the messenger RNA
expression of immunosuppressive proteins in lamina propria cell suspensions.
FISH does not allow for the evaluation of protein expression and function, but it
could be used in colon sections to identify whether Gr1+CD11b+ cells are
expressing Arginase I and NOS2 mRNA sequences (Perske et al., 2010). FISH
could
also
be
potentially
be
used
in
combination
with
protein
immunohistochemistry for Gr1+CD11b+ cells. This technique may be more
challenging because of the potential for different antibodies and probes
interfering with each other, but would have the added advantage of allowing for
the comparison of MDSC function by location, for example in neoplastic versus
inflammatory lesions. Intracellular NOS and Arginase production can also be
evaluated by flow cytometry analysis (Obermajer et al., 2013). Combining these
with Gr1+CD11b+ flow cytometry in colonic lamina propria cell suspensions would
allow the evaluation of immunosuppressive protein function in colonic MDSC.
This work confirmed that Gr1+CD11b+ cells in IL-10-/- mice were MDSC by
establishing
the
presence
of
immunosuppressive
immunosuppressive activity.
61
pathways
and
Urea Concentation (µM)
0.3
*$
0.2
*
0.1
0.0
Positive Negative
BM
Spleen
Figure 3-5 IL-10 deficient Gr1+CD11b+ cells express arginase I activity
This figure illustrates arginase I enzymatic activity expressed as μ x urea
produced in 5 x 105 Gr1+CD11b+ cell lysates derived from bone marrow (BM) and
spleen of IL-10 deficient mice at 3 months of age. Lysate buffer and liver cell
lysates were used as controls. n ≥ 4, * indicates significant increase (p<0.05)
from negative controls. $ indicates significant increase (p<0.05) from BM, Oneway ANOVA followed by Bonferroni’s Post test
62
Nitrite Concentration (µM)
20
*$
15
*
10
5
0
Positive Negative
BM
Spleen
Figure 3-6 IL-10 deficient Gr1+CD11b+ cells have NOS2 Activity
This
figure
illustrates
NOS2
enzymatic
activity
represented
as
nitrite
concentration, a stable product of nitric oxide production, in 5 x 105 Gr1+CD11b+
cells derived from IL-10 deficient bone marrow (BM) and spleen at 3 months of
age. Carrier agent and sodium nitrate were used as controls. n ≥ 4, * indicates
significant
increase (P<0.05) from negative controls.
$ indicates significant
increase (P<0.05) from BM, One-way ANOVA followed by Bonferroni’s Post test
63
%Proliferating CD4+ Cells
50
40
*
30
*$
20
10
0
T-Cells
BM
Spleen
CD3 CD28 Stimulated T-Cells
Figure 3-7 IL-10 deficient Gr1+CD11b+ cells suppress T-cell proliferation
This figure illustrates the percentage of proliferating T-cells following stimulation
with CD3 CD28 antibodies and co-incubation with Gr1+CD11b+ cells isolated
from the bone marrow (BM) and spleen of IL-10 deficient mice at 3 months of
age. T-cells were loaded with CFSE dye and proliferation was determined by flow
cytometry analysis for low CFSE cells. Unstimulated T-cells were used as a
control. n ≥ 4, * indicates significant decrease (P<0.05) from stimulated T-cells.
$ indicates significant decrease (P<0.05) from BM groups, One-way ANOVA
followed by Bonferroni’s Post test
64
3.3 MDSC function in vivo
After confirming that the Gr1+CD11b+ cells in the IL-10 deficient mouse have
immunosuppressive activity and therefore can be described as MDSC we next
wanted to test whether these cells play a role in cancer development in this
model in vivo. We tested this by depleting and transferring MDSC in vivo.
3.3.1 Depleting MDSC in vivo decreases cancer development in the IL-10
deficient mouse
Low dose chemotherapeutic drugs such as gemcitabine and 5-fluorouracil (5-FU)
have been reported to potently target MDSC both in vitro and in vivo (Suzuki et
al., 2005; Vincent et al., 2010). These drugs are cytotoxic and were designed to
target fast dividing cancer cells. At low doses though, they potently target MDSC
and have been shown not to significantly affect cancer cells or immune cell types
(Suzuki et al., 2005; Vincent et al., 2010).
We used 5-fluorouracil and gemcitabine to deplete MDSC in IL-10 deficient mice
and study cancer development in vivo. IL-10-/- mice at 6 weeks of age were given
weekly injections of 60mg/Kg 5-FU (Sigma Aldrich, St. Louis, USA) or
gemcitabine (Sigma Aldrich, St. Louis, USA) for 5 weeks. Mice were sacrificed at
12 weeks of age and MDSC counts, inflammation and cancer development were
studied. Dysplasia scoring was done based on a previously published system
that scores the levels of crypt reforming, epithelial dysplasia and submucosal
65
invasion (Zhang et al., 2007b). Both, 5-FU (9.48 ± 1.58 cells/5-2) and gemcitabine
(14.26 ± 1.29 cells/em2), treatments reduced MDSC counts in colon as compared
to saline control treated IL-10-/- mice (30.61 ± 4.24 cells/tm2), determined via
immunohistochemistry (Figure 3-8). The decrease in MDSC counts was
accompanied by a decrease in polyp and dysplasia scores in 5-FU and
gemcitabine treated mice, indicating reduced cancer development. 5-FU
treatment reduced polyp scores from 3.00 ± 0.00 to 0.33 ± 0.21 (Figure 3-9) and
dysplasia scores from 4.40 ± 0.81 to 0.17 ± 0.17 (Figure 3-10). Gemcitabine
treated IL-10-/- mice had polyp and dysplasia scores of 0.33 ± 0.21 and 2.00 ±
0.81, respectively. These data indicate that targeting MDSCs with low dose
chemotherapeutics decreased neoplastic changes in IL-10 deficient mouse
colons.
Interestingly, depleting MDSCs did not affect inflammation development in the IL10 deficient mice. Inflammation in the colon was scored based on a previously
published scoring system (Zhang et al., 2007b). Histologically, inflammation was
scored based on the level of destruction of mucosal architecture, inflammatory
cell infiltrate and muscle thickness. Treatment with 5-FU or gemcitabine did not
affect the macroscopic (Figure 3-11) or histological (Figure 3-12) scores of
inflammation. Mice treated with the drugs or with saline had similar levels of
inflammatory mucosal damage and cell infiltration.
66
Gr1+CD11b+ Cell Count
/Unit Area of Mucosa
A
40
30
20
*
10
0
Control
5-FU
Gr1+CD11b+ Cell Count
/Unit Area of Mucosa
B
40
30
*
20
10
0
Control
Gem
Figure 3-8 Low dose chemotherapeutics deplete MDSC in the IL-10
deficient mouse
This figure illustrates the number of Gr1+CD11b+ cells in colon sections of IL-10
deficient mice following treatment with (A) 5-FU and (B) gemcitabine as
determined via immunohistochemistry. Mice at 6 weeks of age were treated with
a 60 mg/Kg dose weekly for 5 weeks and sacrificed at 12 weeks of age. Saline
treated mice were used as controls. n ≥ 5, * indicates significant decrease
(p<0.05) from control, Two-tailed Student’s t test
67
A
Polyp Score
4
3
2
*
1
0
Control
5-FU
B
Polyp Score
4
3
2
*
1
0
Control
Gem
Figure 3-9 Lower MDSC counts are associated with reduced polyp scores
in the IL-10 deficient mouse
This figure illustrates the macroscopic polyp scores for the colons of IL-10
deficient mice following treatment with (A) 5-FU and (B) gemcitabine or saline
controls. Mice at 6 weeks of age were treated with a 60 mg/Kg dose weekly for 5
weeks and sacrificed at 12 weeks of age. n ≥ 5, * indicates significant decrease
(p<0.05) from control, Two-tailed Student’s t test
68
Histological Dysplasia Score
6
Histological Dysplasia Score
A
6
4
2
0
*
Control
5-FU
B
4
*
*
2
0
Control
Gem
Figure 3-10 Lower MDSC counts are associated with reduced dysplasia
scores in the IL-10 deficient mouse
This figure illustrates the histological dysplasia scores for colons of IL-10
deficient mice following treatment with (A) 5-FU and (B) gemcitabine or saline
controls. Mice at 6 weeks of age were treated with a 60 mg/Kg dose weekly for 5
weeks and sacrificed at 12 weeks of age. n ≥ 5, * indicates significant decrease
(p<0.05) from control, Two-tailed Student’s t test
69
Macroscopic Score of Inflammation
A
4
3
2
1
0
Control
5-FU
Macroscopic Score of Inflammation
B
5
4
3
2
1
0
Control
Gem
Figure 3-11 Lower MDSC counts do not alter macroscopic inflammation in
the IL-10 deficient mouse
This figure illustrates the macroscopic inflammation scores for the colons of IL-10
deficient mice following treatments with (A) 5-FU and (B) gemcitabine or saline
controls. Mice at 6 weeks of age were treated with a 60 mg/Kg dose weekly for 5
weeks and sacrificed at 12 weeks of age. n ≥ 5, Two-tailed Student’s t test
70
Histological Score of Inflammation
A
6
4
2
0
Control
5-FU
Histological Score of Inflammation
B
6
4
2
0
Control
Gem
Figure 3-12 Lower MDSC counts do not affect histological inflammation in
the IL-10 deficient mouse
This figure illustrates the histological inflammation scores for the colons of IL-10
deficient mice following treatment with (A) 5-FU and (B) gemcitabine or saline
controls. Mice at 6 weeks of age were treated with a 60 mg/Kg dose weekly for 5
weeks and sacrificed at 12 weeks of age. n ≥ 5, Two-tailed Student’s t test
71
3.3.2 Adoptive transfer of MDSC in vivo increases cancer development in
the IL-10 deficient mouse
To test whether increasing MDSC numbers in vivo could alter cancer
development in the IL-10 deficient mouse mice were given tail vein injections of
bone marrow derived MDSC. IL-10-/- mice at 6 weeks of age were given weekly
injections of 3 x 106 MDSC weekly for 5 weeks and sacrificed at 12 weeks of age.
To determine whether MDSC injected via tail vein were migrating to the colon,
we injected CFSE labeled MDSC into one mouse. The colon from this mouse
was excised and frozen sections were visualized using a microscope. Figure 313A shows a CFSE labeled MDSC in the colon of an IL-10 deficient mouse
proving that adoptively transferred MDSC can migrate to the colon.
The adoptive transfer of MDSC did not significantly affect macroscopic polyp
scores (Figure 3-14A). This was because our polyp scoring scale goes ranges
from 0 to 3 and saline treated IL-10 deficient mice at three months of age had a
score close to the peak of the range at 2.75 ± 0.17. However, dysplasia scores
were significantly higher in mice injected with MDSC (6.38 ± 0.50) as compared
to saline controls (4.38 ± 0.50, Figure 3-14B). Importantly, 8 of 9 of the MDSC
treated mice developed invasive cancers as compared to 1 of 8 in the saline
treated controls. The adoptive transfer of MDSC did not affect macroscopic or
histological scores of inflammation in the colons of IL-10 deficient mice (Figure 315). Despite an increase in cancer development, the adoptive transfer of MDSC
72
did not affect MDSC counts in the colon determined via immunohistochemistry
(Figure 3-13B). We have already established that adoptively transferred MDSC
are able to migrate to the colon, but this was an interesting finding that at first
suggests that MDSC may not be reaching the colon in large numbers. However,
it is important to look at this data in the context of life cycle of the cells being
injected. The life cycle of MDSC in vivo is unknown. The next best approximation
for MDSC life cycles can be made from that of the cells they mature into:
neutrophils and monocytes. The life cycle of monocytes is also unknown. The
lifecycle of inactivated neutrophils in circulation is 5 days and the life cycle of
activated neutrophil is less than two days (Kumar, 2010). Since we only
evaluated MDSC counts 7 days after the final injection of cells, it is likely that the
injected MDSC would have lived through their life cycles by then. We chose to
start treating animals at 6 weeks of age for our in vivo experiments because
inflammation and dysplasia are not present in the colons of IL-10 deficient mice
at this time point.
MDSC adoptive transfer experiments previously have been performed by a
number of other groups as an intervention in neoplastic and inflammatory
conditions (Hegde et al., 2011; Ramachandran et al., 2013; Yin et al., 2010). All
of these groups transferred 5 x 106 MDSC in their experiments. This number
represents only a fraction of Gr1+CD11b+ cells present in spleen in animals
suffering from inflammatory or cancerous conditions (Dolcetti et al., 2008;
73
Sawanobori et al., 2008). We chose a 3 x 106 cell dose because we are able to
reliably able to isolate approximately 6 x 106 cells from the bone marrow of IL-10
deficient mice. This allowed us to inject two animals from MDSC derived from the
bone marrow of one MDSC. Higher or lower doses of MDSC may have varying
effects on disease development and should be followed up in future studies.
We also conducted the MDSC adoptive transfer experiment with a single dose of
cells given at 6 weeks of age. Animals were sacrificed at 12 weeks and the
dysplasia scores showed statistically insignificant increase in treated animals.
The fact that neutrophils have a relatively short life indicated that multiple
injections may be more efficacious. We sacrificed the animals in our in vivo
experiments at 12 weeks of age because by this time point the majority of IL-10
deficient mice have well established inflammation in the colon and approximately
12% of mice develop adenocarcinomas. This timing gave our treatments the
opportunity to influence the development of inflammation and cancer. Trying in
vivo interventions at different time frames could help further elucidate the role of
MDSC in this model. A longer trial could show whether MDSC remain as critical
to disease development in the longer term as they are in these first 6 weeks.
Using low dose chemotherapeutics at a later time frame could help answer
whether these drugs could be useful in patients at risk of developing colon
cancer, for example patients with polyps. These data support a critical role for
MDSC in the progression of dysplasia development in the IL-10 deficient model.
74
A
Gr1+CD11b+ Cell Count
/Unit Area of Mucosa
B
40
30
20
10
0
Control
MDSC Transfer
Figure 3-13 Adoptive transfer of MDSC does not affect MDSC levels in the
colons of IL-10 deficient mice
(A) A CFSE stained bone marrow derived MDSC in a colon section of an IL-10
deficient mouse (400X). The colon was collected four hours after injection with
labeled MDSC. (B) Gr1+CD11b+ cell counts in colon sections of IL-10 deficient
mice following adoptive transfers of MDSC cells or saline controls as determined
via immunohistochemistry. Bone marrow derived MDSC (3 x 106) were injected
via tail-vein 5 times and animals were sacrificed at 6 weeks. n ≥ 5, (B) Two-tailed
Student’s t test
75
A
Polyp Score
4
3
2
1
0
Control
MDSC Transfer
Histological Dysplasia Score
B
8
*
6
4
2
0
Control
MDSC Transfer
Figure 3-14 Adoptive transfer of MDSC increases neoplastic changes in the
colons of IL-10 deficient mice
This figure illustrates (A) polyp scores and (B) dysplasia scores for colons of IL10 deficient mice following adoptive transfers of MDSC cells or saline controls.
Mice at 6 weeks of age were injected via tail vein with bone marrow derived
MDSC (3 x 106) weekly 5 times and sacrificed at age of 12 weeks. n ≥ 5, *
indicates significant increase (p<0.05) from Control, (B) Two-tailed Student’s t
test
76
Macroscopic Score of Inflammation
A
5
4
3
2
1
0
Control
MDSC Transfer
Control
MDSC Transfer
Histological Score of Inflammation
B
5
4
3
2
1
0
Figure 3-15 Adoptive transfer of MDSC does not affect inflammation in IL10 deficient mouse colons
(A) Macroscopic inflammation scores and (B) Histological inflammation scores
assigned to colons sections of IL-10 deficient mice following adoptive transfers of
MDSC cells or saline controls. Mice at 6 weeks of age were injected via tail vein
with bone marrow derived MDSC (3 x 106) weekly 5 times and sacrificed at the
age of 12 weeks. n ≥ 5, Two-tailed Student’s t test
77
The data from experiments with low dose chemotherapeutic drug targeting of
MDSC support the role of MDSC in the development of cancer in this model. It is
important to recognize that some or all of the effect observed in our model could
be because of effect of the chemotherapeutic drugs on cancer cells rather than
MDSC directly. Vincent et al. and others have done extensive work to show both
in vitro and in vivo that MDSC are the only affected cell population at these low
doses of 5-FU and gemcitabine (Le et al., 2009; Suzuki et al., 2005; Vincent et al.,
2010). Vincent et al. also showed that the MDSC depletion effect occur within
hours
of
the
treatment.
Other
effects
of
treatment
with
low
dose
chemotherapeutic drugs, such as decreased cancer development, are observed
at later time points suggesting that MDSC depletion could be affecting cancer
development. This data in context together with the in vitro MDSC data and
adoptive transfer data our results would suggest that it is likely that the
decreased neoplastic changes are in part due to the depletion of MDSC by these
drugs.
Other potential mechanisms for therapeutically targeting MDSC in vivo include
affecting their function using phosphodiesterase-5 inhibitors such as sildenafil,
inducing their maturation with all-trans retinoic acid and targeting them with antiGr1 and CD11b antibodies (Kusmartsev et al., 2003; Serafini et al., 2006;
Srivastava et al., 2012). We did not attempt the use of all-trans retinoic acid and
Gr1 or Cd11b antibodies because these treatments would have unwanted effects
78
on other cell populations of myeloid origin. PDE-5 inhibitors such as sildenafil
and vardenafil, which increase intracellular cyclic guanosine monophosphate
availability, can decrease MDSC function by decreasing arginase I and NOS2
expresssion (Serafini et al., 2006). We attempted to target MDSC function in
vivo with daily injections of 20 mg/Kg sildenafil (Sigma Aldrich, St. Louis, USA) in
6 week old IL-10-/- mice. Mice were sacrificed at 12 weeks of age and cancer
development was studied. No significant effect on cancer development was
observed with sildenafil treatment in the IL-10 deficient mice (data not shown).
This could be because MDSC in this model are not affected by PDE-5 inhibition
or perhaps the dose used was ineffective in the IL-10 deficient mouse. Further
work is needed to make any conclusions from this experiment. For example, this
could be further tested in vitro by treating MDSC with sildenafil before studying
their function in the Arginase I or T-cell suppression assay. If MDSC function is
decreased by sildenafil treatment in vitro then that would suggest that the PDE-5
pathway is important for MDSC function in this model. Further in vivo work could
help tease out the right dose to target MDSC function in the IL-10 deficient
mouse.
3.4 MDSC in the AOM/DSS Model of Colitis Associated Cancer
Having already established the presence and protumorigenic role of MDSC in the
IL-10 deficient mouse model of colitis-associated cancer, we were interested in
determining whether such a link can be found in other models. A well established
79
model of inflammation associated colon cancer is the azoxymethane (Sigma
Aldrich, St Louis, USA) and dextran sulfate sodium model (MP Biomedical, Santa
Ana, USA) (Fukata et al., 2007; Kanneganti et al., 2011). Mice are treated with
AOM, a carcinogen, followed by single or repeated rounds of DSS, which
induces inflammation. In our model, we injected 2-month-old C57BL/6 mice with
10 mg/kg AOM. One week later, mice were given 2% DSS in drinking water for 7
days. Water only and AOM only treatments were used as controls. Mice were
sacrificed 6 weeks after the end of DSS treatment and cancer development and
Gr1+CD11b+ cell counts were determined. Dysplasia scores for mice treated with
AOM/DSS (7.3 ± 0.31) were significantly higher than in C57BL/6 mice no
treatment (0.75 ± 0.75, Figure 3-16A). Polyp scores were also significantly higher
in AOM/DSS treated mice (data not shown). All eight AOM/DSS treated mice
developed invasive adenocarcinomas. Interestingly, Gr1+CD11b+ counts were
significantly increased in the colons of AOM/DSS treated mice (17.0 ± 2.8
cells/unit area of mucosa) as compared to controls (3.0 ± 1.0 cells/unit area of
mucosa) as determined by immunohistochemistry in frozen colon sections
(Figure 3-16B). Interestingly, MDSC counts are lower than IL-10 deficient mice of
the same age (3 months) and much lower than 6-month-old IL-10 deficient mice.
