L'INFLUENCE DU RECEPTEUR A L'OESTROGENE a SUR LA DYNAMIQUE CHROMATINIENNE DANS LES CANCERS DU SEIN HORMONO-DEPENDENTS PAR AMY SVOTELIS These soumis au Departement de biologie pour I'obtention du diplome de philosophiae doctor (Ph.D.) FACULTE DES SCIENCES UNIVERSITE DE SHERBROOKE Sherbrooke, Quebec, Canada, mai 2011 Library and Archives Canada Bibliotheque et Archives Canada Published Heritage Branch Direction du Patrimoine de I'edition 395 Wellington Street Ottawa ON K1A 0N4 Canada 395, rue Wellington Ottawa ON K1A 0N4 Canada Your file Votre reference ISBN: 978-0-494-83329-2 Our file Notre reference ISBN: NOTICE: 978-0-494-83329-2 AVIS: The author has granted a nonexclusive license allowing Library and Archives Canada to reproduce, publish, archive, preserve, conserve, communicate to the public by telecommunication or on the Internet, loan, distrbute and sell theses worldwide, for commercial or noncommercial purposes, in microform, paper, electronic and/or any other formats. L'auteur a accorde une licence non exclusive permettant a la Bibliotheque et Archives Canada de reproduire, publier, archiver, sauvegarder, conserver, transmettre au public par telecommunication ou par Plnternet, preter, distribuer et vendre des theses partout dans le monde, a des fins commerciales ou autres, sur support microforme, papier, electronique et/ou autres formats. The author retains copyright ownership and moral rights in this thesis. Neither the thesis nor substantial extracts from it may be printed or otherwise reproduced without the author's permission. L'auteur conserve la propriete du droit d'auteur et des droits moraux qui protege cette these. Ni la these ni des extraits substantiels de celle-ci ne doivent etre imprimes ou autrement reproduits sans son autorisation. In compliance with the Canadian Privacy Act some supporting forms may have been removed from this thesis. Conformement a la loi canadienne sur la protection de la vie privee, quelques formulaires secondares ont ete enleves de cette these. While these forms may be included in the document page count, their removal does not represent any loss of content from the thesis. Bien que ces formulaires aient inclus dans la pagination, il n'y aura aucun contenu manquant. Canada Le27mai2011 lejury a accepte la these de Madame Amy Svotelis dans sa version finale. Membres du jury Professeur Nicolas Gevry Directeur de recherche Departement de biologie Professeur Luc R. Gaudreau Codirecteur de recherche Departement de biologie Professeur Daniel Lafontaine Membre Departement de biologie Professeur Andre Tremblay Membre externe Universite de Montreal, CHU Ste-Justine Professeur Viktor Steimle President rapporteur Departement de biologie TABLE OF CONTENTS ABSTRACT iv RESUME VI ACKNOWLEDGEMENTS LIST OF ABBREVIATIONS VIII X LIST OF TABLES XII LIST OF FIGURES XIII CHAPTER 1 1 I. 1 INTRODUCTION 1.1. T H E EUKARYOTIC GENOME 1 /. /. /. Structure of the eukaryotic genome 2 1.1.2. Chromatin remodelling via A TP-dependent complexes 5 1.1.3. Incorporation ofhistone variants into the nucleosome 7 1.1.3.1. 1.1.4. 1.2. The his tone variant H2A.Z Post-translational h iston e modifications CHROMATIN ARCHITECTURE AND REGULATABLE GENE EXPRESSION 10 14 19 1.2.1. RNA Polymerase II transcription of genes 20 1.2.2. Transcription factor mediated gene regulation 22 1.2.3. Chromatin architecture at regulatory elements 24 1.2.4. Mechanisms of transcriptional activation and roles ofH2A.Z in gene expression 25 1.2.5. Gene silencing and the resolution of poised chromatin states 29 1.3. NUCLEAR RECEPTOR MEDIATED TRANSCRIPTION 1.3.1. ERa-regulated gene expression 37 1.3.1.1. The ERa genomic pathway 37 1.3.1.2. Non-classical ERa pathways 40 1.3.2. 1.4. 34 ERa-dependent breast cancer and anti-estrogen resistance RESEARCH PROJECT AND OBJECTIVES 41 44 ii CHAPTER II II. 47 REGULATION OF GENE EXPRESSION AND CELLULAR PROLIFERATION BY HISTONEH2A.Z II.l. PREAMBLE H.2. MANUSCRIPT 47 47 49 CHAPTER HI III. 78 H2A.Z OVEREXPRESSION PROMOTES CELLULAR PROLIFERATION OF BREAST CANCER CELLS 78 111.1. PREAMBLE 78 111.2. MANUSCRIPT 80 CHAPTER IV IV. 101 H3K27 DEMETHYLATION BY JMJD3 AT A POISED ENHANCER OF ANTI- APOPTOTIC GENE BCL2 DETERMINES ERa LIGAND-DEPENDENCY IV. 1. PREAMBLE IV.2. MANUSCRIPT 101 101 103 CHAPTER V 148 V. 148 DISCUSSION V.l. ERa MODULATION OF CHROMATIN SIGNATURES AFFECTS THE CELL CYCLE 149 V.2. T H E ROLE OF EPIGENETIC SIGNATURES IN ANTI-ESTROGEN RESISTANCE 153 V.3. GENERAL CONCLUSIONS AND PERSPECTIVES VI. REFERENCES 156 159 in ABSTRACT The human genome is organised into a DNA-protein complex called chromatin, of which the main repeating unit is the nucleosome. Chromatin is generally repressive to gene expression, rendering RNA Polymerase II regulatable gene expression dependent on chromatin remodelling complexes. These complexes will displace nucleosomes or change the nucleosomal structure by incorporating histone variants or by the posttranslational modification of histone. Chromatin remodelling works in concert with transcription activators on regulatory elements of regulatable genes. The histone