Only 12 % of IL-10 deficient mice develop invasive cancers by 3 months of age,
which increases to 20 % at 6 months. Mice treated with AOM alone did not show
significantly different results from water treatment. These data indicate that
Gr1+CD11b+ cells are significantly increased in the AOM/DSS model.
80
A
*
Dysplasia Score
8
7
6
5
4
3
2
1
0
WT
AOM only
AOM/DSS
B
*
Gr1+CD11b+ Cells
/Unit area of Mucosa
20
15
10
5
0
WT
AOM only
AOM/DSS
Figure 3-16 Dysplasia and Gr1+CD11b+ cell counts are increased in the
AOM/DSS model of colitis-associated cancer
This figure illustrates (A) dysplasia scores and (B) Gr1+CD11b+ cell counts in
colons sections of C57BL/6 mice following treatment with AOM and DSS, AOM
only and water only controls. 2 month old mice were injected with 10 mg/kg AOM.
One week later mice were given 2% DSS in drinking water for 7 days. Mice were
sacrificed 6 weeks after DSS treatment. n = 4-8, * indicates significant increase
(p<0.05) from WT, One-way ANOVA followed by Bonferroni’s Post test
81
We have established the increased presence of Gr1+CD11+ cells in the colon.
While we have been unable to isolate Gr1+CD11+ cells from the colon and
confirm their immunosuppressive nature, the in vitro experiments on bone
marrow and spleen derived MDSC demonstrate their immunosuppressive
abilities in this model. The in vivo experiments together establish a
protumorigenic role for MDSC in the IL-10 deficient model, where depleting them
decreases neoplasia and their adoptive transfer increases neoplasia. Additionally,
we also report the increased MDSC in an alternative model of inflammation
associated colon cancer. These experiments support a role for Gr1+CD11b+,
immunosuppressive, MDSC in the progression of inflammation associated
cancer in the IL-10 deficient mouse.
82
Chapter 4: The role of MDSC in the Interleukin 10 Toll Like Receptor 4
double deficient mouse
83
Summary
The following experiments study the role of MDSC in the IL-10 TLR4 double
deficient mouse. First, the increased development of cancer in the IL-10 TLR4
double deficient mouse relative to the IL-10 deficient mouse is established.
Second, the increased recruitment and correlation of MDSC with cancer
development in this model is shown. Third, peripheral blood and colonic
experiments show that MDSC are the only upregulated cell type in the IL-10
deficient mouse in the absence of TLR4. Finally, our data show that TLR4
expression does not affect MDSC function but that TLR4 in colon tissue
modulates cancer development. Together these experiments further establish a
protumorigenic role of MDSC in the IL-10 deficient mouse model and indicate
that TLR4 expression in the colon modulates MDSC recruitment and cancer
development.
4.1 Cancer incidence and MDSC levels in the IL-10 TLR4 double deficient
mouse
Chapter 3 shows the protumorigenic role for MDSC in vivo and in vitro in the IL10 deficient mouse. TLR4 plays an important role in the pathogenesis of both
inflammation and cancer. Our laboratory and others have reported that TLR4 is a
modulator of inflammation-associated cancer in the colon (Fukata et al., 2007;
Zhang et al., 2007a). Others have shown the importance of the NFhe pathway,
which is activated by TLR4, in the progression of colon cancer (Greten et al.,
84
2004). Our laboratory has developed a novel IL-10 and TLR4 double deficient
mouse. The first step in understanding the potential role of MDSC in this model
was to establish the inflammation and cancer levels in this model.
4.1.1 Inflammation and Cancer levels in the IL-10 TLR4 Double Deficient
mouse
The IL-10-/- TLR4-/- mouse develops cancer at a markedly increased rate and
incidence as compared to a TLR competent IL-10 deficient mouse. Colon cancer
was evaluated with the help of a blinded pathologist. Adenocarcinomas were
defined as invasive cancers where high dysplastic crypts have invaded into the
submucosal layer. This work was performed my Dr. Rui Zhang, a post-doctoral
fellow under Dr. McCafferty’s supervision.
At three months of age 50% of IL-10-/- TLR4-/- mice develop adenocarcinomas
compared to 12% of IL-10-/- mice (Figure 4-1A). Histological inflammation scores
were evaluated based on factors such as leukocyte infiltration, muscle thickness
and crypt architecture. Histological inflammation scores showed a small but
significant increase in IL-10-/- TLR4-/- mice (6.8 ± 0.2) compared to IL-10-/- mice
(6.0 ± 0.2, Figure 4-1B). Wild type 129SvEv mice had a baseline inflammation
score of 1.4 ± 0.3.
85
Incidence of
Adenocarcinoma (%)
A
100
75
50
25
0
WT
IL-10-/-
IL-10-/-/TLR4-/-
Histological Score
of Inflammation
B
Figure
4-1
TLR4
*
7
6
*#
5
4
3
2
1
0
WT
deficiency
IL-10-/-
increases
IL-10-/-/TLR4-/-
cancer
development
and
inflammation in the IL-10 deficient mouse
This figure illustrates (A) the incidence of adenocarcinomas and (B) histological
inflammation scores in the colons of three month old mice on the 129SvEv
background. n ≥ 20, * indicates significant increase (p<0.05) from WT, # indicates
significant increase (p<0.05) from IL-10-/-, (B) One-way ANOVA followed by
Bonferroni’s Post test
86
These data demonstrate that there is comparable, if not slightly higher, level of
inflammation present in the absence of TLR4 in the IL-10 deficient mouse. This is
not surprising as other have shown a homeostatic role for TLR4 in models of gut
(Fukata et al., 2005; Gonzalez-Navajas et al., 2010). These data also establish a
striking increase in the development of adenocarcinoma in the absence of TLR4
in this model. The reason for this increase is unclear. However, since our earlier
data in the IL-10 deficient mouse have shown a protumorigenic role for MDSC,
we investigated whether MDSC numbers and/or function were altered in the
absence of TLR4. Having established a key role for MDSC in cancer
development in the IL-10 model, we next wanted to see how MDSC recruitment
was altered in this model in the absence of TLR4.
4.1.2 MDSC recruitment in the IL-10 TLR4 double deficient mouse
A marked increase in MDSC levels is observed in the bone marrow, spleen and
site of lesion in various animal and human inflammatory and cancerous
conditions (Ostrand-Rosenberg and Sinha, 2009). We took a systematic
approach in quantifying levels of MDSC in the spleen, bone marrow and the
colon, the site of inflammation and cancer, in the presence and absence of TLR4.
MDSC levels in the bone marrow were determined by flow cytometry analysis for
Gr1+CD11b+ cells in cell suspensions obtained by flushing femur and tibia bones
of 3-month-old mice. MDSC levels were significantly increased in the IL-10-/mouse bone marrow (55.4 ± 5.4 %) compared to wild type animals (34.8 ± 3.5 %).
87
MDSC levels were comparable in the bone marrow of IL-10-/- TLR4-/- mice (60.3 ±
3.4 %) and IL-10-/- counterparts (Figure 4-2A). MDSC levels in the spleen were
determined by flow cytometry analysis for Gr1+CD11b+ cells in cell suspensions
obtained by mechanical digestion of mouse spleens. MDSC levels were
significantly increased in the IL-10-/- mouse spleens (9.4 ± 1.7 %) compared to
wild type animals (1.6 ± 0.3 %). MDSC levels in the spleens of IL-10-/- TLR4-/mice (8.6 ± 2.4) were comparable to IL-10-/- mice (Figure 4-2B). This work was
performed by Dr. Rui Zhang, a postdoctoral fellow under the supervision of Dr.
McCafferty.
We next studied MDSC recruitment to the colon via colon section
immunohistochemistry
and
lamina
propria
flow
cytometry
analysis
for
Gr1+CD11b+ cells. We have already established that MDSC levels were
significantly increased in the colons of IL-10-/- mice compared to wild type
animals at both three and six months of age (Page 47). Lamina propria cell flow
cytometry showed a similar increase in the percentage of Gr1+CD11b+ cells in
the IL-10-/- TLR4-/- from IL-10-/- counterparts at both 3 (5.9 ± 0.5 %) and 6 (8.8 ±
1.2 %) months of age (Figure 4-3A). Gr1+CD11b+ cell immunohistochemistry
showed significantly higher cell numbers in the IL-10 TLR4 double deficient colon
sections as compared to IL-10 deficient sections at both 3 (64.6 number>84</rec2) and 6 (145.9 ± 17.8 cells/μm2) months of age (Figure 4-3B).
88
Gr1+CD11b+ Cells
in Bone Marrow (%)
A
*
70
60
*
50
40
30
20
10
0
WT
IL-10-/-
IL-10-/-/TLR4-/-
*
*
IL-10-/-
IL-10-/-/TLR4-/-
Gr1+CD11b+ Cells
in Spleen (%)
B
12
10
8
6
4
2
0
WT
Figure 4-2 TLR4 deficiency does not affect MDSC levels in the bone marrow
and spleen in the IL-10 deficient mouse
This figure illustrates MDSC levels in (A) the bone marrow and (B) spleens of
three month old mice. MDSC levels were determined via flow cytometry for
Gr1+CD11b+ cells. This work was performed by Dr. Rui Zhang. n ≥ 10, * indicates
significant increase (p<0.05) from WT, One-way ANOVA followed by Bonferroni’s
Post test
89
A
Gr1+CD11b+ Cells
in Colon LP (%)
15
*#
10
*#
5
WT
IL-10-/IL-10-/-/TLR4-/-
*
*
0
6 Months Old
3 Months Old
Gr1+CD11b+ Cell Count
/Unit Area of Mucosa
B
#
175
150
WT
IL-10-/IL-10-/-/TLR4-/-
125
100
*#
75
50
25
*
0
3 Months Old
6 Months Old
Figure 4-3 TLR4 deficiency increases MDSC recruitment to the colon in the
IL-10 deficient mouse
This figure illustrates MDSC levels in colons of three and six month old mice.
MDSC levels were determined via (A) flow cytometry for Gr1+CD11b+ cells in
colonic lamina propria cells and (B) Gr1+CD11b+ cell immunohistochemistry in
colon sections. n = 4-6, * indicates significant increase (p<0.05) from WT, #
indicates significant increase (p<0.05) from IL-10-/-, One-way ANOVA followed by
Bonferroni’s Post test
90
These data show that MDSC levels are comparable in the spleens and bone
marrow of IL-10-/- and IL-10-/- TLR4-/- mice. Interestingly, MDSC levels are
significantly increased in the colon, the site of inflammation and cancer, in the
absence of TLR4 in the IL-10 deficient mouse. This indicates a correlation of
MDSC presence with cancer development.
4.1.3 MDSC and Cancer correlation
Our data so far suggest MDSC are recruited to the colon in increased numbers in
the absence of TLR4 and that these cells contribute to the development of
dysplasia in the colon. Next we examined the location of MDSC within the colon
tissue. Using immuohistochemically stained and H&E labeled serial sections we
examined the general distribution of MDSC in the colon. H&E sections allowed
us to identify inflamed areas and areas with adenocarcinoma. Using Gr1+CD11b+
cell immunohistochemistry we were able to count MDSC cells in inflamed and
tumor areas within the same colon section. MDSC counts per unit area of
mucosa (μm2) were greatly increased in areas of adenocarcinoma (1177 ± 230
cells/μm2) than in inflamed areas (122 ± 54 cells/μm2) of approximately the same
size in four IL-10-/- and IL-10-/- TLR4-/- mouse colon sections (Figure 4-4A). We
determined the correlation of cancer development with inflammation in this model
by plotting MDSC counts against histological scores of inflammation in colons
from WT, IL-10-/-, and IL-10-/- TLR4-/- mice. A positive correlation was observed
between MDSC levels and inflammation in the colon (r2=0.67, n=15, Figure 4-4B).
91
Next, we studied the correlation between MDSC levels and cancer development
in this model. When we plotted dysplasia scores against whole tissue MDSC
counts from WT, IL-10-/-, and IL-10-/- TLR4-/- mice a stronger positive correlation
was observed (r2=0.82, n=28, Figure 4-4C).
Our data illustrate that MDSC congregate in areas of dysplasia over inflammation.
These data suggest that both inflammation and MDSC recruitment are drivers of
cancer development in the IL-10 deficient mouse model. These data establish a
strong correlation between MDSC and cancer development in the IL-10-/- and IL10-/- TLR4-/- mouse. The increased cancer development in the IL-10-/- mouse in
the absence of TLR4 could in part by explained by an increased recruitment of
MDSC.
92
Histological Inflammation Score
B
Gr1+CD11b+ Cell Count
/Unit Area of Mucosa
A
*
1500
1000
500
0
Inflamed Areas
8
6
4
2
0
0
50
100
150
MDSC Count
r2 = 0.67
Cancerous Areas
C
Dysplasia Score
9
6
3
0
0
50
100
150
200
250
MDSC Count
r2 = 0.82
Figure 4-4 MDSC recruitment correlates with neoplastic changes in the IL10 deficient mouse model
(A) Compares the level of MDSC in inflamed and cancerous areas
(adenocarcinoma) in the colons of IL-10 deficient and IL-10 TLR4 double
deficient mice (n=8). This figure also illustrates the correlation between (B)
histological inflammation scores or (C) dysplasia scores and MDSC levels in the
colons of wild type, IL-10 deficient and IL-10 TLR4 double deficient mice at 3 and
6 months of age (n=30). The slopes of the correlation were significantly changed
from 0 (p<0.05). MDSC levels were determined via Gr1+CD11b+ cell
93
immunohistochemistry in colon sections. * indicates significant increase (p<0.05)
from Inflamed Areas, (A) Two-tailed Student’s t test, (B) and (C) Linear
regression analysis
94
4.2 Other leukocyte population levels in the absence of TLR4 in the IL-10
deficient mouse
Having established an increased recruitment of MDSC in the colons of IL-10
deficient mice in the absence of TLR4 we next wanted to determine whether
other white blood cell populations were affected. We first performed a leukocyte
differential count on peripheral blood from IL-10-/- and IL-10-/- TLR4-/- mice. Total
white blood cell counts in peripheral blood were comparable in IL-10-/- (5.5 ± 0.42
x 106 cells/ml) and IL-10-/- TLR4-/- (5.7 ± 0.81 x 106 cells/ml) as determined by
hemocytometer counting (n=4). The differential count illustrated that the
percentage of monocytes, granulocytes and lymphocytes were comparable in
peripheral blood of IL-10-/- and IL-10-/- TLR4-/- mice (Figure 4-5).
Next we used flow cytometry to identify specific leukocyte populations in colonic
lamina propria following EDTA and collagenase digestions of colon tissue from 3month-old IL-10-/- and IL-10-/- TLR4-/- mice. The percentage of T-cells, B-cells,
macrophage and dendritic cells was determined by flow cytometry analysis for
CD4+, CD19+, F4/80+ and CD11c+ cells, respectively. The percentage of B-cells,
macrophage and dendritic cells was comparable in IL-10-/- and IL-10-/- TLR4-/colons (Figure 4-6). The percentage of MDSC was also measured by flow
cytometry analysis for Gr1+CD11b+ cells to confirm previous results. As in the
previous work, MDSC levels were significantly increased in the IL-10-/- TLR4-/mouse colons (10.0 ± 0.99 %) as compared to IL-10-/- (3.9 ± 0.44 %).
95
Interestingly, the percentage of T-cells was decreased in IL-10 TLR4 double
deficient mice (17.8 ± 0.41 %) from IL-10 deficient mice (30.3 ± 1.7 %). This
decrease in T-cells might be expected as we have shown MDSC suppress the
proliferation of T-cells in this model.
These data show that white blood cell levels in peripheral blood are comparable
in IL-10-/- and IL-10-/- TLR4-/- mice. We also demonstrate that MDSC are the only
upregulated cell type in the colon in the absence of TLR4 in the IL-10 deficient
mouse model.
96
yt
e
M
on
oc
yt
Ly
m
ph
oc
cy
lo
nu
ra
G
e
IL-10-/IL-10-/-/TLR4-/-
te
%Leukocyte
55
50
45
40
35
30
25
20
15
10
5
0
Figure 4-5 TLR4 deficiency does not affect peripheral blood leukocyte
levels in the IL-10 deficient mouse
This figure illustrates differential leukocyte counts in the peripheral blood of threemonth-old mice on the 129SvEv background. Peripheral blood was collected via
cardiac puncture. Leukocyte differential counts were determined histologically
using H&E labeled blood smears. n = 3, Two-way ANOVA followed by
Bonferroni’s Post test
97
35
*
%Leukocyte
30
IL-10-/IL-10-/-/TLR4-/-
25
20
15
10
*
5
e
ag
C
D
ls
M
ac
ro
B
ph
-C
el
ls
el
C
T-
M
D
SC
0
Figure 4-6 T-cells are decreased in the colon in the absence of TLR4 in the
IL-10 deficient mouse
This figure illustrates percentage of various leukocyte populations in the colons of
three-month-old mice on the 129SvEv background. Leukocyte levels were
determined via flow cytometry of colonic lamina propria cells isolated following
EDTA and collagenase digestions. n = 3, * indicates significant change (p<0.05)
from IL-10-/-, Two-way ANOVA followed by Bonferroni’s Post test
98
Our data so far have illustrated an enhanced recruitment of MDSC to the colon in
TLR4 deficient mice. We next asked the question whether their function is altered
in the absence of TLR4 in the IL-10 deficient model. We investigated this using
the in vitro tests of L-arginine metabolism and suppression of T-cell proliferation.
4.3 MDSC function in the IL-10 TLR4 double deficient mouse
MDSC are levels are highest in the bone marrow, spleen and at the sites of
inflammation or cancer (Gabrilovich and Nagaraj, 2009). We have been unable to
isolate purified MDSC from the colon, the site of cancer in IL-10 deficient and IL10 TLR4 double deficient mice. We have been able to isolate pure MDSC
populations from the bone marrow (>80 %) and spleen (>92 %). In vitro function
in bone marrow and spleen derived MDSC was measured by arginase I assay,
griess reaction for nitrate production and suppression of T-cell proliferation assay.
MDSC derived from the bone marrow and spleens of IL-10-/- and IL-10-/-TLR4-/had comparable levels of arginase I activity, nitric oxide production and T-cell
proliferation suppression ability (Figure 4-7, spleen data not shown). These data
indicate that TLR4 does not affect the function of MDSC in this model, only their
recruitment.
Having demonstrated that TLR4 competence does not affect MDSC function, we
were interested in determining what proportion of MDSC that express TLR4 in
the IL-10-/- mouse. MDSC were treated with lipopolysaccharide (LPS) in order to
99
induce TLR4 expression. We were not able to detect TLR4 without stimulation
with LPS, a gram-negative bacterial cell wall component. LPS has previously
been used to induce TLR4 expression in MDSC and other cell types (Bunt et al.,
2009). We performed flow cytometry analysis for TLR4+ cells in MDSC from 3month-old IL-10-/- mice. MDSC purified from the bone marrow were triple labeled
with Gr1, CD11b and TLR4 antibodies. The percentage of TLR4+ cells in
Gr1+CD11b+ cell poplulations from IL-10-/- TLR4-/- mice, which were used as
controls, was 0.16 ± 0.017 % (Figure 4-8). The percentage of TLR4+ cells in
Gr1+CD11b+ cell populations from IL-10-/- mice was 5.1 ± 0.30 %. The
percentage of TLR4+ MDSC in IL-10 deficient mice, while much higher than the
negative controls, suggests that only a small proportion of MDSC express
detectable levels of TLR4 in this models. Since the majority of MDSC do not
express TLR4 and as our findings suggest, it is unlikely to affect their function.