variant H2A.Z has a major role in creating a permissive structure at gene regulatory elements. Conversely, the di- and tri-methylation of histone H3 lysine 27 (H3K27) has a repressive effect on gene regulation, but can be reversed by the recently identified demethylase, JMJD3. The steroid hormone estrogen (E2) and its intracellular receptor estrogen receptor a (ERa) stimulate transcription of target genes by promoting local changes in hormone-responsive promoters embedded in chromatin. ERa-dependent cancers demonstrate deregulated proliferation, and the treatment of these cancers with antiestrogens (AE) occasionally leads to resistant cancer subtypes. H2A.Z overexpression has been associated with ERa target gene expression and breast cancer. In addition, an interesting link exists between ERa and H3K27me3 related chromatin remodelling complexes. We thus hypothesized that ERa-mediated transcription in normal and antiestrogenresistant breast cancer implicates the modification of chromatin signatures on target genes and results in proliferation. We observed that H2A.Z overexpression is related to ERa levels and leads to increased proliferation in low E2 concentrations and in the presence of the AE tamoxifen. We also show that the perturbation of a repressive epigenetic mark that normally controls the expression of the proto-oncogene BCL2 in response to E2 leads to its constitutive transcriptional activation and deregulation of the apoptosis program in AE-resistant breast cancer cells. iv Therefore my doctoral studies present the following conclusions: (1) epigenetic modifications are useful prognostic markers for breast cancer severity; (2) the deregulation of these modifications leads to carcinogenesis; and (3) continued deregulation of these pathways can lead to more severe breast cancer and AE resistance. Key words: Estrogen receptor, transcription, chromatin, H2A.Z, histone modifications V RESUME L'organisation du genome dans un complexe d'ADN et proteines, appele la chromatine presente une barriere a l'expression des genes regule par l'ARN Polymerase II. L'activite de complexes de remodelage de la chromatine sert a modifier la structure de la chromatine pour la rendre permissive a la transcription via 1'incorporation des variants d'histone ou la modification post-traductionnelle des histones dans le nucleosome. De plus, ces activites sont en partie recrutees aux sequences regulatrices par des activateurs de la transcription. La dynamique de recrutement des complexes de remodelage de la chromatine sur les genes dependant de la recepteur a l'cestrogene a (ERa) est controlee par un processus epigenetique antinomique qui est initie par et qui se termine par un remodelage de la chromatine. Les cancers du sein ERa-dependent cancers demontrent une proliferation anormale, et le traitement de ces cancers avec des anti-oestrogenes (AE) peut mener a des cancers resistants a ces traitements. L'incorporation cyclique de H2A.Z aux genes dependants d'ERa est necessaire a l'initiation de la transcription de ces genes. Au contraire, la di- et tri-methylation de l'histone H3 sur la lysine 27 (H3K27) jouent un role important dans la formation d'une structure de la chromatine ayant un effet negatif sur la transcription, et cette marque peut etre enlevee par la demethylase JMJD3. L'objectif general de ce projet de recherche est d'ameliorer les connaissances sur les mecanismes moleculaires qui gouvernent l'expression des genes dependants de ERa et ce, dans le contexte de la structure de la chromatine et l'etablissement du cancer du sein et la resistance aux traitements AE. On a demontre que la surexpression de H2A.Z existe dans les cancers du sein, et celle-ci est liee avec l'expression d'ERa. La surexpression de H2A.Z dans les cellules de cancer du sein hormono-dependent augmente la proliferation des cellules dans des conditions depourvue d'oestrogene et en presence d'un AE tamoxifene. Aussi, on a demontre la regulation du gene anti-apoptotique BCL2 par ERa et JMJD3 via la demethylation de H3K27me3, une regulation qui est perdue dans les cancers resistant aux AE. VI En resume, mes etudes doctorales m'ont amene a proposer les conclusions suivantes: (1) les modifications epigenetique sont des outils interessant dans la detection de cancer du sein avec un mauvais pronostique; (2) la deregulation de ces modifications peut mener a la carcinogenese; et (3) une deregulation prolongee des voies qui affectent ces modifications peut mener aux cancers plus severe, dont des cancers resistants aux traitements AE. Mots cles: Receptor a l'cestrogene, transcription, chromatine, H2A.Z, modifications d'histones Vll ACKNOWLEDGEMENTS The process of acknowledging all of those who have contributed to my doctoral studies brings about a great amount of nostalgia. As a result, it is almost impossible to mention everyone that has contributed to my learning process. Notoriously known as an emotional and sensitive person (in both the positive and negative realms of these terms), please bear with me, as this will be the only intensely personal section of an otherwise scientific thesis. First and foremost, I must thank Nicolas Gevry. His unrelenting support of me over the years is second only to my family. Starting out as an annoying returning student with an immeasurable number of questions, I can only hope to live up to the expectations he now has of me. I count myself lucky to have worked so closely with him all these years, and have revelled in the everchanging relentless idea machine with his off-key singing, whistling, strange expressions and sense of humour, as well as the many moments we have worked, discussed, and laughed together. Thank you Nic for being such an incredible boss, mentor, and friend. I cannot forget my co-director Luc Gaudreau, who originally believed in me and pushed me to believe in myself when I didn't, and tried his best to get his "Calimero" to toughen up! Your success in research is an inspiration, and thanks you for all that you have taught me. Special thanks are reserved for the jury members of my thesis, who will be taking time to review my work. The job of a researcher is a noble one, although rarely recognised and appreciated, so much of their time dedicated to volunteer work. This is why I first thank Andre Tremblay, my external evaluator. Viktor Steimle has been a non-stop source of knowledge and interesting tidbits through the years, and I would never understand FACS (or many other things) without him. Just for your own personal enjoyment Viktor, I have included a few well-placed "proper"s in my thesis. I also appreciate the more recent yet significant contribution of Daniel Lafontaine to my studies, always there for a good pep talk. Finally, Benoit Leblanc rivals Viktor in the knowledge department, and his contribution to project-related and non-scientific silly discussions will always be remembered. My Gevry lab-mates need to be specially mentioned. Gabrielle lived through my pregnancy with me, keeping the others in line and suffered through my slave-driver ways in the preparation of the most recent article. Mylene was always there for scientific and non-scientific discussion, and I vm apologise for the incessant chatter that may have led to human error in your experiments... I hope to have helped Anne-Marie, Lydia, Guylaine, and Ma'fka in their learning processes, since I have sincerely enjoyed their company during the past few years and they have been the subject of my constant teasing and silliness. I only hope the newcomers, Stephanie and Alexei, will become as used to this as you all have! My colleagues in Luc's lab, Alain, Maud, Liette, Sylvain, Marc, Annie, Sebas, Joelle and yes, even my nemesis Ben, have all contributed in their own unique way to my progression through the years. I especially thank the overworked and underappreciated Manon, who is the best Mommy to my cells I could ask for. Impossible to forget, although not lab-mates, my department colleagues Gabi, Jean-Phillipe, Simon, Jean-Francois, Jerome and Benoft played an important role in my psychological wellness over the years. Thanks as well to Andree-Anne, who renewed my faith in the youngun's... Last, but most definitely not least, I thank my family with all my heart. My husband, Francis Jacques, was the essential in my re-entry into research in 2005 and has suffered through countless moments of tardiness, existential and professional questioning, and the long hours spent at the lab. If it was not for his help during my studies, my pregnancy and the birth of our child, Noah, I would have quit many times. As I sit writing this on a wintery Saturday afternoon alone in the lab, he is at home, taking care of our little Noah. Saying this, I also have to thank Noah, who was such a good fetus and baby once he came into this world, letting Mommy finish her Ph.D.! The support of my mother will stay with me my whole life, my number one fan. She is always backed up by the cheerleaders, my sisters. Finally, I hope I have made my inspiration, my father, proud. "No! Try not. Do or do not. There is no try." - Yoda, a long time ago in a galaxy far, far away IX LIST OF ABBREVIATIONS 3C 3D ACF AD AE AF-1 AF-2 ATP ATPase bp BRD CAF CBP CENP CHD ChlA-PET ChIP ChlP-PET ChlP-seq CRC C-terminal DBD DNA DSB E2 EGFR ER ERE EZH FISH GNAT H2A H2B H3 H4 HAT HDAC HER2 HMT HP1 HRE HZAD chromosome conformation capture three-dimensional ATP-utilizing chromatin-assembly and -modifying factor activation domain anti-estrogen activation function 1 activation function 2 adenosine-5'-phosphate ATP hydrolysis base pairs bromodomain chromatin assembly factor CREB-binding protein centromere protein chromodomain chromatin interaction analysis with paired-end tag sequencing chromatin immunoprecipitation ChIP analysis with paired-end tag sequencing ChIP analysis with deep sequencing chromatin remodelling complexes carboxy terminal DNA-binding domain deoxyribonucleic acid double strand break estrogen epidermal growth factor receptor estrogen receptor estrogen response element enhancer of zeste fluorescence in situ hybridization Gcn5-related acetyltransferase histone 