100
Po
si
tiv
e
N
eg
at
iv
e
IL
-1
IL
0 -/-1
0 -/B
M
TL
R
4 -/IL
B
-1
IL
M
0 -/-1
0 -/Sp
TL
le
en
R
4- /
Sp
le
en
Nitrite Concentration (µM)
Po
si
tiv
e
N
eg
at
iv
e
IL
IL
-1
-1
00//B
M
TL
R
4/IL
B
-1
M
IL
0
-/-1
0 -/Sp
TL
le
en
R
4 -/Sp
le
en
Urea Concentation (µM)
A
B
0.3
0.2
* *
0.1
12
8
* *
0.0
16
* *
* *
4
0
C
101
40
#
30
20
#
#
#
10
el
R
IL
0 -/TL
IL
-1
IL
-1
0 -/B
M
C
T-
M
D
4 -/SC
B
-1
M
IL
0 -/-1
M
D
0 -/Sp
SC
TL
le
en
R
4 -/M
D
Sp
SC
le
en
M
D
SC
0
ls
%Proliferating CD4+ Cells
50
CD3 CD28 Stimulated T-Cells
Figure 4-7 TLR4 does not affect MDSC function in the IL-10 deficient mouse
(A) Illustrates arginase I enzymatic activity expressed as μI urea produced in 5 x
105 MDSC lysates. Lysate buffer and liver cell lysates were used as controls. (B)
Illustrates NOS2 enzymatic activity represented as nitrite concentration, a stable
product of nitric oxide production, in 5 x 105 MDSC cells. Carrier agent and
sodium nitrate were used as controls. (C) Illustrates the percentage of
proliferating T-cells following stimulation with CD3 CD28 antibodies and coincubation with MDSC cells. MDSC were isolated from the bone marrow of 3month-old mice via percoll density gradient centrifugation and from the spleen via
Miltenyi magnetic beads isolation. n≥4, * indicates significant increase (p<0.05)
from negative controls, # indicates significant decrease (p<0.05) CD3 CD28
stimulated T-cells, One-way ANOVA followed by Bonferroni’s Post test
102
%TLR4+ MDSC
6
4
2
0
IL-10-/-/TLR-4-/-
IL-10-/-
Figure 4-8 TLR4 expression in MDSC in the IL-10 deficient mouse
This figure illustrates percentage of TLR4+ MDSC (Gr1+CD11b+TLR4+) cells in
the bone marrow of 3-month-old mice. TLR4+ MDSC levels were determined via
flow cytometry of bone marrow cells. n=3-4
103
4.4 TLR4 competence and cancer development
Our data on MDSC in the IL-10 TLR4 double deficient mouse indicate that
functionally they are comparable to cells from the IL-10 deficient mouse, but
recruited to the colon in greater numbers. This suggests that the TLR4 deficiency
likely
induces
enhanced
MDSC
recruitment
by
affecting
the
tissue
microenvironment. To test this directly, we transferred the bone marrow, the
source of MDSC, between TLR4 competent and TLR4 deficient IL-10-/- mice. If
TLR4 incompetent bone marrow were to increase cancer development in the IL10 deficient colon, it would indicate that TLR4 competency in the MDSC plays a
role in cancer development.
Bone marrow transplant experiments were performed in IL-10-/- and IL-10-/- TLR4/-
mice. Mice at two months of age were irradiated to eliminate the recipient
marrow and injected with bone marrow cell suspensions from the opposite
genotype via tail vein (n=5). Mice were given broad-spectrum antibiotics in
drinking water for 2 weeks following the transplant to avoid infections in an
immunocompromised state and sacrificed at 6 months of age. Bone marrow
transplants between the same genotype (eg: IL-10-/- to IL-10-/-) were used as
controls. We assessed macroscopic and histological parameters of inflammation.
Macroscopic scores of colon inflammation were comparable in all of the groups
(Figure 4-9A). Histological scores of inflammation were also comparable in all
control and treatment groups (Figure 4-9B). Interestingly, the histological scores
104
of inflammation were relatively high in all groups for their age. Next, we examined
parameters of cancer development. Macroscopic polyp scores, an indicator of
hyperplasia, were unchanged among all groups (Figure 4-9C). Surprisingly, no
dysplastic changes were observed in any of the treatment groups. Therefore, no
cancer development was observed even at this advanced age. This was most
likely an affect of the transplant experiment, the antibiotic treatment or a
combination of the two. Irradiation has a greater effect on fast dividing cell types
such as immune cells that play a key role in inflammation-associated cancer.
Radiation is also used as a treatment for various cancers because it causes DNA
damage and cell death in fast dividing cancer cells. The radiation treatment in
this experiment could have killed off the cancer cells in the colon, leading to
decreased cancer development. In all groups, antibiotic treatment post irradiation
and BMT could affect the microflora in the gut and affect cancer development.
For example, Antibiotic treatment has been shown to decrease inflammation and
cancer development in the gut by decreasing the microflora (Hale and Greer,
2012). The nature of the techniques used to conduct this experiment likely
interfered with the outcome being tested. Repeat trials should be performed with
a lower dose of antibiotics and the animal sacrifice should be delayed until 8 or
10 months of age. Alternative controls, such as transferring wild type bone
marrow into IL-10 deficient and IL-10 TLR4 double deficient mice, could be
added to future experiments to study the effects of normal bone marrow
interaction with the inflamed colon tissue microenvironments.
105
Having already established increased cancer development in the IL-10-/- TLR4-/mouse colons, we were interested in studying how TLR4 expression is
modulated in IL-10 deficient colons. The modulation of TLR4 expression within
IL-10 colons could further indicate whether TLR4 plays a role in the tissue
microenvironment in the pathogenesis of cancer in this model. This work was
performed in collaboration with a project student under the supervision of Dr.
McCafferty, Mattias Svensson. TLR4 mRNA expression was studied colons of IL10 deficient mice. Polyps and cancer are almost always found in the proximal
colon, close to the ileo-ceacal junction in this model (Zhang et al., 2007b). Wild
type colon TLR4 levels were set as standards and TLR4 mRNA was quantified in
IL-10 deficient distal colons and polyps collected from the proximal colon (Figure
4-10). Interestingly, TLR4 expression was significantly lower in the IL-10-/- polyp
region (0.38 ± 0.098) as compared to the distal colon (0.86 ± 0.22). We also
attempted to analyze TLR4 protein in the IL-10 deficient colon via western blot
analysis with two different TLR4 antibodies. These attempts were unsuccessful
as we were unable to visualize any bands, including the positive controls. These
data are interesting because they demonstrate a differential expression of TLR4
within the colon tissue around sites of dysplasia. They suggest TLR4 expression
as a potential marker for the transformation from inflammation to cancer. It also
indicates that the TLR4 deficiency is important in the colon tissue for modulating
protumorigenic changes.
106
A
B
6
Histological Score
of Inflammation
4
2
8
6
4
2
0
4
4-
R
LR
/-T
0-1
IL
to
in
0-1
0IL
-1
/-
LR
/-T
/-T
0-1
TL
-/10
L-
-I
4-
LR
/-
4-
0-1
IL
IL
IL
/-
in
in
to
to
IL
IL
-1
-1
0-
0-
/-
/-
4LR
/-T
0-1
IL
to
in
/0-
-1
IL
/-
/-
4
R
TL
-/10
L-
-I
/4LR
IL
-1
IL
0-
-1
0-
/-T
/-T
IL
LR
-1
4-
0-
/-
/-
in
in
to
to
IL
IL
-1
-1
0-
0-
/-
/-
0
/-
Macroscopic Score
of Inflammation
10
Macroscopic Polyp Score
C
4
3
2
1
/-
4
4-
R
LR
TL
/-T
-/-
0-
10
-1
L-
IL
-I
to
/-
in
4IL
-1
0-
/-
LR
0-1
IL
IL
-1
0-
/-T
/-T
IL
LR
-1
4-
0-
/-
/-
in
in
to
to
IL
IL
-1
-1
0-
0-
/-
/-
0
Figure 4-9 Bone marrow transplants between IL-10 TLR4 double deficient
and IL-10 deficient mice do not affect inflammation and cancer
development
This figure illustrates (A) macroscopic inflammation scores (B) histological
inflammation scores and (C) macroscopic polyp scores for mouse colons from
bone marrow transplant recipient mice. Mice at 2 months of age were irradiated
and injected with donor marrow. Mice were treated with neomycin for 2 weeks
107
following the irradiation and sacrificed at 6 months of age. IL-10 deficient mice
were given IL-10 TLR4 double deficient bone marrow and vise versa. Bone
marrow transplants between the same genotypes were used as controls. n = 5,
One-way ANOVA followed by Bonferroni’s Post test
108
Realtive quantification
of TLR4
1.2
0.8
*
0.4
0.0
WT
Distal Colon
Polyp Area
IL10-/-
Figure 4-10 TLR4 mRNA expression is decreased in the polyps of IL-10
deficient mice
This figure illustrates the relative quantification of TLR4 message expression in
the colon regions of three-month-old mice. TLR4 mRNA expression was
determined by RT-PCR using wild types as standards. n = 7, * indicates
significant change (p<0.05) from Distal Colon, Two-tailed Student’s t test
109
The data shown in this chapter show that the absence of TLR4 increases cancer
development in the IL-10 deficient mouse model. MDSC are the only upregulated
leukocytes in the absence of TLR4 and their levels highly correlate with
neoplastic changes in this model. TLR4 deficiency does not affect MDSC
function. The majority of MDSC do not express TLR4 and TLR4 expression is
decreased in IL-10-/- polyps. These data suggest that increased MDSC
recruitment and cancer development in the colon in the absence of TLR4 is likely
a result of changes in the colon tissue.
110
Chapter 5: MDSC chemotaxis in vitro and in vivo
111
Summary
The following experiments elicit a potential mechanism for the increased
recruitment of MDSC in the absence of TLR4 in the IL-10 deficient mouse. In
vitro and in vivo chemotaxis assays were used to identify potential MDSC
chemoattractants in the IL-10 deficient mouse. We also determined that TLR4
does not modulate MDSC chemotaxis in this model. Finally, we show that MDSC
chemoattractant protein levels are significantly increased in the absence of TLR4
in the IL-10 deficient mouse. Our findings suggest that TLR4 modulates MDSC
recruitment in the IL-10 deficient mouse by increasing the bioavailability of MDSC
chemoattractants.
Our data so far show a key role for MDSC and TLR4 in cancer development in
the IL-10 deficient mouse model of inflammation-associated cancer. TLR4
deficiency increases MDSC recruitment and cancer development in the colon.
TLR4 message is decreased in hyperplastic areas in IL-10 deficient mouse
colons. These data together suggest that the absence of TLR4 in the tissue
microenvironment causes a change that leads to increased MDSC recruitment
and cancer development. In this chapter, we investigated the potential
mechanisms involved in the increased recruitment of MDSC observed in the IL10-/- mice in the absence of TLR4. Our first step was to identify factors that recruit
MDSC in this model. Next, we would examine whether these factors are affected
by TLR4 deficiency in IL-10-/- mouse colons.
112
A number of agents, including IL-6, prostaglandin E2 and MCP-1, have been
proposed to be involved in MDSC recruitment (Cheng et al., 2011; Huang et al.,
2007; Obermajer et al., 2011a; Sinha et al., 2007b; Tu et al., 2008). These
studies were largely conducted in vivo, using pharamacological antagonism or
genetic knockouts. Huang et al. used antibodies to decrease MCP-1
bioavailability and genetics knockouts for its receptor, CCR2, to show that MCP-1
is crucial for MDSC recruitment to the cancer site (Huang et al., 2007). Sinha et
al. have shown the importance of prostaglandin E2 in MDSC recruitment by
knocking out its receptor, EP2, and pharmacological blockade of the
cyclooxygenase 2 pathway that generates prostaglandin E2 in mouse model of
breast cancer (Sinha et al., 2007b). While these studies suggest that these
factors play a role in MDSC recruitment, it is unlikely that all are direct
chemoattractants. We focused on identifying potential direct chemoattractants of
MDSC because their bioavailability in the colon would likely determine MDSC
recruitment levels. We first investigated MDSC chemotaxis in vitro, which to our
knowledge we are the first to do. In order to examine MDSC recruitment in vitro
we first had to establish an appropriate system. We examined MDSC migration in
three chemotaxis assays described in literature: underagarose assay, ibidi
chamber assay and transwell chamber assay.
113
5.1 Underagarose and Ibidi Chamber Chemotaxis Assays
Our laboratory has previously used the underagarose assay to study neutrophil
chemotaxis in vitro (Khajah et al., 2013). All in vitro chemotaxis assays rely on
cells migrating along a gradient of chemoattractant concentration. This assay is
performed by tracking the movement of cells under a layer of agarose from the
well containing cells towards the chemoattractant (Heit and Kubes, 2003). The
net number of migrating cells is determined by counting the cells moving towards
the chemoattractant well minus the cells moving away in the opposite direction.
Vehicle was used as control. We used neutrophil chemotaxis in this assay with a
previously identified chemoattractant, fMLP, for comparison with MDSC.
Neutrophils were isolated from the bone marrow of wild type mice via percoll
gradient density centrifugation. Neutrophil migration significantly increased
towards fMLP as compared to PBS controls (Figure 5-1A). Migration levels were
comparable to previously reported levels (Khajah et al., 2013).
MDSC were isolated from IL-10-/- mouse bone marrow via percoll density
gradient centrifugation. The purity of MDSC derived in this manner as confirmed
by flow cytometry analysis for Gr1+CD11b+ cells was greater than 80%. MDSC
migration towards neutrophil chemoattractants including MIP-2 (0.25 μ( - 2 μ ),
KC (0.25 μ( - 2 μ-) and fMLP (0.5 - 2 μ2) was unchaged from control levels.
Table 5-1, shows the number of migrating cells towards one representative
concentration from each of these chemoattractants. Interestingly, while
114
chemotaxis levels did not significantly increase with these chemoattractants, the
trend and variability was higher than control levels. This could indicate that these
chemoattractants are either inducing the random movement of cells or attracting
the small proportion of impure cells.
Table 5-1 The number of migrating MDSC towards chemoattractants in the
underagarose chemotaxis assay (n = 3-6)
Chemoattractant
Net Migrating Cells
Control
0.94 ± 1.1
MIP-2 (1 μI)
2.1 ± 1.6
KC (0.5 μ.)
1.4 ± 1.1
fMLP (1 μ()
3.2 ± 2.7
After some preliminary data showed promising results, we generated a dose
response curve for MDSC chemotaxis towards MCP-1 (0.1 - 8 μ t) in the
underagarose assay (Figure 5-1B). MDSC chemotaxis was significantly
increased towards 4 μw MCP-1 (16.9 ± 2.1 net migrating cells) as compared to
controls (-0.33 ± 0.67 net migrating cells). An issue with this assay is that it does
not allow us to specifically extract the migrating cells and confirm that they are
Gr1 and CD11b positive. Therefore, while the there was a significant increase in
115
the number of migrating cells towards MCP-1, we could not confirm whether
these cells were Gr1+CD11b+ or from the approximately 20% impure cell
population.
We next tried the Ibidi chamber chemotaxis assay (Heit et al., 2008; Zantl and
Horn, 2011). In this assay, cells are placed in a small channel (0.4x17x4.8 mm)
between two larger reservoirs (80 μe). Chemoattractant conditions are placed in
one of the large reservoirs and the other is filled with vehicle, leading to a
concentration gradient across the channel. The movement of cells in the channel
was tracked closely over 16 hours using a camera attached to an inverted
microscope. Migrating cells were considered chemotactic if their net movement
was greater than 2 mm towards the chemoattractant reservoir. MDSC were
isolated from IL-10-/- mice via percoll density gradient centrifugation. The
advantage of ibidi chambers over underagarose is that cells in the reservoir can
be easily fixed and labeled with antibodies. We used the same protocol as
Gr1+CD11b+ immunohistochemistry to check which chemotactic cells were
Gr1+CD11b+ (Figure 5-2A). Using the ibidi chemotaxis, we found that MDSC
migration towards 1 μ
MCP-1 (18.3 ± 2.1 migrating cells) was significantly
increased as compared to PBS controls (4.0 ± 0.77 migrating cells, Figure 5-2B).
These data suggest that MCP-1 is a chemoattractant for Gr1+CD11b+ cells from
IL-10 deficient mice.
116
The Ibidi chemotaxis chamber has the advantage of allowing us to confirm that
migrating cells were Gr1+CD11b+. The ibidi chamber also has the added
advantages of using a small amount of chemoattractant per well and allows us to
determine the speed and pathway of cell movement. However, only three ibidi
chemotaxis chambers fit on one slide that has to be monitored by a camera
attached to a microscope. Therefore only three replicates can be monitored
simultaneously on one microscope. In addition, data collection from these three
replicates was time consuming and required approximately 24 hours of
preparation, experimentation and analysis time. This method was not ideal due to
increased cost in time and in animal sacrifice.
117
A
*
Net Migrating Cells
50
40
30
20
10
0
-10
PBS
fmlp (1µM)
B
*
Net Migrating Cells
20
10
0
0.
P
1µ
M BS
M
0.
5µ CP
-1
M
M
C
1µ
PM
1
M
2µ CP
-1
M
M
4µ CP
-1
M
M
6µ CP
-1
M
M
8µ CP
-1
M
M
C
P1
-10
Figure 5-1 Neutrophil and MDSC Underagarose Chemotaxis Assay
This figure illustrates the number of net migrating (A) neutrophils and (B) MDSC
in the underagarose chemotaxis assay. Cells were isolated from the bone
marrow via percoll density gradient centrifugation. Neutrophils were isolated from
wild type mice and MDSC were isolated from IL-10-/- mice. Migration was
determined following by counting the number of migrating cells following a 4 hour
incubation at 37°C in 5% CO2. n = 3-7, * indicates significant increase (p<0.05)
from PBS, (A) Two-tailed Student’s t test, (B) One-way ANOVA followed by
Bonferroni’s Post test
118
A
B
Migrating Cells
25
*
20
15
10
5
0
PBS
MCP-1 (1 µM)
Figure 5-2 MDSC Ibidi Chemotaxis
This figure illustrates (A) a representative image of Gr1+CD11b+ cells and (B) the
number of migrating MDSC in the Ibidi chamber chemotaxis assay. MDSC were
isolated from the bone marrow of IL-10-/- mice via percoll density gradient
centrifugation. Cell movement was monitored via an inverted microscope over 16
hours at 37°C. Cells with net movement greater than 2 mm towards the
chemoattractant reservoir were considered chemotactic. Cells were fixed and
labeled with Gr1 (FITC) and CD11b (PE) antibodies. Double-labeled cells are
golden coloured. n = 6, * indicates significant increase (p<0.05) from PBS, Twotailed Student’s t test
119
Our data in MDSC chemotaxis assays show that MCP-1 is a chemoattractant.
The ideal assay would allow the testing of a number of potential
chemoattractants with a reasonable use of resources and allow for the
confirmation of migrating cells as being Gr1+CD11b+. We were successful in
achieving both of these goals with the transwell chamber chemotaxis assay.
5.2 Transwell Chamber Chemotaxis Assay
The transwell chamber, as shown in the
attached image, has an upper chamber
and a lower chamber connected by an 8
μc porous membrane. Cells (5 x 105 bone marrow derived MDSC) were placed
in the upper chamber, which has pores at the bottom to allow for cells to migrate
to the lower chamber, which contains the chemoattractant. Migrated cells
suspensions were cytospun onto slides. These slides were labeled with
Gr1+CD11b+
antibodies
with
the
same
protocol
as
the
colon
immunohistochemistry. Gr1+CD11b+ cells were counted as net migrating cells.
The percentage of migrating cells that were Gr1+CD11b+ was always greater
than 90%. Vehicle only in the lower well was used as a control. Chemoattractant
in both the upper and lower chambers was used as a control for chemokinesis.
The transwell assay allowed us to test a large number of conditions to be
performed on the same day and confirm that migrating cells are Gr1+CD11b+.
120
Confirming results from previous assays, our preliminary data in the transwell
assay showed that MCP-1, but not fMLP, was a chemoattractant for MDSC. Our
data also showed that greater than 90% of cells migrating towards MCP-1 were
Gr1+CD11b+. Having established the assay, we next performed a dose response
curve for MDSC migration towards MCP-1. Migration towards MCP-1 was
significantly increased from control levels at 50 and 100 ng/ml concentrations
(Figure 5-3).
Next, we tested various factors identified as important for MDSC recruitment in
literature and common leukocyte chemoattractants in the transwell chamber
chemotaxis assay. We found no significant increase in MDSC migration towards
IL-1β (10 ng/ml - 2 mltio), IL-6 (100 ng/ml - 2 g/ml), prostaglandin E2 (1 ng/ml 1 μg/ml), KC (0.1 μM - 2 μM), fMLP (0.5 ng/ml - 2 μg/ml) and VEGF (100
ng/ml - 1 mll V) as compared to control levels. Figure 5-4 shows the number of
migrating
cells
towards
one
representative
concentration
from
these
chemoattractants.
Using the transwell chamber chemotaxis assay, we also identified SDF1/CXCL12 as a chemoattractant for MDSC in this model (Figure 5-5). Migration
towards SDF-1 was significantly increased from controls at 100, 150 and 200
ng/ml concentrations. We tested SDF-1 in our model because SDF-1 and its
receptor have previously been identified as being key to MDSC recruitment in
121
ovarian cancer and related to MDSC in a model of breast cancer (Liu et al., 2010;
Obermajer et al., 2011b). Chemotaxis is the movement of cells along a gradient
towards a chemoattractant. Some agents induce chemokinesis in cells, which is
movement in random directions. We confirmed that MCP-1 and SDF-1 induce
chemotaxis and not chemokinesis in MDSC by loading the concentration of the
chemoattractant that induced highest migration of cells in both the upper and
lower chamber (Figure 5-3 & 5-5). This did not increase the migration of cells into
the lower chamber for MCP-1 (100 ng/ml) or SDF-1 (150ng/ml).
We next compared MDSC migration in cells derived from TLR4 competent and
deficient IL-10-/- mice. Interestingly, migration was comparable in MDSC derived
from IL-10-/- and IL-10-/- TLR4-/- mice towards both MCP-1 and SDF-1 (Figure 56). This finding is in agreement with previous data that suggested that TLR4
competence does not affect MDSC function. These data show that MCP-1 and
SDF-1 are MDSC chemoattractants in the IL-10 deficient mouse model. Both
MCP-1 and SDF-1 have been related to MDSC recruitment in previous studies,
but we are the first to show that they are direct chemoattractants.
122
8
6
*
*
4
2
0
C
on
12 t r o
.5
ng l
/
2 5 ml
ng
/
50 ml
ng
10 / m
0n l
g
20 /m
0n l
g
40 /m
0n l
g/
C 800 ml
he
n
m g/m
ok
in l
es
is
Migrating Gr1+CD11b+ Cells
(x 10^4 cells/ml)
10
Figure 5-3 MDSC migrate towards MCP-1 in the Transwell Chemotaxis
Assay
This figure illustrates a dose response curve of the number of migrating MDSC
towards MCP-1 in the transwell chamber chemotaxis assay. MDSC were isolated
from the bone marrow of 3-month-old IL-10-/- mice via percoll density gradient
centrifugation. Cells well allowed to migrate at 37°C for three hours. Migrating
cells were confirmed as Gr+CD11b+ via immunohistochemistry. n ≥ 3, * indicates
significant increase (p<0.05) from Control, One way ANOVA followed
Bonferroni’s Post Test
123
by
Migrating Gr1+CD11b+ Cells
(x 10^4 cells/ml)
10
*
8
6
4
2
l)
/m
/m
-6
IL
β
(1
µg
ng
-1
IL
PG (1 µ l)
E2 g/
m
K (1 µ l)
C
g
VE (10 / m
l)
0
G
n
F
(5 g/m
fM
0
LP 0 n l)
(1 g/m
00
l)
ng
/m
l)
M
C
P-
1
(1
00
C
on
tr
ol
0
Figure 5-4 MDSC migration in the Transwell Chemotaxis Assay
This figure illustrates the number of migrating MDSC towards representative
doses of various factors in the transwell chamber chemotaxis assay. MDSC were
isolated from the bone marrow of 3-month-old IL-10-/- mice via percoll density
gradient centrifugation. Cells were allowed to migrate at 37°C for three hours.
Migrating cells were confirmed as Gr+CD11b+ via immunohistochemistry. n ≥ 3, *
indicates significant increase (p<0.05) from Control, One way ANOVA followed
by Bonferroni’s Post Test
124
is
l
es
C
he
m
ok
in
m
l
g/
40
0n
g/
m
l
*
0n
20
15
0n
g/
m
l
m
l
0n
g/
/m
10
ng
tr
50
on
C
*
*
ol
Migrating Gr1+CD11b+ Cells
(x 10^4 cells/ml)
11
10
9
8
7
6
5
4
3
2
1
0
Figure 5-5 MDSC migrate towards SDF-1 in the Transwell Chemotaxis
Assay
This figure illustrates a dose response curve of the number of migrating MDSC
towards SDF-1 protein in the transwell chamber chemotaxis assay. MDSC were
isolated from the bone marrow of 3-month-old IL-10-/- mice via percoll density
gradient centrifugation. Cells were allowed to migrate at 37°C for three hours.
Migrating cells were confirmed as Gr+CD11b+ via immunohistochemistry. n ≥ 3, *
indicates significant increase (p<0.05) from Control, One way ANOVA followed
by Bonferroni’s Post Test
125
A
10
Migrating Cells
(*10^4 Cells/ml)
8
IL-10-/IL-10-/-/TLR4-/-
*
*
6
4
2
C
on
12 t r o
.5
ng l
/
2 5 ml
ng
/
50 ml
ng
10 / m
0n l
g
20 /m
0n l
g
40 /m
0n l
g/
C 800 ml
he
ng
m
ok /ml
in
es
is
0
B
Migrating Cells
(*10^4 Cells/ml)
12
*
*
8
IL-10-/IL-10-/-/TLR4-/-
*
4
is
l
es
ok
in
l
m
C
he
m
40
0n
g/
m
l
g/
0n
20
15
0n
g/
m
l
l
m
g/
/m
0n
10
ng
50
C
on
tr
ol
0
Figure 5-6 TLR4 does not affect MDSC chemotaxis in the IL-10 deficient
mouse
This figure illustrates the number of migrating MDSC towards (A) MCP-1 and (B)
SDF-1 in the transwell chamber chemotaxis assay. MDSC were isolated from the
bone marrow of 3-month-old mice via percoll density gradient centrifugation.
Cells were allowed to migrate at 37°C for three hours. Migrating cells were
confirmed as Gr+CD11b+ via immunohistochemistry. n ≥ 3, * indicates significant
increase (p<0.05) from Control, Statistical analysis: One way ANOVA followed
by Bonferroni’s Post Test
126
5.3 MCP-1 increases MDSC chemotaxis in vivo
Our in vitro data have identified MCP-1 and SDF-1 as MDSC chemoattractants.
Next, we wanted to determine whether this would translate into increased
recruitment of MDSC in vivo. We employed the use of intravital microscopy to
study in vivo recruitment kinetics in leukocyte-endothelial cell interaction in
skeletal muscle vasculature as previously described (McCafferty et al., 2002).
These studies are challenging and require significant time and practice to perfect.
In order to complete these studies for my thesis the following experiment was
performed in collaboration with Dr. Ying Gao, a post-doctoral fellow under Dr.
McCafferty’s supervisions, and Dr. Katarzyna Stevens of the intravital core,
University of Calgary, who routinely use this technique. I isolated MDSC from the
bone marrow and labeled them while Dr. Gao or Stevens performed the intravital
studies and analysis. Wild type mice at 3 months of age were given MCP-1 (300
ng in 0.1 ml) or saline (0.1 ml) subcutaneously. Mice were then anesthetized with
a ketamine-xylazine cocktail and the skeletal muscle was isolated with blood
vessels intact as previously described (McCafferty et al., 2002). MDSC were
isolated from IL-10-/- at 6 months of age and labeled with CFSE dye. Cells (upto
10 x 106) were incubated with 1 ml of 1 μ CFSE dye for 15 minutes. Three
hours after the subcutaneous injection of MCP-1 or saline, 4 x 106 CFSE labeled
MDSC were injected by intravenous jugular route. The adherence of green
fluorescent cells was recorded for 1 minute in 5 post-capillary venules (20 - 40 μ
2 in size) every fifteen minutes for 30 minutes. MDSC adhesion was defined as a
127
fluorescent cell being stationary for 30 seconds. Data are presented as the
average number of adherent cells in 5 vessels at the 30-minute time point. Our
initial data showed a low number of adhering cells in capillaries, so we also
recorded a field of view (40X magnification) for 1 minute every fifteen minutes for
one hour. Data are presented as the average adhering cells in fields of views at
the 30-minute time point.
Adhesion of MDSC was significantly increased upon MCP-1 treatment. The
average number of adhering MDSC in 5 vessels increased from 0.65 ± 0.17
adherent cells in saline treated mice to 1.8 ± 0.54 adherent cells in MCP-1
treated mice (Figure 5-7A). The number of adherent cells were also increased in
the field of view at 40X magnification from 24.0 ± 6.5 adherent cells in saline
treated mice to 47.1 ± 7.4 adherent cells in MCP-1 treated mice (Figure 5-7B).
Next, we also studied MDSC-endothelial cell interaction in colon vasculature of
wild type, IL-10-/- and IL-10-/- TLR4-/- animals as previously described (Qi et al.,
2005). The purpose of this experiment was to compare MDSC recruitment
kinetics in untreated mice in the vasculature of the colon, the site of inflammation
and cancer in our models. CFSE labeled MDSC (4 x 106) isolated from 6-monthold IL-10 deficient mice were injected into untreated 3-month-old wild type, IL-10/-
and IL-10-/- TLR4-/- mice via femoral vein. The adherence of fluorescent cells
was recorded in five fields of view (40X magnification) in the ascending colon
128
from the serosal side at 30 minutes post cell injection. Data are presented as the
average adhering cells at the 30-minute time point. MDSC adherence was
comparable in IL-10-/- (33.8 ± 5.6 adherence cells) and IL-10-/- TLR4-/- (35.3 ±
12.2 adherence cells) mouse colons. MDSC adherence trended higher in these
mutant mice than wild type (15.6 ± 5.6 adherence cells), but the change was not
significant.
Our in vivo data suggest that MCP-1 increases MDSC recruitment in skeletal
muscle vasculature. There is a possibility that cells activated during the isolation
procedure are binding in a non-specific manner. However, increased cell
adhesion is observed upon MCP-1 treatment indicating that the binding is not
non-specific. Using fMLP as a negative control would further help confirm that
this was not non-specific binding. We observed a relatively low number of cells
adhering per vessel even after MCP-1 treatment. This experiment could be
further optimized by modulating the dose of MCP-1, time between drug treatment
and cell injection or the number of cells injected. We used skeletal muscle to
study MDSC recruitment kinetics in vivo because it is easily transilluminated
compared to the colon. It is however possible that MDSC-endothelial interactions
in skeletal vasculature differ from that in the colon. Our initial data do not show
MDSC adherence was increased in IL-10-/- and IL-10-/- TLR4-/- than in wild type
mouse colons. There is however a trend towards increased recruitment that may
be significant in a larger sample size. From our previous data, we would expect
129
increased MDSC adherence in the absence of TLR4 in the IL-10-/- colon.
Interestingly, MDSC adherence levels were comparable in IL-10-/- and IL-10-/TLR4-/- mouse colons. This may be explained by a number of factors. We did not
score the colons for inflammation and cancer. The IL-10 deficient mouse is a
variable model and the level of disease development would affect cell recruitment
kinetics. It is possible in a sample size of 3 that dysplasia levels were not
reflective of the difference between the two mutant mice. These data suggest no
differences in MDSC-endothelial adherence but cell recruitment is a multi-step
process that involves rolling, adherence and transmigration across the
endothelial barrier. TLR4 may affect transmigration rather than adherence.
Future investigations could compare the expression of molecules involved in
adherence and transmigration in IL-10-/- and IL-10-/- TLR4-/- colons. We studied
intact colons from the serosal end using a spinning disk microscope, which
allows us to observe vasculature in the muscle and submucosal layers of the
colon. Dysplasia is initiated and largely found in the mucosal layer. MDSC
recruitment kinetics maybe different in the mucosal layer than those observed
from the serosa. Further intravital studies from the mucosal end could help
delineate this difference. These data show that MCP-1 significantly enhances
MDSC adhesion in vivo. Taken together with the in vitro data, our data make a
strong case for MCP-1 as a chemoattractant for MDSC in the IL-10 deficient
mouse.
130
Adhering Cells
(Average in 5 Vessels)
A
*
2.5
2.0
1.5
1.0
0.5
0.0
Saline
MCP-1 (300ng)
B
Adhering Cells
(4X Field of View)
60
*
40
20
0
Saline
MCP-1 (300ng)
Figure 5-7 MCP-1 increases MDSC recruitment kinetics in vivo
This figure illustrates the number of adherent MDSC in (A) 5 post-capillary
venules (20 and 40 μ 0) and (B) field of view at 40X magnification in the
cremaster muscles of 3-month-old wild type mice in vivo. Mice were given
subcutaneous injections of saline or MCP-1. MDSC were isolated from the bone
marrow of 6-month-old IL-10-/- and labeled with CFSE. 4 x 106 labelled MDSC
were injected and adherence was observed using a spinning disk microscope. n
= 3-4, * indicates significant increase (p<0.05) from Control, Two-tailed Student’s
t test
131
Adhering Cells
(4X Field of View)
50
40
30
20
10
0
Wild type
IL-10-/-
IL-10-/- TLR4-/-
Figure 5-8 MDSC recruitment kinetics in the colon in vivo
This figure illustrates the number of adherent MDSC in field of view at 40X
magnification in the ascending colon of 3-month-old untreated mice. MDSC were
isolated from the bone marrow of 6-month-old IL-10-/- mice and labeled with
CFSE. 4 x 106 labelled MDSC were injected and adherence was observed using
a spinning disk microscope. Wild type n = 2, Mutant n = 3, Two-tailed Student’s t
test between mutant mouse groups
132
The data from in vitro and in vivo recruitment studies suggest that MDSC can be
recruited to SDF-1 and MCP-1. However, TLR4 deficiency does not alter their
ability migrate towards these factors in vitro. These data further suggest that the
increased MDSC recruitment into the colon in the absence of TLR4 is mediated
by a change in the tissue microenvironment. Our previous data indicate that
levels of MDSC in the spleen were comparable in IL-10-/- and IL-10-/- TLR4-/- mice.
We therefore examined how TLR4 deficiency effects the expression of these
chemoattractants in colon tissue.
5.4 Chemoattractant protein and mRNA levels in the IL-10 deficient mouse
We determined chemoattractant levels in the proximal and distal colons of IL-10-/and IL-10-/- TLR4-/- rather than whole colons because earlier experiments
indicated that TLR4 levels are modulated differently in the proximal and distal
part of the colon. Chemoattractant levels were determined in 6-week and 6month-old mice to determine how chemoattractant levels are changed after
disease development.
MCP-1 and SDF-1 mRNA levels were determined in colon tissue by the real time
polymerase chain reaction. RNA was extracted from tissue with Trizol and
purified. Purified RNA was reverse transcribed into cDNA and amplified with
chemoattractant and GAPDH, the housekeeping gene, probe and primers. One
of samples from the 6-week-old IL-10-/- group was given the relative value of 1.
133
MCP-1 relative quantification levels over GAPDH were unchanged between IL10-/- and IL-10-/- TLR4-/- colons in the proximal and distal colon in both age groups
(Figure 5-9). The SDF-1 RT-PCR did not generate quantifiable results. Next, we
determined protein levels in colons via western blot analysis. Laemmli buffer was
added to lysed colon tissue and boiled. This solution was run through stracking
and separating SDS-PAGE gels by electrophoresis. Protein was transferred to
nitrocellulose and incubated with chemoattractant antibody overnight. The next
day, the membrane was incubated with secondary antibody and visualized. A
representative blot is provided in Figure 5-10A. MCP-1 protein levels were
comparable in the proximal colon at 6 weeks of age. MCP-1 protein levels were
significantly increased in IL-10-/- TLR4-/- colons as compared to IL-10-/- in the
proximal colon at 6 months of age and in the distal colon at both 6 weeks and 6
months of age (Figure 5-10B). We have shown that MCP-1 protein is significantly
increased in the IL-10 deficient mouse colon in the absence of TLR4. These
data suggest that TLR4 deficiency increases MCP-1 levels in the colon leading to
increased recruitment of protumorigenic MDSC. MCP-1 protein is subject to
methylation and posttranslational modifications, especially in inflammatory
environments. A western blot the protein can show up in stretched or multiple
bands (Fujita et al., 2010; Grammas and Ovase, 2001). In our blots, we found
MCP-1 protein in two distinct bands (Figure 5-10A).