2 A histone 2 B histone 3 histone 4 histone acetyltransferase histone deacetylase human epidermal growth factor receptor 2 histone methy transferase heterchromatic protein 1 hormone response element ^/-activated domain ISWI Jmj kb KDM LBD LSD MAPK MLL MYST NAP N-terminal NR PcG PCR pEZH2 PI3K PIC PRC PRMT pTEF-b RCAF RE RNA RNAi RNAPII SET SWI/SNF TFII trxG TSS Ub imitation switch jumonji kilobases lysine demethylase ligand-binding domain lysine-specific demethylase Mitogen activated protein kinase Mixed Lineage Leukaemia MOZ, Ybf2/Sas3, Sas2 and TIP60 nucleosome assembly protein amino terminal nuclear receptor polycomb group polymerase chain reaction phosphorylated EZH2 phosphotidylinositol-3 kinase pre-initiation complex polycomb respressive complex peptidylarginine methyltransferases positive transcription elongation factor b replication coupling assembly factor response elements ribonucleic acid RNA interference RNA polymerase II su(var)3-9, enhancer of zeste, trithorax SWItch/Sucrose NonFermentable transcription factor II trithorax group transcription start site ubiquitin LIST OF TABLES CHAPTER I : INTRODUCTION TABLE 1-1: CHROMATIN CONFORMATIONS AT DIFFERENT PROMOTER TYPES CHAPTER III : H2A.Z 25 OVEREXPRESSION PROMOTES CELLULAR PROLIFERATION OF BREAST CANCER CELLS TABLE 3-1: HIGH GRADE BREAST CANCER CORRELATES WITH HIGH LEVELS OF H2A.Z 89 TABLE 3-2: HIGH LEVELS OF H2A.Z CORRELATE WITH HIGH LEVELS OF IMPORTANT CELL CYCLE REGULATORS 89 CHAPTER IV : T H E CONTROL OF H3K27 METHYLATION STATUS AFFECTS THE APOPTOTIC PROGRAM IN HORMONE-DEPENDENT BREAST CANCER AND ANTI-ESTROGEN RESISTANCE TABLE 4-S1: E2-REGULATED GENES NEGATIVELY AFFECTED BY THE KNOCKDOWN OF JMJD3 139 TABLE 4-S2 : POTENTIAL ANTI-APOPTOTIC GENES NEGATIVELY REGULATED BY THE KNOCKDOWN OF JMJD3 140 TABLE 4-S3 : LIST OF PRIMERS USED IN THIS STUDY 141 XII LIST OF FIGURES CHAPTER I : INTRODUCTION Figure 1-1 : The 3 main mechanisms of site exposure on DNA through chromatin remodelling....5 Figure 1-2 : Phytogeny of H2A variants 9 Figure 1-3 : Epigenetic tools 15 Figure 1-4 : Gene promoter structure in inducible gene expression 22 Figure 1-5 : Chromatin conformations at different promoter types 25 Figure 1-6 : Polycomb-mediated repression and model of cell fate decision on poised promoters 33 Figure 1-7 : The different pathways of gene regulation by ERa 36 CHAPTER II : REGULATION OF GENE EXPRESSION AND CELLULAR PROLIFERATION BY HISTONE H2A.Z Figure 2-1 : Proposed model for the control of cellular proliferation by H2A.Z in mammalian cells CHAPTER 69 III: H2A.Z OVEREXPRESSION PROMOTES CELLULAR PROLIFERATION OF BREAST CANCER CELLS Figure 3-1 : The overexpression of H2A.Z promotes E2-independent cell growth 85 Figure 3-2 : H2A.Z is overexpressed in several different cancerous cell lines and tissues and correlates with ERa levels 86 Figure 3-3 : High grade breast cancer correlates with high levels of H2A.Z 88 Figure 3- 4 : ERa regulates the expression of H2A.Z in breast cancer cells 91 CHAPTER IV : THE CONTROL OF H3K27 METHYLATION STATUS AFFECTS THE APOPTOTIC PROGRAM IN HORMONE-DEPENDENT BREAST CANCER AND ANTI-ESTROGEN RESISTANCE Figure 4-1: JMJD3 causes apoptosis in ERa-positive breast cancer cells 109 Figure 4-2: JMJD3 regulates BCL2 gene transcription in ERa-positive cells 112 Figure 4-3 : JMJD3 colocalizes with ERa at the BCL2 promoter 114 Figure 4-4 : Presence of ERa and JMJD3 at BCL2 are interdependent 116 Figure 4-5 : AE-resistant cells have a modified H3K27me3 chromatin signature that alters BCL2 transcriptional activity 121 Figure 4-6 : Inactivation of the EZH2 methyltransferase activity by the HER2/AKT pathway bypasses the Xlll need for JMJD3 at the BCL2 enhancer region in AE-resistant cells 125 Figure 4-7: Summary model of the role of JMJD3 and H3K27 methylation in the control of BCL2 gene expression in tamoxifen sensitive and resistant breast cancer cells 130 Supplementary figures Figure 4-S1 : The shRNA-mediated knockdown of JMJD3 affects apoptosis in MCF7 cells 134 Figure 4-S2 : The effect of JMJD3 knockdown is specific to ERa-positive cells 135 Figure 4-S3 : The H3K27me3 demethylase UTX does not affect BCL2 expression 135 Figure 4-S4 : H3K27me3 status does not affect chromatin remodelling at the BCL2 enhancer region 136 Figure 4-S5: Anti-estrogen resistant cells exhibit an altered epigenetic pattern and regulation of BCL2.. 