134
Relative Quantification
(MCP-1/GAPDH)
15
10
5
-1 IL0 -/- 10 TL /-P
R -/ ro
- x
IL I Pr im
-1 L- ox al
0 -/- 10 - im
TL /-D al
R -/ is
- ta
D l
is
ta
l
IL
IL
-1 IL0 -/- 10 TL /-P
R -/ ro
- x
IL I Pr im
-1 L- ox al
0 -/- 10 - im
TL /-D al
R -/ is
- ta
D l
is
ta
l
0
6 Week Old
6 Months Old
Figure 5-9 MCP-1 mRNA levels are comparable in the IL-10 deficient mouse
in the absence of TLR4
This figure illustrates the levels of MCP-1 messenger RNA in mouse colon tissue
from IL-10 deficient and IL-10 TLR4 double deficient mice. RNA was purified
from colon tissue with Trizol and complimentary DNA was generated. Messenger
RNA levels were quantified by real time polymerase chain reaction. n = 3, Oneway ANOVA followed by Bonferroni’s Post test
135
A
I
0 -/- L-1
MCP-1/Actin Average Intensity
TL 0 -/P
R
4 -/- rox
IL
i
-1 IL Pro ma
0 -/- -1 x l
i
TL 0 -/- ma
R Di l
4 -/- st
D al
is
ta
l
B
2.5
*
2.0
1.5
1.0
0.5
*
*
I
0 -/- L-1
TL 0 -/R Pr
4 -/- ox
IL
i
-1 IL Pro ma
0 -/- -1 x l
i
TL 0 -/- ma
R Di l
4 -/- st
D al
is
ta
l
-1
IL
IL
-1
0.0
6 Week Old
6 Months Old
Figure 5-10 MCP-1 protein levels are significantly increased in in the IL-10
deficient mouse in the absence of TLR4
This figure illustrates (A) representative western blots of MCP-1 and βoactin
protein in colon tissue from 6-month-old mice and (B) MCP-1 protein levels
quantified by densitometry over actin in mouse colon tissue. Protein levels were
determined by western blot analysis. n = 3, * indicates significant change
between groups (p<0.05), One-way ANOVA followed by Bonferroni’s post test
136
SDF-1 has previously been reported to be expressed in human colons and
colonic cells lines as well as mouse colons (Ding et al., 2013; Mikami et al., 2008;
Schimanski et al., 2008). We used the same western blot protocol as MCP-1 to
determine SDF-1 protein levels in the colon. We were unable to visualize any
SDF-1 protein from mouse colons via western blot analysis. Only the SDF-1
protein positive control band was visualized at the correct size. As SDF-1 protein
may be present only in minute quantities in our model, we decided to increase
the potential protein in the western blot by immunoprecipitation. Agarose bead
slurry was incubated with lysed colon tissue to remove non-specific binding
particles. After centrifugation, the supernatant was incubated with SDF-1
antibody overnight. The next day this solution was incubated with agarose beads.
After centrifugation, the pellet was washed, resuspended in SDS buffer and
boiled. This solution was run through the western blot as previously described.
We were again unable to visualize any bands except the positive control. It
remains unclear whether SDF-1 plays a role in MDSC recruitment to the colon in
this model. It is possible that either SDF-1 does not play a role in this model or
that protein levels are too low to be detectable by immunoprecipitation and
western
blotting
techniques.
A
radiometric
assay
or
enzyme
linked
immunosorbent assay may be able to detect SDF-1 in IL-10 deficient colons.
Another possibility is that the two different antibodies used are not compatible
with the SDF-1 protein in 129SvEv mice.
137
This chapter aimed to elucidate the relationship between the absence of TLR4
and increased MDSC recruitment in the IL-10 deficient mouse. To understand
how TLR4 was affecting MDSC recruitment to the colon, we first identified MCP1 and SDF-1 as MDSC chemoattractants via both in vitro and in vivo assays.
Then our data showed that in the absence of TLR4, MCP-1 protein levels are
increased in the IL-10 deficient mouse. These data taken together show a
potential sequence of events where as disease development progresses in the
IL-10
deficient
mouse,
TLR4
deficiency
leads
to
increased
MDSC
chemoattractants in the colon. These chemoattractants increase MDSC
recruitment into the colon. This increased MDSC recruitment, as our earlier
findings have shown, is associated with increased cancer development in colitisassociated cancer.
138
Chapter 6: Discussion and Future Directions
139
Colorectal cancers are neoplasms of the colon, rectum and appendix. CRCs
have a heavy disease burden and are a leading cause of cancer related deaths
in Canada and worldwide (Parkin et al., 2010; Singh et al., 2012a). Colon
adenocarcinoma is the most common presentation of CRC and a heterogeneous
combination of events can lead to its development (Kumar, 2010). Long-standing
inflammation in the colon is related to an increased risk of developing
adenocarcinoma (Bernstein and Nabalamba, 2007). While the link between
inflammation and cancer development has been established in CRC and many
other types of cancers, the underlying mechanisms remain poorly understood. A
key characteristic of both inflammation and cancer is the presence of leukocytes
(Goldszmid and Trinchieri, 2012). One leukocyte population that plays a role in
both inflammatory bowel disease and colon cancer is the myeloid derived
suppressor cell (Ostrand-Rosenberg and Sinha, 2009). Murine MDSC are
identified by Gr1 and CD11b markers, and the ability to suppress the immune
response (Melani et al., 2003). These are immature cells that are recruited away
from the bone marrow to sites of cancer. There MDSC are thought to promote
tumor formation by suppressing the immune response and promoting
angiogenesis. The MDSC also likely play an immunosuppressive role in
inflammation and this is still being explored (Kong et al., 2013). The role of
MDSC and their mechanisms have not been colitis associated cancer have not
been studied.
140
Three main types of experimental models of colitis-associated cancer are studied
in literature. Ours is unique in that in the absence of IL-10, it is spontaneous
chronic
inflammation
with
key
similarities
to
clinical
IBD
that
drives
adenocarcinoma development as mice age (Zhang et al., 2007b). We found that
MDSC recruitment was elevated to the colon in this model. We are also in the
unique position of being able to study the role of TLR4 in cancer development
with an IL-10 and TLR4 double knockout mouse (Zhang et al., 2007a). TLR4 and
related pathways are thought to be homeostatic regulators of intestinal
inflammation (Gonzalez-Navajas et al., 2010; Greten et al., 2004). The loss of
this innate immune receptor is involved in the progression from inflammation to
the cancer phenotype at a much earlier time point (Zhang et al., 2007a).
Furthermore, novel data presented in this thesis illustrate a profound recruitment
of MDSC to the gut of IL-10 deficient mice as they age, which is exacerbated in
the absence of TLR4 and therefore make a potential contribution to disease
progression. Our studies examined the role of MDSC in the IL-10 deficient model
of inflammation-associated cancer and the potential role of TLR4 in their
regulating recruitment and function. Despite the presence of MDSC in cancer
models, little is known about their recruitment factors. We hypothesized that
MDSC contribute to cancer development in this model and TLR4 modulates their
recruitment to affect cancer development in colitis-associated cancer.
141
First, we established the presence of MDSC in the IL-10 deficient colon by using
immunohistochemistry and flow cytometry analysis for Gr1+CD11b+ cells. Using
flow cytometry we demonstrated increased MDSC levels with age, which is also
associated with cancer development. This is the first time MDSC have been
visualized in colon sections via immunohistochemistry. Employing this technique
gave us the added advantage of being able correlate dysplasia development and
MDSC levels in the same colon. Colon tissues were examined for location of
MDSC and we found cells accumulate in areas of cancer, supporting data in
literature that suggest MDSC are recruited to the tumor microenvironment
(Gabrilovich and Nagaraj, 2009). Interestingly, in IL-10-/- mice on the C57BL/6
background Singh et al. reported that low levels of MDSC associated with
inflammation (Singh et al., 2012b). They showed that at 6 months of age IL-10-/mice on the C57BL/6 background approximately 0.4 % of colonic lamina propria
cells are MDSC. In our 6-month-old IL-10-/- mice on the 129SvEv background
MDSC counts are 8.8 ± 1.2 % determined by flow cytometry analysis for
Gr1+CD11b+ cells. This difference is striking even accounting for slightly altered
cell isolation protocols and different antibody suppliers. This is probably due to
C57BL/6 mice being less susceptible to developing inflammation (Mahler et al.,
1998). This study associated MDSC with inflammation in the IL-10 deficient
mouse, but our interest is in their role in colitis-associated cancer.
142
A striking observation in these studies is that MDSC recruitment in the colon is
increased in the IL-10 deficient mouse in the absence of TLR4. TLR4 deficiency
did not however, alter MDSC levels in the bone marrow or spleen. These data
suggest TLR4 in some manner regulates MDSC recruitment to the gut. We
observed a strong correlation between MDSC levels with dysplasia scores in the
colons of wild type, IL-10 deficient and IL-10 TLR4 double deficient mice. MDSC
were the only cell type significantly increased in the colon the absence of TLR4.
Interestingly, TLR4 deficiency decreased T-cell counts in the colon further
supporting an immunosuppressive role of MDSC in this model. We also found
elevated Gr1+CD11b+ cell counts in the AOM/DSS model of colitis-associated
cancer. This demonstrates that MDSC presence is not limited to the IL-10 model
and may play a role in other models of inflammation-associated cancer. Further
in vivo and in vitro MDSC functional studies in the AOM/DSS and other models
are warranted to determine if MDSC have a universal role in colitis-associated
cancer.
Next, we studied Gr1+CD11b+ cell function in vitro in the IL-10 deficient mouse. It
was critical to establish immunosuppressive functionality in these cells to confirm
they are MDSC. Gr1 and CD11b can be present in a number of myeloid cell
populations, such as neutrophils, but it is the ability to both express these
markers and to suppress the immune response that characterizes MDSC
(Gabrilovich and Nagaraj, 2009). We achieved this by establishing the presence
143
of known immunosuppressive pathways in MDSC, arginase I and NOS 2
enzymatic activity, and by showing the ability of MDSC in the IL-10 deficient
model in suppressing the proliferation of T-cells. We found that approximately 5%
of MDSC express TLR4. TLR4 competence did not affect MDSC function in the
arginase I activity, NOS2 activity and T-cell proliferation suppression assays.
These are three of the most commonly used assays in assessing MDSC
immunosuppressive functionality (Gabrilovich and Nagaraj, 2009; OstrandRosenberg and Sinha, 2009).
MDSC
suppress
the
immune
response
and
contribute
to
the
local
microenvironment by other mechanisms, such as direct cell-to-cell contact CD8+
cell suppression, and production of immunosuppressive and proangiogenic
factors, such as VEGF, that were not tested here (Dolcetti et al., 2008; Nagaraj et
al., 2007). Interestingly, one of the immunosuppressive factors produced by
MDSC is IL-10, which suppresses the immune response in macrophage and Tcells by decreasing the production of cytokines such as IL-12 (Koike et al., 2012;
Obermajer and Kalinski, 2012; Sinha et al., 2007a; Srivastava et al., 2012). TLR4
has been proposed to regulate MDSC cross talk and function. Koike et al report
that IL-10 production by MDSC is MyD88 dependent, which is activated by
pattern recognition receptors, such as TLR4 (Koike et al., 2012). Interestingly,
TLR4 deficiency decreased MDSC function, including IL-10 production, by cutting
off cross talk between MDSC and macrophage (Bunt et al., 2009). The lack of
144
functional differences between TLR4 competent and deficient MDSC in our
model could be due to the added deficiency in IL-10. We have already
established the ability of IL-10 deficient MDSC in suppressing T-cell proliferation.
Therefore IL-10 is not essential for MDSC immunosuppression in our model.
However, it is possible that IL-10 competent MDSC could have a further
enhanced ability to suppress T-cell or macrophage function. A comparison of IL10 competent and deficient MDSC could indicate the importance of this
immunosuppressive mechanism in MDSC. The potential role of TLR4 in MDSC
immunosuppressive function could be addressed with functional assays in TLR4
deficient but IL-10 competent MDSC. One of the issues with this experiment is
the low levels of MDSC in healthy wild type mice. An alternate model that
induces MDSC expansion would have to be used or MDSC would have to be
generated from bone marrow cells ex vivo, a methodology for this has been
described recently (Lechner et al., 2010).
We observed enhanced immunosuppressive functionality in spleen derived
MDSC over bone marrow derived cells from both IL-10 deficient and IL-10 TLR4
double deficient mice. MDSC could be going through a type of activation step
through recruitment factors and/or by peripheral exposure to various factors.
Exposure to a number of inflammation related factors including prostaglandin E2,
IL-1β, interferon γ and tumor necrosis factor α has been shown to induce
increased functionality in MDSC (Sevko and Umansky, 2013; Yang et al., 2013).
145
Increased levels of these cytokines have been reported in the IL-10 deficient
mouse (Kawachi et al., 2000). IL-10-/- TLR4-/- mice have similar levels of
inflammation to IL-10-/- mice and their MDSC have similar immunosuppressive
abilities suggesting that they are exposed to a similar activating environment. IL1e has been shown to expand MDSC numbers and to enhance their function
through a NF-κh dependent pathway (Tu et al., 2008). Our data demonstrate
that no difference between TLR4 competent and deficient MDSC functionality
indicating that NF-κu is not important or is activated by a different mechanism in
MDSC function. Prostaglandin E2 has been shown to induce MDSC and
enhance their expression of arginase I and NOS2 enzymes in both human and
murine models (Obermajer et al., 2011a; Obermajer et al., 2011b; Obermajer et
al., 2012; Sinha et al., 2007b). Prostaglandin E2 may be an interesting target for
future studies in this model because it is secreted by colon cancer cells and our
work has shown that COX-2 expression, which is part of the prostaglandin E2
production pathway, is enhanced in this model in the absence of TLR4 (data not
shown). Interestingly, Watanabe et al. have reported that Gr1+CD11b+ cells
found in the spleens of tumor-bearing mice are potent immunosuppresors but
Gr1+CD11b+ cells from wild type spleens had much lower suppressive effects
(Watanabe et al., 2008). Our results are consistent with the hypothesis that
inflammatory cytokines stimulate MDSC in the periphery to enhance their
function.
146
To demonstrate a role of MDSC in vivo in our model of colitis-associated cancer
we
took
two
approaches:
depletion
and
supplementation.
Low
dose
chemotherapeutics such as gemcitabine and 5-FU have previously been
employed to target MDSC and reduce cancer development in other models
(Suzuki et al., 2005; Vincent et al., 2010). We recognize that there is an inherent
issue with using cytotoxic drugs in this study. However, in vivo and in vitro work
by these other groups showed that low doses of these drugs target MDSC more
potently and efficaciously than cancer cells and other leukocytes. We showed
that repeated low doses of 5-FU and gemcitabine significantly decrease MDSC
counts and dysplasia development in the colon. Vincent et al. reported that 5-FU
targets MDSC in more potent manner than gemcitabine. This observation was
repeated in our results where we found that at the same dose, 5-FU decreased
MDSC counts and dysplasia further than gemcitabine. Vincent et al. used a
single dose gemcitabine and 5-FU in a model of thymoma cancer cell line
injection murine model of cancer. Le et al. used both single and multiple doses of
gemcitabine in a 4T1 mammary carcinoma cell line injection model of murine
cancer (Le et al., 2009; Vincent et al., 2010). Interestingly, while both these
studies showed decreased tumor sizes, neither showed the dramatic decrease in
dysplasia development observed by us in the IL-10 deficient mouse, where we
observed no adenocarcinoma formation, only low-grade adenomas in some mice.
This may be explained by differences between the models, but also potentially a
more critical role for MDSC in dysplasia development in colitis associated cancer
147
and warrants further study. Recently, others have shown that the adoptive
transfer of MDSC increases immunosuppression in models of inflammation or
cancer (Parekh et al., 2013; Schmidt et al., 2013). Schmidt et al. showed that
MDSC adoptive transfer increases immunosuppression acutely in a model of
hepatocellular carcinoma. Another recent study showed increased mortality
following an adoptive transfer of MDSC, which suggested an important role for
MDSC in cancer progression in a model of multiple myeloma (Ramachandran et
al., 2013). Our data indicate increased cancer development with adoptive
transfers of MDSC in a model of inflammation-associated cancer. To our
knowledge, this work is the first to show increased dysplasia with an adoptive
transfer for MDSC.
A number of groups have shown MDSC as having an anti-inflammatory effect in
colitis and other models of inflammation (Haile et al., 2008; Parekh et al., 2013;
Singh et al., 2012b). In light of these recent studies, a surprising finding from our
work was the lack of effect on inflammation despite significant differences in
dysplasia with in vivo MDSC depletion and adoptive transfer studies. This may
be explained by a number of factors. We scored inflammation macroscopically
and histologically through scoring systems, which may not incorporate minute but
significant changes in inflammation that could be reflected in more sensitive
assays such as myeloperoxidase levels or assays for cytokines levels. Haile et al.
showed MDSC are immunosuppressive in vivo in a T-cell transfer model of colitis
148
by co-injecting MDSC with the inflammation inducing T-cells. This is similar to
decreasing T-cell responsiveness in vitro by co-incubation with MDSC and does
not necessarily suggest that MDSC reduce established colitis severity. Singh et
al. showed resveratrol treatment decreases inflammation and increases MDSC
recruitment in the IL-10 deficient mouse, but did not establish a cause and effect
relationship between the two changes (Haile et al., 2008; Singh et al., 2012b).
Zhang et al. have suggested that MDSC recruitment is elevated and their
adoptive transfer decreases inflammation in DSS colitis (Zhang et al., 2011). Our
data also show that MDSC are recruited to cancer lesions in nearly 5X higher
numbers than to inflammatory lesions within the same colons. In our model,
where dysplastic lesions are common, it is likely that MDSC are not recruited to
inflammatory lesions in large enough numbers to affect a change. We looked at
inflammation at a point where dysplasia is evident, but earlier time points may
show different results. Future studies could examine inflammation at an earlier
time point where cancer phenotype has not yet developed.
We showed that TLR4 mRNA is downregulated in IL-10 polyps compared to nonhyperplastic mucosa. This evidence suggests that TLR4 may play a role in the
modulation of dysplasia development through alterations in colonic tissue. We
hypothesized that the absence of TLR4 signaling is enhancing cancer
development in the colon by increasing MDSC recruitment through a change in
the microenvironment, such as the modulation of chemoattractant levels. To
149
determine how TLR4 was enhancing MDSC recruitment in the colon, we first had
to determine which factors affect MDSC recruitment. Numerous studies have
identified factors that play a role in MDSC recruitment (Sevko and Umansky,
2013). These studies have generally been conducted in vivo with genetic or
pharmacological knockouts. We identified MDSC chemoattractants using in vitro
and in vivo chemotaxis assays. We found that MDSC from the IL-10 deficient
mouse migrated towards MCP-1 and SDF-1. Both of these factors have been
previously related to MDSC recruitment (Huang et al., 2007; Liu et al., 2010).
Migration towards either MCP-1 or SDF-1 was not affected by TLR4 deficiency,
again indicating that TLR4 does not affect MDSC directly. Interestingly, while
message levels were unchanged, we found that MCP-1 protein was significantly
increased in the colons of IL-10 deficient mice in the absence of TLR4 at 6
months of age. In 6-week-old IL-10 deficient mice when no inflammation or
dysplasia are apparent, MCP-1 protein was significantly increased in the distal
colon in the absence of TLR4. This suggests that the lack of TLR4 signaling in
the colon increases chemoattractant levels such as MCP-1 , which can recruit
MDSC.
MCP-1, a CC family chemokine, is primarily secreted by monocyte/macrophage
and dendritic cells upon activation and is a potent chemoattractant and activator
of macrophage populations (Popivanova et al., 2009). Innate immune receptors
such as TLRs play a key role in the initial activation of macrophage and dendritic
150
cells by allowing them to recognize the presence of foreign antigen and initiating
the process of activating an immune response via the NF-κi pathway (Danese
and Mantovani, 2010; Takeda and Akira, 2004). Later recruitment of
macrophages that produce chemokines such as MCP-1 in large quantities
happens due to the cytokines released by activated T-helper cells and
macrophage at the site of inflammation (Danese and Mantovani, 2010; De Paepe
et al., 2009). MCP-1 has been previously related to inflammation and cancer in
numerous models. MCP-1 levels are increased in IBD patients and the
AOM/DSS model of colitis-associated cancer (Popivanova et al., 2008;
Reinecker et al., 1995). Pharmacological blockage or deficiency of the MCP-1
receptor results in decreased cancer development in a model of colitisassociated cancer (Popivanova et al., 2009). MCP-1 and its receptor have been
previously related to MDSC recruitment in vivo (Boelte et al., 2011; Huang et al.,
2007; Jackson et al., 2013). The mechanism of how TLR4 affects MCP-1 levels
and MDSC recruitment to the colon in the IL-10 deficient mouse is an important
question that remains to be addressed.
Our work supports increased MCP-1 levels in the colon in the absence of TLR4
as the key to elevated MDSC recruitment. The increased MCP-1 levels are
unlikely to be a direct effect due to lack of TLR4 signaling. Innate immune
receptors such as TLR4 are thought to induce inflammation related cytokines and
chemokines such as MCP-1 (Lapara and Kelly, 2010; Yoshimura and Takahashi,
151
2007). However, TLR4 and related pathways also play an important homeostatic
role and the loss of this function leads to the development of inflammation in the
colon (Fukata and Abreu, 2007; Gonzalez-Navajas et al., 2010; Zhang et al.,
2007a). This inflammatory response would certainly involve the activation of the
NF-κF pathway in immune cells including MCP-1 secreting macrophage and
dendritic cells. The NF-κh pathway has been identified by Greten et al. as a key
modulator of inflammation associated cancer in the colon (Greten et al., 2004).
TLR4 signaling is also important for epithelial proliferation, a key step in the
resolution of inflammation (Ruemmele et al., 2002). Studies in various disease
models show that lack of TLR signaling increases inflammation and injury
including the production of cytokines such as MCP-1 (Hayashi et al., 2012;
Zampell et al., 2012). Therefore, a potential pathway linking TLR4 and MDSC
recruitment is the activation of an altered and persistent immune response after
the loss of TLR4’s homeostatic functionality leading to increased MCP-1
production and MDSC recruitment. This potential pathway could be verified in
further studies with TLR4 antagonists or antibody in the IL-10 deficient mouse.
Results from MCP-1 antagonist and antibody studies could determine whether
MCP-1 plays a key role in MDSC recruitment in vivo. Successful bone marrow
transplant experiments between IL-10 deficient and IL-10 TLR4 double deficient
mice could explain whether it is TLR4 deficiency in myeloid cells, colon tissue or
a combination of both is important in determining MCP-1 levels, MDSC
recruitment and cancer development in this model.
152
We find that TLR4 protects against cancer development in the IL-10 deficient
model of colitis-associated cancer. This is in striking contrast to results published
by Fukata et al., who reported that TLR4 promotes cancer development in the
AOM/DSS model of colitis-associated cancer (Fukata et al., 2007). A number of
factors may explain these opposing results. The IL-10 deficient mouse and
AOM/DSS are both models of colitis-associated cancer, but the mechanisms of
cancer pathogenesis differ greatly. In the AOM/DSS model, the carcinogen, AOM,
initiates cancer development and barrier disruption and inflammation induced by
DSS are used to drive cancer development. In the IL-10 deficient mouse, cancer
initiation and development are both driven by the chronic inflammatory
microenvironment in the mucosa. Another key difference between the two
models is the extent of MDSC recruitment. MDSC recruitment to the colon in the
AOM/DSS model in our hands, where 100 % of mice developed invasive cancer,
was four times lower than in 6-month-old IL-10 deficient mice, when only 20 % of
mice develop invasive cancers. These data suggest a greater recruitment and
better correlation with cancer development for MDSC in the IL-10 deficient than
the AOM/DSS model of colitis associated cancer. We have established a key role
for MDSC in carcinogenesis in the IL-10 deficient mouse and MDSC recruitment
to the colon is even greater in the absence of TLR4. Therefore, our data suggest
that MDSC recruitment is one of the key differences that may explain the
153
opposing roles for TLR4 in cancer development in the IL-10 deficient and
AOM/DSS models.
The link between inflammation and cancer is well established but not fully
understood (Ben-Neriah and Karin, 2011; Rutter et al., 2004). Though we do not
find MDSC to play an anti-inflammatory role in the IL-10 deficient model,
inflammation does recruit MDSC to the colon in our model and numerous others.
We have established the critical role for MDSC in cancer development in the
colon. Therefore, our data suggest that MDSC may be a critical component in the
link between inflammation and cancer. Once recruited by the inflammatory
microenvironment MDSC could help transformed cells in immune escape and
growth (Ostrand-Rosenberg and Sinha, 2009).
In recent years, a number of MDSC subpopulations with functional, phenotypic
and morphological heterogeneity have been described (Gabrilovich and Nagaraj,
2009; Haile et al., 2010; Peranzoni et al., 2010). Reports have suggested MDSC
in various models may have different roles based on such things as monocytic vs
granulocytic lineage, the level of Gr1 expression and the presence of markers
such as CD49d (Duffy et al., 2013; Haile et al., 2010). This is one interesting
aspect of MDSC biology that is not explored here. Further studies could tease
out if MDSC subpopulations have specific roles in the IL-10 deficient mouse. It is
154
possible that certain subpopulations have a more potent immunosuppressive
function, produce more proangiogenic factors or may migrate differently towards
chemoattractants.
The work presented here has shown that active immunosuppressive MDSC are
present in the IL-10 deficient mouse model of colitis-associated cancer. We are
the first to study their role in a model of inflammation-associated cancer. We
have shown that MDSC contribute to cancer development in this model. Our in
vivo data show a profound effect on cancer development by MDSC as compared
to other models. In a novel IL-10 TLR4 double deficient mouse, cancer
development is significantly increased. TLR4 is generally thought to be a proinflammatory mediator, but our data supports growing evidence of its
homeostatic role. We find that in the absence of TLR4, MDSC recruitment is also
elevated in the IL-10 mouse and correlates with cancer development. We
identified MCP-1 and SDF-1 as MDSC chemoattractants. This work contributes
to the field by being the first to identify direct MDSC chemoattractants in vitro. We
propose TLR4 modulation of MCP-1 levels in the colon tissue as a mechanism
for increased MDSC recruitment leading to increased cancer development in the
IL-10
deficient
model.
Our
data
strongly
suggest
that
the
tissue
microenvironment and MDSC may be a critical part of that link between
inflammation and cancer.
155
References
Abreu, M.T., M. Fukata, and M. Arditi. 2005. TLR signaling in the gut in health
and disease. J Immunol 174:4453-4460.
Ahmadi, A., S. Polyak, and P.V. Draganov. 2009. Colorectal cancer surveillance
in
inflammatory
bowel
disease:
the
search
continues.
World
J
Gastroenterol 15:61-66.
Almand, B., J.I. Clark, E. Nikitina, J. van Beynen, N.R. English, S.C. Knight, D.P.
Carbone, and D.I. Gabrilovich. 2001. Increased production of immature
myeloid cells in cancer patients: a mechanism of immunosuppression in
cancer. J Immunol 166:678-689.
Andersen, V., A. Ernst, J. Christensen, M. Ostergaard, B.A. Jacobsen, A.
Tjonneland, H.B. Krarup, and U. Vogel. 2010. The polymorphism
rs3024505 proximal to IL-10 is associated with risk of ulcerative colitis and
Crohns disease in a Danish case-control study. BMC Med Genet 11:82.
Arora,
M.,
S.L.
Poe,
A.
Ray,
and
P.
Ray.
2011.
LPS-induced
CD11b+Gr1(int)F4/80+ regulatory myeloid cells suppress allergen-induced
airway inflammation. Int Immunopharmacol 11:827-832.
Atsumi, T., R. Singh, L. Sabharwal, H. Bando, J. Meng, Y. Arima, M. Yamada, M.
Harada, J.J. Jiang, D. Kamimura, H. Ogura, T. Hirano, and M. Murakami.
2014. Inflammation amplifier, a new paradigm in cancer biology. Cancer
Res 74:8-14.
156
Ayala-Torres, S., Y. Chen, T. Svoboda, J. Rosenblatt, and B. Van Houten. 2000.
Analysis of gene-specific DNA damage and repair using quantitative
polymerase chain reaction. Methods 22:135-147.
Bae, J.M., J.H. Kim, and G.H. Kang. 2013. Epigenetic alterations in colorectal
cancer: the CpG island methylator phenotype. Histol Histopathol
Beda, N., and A. Nedospasov. 2005. A spectrophotometric assay for nitrate in an
excess of nitrite. Nitric Oxide 13:93-97.
Ben-Neriah, Y., and M. Karin. 2011. Inflammation meets cancer, with NF-kappaB
as the matchmaker. Nat Immunol 12:715-723.
Bernstein, C.N., J.F. Blanchard, E. Kliewer, and A. Wajda. 2001. Cancer risk in
patients with inflammatory bowel disease: a population-based study.
Cancer 91:854-862.
Bernstein, C.N., and A. Nabalamba. 2007. Hospitalization-based major
comorbidity
of
inflammatory
bowel
disease
in
Canada.
Can
J
Gastroenterol 21:507-511.
Bertram, J.S. 2000. The molecular biology of cancer. Molecular aspects of
medicine 21:167-223.
Bilinski, C., J. Burleson, and F. Forouhar. 2012. Inflammation associated with
neoplastic colonic polyps. Ann Clin Lab Sci 42:266-270.
Boelte, K.C., L.E. Gordy, S. Joyce, M.A. Thompson, L. Yang, and P.C. Lin. 2011.
Rgs2 mediates pro-angiogenic function of myeloid derived suppressor
157
cells in the tumor microenvironment via upregulation of MCP-1. PLoS One
6:e18534.
Boland, C.R., and A. Goel. 2010. Microsatellite instability in colorectal cancer.
Gastroenterology 138:2073-2087 e2073.
Bouma, G., and W. Strober. 2003. The immunological and genetic basis of
inflammatory bowel disease. Nat Rev Immunol 3:521-533.
Bronte, V., S. Cingarlini, I. Marigo, C. De Santo, G. Gallina, L. Dolcetti, S. Ugel, E.
Peranzoni, S. Mandruzzato, and P. Zanovello. 2006. Leukocyte infiltration
in cancer creates an unfavorable environment for antitumor immune
responses: a novel target for therapeutic intervention. Immunol Invest
35:327-357.
Bronte, V., M. Wang, W.W. Overwijk, D.R. Surman, F. Pericle, S.A. Rosenberg,
and N.P. Restifo. 1998. Apoptotic death of CD8+ T lymphocytes after
immunization: induction of a suppressive population of Mac-1+/Gr-1+ cells.
J Immunol 161:5313-5320.
Brudecki, L., D.A. Ferguson, D. Yin, G.D. Lesage, C.E. McCall, and M. El Gazzar.
2012. Hematopoietic stem-progenitor cells restore immunoreactivity and
improve survival in late sepsis. Infect Immun 80:602-611.
Bunt, S.K., V.K. Clements, E.M. Hanson, P. Sinha, and S. Ostrand-Rosenberg.
2009. Inflammation enhances myeloid-derived suppressor cell cross-talk
by signaling through Toll-like receptor 4. J Leukoc Biol 85:996-1004.
158
Carvalho-Tavares, J., M.J. Hickey, J. Hutchison, J. Michaud, I.T. Sutcliffe, and P.
Kubes. 2000. A role for platelets and endothelial selectins in tumor
necrosis
factor-alpha-induced
leukocyte
recruitment
in
the
brain
microvasculature. Circ Res 87:1141-1148.
Chalifoux, L.V., and R.T. Bronson. 1981. Colonic adenocarcinoma associated
with chronic colitis in cotton top marmosets, Saguinus oedipus.
Gastroenterology 80:942-946.
Cheng, L., J. Wang, X. Li, Q. Xing, P. Du, L. Su, and S. Wang. 2011. Interleukin6 induces Gr-1+CD11b+ myeloid cells to suppress CD8+ T cell-mediated
liver injury in mice. PLoS One 6:e17631.
Church, J.M., F.L. Weakley, V.W. Fazio, B.A. Sebek, E. Achkar, and M. Carwell.
1985. The relationship between fistulas in Crohn's disease and associated
carcinoma. Report of four cases and review of the literature. Dis Colon
Rectum 28:361-366.
Collier, P.E., P. Turowski, and D.L. Diamond. 1985. Small intestinal
adenocarcinoma complicating regional enteritis. Cancer 55:516-521.
Costa, A., A. Scholer-Dahirel, and F. Mechta-Grigoriou. 2014. The role of
reactive oxygen species and metabolism on cancer cells and their
microenvironment. Semin Cancer Biol
Coussens, L.M., and Z. Werb. 2002. Inflammation and cancer. Nature 420:860867.
159
Dalgleish, A.G., Haefner, B., editor. 2006. The Link Between Inflammation and
Cancer. Spring US, New York. 256 pp.
Danese, S., and A. Mantovani. 2010. Inflammatory bowel disease and intestinal
cancer: a paradigm of the Yin-Yang interplay between inflammation and
cancer. Oncogene 29:3313-3323.
De Marzo, A.M., E.A. Platz, S. Sutcliffe, J. Xu, H. Gronberg, C.G. Drake, Y.
Nakai, W.B. Isaacs, and W.G. Nelson. 2007. Inflammation in prostate
carcinogenesis. Nat Rev Cancer 7:256-269.
De Paepe, B., K.K. Creus, and J.L. De Bleecker. 2009. Role of cytokines and
chemokines in idiopathic inflammatory myopathies. Curr Opin Rheumatol
21:610-616.
Delaunoit, T., P.J. Limburg, R.M. Goldberg, J.F. Lymp, and E.V. Loftus, Jr. 2006.
Colorectal cancer prognosis among patients with inflammatory bowel
disease. Clin Gastroenterol Hepatol 4:335-342.
Demaria, S., E. Pikarsky, M. Karin, L.M. Coussens, Y.C. Chen, E.M. El-Omar, G.
Trinchieri, S.M. Dubinett, J.T. Mao, E. Szabo, A. Krieg, G.J. Weiner, B.A.
Fox, G. Coukos, E. Wang, R.T. Abraham, M. Carbone, and M.T. Lotze.
2010. Cancer and inflammation: promise for biologic therapy. J
Immunother 33:335-351.
Diaz-Montero, C.M., M.L. Salem, M.I. Nishimura, E. Garrett-Mayer, D.J. Cole,
and A.J. Montero. 2008. Increased circulating myeloid-derived suppressor
cells correlate with clinical cancer stage, metastatic tumor burden, and
160
doxorubicin-cyclophosphamide
chemotherapy.
Cancer
Immunol
Immunother
Ding, X., Z. Zhao, W. Duan, S. Wang, X. Jin, and L. Xiang. 2013. Expression
patterns of CXCR4 in different colon tissue segments of patients with
Hirschsprung's disease. Exp Mol Pathol 95:111-116.
Dolcetti, L., I. Marigo, B. Mantelli, E. Peranzoni, P. Zanovello, and V. Bronte.
2008. Myeloid-derived suppressor cell role in tumor-related inflammation.
Cancer Lett
Dube, C. 2012. Tackling colorectal cancer as a public health issue: what can the
gastroenterologist do? Can J Gastroenterol 26:417-418.
Duffy, A., F. Zhao, L. Haile, J. Gamrekelashvili, S. Fioravanti, C. Ma, T.
Kapanadze, K. Compton, W.D. Figg, and T.F. Greten. 2013. Comparative
analysis of monocytic and granulocytic myeloid-derived suppressor cell
subsets in patients with gastrointestinal malignancies. Cancer Immunol
Immunother 62:299-307.
Eaden, J.A., K.R. Abrams, and J.F. Mayberry. 2001. The risk of colorectal cancer
in ulcerative colitis: a meta-analysis. Gut 48:526-535.
Ekbom, A., C. Helmick, M. Zack, and H.O. Adami. 1990. Ulcerative colitis and
colorectal cancer. A population-based study. N Engl J Med 323:1228-1233.
Engelhardt, K.R., N. Shah, I. Faizura-Yeop, D.F. Kocacik Uygun, N. Frede, A.M.
Muise, E. Shteyer, S. Filiz, R. Chee, M. Elawad, B. Hartmann, P.D.
Arkwright, C. Dvorak, C. Klein, J.M. Puck, B. Grimbacher, and E.O.
161
Glocker. 2013. Clinical outcome in IL-10- and IL-10 receptor-deficient
patients with or without hematopoietic stem cell transplantation. J Allergy
Clin Immunol 131:825-830.
Erdman, S.E., T. Poutahidis, M. Tomczak, A.B. Rogers, K. Cormier, B. Plank,
B.H. Horwitz, and J.G. Fox. 2003. CD4+ CD25+ regulatory T lymphocytes
inhibit microbially induced colon cancer in Rag2-deficient mice. Am J
Pathol 162:691-702.
Fattovich, G., T. Stroffolini, I. Zagni, and F. Donato. 2004. Hepatocellular
carcinoma in cirrhosis: incidence and risk factors. Gastroenterology
127:S35-50.
Fearon, E.R., and B. Vogelstein. 1990. A genetic model for colorectal
tumorigenesis. Cell 61:759-767.
Fernandez, L., A. Martinez, J.L. Mendoza, E. Urcelay, M. Fernandez-Arquero, J.
Garcia-Paredes, M. Diaz-Rubio, and E.G. de la Concha. 2005. Interleukin10 polymorphisms in Spanish patients with IBD. Inflamm Bowel Dis
11:739-743.
Fujii, S., T. Fujimori, H. Kawamata, J. Takeda, K. Kitajima, F. Omotehara, T.
Kaihara, T. Kusaka, K. Ichikawa, Y. Ohkura, Y. Ono, J. Imura, S.
Yamaoka, C. Sakamoto, Y. Ueda, and T. Chiba. 2004. Development of
colonic neoplasia in p53 deficient mice with experimental colitis induced
by dextran sulphate sodium. Gut 53:710-716.
162
Fujita, K., C.M. Ewing, R.H. Getzenberg, J.K. Parsons, W.B. Isaacs, and C.P.
Pavlovich. 2010. Monocyte chemotactic protein-1 (MCP-1/CCL2) is
associated with prostatic growth dysregulation and benign prostatic
hyperplasia. Prostate 70:473-481.
Fukata, M., and M.T. Abreu. 2007. TLR4 signalling in the intestine in health and
disease. Biochem Soc Trans 35:1473-1478.
Fukata, M., and M.T. Abreu. 2008. Role of Toll-like receptors in gastrointestinal
malignancies. Oncogene 27:234-243.
Fukata, M., A. Chen, A.S. Vamadevan, J. Cohen, K. Breglio, S. Krishnareddy, D.
Hsu, R. Xu, N. Harpaz, A.J. Dannenberg, K. Subbaramaiah, H.S. Cooper,
S.H. Itzkowitz, and M.T. Abreu. 2007. Toll-like receptor-4 promotes the
development of colitis-associated colorectal tumors. Gastroenterology
133:1869-1881.
Fukata, M., K.S. Michelsen, R. Eri, L.S. Thomas, B. Hu, K. Lukasek, C.C. Nast, J.
Lechago, R. Xu, Y. Naiki, A. Soliman, M. Arditi, and M.T. Abreu. 2005.
Toll-like receptor-4 is required for intestinal response to epithelial injury
and limiting bacterial translocation in a murine model of acute colitis. Am J
Physiol Gastrointest Liver Physiol 288:G1055-1065.
Fuxe, J., and M.C. Karlsson. 2012. TGF-beta-induced epithelial-mesenchymal
transition: a link between cancer and inflammation. Semin Cancer Biol
22:455-461.
163
Gabrilovich, D., T. Ishida, T. Oyama, S. Ran, V. Kravtsov, S. Nadaf, and D.P.
Carbone.
1998.
Vascular
endothelial
growth
factor
inhibits
the
development of dendritic cells and dramatically affects the differentiation
of multiple hematopoietic lineages in vivo. Blood 92:4150-4166.
Gabrilovich, D.I., and S. Nagaraj. 2009. Myeloid-derived suppressor cells as
regulators of the immune system. Nat Rev Immunol 9:162-174.
Glocker, E.O., D. Kotlarz, K. Boztug, E.M. Gertz, A.A. Schaffer, F. Noyan, M.