136 Figure 4-S6 : Depletion of PRC complex member SUZ12 induces expression of BCL2 137 Figure 4-S7 : Inhibition of pEZH2 in AE resistant cells decreases BCL2 expression 137 Figure 4-S8 : A decrease in H3K27me3 due to EZH2 phosphorylation leads to resistance to tamoxifeninduced apoptosis 138 xiv CHAPTER I I. INTRODUCTION 1.1. The eukaryotic genome The world we live in is teeming with diverse forms of life, all based on the same simple structure: a series of nucleotides (A, T, C, G) which are arranged into base pairs (bp) in a double helix called DNA. The specific arrangement, or sequence, of these nucleotides into genes will determine the different characteristics of an organism, from a simple-cell prokaryotic or eukaryotic organism such as a bacteria or yeast, to complex multicellular eukaryotic organisms that are composed of multiple organs or tissues, such as plants and animals. The entirety of genes in an organism is called its genome, and generally the more complex the organism, the larger the genome. However, the size of each cell does not necessarily vary accordingly to accommodate the increasing amount of DNA. For example, the yeast Saccharomyces cerevisiae genome is 12.1 million bp, approximately 6 300 genes, would measure if placed end to end almost 1 centimetre (cm) and fits in a cell of 5-10 micrometers (um) in diameter (Alberts et al., 2002). The human genome is composed of 3.2 billion bp that code for approximately 30 000 genes, and would measure if placed end to end 2 metres long, but fits into cells that measure on average 10 urn (almost 200 times smaller than the size of a pinhead) (Alberts et al., 2002). To package a genome this size into such a small space is one of the greatest organising feats ever achieved, using the sorting of sequences into different sections, or 1 chromosomes, and the folding of these DNA sections by proteins into a structure called chromatin. In addition, multicellular organisms are composed of a number of different cell types, but the expression of every single gene simultaneously would create chaos. At the same time, the expression of the wrong genes at the wrong time leads to a number of pathophysiologies, such as cancer. Therefore, the establishment of cell identity depends largely on the timely differential expression of genes that are present in each cell. The effect of chromatin structure on gene expression decisions in normal and cancerous cells has been the subject of my doctoral studies. 1.1.1. Structure of the eukaryotic genome Chromatin is a complex of DNA and proteins that is separated into several levels, achieved via the use of several different proteins and complexes. The first level of chromatin organisation is defined by the nucleosome, 146 base pairs (bp) of DNA wrapped around an octamer of canonical histones (2 of each H2A, H2B, H3 and H4), with generally 50-80 bp of linker DNA between nucleosomes (Kornberg and Thomas, 1974). Histones are proteins with a high proportion of positively charged amino acids, and the central domain consists of three a-helixes separated by loop domains, known as the "histone fold" domain (Arents et al., 1991). It is believed that these two characteristics permit the histones to tightly bind the DNA via the sugar phosphate backbone, mostly in the minor groove of DNA (Luger et al., 1997). The main variations between the histones occur in the N-terminal tails, which are known to be subject to specific post-translational modifications (Strahl and Allis, 2000). The protruding Nterminal tails interact with DNA, neighbouring nucleosomes, and non-chromatin proteins (Schwarz et al., 1996). 2 Chromatin is basically separated into two forms in the cells: heterochromatin and euchromatin. Heterochromatin is known as the most highly condensed form and generally remains always condensed (Craig, 2005). For example, regions of heterochromatin present at the end of chromosomes, the telomeres, and at the interaction point between chromosomes, the centromere, rarely contain genes and are known as constitutive heterochromatin (Craig, 2005). However, some regions of chromatin present in different areas of the chromosome have the capacity to condense in the response of cellular signals, known as facultative heterochromatin (Craig, 2005). The histone protein HI, larger than the core histones, can bind to the DNA-nucleosomal axis and change the path of the linker DNA to help in further compaction of chromatin (Bustin et al., 2005). Additional levels of DNA packaging exist in order to organise the genetic information into a more efficiently compacted structure and to preserve the DNA during cell division, where the condensation of chromatin into the chromosomes occurs (Felsenfeld and McGhee, 1986). Euchromatin makes up the majority of chromatin in eukaryotic cells, of which 10% is actively being transcribed at any moment, giving it the designation of "active chromatin" (Cairns, 2009). Euchromatin is defined by its less condensed structure than heterochromatin (Cairns, 2009). However, the simple presence of nucleosomes provides an important barrier to gene expression and DNA replication mechanisms that must be overcome (Knezetic and Luse, 1986; Lorch et al., 1987). Thus, gene expression is dependent on complexes and mechanisms that modify nucleosomal positions and structure. Therefore, there exist several factors that determine nucleosomal assembly on a DNA template, and genome-wide studies in different organisms have revealed the requirements for nucleosome positioning in vivo (Albert et al., 2007; Field et al., 2009; Field et al., 2008; Kaplan et al., 2009; Lee et al., 2007b; Mavrich et al., 2008a; Mavrich et al., 2008b; Ozsolak et al., 2007; Peckham et al., 2007; Schones et al., 2008; Shivaswamy et al., 2008; Valouev et al., 2008; Yuan et al., 2005). First, the DNA sequence in itself encodes preferential locations for nucleosome assembly. Considering that a mechanical 3 stress is created when DNA must be wrapped around the nucleosome, sequences with the least resistance to the sharp bending, such as periodic stretches of AA/TT dinucleotides, are preferred nucleosome locations, whereas long tracts of rigid sequences are often devoid of nucleosomes (Segal and Widom, 2009). The original positioning of nucleosomes on DNA can then be forcibly modified by complexes that affect the histoneDNA interaction in different ways. Chromatin remodelling complexes (CRC) are large complexes composed of a variable number of proteins that direct nucleosome dynamics in the cell by regulating DNA accessibility. There are three main ways that the eukaryotic cell remodels chromatin: ATP-dependent site exposure, the incorporation of histone variants into the nucleosome, and post-translational modification of the histones (Figure 1-1; (Saha et al., 2006)). A common feature of CRC is the presence of protein domains that are required for nucleosome interaction: bromodomains (BRD) bind to acetylated residues; chromodomains (CHD) recognise methylated residues; and plant homeodomain (PHD) fingers and Tudor domains are known to bind methylated histones (Saha et al., 2006; Zhang, 2006). These complexes also contain subunits with catalytic activity, such as ATPase, acetylase and/or methylase activities, which are essential in executing the chromatin remodelling mechanisms. Each of these mechanisms is crucial for cell viability and the equilibrium between these mechanisms is central in proper gene regulation. 4 Positioning ATP-de pendent CRC Composition ATP-dependent CRC Canonical nucleosome Variant nucleosome Modification CRC with histone modifying enzymes • Figure 1-1 : The 3 main mechanisms of site exposure on DNA through chromatin remodelling The action of chromatin remodelling complexes can modify nucleosomal positions on DNA or the composition of nucleosomes by incorporating histone variants. Nucleosomes can also be modified by the actions of chromatin remodelling complexes that contain proteins with histone modifying enzymatic capacity. Adapted from (Saha et al., 2006). 1.1.2. Chromatin remodelling via ATP-dependent complexes In general, ATP-dependent CRC will affect chromatin structure via intrinsic ATPase activity contained in the main subunit of the complex. The ATPase activity will permit the disruption of histone-DNA contacts while the remodelling factor subunits will either reposition the nucleosome along DNA, eject the nucleosome, or unwrap the DNA from 5 the nucleosome surface (Figure 1-1) (Clapier and Cairns, 2009; Saha et al., 2006). To date, there exist four known main families of ATP-dependent CRC with different ATPase activities in eukaryotic organisms, whose composition and function varies in each organism: SWI2/SNF2 (Switching/Sucrose Non-Fermenting), ISWI (Imitation Switch), CHD (chromodomain), and INO80 families (Clapier and Cairns, 2009; Eberharter and Becker, 2004). Assembly of the nucleosome during replication occurs through the concerted action of the CAF-1 (Chromatin Assembly Factor 1), RCAF (Replication-Coupling Assembly Factor), ACF (ATP-utilizing Chromatin assembly and remodelling Factor), and NAP-1 or NAP-2 (Nuclesome Assembly Protein 1 or 2) complexes (Ito et al., 1999; Loyola et al., 2001; Rodriguez et al., 1997; Tyler et al., 1999). CAF-1 and RCAF aid in the formation of an H3-H4 tetramer and its deposition onto DNA (Smith and Stillman, 1989, 1991) while Nap-1 or Nap-2 can bind H2A-H2B dimers and act as histone chaperone proteins to deposit the dimer onto the H3-H4 tetramer, aided by the ACF complex, which contains the ISWI ATPase (Ito et al., 1999; Rodriguez et al., 1997). Studies in human cells have demonstrated that assembly is dependent on the ATP-dependent RSF (human Remodelling and Spacing Factor) complex, also an ISWI-containing complex, and can take place without the use of a histone chaperone (Loyola et al., 2001). The ATPase activity of CRCs increases the accessibility to DNA and aids in the regular spacing of nucleosomes along DNA (Ito et al., 1999). Both the ISWI and human INO80 complexes can displace nucleosomes in cis by "sliding" the nucleosomes along DNA (Jin et al., 2005b; Langst and Becker, 2001). Members of the SWI2/SNF2 families of chromatin remodelling complexes can displace nucleosomes in cis and trans, completely disrupting chromatin structure in order to move a nucleosome to a different position on DNA (Fan et al., 2003a; Imbalzano et al., 1994; Mizuguchi et al., 2004). The members of the CHD family are characterised by the presence of a chromodomain-containing subunit, used to bind methylated lysine residues on proteins, and often have a histone deacetylase 6 associated with the complex (Delmas et al., 1993; Feng and Zhang, 2003; Kelley et al., 1999). The actions of each of these complexes are also implicated directly in the regulation of gene expression, often by the intrinsic activity of the complexes