Perro, J. Diestelhorst, A. Allroth, D. Murugan, N. Hatscher, D. Pfeifer, K.W.
Sykora, M. Sauer, H. Kreipe, M. Lacher, R. Nustede, C. Woellner, U.
Baumann, U. Salzer, S. Koletzko, N. Shah, A.W. Segal, A. Sauerbrey, S.
Buderus, S.B. Snapper, B. Grimbacher, and C. Klein. 2009. Inflammatory
bowel disease and mutations affecting the interleukin-10 receptor. N Engl
J Med 361:2033-2045.
Goldszmid, R.S., and G. Trinchieri. 2012. The price of immunity. Nat Immunol
13:932-938.
Gonzalez-Navajas, J.M., S. Fine, J. Law, S.K. Datta, K.P. Nguyen, M. Yu, M.
Corr, K. Katakura, L. Eckman, J. Lee, and E. Raz. 2010. TLR4 signaling in
effector CD4+ T cells regulates TCR activation and experimental colitis in
mice. J Clin Invest 120:570-581.
Grammas, P., and R. Ovase. 2001. Inflammatory factors are elevated in brain
microvessels in Alzheimer's disease. Neurobiol Aging 22:837-842.
164
Greten, F.R., L. Eckmann, T.F. Greten, J.M. Park, Z.W. Li, L.J. Egan, M.F.
Kagnoff,
and
M.
Karin.
2004.
IKKbeta
links
inflammation
and
tumorigenesis in a mouse model of colitis-associated cancer. Cell
118:285-296.
Haile, L.A., J. Gamrekelashvili, M.P. Manns, F. Korangy, and T.F. Greten. 2010.
CD49d is a new marker for distinct myeloid-derived suppressor cell
subpopulations in mice. J Immunol 185:203-210.
Haile, L.A., R. von Wasielewski, J. Gamrekelashvili, C. Kruger, O. Bachmann,
A.M. Westendorf, J. Buer, R. Liblau, M.P. Manns, F. Korangy, and T.F.
Greten. 2008. Myeloid-derived suppressor cells in inflammatory bowel
disease: a new immunoregulatory pathway. Gastroenterology 135:871881, 881 e871-875.
Hajishengallis, G., R.P. Darveau, and M.A. Curtis. 2012. The keystone-pathogen
hypothesis. Nat Rev Microbiol 10:717-725.
Hale, L.P., and P.K. Greer. 2012. A novel murine model of inflammatory bowel
disease and inflammation-associated colon cancer with ulcerative colitislike features. PLoS One 7:e41797.
Hamilton, J.A. 2002. GM-CSF in inflammation and autoimmunity. Trends
Immunol 23:403-408.
Hayashi, C., G. Papadopoulos, C.V. Gudino, E.O. Weinberg, K.R. Barth, A.G.
Madrigal, Y. Chen, H. Ning, M. LaValley, F.C. Gibson, 3rd, J.A. Hamilton,
and
C.A.
Genco.
2012.
Protective
165
role
for
TLR4
signaling
in
atherosclerosis progression as revealed by infection with a common oral
pathogen. J Immunol 189:3681-3688.
Hegde, V.L., P.S. Nagarkatti, and M. Nagarkatti. 2011. Role of myeloid-derived
suppressor cells in amelioration of experimental autoimmune hepatitis
following activation of TRPV1 receptors by cannabidiol. PLoS One
6:e18281.
Heit, B., and P. Kubes. 2003. Measuring chemotaxis and chemokinesis: the
under-agarose cell migration assay. Sci STKE 2003:PL5.
Heit, B., L. Liu, P. Colarusso, K.D. Puri, and P. Kubes. 2008. PI3K accelerates,
but is not required for, neutrophil chemotaxis to fMLP. J Cell Sci 121:205214.
Huang, B., Z. Lei, J. Zhao, W. Gong, J. Liu, Z. Chen, Y. Liu, D. Li, Y. Yuan, G.M.
Zhang, and Z.H. Feng. 2007. CCL2/CCR2 pathway mediates recruitment
of myeloid suppressor cells to cancers. Cancer Lett 252:86-92.
Hugot, J.P., M. Chamaillard, H. Zouali, S. Lesage, J.P. Cezard, J. Belaiche, S.
Almer, C. Tysk, C.A. O'Morain, M. Gassull, V. Binder, Y. Finkel, A. Cortot,
R. Modigliani, P. Laurent-Puig, C. Gower-Rousseau, J. Macry, J.F.
Colombel, M. Sahbatou, and G. Thomas. 2001. Association of NOD2
leucine-rich repeat variants with susceptibility to Crohn's disease. Nature
411:599-603.
166
Jackson, A.R., V.L. Hegde, P.S. Nagarkatti, and M. Nagarkatti. 2013.
Characterization of endocannabinoid-mediated induction of myeloidderived suppressor cells involving mast cells and MCP-1. J Leukoc Biol
Jess, T., J. Simonsen, K.T. Jorgensen, B.V. Pedersen, N.M. Nielsen, and M.
Frisch. 2012. Decreasing risk of colorectal cancer in patients with
inflammatory bowel disease over 30 years. Gastroenterology 143:375-381
e371; quiz e313-374.
Kado, S., K. Uchida, H. Funabashi, S. Iwata, Y. Nagata, M. Ando, M. Onoue, Y.
Matsuoka, M. Ohwaki, and M. Morotomi. 2001. Intestinal microflora are
necessary for development of spontaneous adenocarcinoma of the large
intestine in T-cell receptor beta chain and p53 double-knockout mice.
Cancer Res 61:2395-2398.
Kanneganti, M., M. Mino-Kenudson, and E. Mizoguchi. 2011. Animal models of
colitis-associated carcinogenesis. J Biomed Biotechnol 2011:342637.
Kawachi, S., S. Jennings, J. Panes, A. Cockrell, F.S. Laroux, L. Gray, M. Perry,
H. van der Heyde, E. Balish, D.N. Granger, R.A. Specian, and M.B.
Grisham. 2000. Cytokine and endothelial cell adhesion molecule
expression in interleukin-10-deficient mice. Am J Physiol Gastrointest
Liver Physiol 278:G734-743.
Khajah, M., G. Andonegui, R. Chan, A.W. Craig, P.A. Greer, and D.M.
McCafferty. 2013. Fer kinase limits neutrophil chemotaxis toward end
target chemoattractants. J Immunol 190:2208-2216.
167
Kohno, H., R. Suzuki, S. Sugie, and T. Tanaka. 2005. Beta-Catenin mutations in
a mouse model of inflammation-related colon carcinogenesis induced by
1,2-dimethylhydrazine and dextran sodium sulfate. Cancer Sci 96:69-76.
Koike, Y., T. Kanai, K. Saeki, Y. Nakamura, M. Nakano, Y. Mikami, Y. Yamagishi,
N. Nakamoto, H. Ebinuma, and T. Hibi. 2012. MyD88-dependent
interleukin-10 production from regulatory CD11b(+)Gr-1(high) cells
suppresses development of acute cerulein pancreatitis in mice. Immunol
Lett 148:172-177.
Kong, Y.Y., M. Fuchsberger, S.D. Xiang, V. Apostolopoulos, and M. Plebanski.
2013. Myeloid derived suppressor cells and their role in diseases. Curr
Med Chem 20:1437-1444.
Kotlarz, D., R. Beier, D. Murugan, J. Diestelhorst, O. Jensen, K. Boztug, D.
Pfeifer, H. Kreipe, E.D. Pfister, U. Baumann, J. Puchalka, J. Bohne, O.
Egritas, B. Dalgic, K.L. Kolho, A. Sauerbrey, S. Buderus, T. Gungor, A.
Enninger, Y.K. Koda, G. Guariso, B. Weiss, S. Corbacioglu, P. Socha, N.
Uslu, A. Metin, G.T. Wahbeh, K. Husain, D. Ramadan, W. Al-Herz, B.
Grimbacher, M. Sauer, K.W. Sykora, S. Koletzko, and C. Klein. 2012.
Loss of interleukin-10 signaling and infantile inflammatory bowel disease:
implications for diagnosis and therapy. Gastroenterology 143:347-355.
Kuhn, R., J. Lohler, D. Rennick, K. Rajewsky, and W. Muller. 1993. Interleukin10-deficient mice develop chronic enterocolitis. Cell 75:263-274.
168
Kumar, V., Abbas, A., Fausto, N., Aster, J., editor. 2010. Robbins and Cotran
Pathologic Basis of Disease. Saunders Elsevier, Philadelphia, PA.
Kundu, J.K., and Y.J. Surh. 2008. Inflammation: gearing the journey to cancer.
Mutation research 659:15-30.
Kusmartsev, S., F. Cheng, B. Yu, Y. Nefedova, E. Sotomayor, R. Lush, and D.
Gabrilovich. 2003. All-trans-retinoic acid eliminates immature myeloid cells
from tumor-bearing mice and improves the effect of vaccination. Cancer
Res 63:4441-4449.
Kusmartsev, S., and D.I. Gabrilovich. 2003. Inhibition of myeloid cell
differentiation in cancer: the role of reactive oxygen species. J Leukoc Biol
74:186-196.
Kusmartsev, S., and D.I. Gabrilovich. 2006. Role of immature myeloid cells in
mechanisms of immune evasion in cancer. Cancer Immunol Immunother
55:237-245.
Kusmartsev, S.A., Y. Li, and S.H. Chen. 2000. Gr-1+ myeloid cells derived from
tumor-bearing mice inhibit primary T cell activation induced through
CD3/CD28 costimulation. J Immunol 165:779-785.
Lapara, N.J., 3rd, and B.L. Kelly. 2010. Suppression of LPS-induced
inflammatory responses in macrophages infected with Leishmania. J
Inflamm (Lond) 7:8.
Le, H.K., L. Graham, E. Cha, J.K. Morales, M.H. Manjili, and H.D. Bear. 2009.
Gemcitabine directly inhibits myeloid derived suppressor cells in BALB/c
169
mice bearing 4T1 mammary carcinoma and augments expansion of T
cells from tumor-bearing mice. Int Immunopharmacol 9:900-909.
Lechner, M.G., D.J. Liebertz, and A.L. Epstein. 2010. Characterization of
cytokine-induced myeloid-derived suppressor cells from normal human
peripheral blood mononuclear cells. J Immunol 185:2273-2284.
Liu, B.Y., I. Soloviev, P. Chang, J. Lee, X. Huang, C. Zhong, N. Ferrara, P.
Polakis, and C. Sakanaka. 2010. Stromal cell-derived factor-1/CXCL12
contributes to MMTV-Wnt1 tumor growth involving Gr1+CD11b+ cells.
PLoS One 5:e8611.
Liu, C., S. Yu, J. Kappes, J. Wang, W.E. Grizzle, K.R. Zinn, and H.G. Zhang.
2007. Expansion of spleen myeloid suppressor cells represses NK cell
cytotoxicity in tumor-bearing host. Blood 109:4336-4342.
Loftus, E.V., Jr. 2004. Clinical epidemiology of inflammatory bowel disease:
Incidence, prevalence, and environmental influences. Gastroenterology
126:1504-1517.
Mahler, M., I.J. Bristol, E.H. Leiter, A.E. Workman, E.H. Birkenmeier, C.O. Elson,
and J.P. Sundberg. 1998. Differential susceptibility of inbred mouse
strains to dextran sulfate sodium-induced colitis. Am J Physiol 274:G544551.
Makarenkova, V.P., V. Bansal, B.M. Matta, L.A. Perez, and J.B. Ochoa. 2006.
CD11b+/Gr-1+ myeloid suppressor cells cause T cell dysfunction after
traumatic stress. J Immunol 176:2085-2094.
170
Mantovani, A., P. Allavena, A. Sica, and F. Balkwill. 2008. Cancer-related
inflammation. Nature 454:436-444.
McCafferty, D.M., A.W. Craig, Y.A. Senis, and P.A. Greer. 2002. Absence of Fer
protein-tyrosine kinase exacerbates leukocyte recruitment in response to
endotoxin. J Immunol 168:4930-4935.
Medzhitov, R., and C.A. Janeway, Jr. 1999. Innate immune induction of the
adaptive immune response. Cold Spring Harb Symp Quant Biol 64:429435.
Melani, C., C. Chiodoni, G. Forni, and M.P. Colombo. 2003. Myeloid cell
expansion elicited by the progression of spontaneous mammary
carcinomas in c-erbB-2 transgenic BALB/c mice suppresses immune
reactivity. Blood 102:2138-2145.
Mencacci, A., C. Montagnoli, A. Bacci, E. Cenci, L. Pitzurra, A. Spreca, M. Kopf,
A.H. Sharpe, and L. Romani. 2002. CD80+Gr-1+ myeloid cells inhibit
development of antifungal Th1 immunity in mice with candidiasis. J
Immunol 169:3180-3190.
Menetrier-Caux, C., G. Montmain, M.C. Dieu, C. Bain, M.C. Favrot, C. Caux, and
J.Y. Blay. 1998. Inhibition of the differentiation of dendritic cells from
CD34(+) progenitors by tumor cells: role of interleukin-6 and macrophage
colony-stimulating factor. Blood 92:4778-4791.
Mikami, S., H. Nakase, S. Yamamoto, Y. Takeda, T. Yoshino, K. Kasahara, S.
Ueno, N. Uza, S. Oishi, N. Fujii, T. Nagasawa, and T. Chiba. 2008.
171
Blockade of CXCL12/CXCR4 axis ameliorates murine experimental colitis.
J Pharmacol Exp Ther 327:383-392.
Miranda, K.M., M.G. Espey, and D.A. Wink. 2001. A rapid, simple
spectrophotometric method for simultaneous detection of nitrate and nitrite.
Nitric Oxide 5:62-71.
Molodecky, N.A., I.S. Soon, D.M. Rabi, W.A. Ghali, M. Ferris, G. Chernoff, E.I.
Benchimol, R. Panaccione, S. Ghosh, H.W. Barkema, and G.G. Kaplan.
2012. Increasing incidence and prevalence of the inflammatory bowel
diseases with time, based on systematic review. Gastroenterology 142:4654 e42; quiz e30.
Moore, K.W., R. de Waal Malefyt, R.L. Coffman, and A. O'Garra. 2001.
Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 19:683765.
Moran, C.J., T.D. Walters, C.H. Guo, S. Kugathasan, C. Klein, D. Turner, V.M.
Wolters, R.H. Bandsma, M. Mouzaki, M. Zachos, J.C. Langer, E. Cutz,
S.M. Benseler, C.M. Roifman, M.S. Silverberg, A.M. Griffiths, S.B.
Snapper, and A.M. Muise. 2013. IL-10R polymorphisms are associated
with very-early-onset ulcerative colitis. Inflamm Bowel Dis 19:115-123.
Nagaraj, S., K. Gupta, V. Pisarev, L. Kinarsky, S. Sherman, L. Kang, D.L. Herber,
J. Schneck, and D.I. Gabrilovich. 2007. Altered recognition of antigen is a
mechanism of CD8+ T cell tolerance in cancer. Nat Med 13:828-835.
172
Neuman, M.G., and R.M. Nanau. 2012. Single-nucleotide polymorphisms in
inflammatory bowel disease. Transl Res 160:45-64.
Obermajer, N., and P. Kalinski. 2012. Generation of myeloid-derived suppressor
cells using prostaglandin E2. Transplant Res 1:15.
Obermajer, N., R. Muthuswamy, J. Lesnock, R.P. Edwards, and P. Kalinski.
2011a. Positive feedback between PGE2 and COX2 redirects the
differentiation of human dendritic cells toward stable myeloid-derived
suppressor cells. Blood 118:5498-5505.
Obermajer, N., R. Muthuswamy, K. Odunsi, R.P. Edwards, and P. Kalinski.
2011b. PGE(2)-induced CXCL12 production and CXCR4 expression
controls the accumulation of human MDSCs in ovarian cancer
environment. Cancer Res 71:7463-7470.
Obermajer, N., J.L. Wong, R.P. Edwards, K. Chen, M. Scott, S. Khader, J.K.
Kolls, K. Odunsi, T.R. Billiar, and P. Kalinski. 2013. Induction and stability
of human Th17 cells require endogenous NOS2 and cGMP-dependent
NO signaling. J Exp Med
Obermajer, N., J.L. Wong, R.P. Edwards, K. Odunsi, K. Moysich, and P. Kalinski.
2012. PGE(2)-driven induction and maintenance of cancer-associated
myeloid-derived suppressor cells. Immunol Invest 41:635-657.
Okayasu, I., M. Yamada, T. Mikami, T. Yoshida, J. Kanno, and T. Ohkusa. 2002.
Dysplasia and carcinoma development in a repeated dextran sulfate
sodium-induced colitis model. J Gastroenterol Hepatol 17:1078-1083.
173
Ording, A.G., E. Horvath-Puho, R. Erichsen, M.D. Long, J.A. Baron, T.L. Lash,
and H.T. Sorensen. 2013. Five-Year Mortality in Colorectal Cancer
Patients with Ulcerative Colitis or Crohn's Disease: A Nationwide
Population-based Cohort Study. Inflamm Bowel Dis 19:800-805.
Ostrand-Rosenberg, S., and P. Sinha. 2009. Myeloid-derived suppressor cells:
linking inflammation and cancer. J Immunol 182:4499-4506.
Packey, C.D., and R.B. Sartor. 2008. Interplay of commensal and pathogenic
bacteria, genetic mutations, and immunoregulatory defects in the
pathogenesis of inflammatory bowel diseases. J Intern Med 263:597-606.
Parekh, V.V., L. Wu, D. Olivares-Villagomez, K.T. Wilson, and L. Van Kaer. 2013.
Activated invariant NKT cells control central nervous system autoimmunity
in a mechanism that involves myeloid-derived suppressor cells. J Immunol
190:1948-1960.
Parkin, D.M., J. Ferlay, M.P. Curado, F. Bray, B. Edwards, H.R. Shin, and D.
Forman. 2010. Fifty years of cancer incidence: CI5 I-IX. Int J Cancer
127:2918-2927.
Parsonnet, J., G.D. Friedman, D.P. Vandersteen, Y. Chang, J.H. Vogelman, N.
Orentreich, and R.K. Sibley. 1991. Helicobacter pylori infection and the
risk of gastric carcinoma. N Engl J Med 325:1127-1131.
Patan, S. 2004. Vasculogenesis and angiogenesis. Cancer Treat Res 117:3-32.
Patel, S.G., and D.J. Ahnen. 2012. Familial colon cancer syndromes: an update
of a rapidly evolving field. Curr Gastroenterol Rep 14:428-438.
174
Peranzoni, E., S. Zilio, I. Marigo, L. Dolcetti, P. Zanovello, S. Mandruzzato, and V.
Bronte. 2010. Myeloid-derived suppressor cell heterogeneity and subset
definition. Curr Opin Immunol 22:238-244.
Perske, C., N. Lahat, S. Sheffy Levin, H. Bitterman, B. Hemmerlein, and M.A.
Rahat. 2010. Loss of inducible nitric oxide synthase expression in the
mouse renal cell carcinoma cell line RENCA is mediated by microRNA
miR-146a. Am J Pathol 177:2046-2054.
Pino, M.S., and D.C. Chung. 2010. The chromosomal instability pathway in colon
cancer. Gastroenterology 138:2059-2072.
Popivanova, B.K., K. Kitamura, Y. Wu, T. Kondo, T. Kagaya, S. Kaneko, M.
Oshima, C. Fujii, and N. Mukaida. 2008. Blocking TNF-alpha in mice
reduces colorectal carcinogenesis associated with chronic colitis. J Clin
Invest 118:560-570.