or by the association with other histone modifiers. For example, the actions of ISWI in the modification of translational positions of nucleosomes along DNA can uncover regulatory regions, thereby modifying gene expression and DNA replication (Fazzio and Tsukiyama, 2003; Langst et al., 1999; Xella et al., 2006). ISWI complexes have also been associated with histone modifying activity (Kal et al., 2000; Wysocka et al., 2006). Of the INO80 members, the ATPase chromatin remodelling activity of the yeast SWRl, and human SRCAP and p400 complexes have a special ability to specifically target H2A/H2B dimers to exchange them with a dimer containing H2A.Z, an H2A variant strongly associated with gene regulation (Gevry et al., 2009; Jin et al., 2005b; Kobor et al., 2004; Krogan et al., 2004; Krogan et al., 2003; Mizuguchi et al., 2004; Ruhl et al., 2006; Wu et al., 2005). CHD family CRC have been associated with active histone modifications and demonstrates a role in relieving torsional stress on DNA during transcriptional and replication processes (Hall and Georgel, 2007; Srinivasan et al., 2008; Zhang et al., 2005b). Taken together, the increasing knowledge of the functions and subunits of CRC have revealed that the three chromatin remodelling mechanisms are strongly inter-related, and have crucial effects on DNA-related activity. 1.1.3. Incorporation of histone variants into the nucleosome Histone variants are paralogues of the canonical histones, differing from the latter by slight to major changes in sequence (Malik and Henikoff, 2003). Recent studies on these variants have shown that they tend to be conserved across species, delineating their 7 importance (Talbert and Henikoff, 2010). Histone variants are generally expressed throughout the cell cycle but are specifically deposited into chromatin at specialized instances via a replication-independent mechanism, contributing to epigenetic control in the cell (Henikoff et al., 2004; Jin et al., 2005a). Both histones H3 and H2A are known to have several variants in mammalian cells: CENP-A, H3.lt, H3.1, H3.2 and H3.3 for H3; and macroH2A, H2A.Bbd, H2A.X, H2A.Z1 (H2A.Z) and H2A.Z2 (H2A.F/Z) for H2A (Hake and Allis, 2006; Pusarla and Bhargava, 2005; Talbert and Henikoff, 2010). Each of the histone variants conveys a special characteristic to the chromatin fiber once they are incorporated. CENP-A (or CenH3) is associated with the formation of the highly compacted centromeric chromatin (Bernad et al., 2009). In contrast, H3.3 is located at gene regulatory regions and areas that are enriched with covalent modifications associated with active chromatin, such as acetylation (Bulger et al., 2003; Elsaesser et al., 2010; McKittrick et al., 2004). H2A variants are numerous and provide a great variability in the nucleosomes they inhabit by modifying nucleosome structure, stability and targeting by CRC, conferring the nucleosome an important role in transcription, DNA repair and chromosome compaction (Figure 1-2; (Talbert and Henikoff, 2010)). The existence of variants of H2A was first observed in mammalian cells, in a study that demonstrated two as-yetunidentified forms of H2A via gel and peptide analysis (West and Bonner, 1980). H2A is the major form of histone H2A proteins in eukaryotic cells, with the variants H2A.X and H2A.Z constituting a minor fraction of total H2A in S phase (Wu and Bonner, 1981). H2A.X, in its phosphorylated form of y-H2A.X, plays a pivotal role in the marking of DNA damage in the form of double-strand breaks (DSB) and the recruitment of DNA repair proteins to these sites (Dickey et al., 2009). H2A.Z has been shown to have an increasingly complex role in several organisms, notably in mammalian cells, with varying roles in transcriptional regulation and nucleosome stability (Svotelis et al., 2009; Zlatanova and Thakar, 2008). 8 " — " * "*~ Trypanosoma bmca M2A Z ~ Texrahym&na ihermophia H2A I "Cryptosporidium parvum H2A £ Toxoplasma gondii H2A Z Ambtdopms thattana HTM ™ Arobktepslififw&JrtaH2A Z ™™— 0>!»5Btt« H2A 2 rffcmo sapient H2AZ1 u Dontor«r«>M2A.Z Homo K#wns H2A Z2 ^O0flusgfl&«H2A.Z2 Dr)rMOWK>H2A.v j Trichofjtax odhopntra H2A 7 -DresppMo nwlonogoster H2Av 5oc^*anpmyic«5 cenrvrstoe H2AZ - SehteosoxfiOfDmyGK pcmbe H2A.Z -— ™ -Dtetyosttitum dfceoMewn H2A.Z ~7r>p<jri050ox» hwm H2A -<J&^iam6taH2A.X -DfCtyoSfcSurr* <AscokfcwiH2A.X Homo sapiens HMBbd Bos taumt HM Sbd ' MUJ muscv&tf H2A.BW J Mus rrmstiAjs H2AU •• A* rt museums H2AL1 C&n*femtferfeH2AI * AJwandnum romonwis* H2A X , f ™ Homo saptem tv&<2A\.2 *" Go&ftgofc«mH2A12 j Homo septem mH2AU "•• 0mto/*rfomH2AU ~ Homo *opfen mH2A2 GaSfus go«us mH2A2 Danio rerio mH2A2 " Ixodes scapufarts mH2A " Nematoste&a wcwnss mH2A - Hyvfre maigrwpap*lfota mHZA - Strongyhcentrotls purpuratui mH2A Trfchep&wt odrwewns mH2A ™" OypfosporwAtirri parvum H2A X * rarqs&tsmo^o^f HiA X *— Temsfrymem thermoptvla HM X ArobkbfHK thobano HMJftCK - / * « * * * » & rMSJnaHM — • O y m SoBvo H2A AVafcitfwsisrtefeiMoHMX O0tfastftfvaH2AJ( —Si*cdl»aror»vc«iDewWsfe» H2A X 5cfir/OSOCt/)ctrOfr<yc»i port?t* H2A.X 'OstdagO moydH