Popivanova, B.K., F.I. Kostadinova, K. Furuichi, M.M. Shamekh, T. Kondo, T.
Wada, K. Egashira, and N. Mukaida. 2009. Blockade of a chemokine,
CCL2, reduces chronic colitis-associated carcinogenesis in mice. Cancer
Res 69:7884-7892.
Qi, W., K.V. Ebbert, A.W. Craig, P.A. Greer, and D.M. McCafferty. 2005.
Absence of Fer protein tyrosine kinase exacerbates endotoxin induced
intestinal epithelial barrier dysfunction in vivo. Gut 54:1091-1097.
175
Raber, P., A.C. Ochoa, and P.C. Rodriguez. 2012. Metabolism of L-arginine by
myeloid-derived suppressor cells in cancer: mechanisms of T cell
suppression and therapeutic perspectives. Immunol Invest 41:614-634.
Rakoff-Nahoum, S., and R. Medzhitov. 2009. Toll-like receptors and cancer. Nat
Rev Cancer 9:57-63.
Ramachandran, I.R., A. Martner, A. Pisklakova, T. Condamine, T. Chase, T. Vogl,
J. Roth, D. Gabrilovich, and Y. Nefedova. 2013. Myeloid-derived
suppressor cells regulate growth of multiple myeloma by inhibiting T cells
in bone marrow. J Immunol 190:3815-3823.
Reinecker, H.C., E.Y. Loh, D.J. Ringler, A. Mehta, J.L. Rombeau, and R.P.
MacDermott. 1995. Monocyte-chemoattractant protein 1 gene expression
in intestinal epithelial cells and inflammatory bowel disease mucosa.
Gastroenterology 108:40-50.
Remo, A., M. Pancione, C. Zanella, and R. Vendraminelli. 2012. Molecular
pathology of colorectal carcinoma. A systematic review centred on the
new role of the pathologist. Pathologica 104:432-441.
Rennick, D., N. Davidson, and D. Berg. 1995. Interleukin-10 gene knock-out
mice: a model of chronic inflammation. Clin Immunol Immunopathol
76:S174-178.
Rhodes, J.M. 1996. Unifying hypothesis for inflammatory bowel disease and
associated colon cancer: sticking the pieces together with sugar. Lancet
347:40-44.
176
Rhodes, J.M., and B.J. Campbell. 2002. Inflammation and colorectal cancer:
IBD-associated and sporadic cancer compared. Trends Mol Med 8:10-16.
Rios-Arrabal, S., F. Artacho-Cordon, J. Leon, E. Roman-Marinetto, M. Del Mar
Salinas-Asensio, I. Calvente, and M.I. Nunez. 2013. Involvement of free
radicals in breast cancer. SpringerPlus 2:404.
Rocchi, A., E.I. Benchimol, C.N. Bernstein, A. Bitton, B. Feagan, R. Panaccione,
K.W. Glasgow, A. Fernandes, and S. Ghosh. 2012. Inflammatory bowel
disease: a Canadian burden of illness review. Can J Gastroenterol
26:811-817.
Rodriguez, P.C., C.P. Hernandez, K. Morrow, R. Sierra, J. Zabaleta, D.D.
Wyczechowska, and A.C. Ochoa. 2010. L-arginine deprivation regulates
cyclin D3 mRNA stability in human T cells by controlling HuR expression.
J Immunol 185:5198-5204.
Rodriguez, P.C., D.G. Quiceno, J. Zabaleta, B. Ortiz, A.H. Zea, M.B. Piazuelo, A.
Delgado, P. Correa, J. Brayer, E.M. Sotomayor, S. Antonia, J.B. Ochoa,
and
A.C.
Ochoa.
2004.
Arginase
I
production
in
the
tumor
microenvironment by mature myeloid cells inhibits T-cell receptor
expression and antigen-specific T-cell responses. Cancer Res 64:58395849.
Roers, A., L. Siewe, E. Strittmatter, M. Deckert, D. Schluter, W. Stenzel, A.D.
Gruber, T. Krieg, K. Rajewsky, and W. Muller. 2004. T cell-specific
inactivation of the interleukin 10 gene in mice results in enhanced T cell
177
responses but normal innate responses to lipopolysaccharide or skin
irritation. J Exp Med 200:1289-1297.
Rossner, S., C. Voigtlander, C. Wiethe, J. Hanig, C. Seifarth, and M.B. Lutz.
2005. Myeloid dendritic cell precursors generated from bone marrow
suppress T cell responses via cell contact and nitric oxide production in
vitro. Eur J Immunol 35:3533-3544.
Rubin, D.T., D. Huo, J.A. Kinnucan, M.S. Sedrak, N.E. McCullom, A.P. Bunnag,
E.P. Raun-Royer, R.D. Cohen, S.B. Hanauer, J. Hart, and J.R. Turner.
2013. Inflammation is an independent risk factor for colonic neoplasia in
patients with ulcerative colitis: a case-control study. Clin Gastroenterol
Hepatol 11:1601-1608 e1601-1604.
Rudolph, U., M.J. Finegold, S.S. Rich, G.R. Harriman, Y. Srinivasan, P. Brabet,
G. Boulay, A. Bradley, and L. Birnbaumer. 1995. Ulcerative colitis and
adenocarcinoma of the colon in G alpha i2-deficient mice. Nat Genet
10:143-150.
Ruemmele, F.M., J.F. Beaulieu, S. Dionne, E. Levy, E.G. Seidman, N. CerfBensussan, and M.J. Lentze. 2002. Lipopolysaccharide modulation of
normal enterocyte turnover by toll-like receptors is mediated by
endogenously produced tumour necrosis factor alpha. Gut 51:842-848.
Rutter, M., B. Saunders, K. Wilkinson, S. Rumbles, G. Schofield, M. Kamm, C.
Williams, A. Price, I. Talbot, and A. Forbes. 2004. Severity of inflammation
178
is
a
risk
factor
for
colorectal
neoplasia
in
ulcerative
colitis.
Gastroenterology 126:451-459.
Saito, S., J. Kato, S. Hiraoka, J. Horii, H. Suzuki, R. Higashi, E. Kaji, Y. Kondo,
and K. Yamamoto. 2011. DNA methylation of colon mucosa in ulcerative
colitis patients: correlation with inflammatory status. Inflamm Bowel Dis
17:1955-1965.
Salvadori, S., G. Martinelli, and K. Zier. 2000. Resection of solid tumors reverses
T cell defects and restores protective immunity. J Immunol 164:2214-2220.
Sander, L.E., S.D. Sackett, U. Dierssen, N. Beraza, R.P. Linke, M. Muller, J.M.
Blander, F. Tacke, and C. Trautwein. 2010. Hepatic acute-phase proteins
control innate immune responses during infection by promoting myeloidderived suppressor cell function. J Exp Med 207:1453-1464.
Sartor, R.B. 2005. Probiotic therapy of intestinal inflammation and infections.
Curr Opin Gastroenterol 21:44-50.
Sartor, R.B. 2006. Mechanisms of disease: pathogenesis of Crohn's disease and
ulcerative colitis. Nat Clin Pract Gastroenterol Hepatol 3:390-407.
Sawanobori, Y., S. Ueha, M. Kurachi, T. Shimaoka, J.E. Talmadge, J. Abe, Y.
Shono, M. Kitabatake, K. Kakimi, N. Mukaida, and K. Matsushima. 2008.
Chemokine-mediated rapid turnover of myeloid-derived suppressor cells in
tumor-bearing mice. Blood 111:5457-5466.
Schicho, R., M. Bashashati, M. Bawa, D. McHugh, D. Saur, H.M. Hu, A. Zimmer,
B. Lutz, K. Mackie, H.B. Bradshaw, D.M. McCafferty, K.A. Sharkey, and M.
179
Storr.
2010.
The
atypical
cannabinoid
O-1602
protects
against
experimental colitis and inhibits neutrophil recruitment. Inflamm Bowel Dis
Schimanski, C.C., P.R. Galle, and M. Moehler. 2008. Chemokine receptor
CXCR4-prognostic
factor
for
gastrointestinal
tumors.
World
J
Gastroenterol 14:4721-4724.
Schmidt, K., S. Zilio, J.C. Schmollinger, V. Bronte, T. Blankenstein, and G.
Willimsky. 2013. Differently immunogenic cancers in mice induce
immature myeloid cells that suppress CTL in vitro but not in vivo following
transfer. Blood 121:1740-1748.
Schultz, M., S.L. Tonkonogy, R.K. Sellon, C. Veltkamp, V.L. Godfrey, J. Kwon,
W.B. Grenther, E. Balish, I. Horak, and R.B. Sartor. 1999. IL-2-deficient
mice raised under germfree conditions develop delayed mild focal
intestinal inflammation. Am J Physiol 276:G1461-1472.
Seamons,
A.,
P.M.
Treuting,
T.
Brabb,
and
L.
Maggio-Price.
2013.
Characterization of Dextran Sodium Sulfate-Induced Inflammation and
Colonic Tumorigenesis in Smad3 (-/-) Mice with Dysregulated TGFbeta.
PLoS One 8:e79182.
Serafini, P., K. Meckel, M. Kelso, K. Noonan, J. Califano, W. Koch, L. Dolcetti, V.
Bronte, and I. Borrello. 2006. Phosphodiesterase-5 inhibition augments
endogenous antitumor immunity by reducing myeloid-derived suppressor
cell function. J Exp Med 203:2691-2702.
180
Setia, S., B. Nehru, and S.N. Sanyal. 2013. Activation of NF-kappaB: Bridging
the gap between inflammation and cancer in colitis-mediated colon
carcinogenesis. Biomedicine & pharmacotherapy = Biomedecine &
pharmacotherapie
Sevko, A., and V. Umansky. 2013. Myeloid-derived suppressor cells interact with
tumors in terms of myelopoiesis, tumorigenesis and immunosuppression:
thick as thieves. J Cancer 4:3-11.
Shojaei, F., X. Wu, A.K. Malik, C. Zhong, M.E. Baldwin, S. Schanz, G. Fuh, H.P.
Gerber, and N. Ferrara. 2007. Tumor refractoriness to anti-VEGF
treatment is mediated by CD11b+Gr1+ myeloid cells. Nat Biotechnol
25:911-920.
Singh, H., E. Shu, A. Demers, C.N. Bernstein, J. Griffith, and K. Fradette. 2012a.
Trends in time to diagnosis of colon cancer and impact on clinical
outcomes. Can J Gastroenterol 26:877-880.
Singh, U.P., N.P. Singh, B. Singh, L.J. Hofseth, D.D. Taub, R.L. Price, M.
Nagarkatti, and P.S. Nagarkatti. 2012b. Role of resveratrol-induced
CD11b(+) Gr-1(+) myeloid derived suppressor cells (MDSCs) in the
reduction of CXCR3(+) T cells and amelioration of chronic colitis in IL-10(/-) mice. Brain Behav Immun 26:72-82.
Sinha, P., V.K. Clements, S.K. Bunt, S.M. Albelda, and S. Ostrand-Rosenberg.
2007a. Cross-talk between myeloid-derived suppressor cells and
181
macrophages subverts tumor immunity toward a type 2 response. J
Immunol 179:977-983.
Sinha, P., V.K. Clements, A.M. Fulton, and S. Ostrand-Rosenberg. 2007b.
Prostaglandin E2 promotes tumor progression by inducing myeloidderived suppressor cells. Cancer Res 67:4507-4513.
Sinha, P., V.K. Clements, and S. Ostrand-Rosenberg. 2005. Reduction of
myeloid-derived suppressor cells and induction of M1 macrophages
facilitate the rejection of established metastatic disease. J Immunol
174:636-645.
Srivastava, M.K., L. Zhu, M. Harris-White, U.K. Kar, M. Huang, M.F. Johnson,
J.M. Lee, D. Elashoff, R. Strieter, S. Dubinett, and S. Sharma. 2012.
Myeloid suppressor cell depletion augments antitumor activity in lung
cancer. PLoS One 7:e40677.
Strober, W., and I.J. Fuss. 2006. Experimental models of mucosal inflammation.
Adv Exp Med Biol 579:55-97.
Sun, H.L., X. Zhou, Y.F. Xue, K. Wang, Y.F. Shen, J.J. Mao, H.F. Guo, and Z.N.
Miao. 2012. Increased frequency and clinical significance of myeloidderived suppressor cells in human colorectal carcinoma. World J
Gastroenterol 18:3303-3309.
Suzuki, E., V. Kapoor, A.S. Jassar, L.R. Kaiser, and S.M. Albelda. 2005.
Gemcitabine
selectively
eliminates
182
splenic
Gr-1+/CD11b+
myeloid
suppressor cells in tumor-bearing animals and enhances antitumor
immune activity. Clin Cancer Res 11:6713-6721.
Takeda, K., and S. Akira. 2004. TLR signaling pathways. Semin Immunol 16:3-9.
Tanaka, T., H. Kohno, R. Suzuki, K. Hata, S. Sugie, N. Niho, K. Sakano, M.
Takahashi, and K. Wakabayashi. 2006. Dextran sodium sulfate strongly
promotes colorectal carcinogenesis in Apc(Min/+) mice: inflammatory
stimuli by dextran sodium sulfate results in development of multiple
colonic neoplasms. Int J Cancer 118:25-34.
Tanaka, T., H. Kohno, R. Suzuki, Y. Yamada, S. Sugie, and H. Mori. 2003. A
novel inflammation-related mouse colon carcinogenesis model induced by
azoxymethane and dextran sodium sulfate. Cancer Sci 94:965-973.
Terzic, J., S. Grivennikov, E. Karin, and M. Karin. 2010. Inflammation and colon
cancer. Gastroenterology 138:2101-2114 e2105.
Thackeray, E.W., P. Charatcharoenwitthaya, D. Elfaki, E. Sinakos, and K.D.
Lindor. 2011. Colon neoplasms develop early in the course of
inflammatory bowel disease and primary sclerosing cholangitis. Clin
Gastroenterol Hepatol 9:52-56.
The
Cancer
Genome
Atlas
Network.
2012.
Comprehensive
molecular
characterization of human colon and rectal cancer. Nature 487:330-337.
Tjalsma, H., A. Boleij, J.R. Marchesi, and B.E. Dutilh. 2012. A bacterial driverpassenger model for colorectal cancer: beyond the usual suspects. Nat
Rev Microbiol 10:575-582.
183
Tobacman, J.K. 2001. Review of harmful gastrointestinal effects of carrageenan
in animal experiments. Environ Health Perspect 109:983-994.
Tu, S., G. Bhagat, G. Cui, S. Takaishi, E.A. Kurt-Jones, B. Rickman, K.S. Betz, M.
Penz-Oesterreicher, O. Bjorkdahl, J.G. Fox, and T.C. Wang. 2008.
Overexpression of interleukin-1beta induces gastric inflammation and
cancer and mobilizes myeloid-derived suppressor cells in mice. Cancer
Cell 14:408-419.
Vincent, J., G. Mignot, F. Chalmin, S. Ladoire, M. Bruchard, A. Chevriaux, F.
Martin, L. Apetoh, C. Rebe, and F. Ghiringhelli. 2010. 5-Fluorouracil
selectively
kills
tumor-associated
myeloid-derived
suppressor
cells
resulting in enhanced T cell-dependent antitumor immunity. Cancer Res
70:3052-3061.
Vogelstein, B., E.R. Fearon, S.R. Hamilton, S.E. Kern, A.C. Preisinger, M.
Leppert, Y. Nakamura, R. White, A.M. Smits, and J.L. Bos. 1988. Genetic
alterations during colorectal-tumor development. N Engl J Med 319:525532.
Watanabe, S., K. Deguchi, R. Zheng, H. Tamai, L.X. Wang, P.A. Cohen, and S.
Shu. 2008. Tumor-induced CD11b+Gr-1+ myeloid cells suppress T cell
sensitization in tumor-draining lymph nodes. J Immunol 181:3291-3300.
Watson, A.J., and P.D. Collins. 2011. Colon cancer: a civilization disorder. Dig
Dis 29:222-228.
184
Wirtz, S., C. Neufert, B. Weigmann, and M.F. Neurath. 2007. Chemically induced
mouse models of intestinal inflammation. Nat Protoc 2:541-546.
Wirtz, S., and M.F. Neurath. 2007. Mouse models of inflammatory bowel disease.
Adv Drug Deliv Rev 59:1073-1083.
Yanagisawa, K., M.A. Exley, X. Jiang, N. Ohkochi, M. Taniguchi, and K. Seino.
2006.
Hyporesponsiveness
to
natural
killer
T-cell
ligand
alpha-
galactosylceramide in cancer-bearing state mediated by CD11b+ Gr-1+
cells producing nitric oxide. Cancer Res 66:11441-11446.
Yang, L., L.M. DeBusk, K. Fukuda, B. Fingleton, B. Green-Jarvis, Y. Shyr, L.M.
Matrisian, D.P. Carbone, and P.C. Lin. 2004. Expansion of myeloid
immune suppressor Gr+CD11b+ cells in tumor-bearing host directly
promotes tumor angiogenesis. Cancer Cell 6:409-421.
Yang, W.C., G. Ma, S.H. Chen, and P.Y. Pan. 2013. Polarization and
reprogramming of myeloid-derived suppressor cells. J Mol Cell Biol
Yin, B., G. Ma, C.Y. Yen, Z. Zhou, G.X. Wang, C.M. Divino, S. Casares, S.H.
Chen, W.C. Yang, and P.Y. Pan. 2010. Myeloid-derived suppressor cells
prevent type 1 diabetes in murine models. J Immunol 185:5828-5834.
Yoshimura, T., and M. Takahashi. 2007. IFN-gamma-mediated survival enables
human neutrophils to produce MCP-1/CCL2 in response to activation by
TLR ligands. J Immunol 179:1942-1949.
Zampell, J.C., S. Elhadad, T. Avraham, E. Weitman, S. Aschen, A. Yan, and B.J.
Mehrara. 2012. Toll-like receptor deficiency worsens inflammation and
185
lymphedema after lymphatic injury. American journal of physiology. Cell
physiology 302:C709-719.
Zantl, R., and E. Horn. 2011. Chemotaxis of slow migrating mammalian cells
analysed by video microscopy. Methods Mol Biol 769:191-203.
Zhang, B., Z. Wang, L. Wu, M. Zhang, W. Li, J. Ding, J. Zhu, H. Wei, and K.
Zhao. 2013. Circulating and tumor-infiltrating myeloid-derived suppressor
cells in patients with colorectal carcinoma. PLoS One 8:e57114.
Zhang, R., S. Ito, N. Nishio, Z. Cheng, H. Suzuki, and K.I. Isobe. 2011. Dextran
sulphate sodium increases splenic Gr1(+)CD11b(+) cells which accelerate
recovery from colitis following intravenous transplantation. Clin Exp
Immunol 164:417-427.
Zhang, R., Y. Li, P.L. Beck, and D.M. McCafferty. 2007a. Toll-like receptor 4
regulates colitis-associated adenocarcinoma development in interleukin10-deficient (IL-10(-/-)) mice. Biochem Soc Trans 35:1375-1376.
Zhang, R., A. Ma, S.J. Urbanski, and D.M. McCafferty. 2007b. Induction of
inducible nitric oxide synthase: a protective mechanism in colitis-induced
adenocarcinoma. Carcinogenesis 28:1122-1130.
Zhu, H., X. Lei, Q. Liu, and Y. Wang. 2013. Interleukin-10-1082A/G
polymorphism and inflammatory bowel disease susceptibility: a metaanalysis based on 17,585 subjects. Cytokine 61:146-153.
186