K2A.X Hpmo sapwrrw H2AX Monodefcfta domesriOJ H2A.X Omtifcrfyrtc/tus onotinus H2A X Li cOewtor*noH2AX Danto/*rfoH2A *tomo wp«m H2A Calks ga8usH2A TWdwpta* «#x»rwu H2AJC r Mus musctAs H2A f*A#smrtefer3H2A ~Aps/rwJtffaraH2A.X "AdSoew voga H2Abd2 AdrwttJ w^ga H2Afadl ——j^&aeta vaga H2Abd 0 01 differences per site tf 1r Kingdom Excavate Amoebo/oan Alveolate Plant Fungt Animal Historic variant H2AZ — HTA4 »rtd H2AV — H2AX •—- Canc*itcal H2A — &detto<i rotifer H2A Plant taiter bmdmg HM — Mammattian H2AJJbd and sperm H2A — AntmaimH2A Figure 1-2 : Phylogeny of H2A variants A phylogenetic tree of H2A variants, showing that H2A.Z and H2A.X diverged from other H2A variants before the diversification of eukaryotes, and may have preceded canonical H2A (Talbert and Henikoff, 2010). 9 1.1.3.1. The histone variant H2A.Z The study of H2A.Z and H2A.Z-containing nucleosomes has been an exciting adventure over the past few years, providing irrefutable evidence that H2A.Z is an essential variant for normal eukaryotic cell function. Originally identified in several organisms, it was found that H2A.Z is significantly more conserved across species (90% sequence identity) than H2A (Iouzalen et al., 1996; Jiang et al., 1998), and it has been suggested that either H2A.Z or H2A.X evolved before the canonical H2A (Figure 1-2; (Talbert and Henikoff, 2010)). It has recently been shown that there are two distinct genes in vertebrates that produce H2A.Z proteins, H2A.Z1 and H2A.Z2 (Eirin-Lopez et al., 2009). H2A.Z2 differs from H2A.Z1 by only three amino acids, but does not seem to be completely functionally redundant with H2A.Z1, shown by the lethality of the murine simple knockout of H2A.Z1 (Eirin-Lopez et al., 2009; Faast et al., 2001). For simplicity, all future references to H2A.Z in this thesis apply to H2A.Z1, unless specifically stated. The crucial differences between H2A and H2A.Z seem to lie within the C-terminal region of the protein. Although its deletion conferred roles in transcription and chromosome stability in Saccharomyces cerevisiae and Schizosaccharomyces pombe, H2A.Z (htzl in yeast) is not essential for survival (Adam et al., 2001; Carr et al., 1994; Jackson and Gorovsky, 2000; Krogan et al., 2004; Larochelle and Gaudreau, 2003; Santisteban et al., 2000). However, the overexpression of H2A.Z in H2A yeast gene knockout strains (Ahtal/Ahta2) could not rescue the lethal phenotype associated with this strain, and the overexpression of either of the H2A genes could not rescue the bhtzl phenotypes (Jackson and Gorovsky, 2000; Santisteban et al., 2000). Also, replacement of the C-terminus of H2A.Z with the equivalent region in H2A could not rescue the Ahtzl phenotype, while a fusion of the H2A.Z C-terminus with H2A lacking its C-terminus restored wild-type function (Adam etal.,2001). 10 The importance of H2A.Z is more evident in metazoan models, such as Tetrahemena thermophila, Xenopus laevis, Drosophila melanogaster, and Mus musculus, where deletion of the gene is lethal (Faast et al., 2001; Iouzalen et al., 1996; Liu et al., 1996a; van Daal et al., 1988). Complementation assays in Drosophila embryos via the injection of H2A.Z in early larval stages rescues this lethality (van Daal et al., 1988). More recently, RNA interference (RNAi) has now permitted us to explore the cellular pathways affected by a decrease in the expression of H2A.Z while escaping the knockout lethal phenotype in metazoan cells. Taken together, these results suggest that H2A.Z has a role in the development of multi-cellular organisms, notably in the regulation of gene expression, which will be discussed in the section 1.2.4. The differences between H2A and H2A.Z function may stem from the differences in the H2A- or H2A.Z-containing nucleosome structures. Despite a homology of only 60% between the primary protein structures of H2A.Z and H2A, crystal structure analysis of reconstituted nucleosomes containing mouse H2A.Z demonstrated only a few major differences from H2A (Suto et al., 2000). A chimeric construct of H2A.Z with the Cterminal region of H2A introduced into Drosophila embryos lacking the wild-type histone variant leads to lethality or major developmental defects, while other areas appear to be interchangeable (Clarkson et al., 1999). Although subtle, these changes lead to a possible steric hindrance between H2A and H2A.Z, which was suggested to lead to homotypic nucleosomes, containing either H2A.Z or H2A in metazoan cells (Suto et al., 2000). However, the existence of heterotypic "ZA" nucleosomes (one H2A/H2B dimer coupled to a H2A.Z/H2B dimer) has been observed in reconstituted vertebrate nucleosomes in vitro and confirmed in vivo by immunoprecipitation in S. cerevisiae and Drosophila melanogaster (Ishibashi et al., 2009; Luk et al., 2010; Weber et al., 2010). The heterotypic nucleosome tends to be less stable than homotypic H2A.Z nucleosomes (Ishibashi et al., 2009). Many unresolved issues remain concerning the particularities of the stability of the H2A.Z-containing nucleosome particle, which seems to depend on 11 nucleosome composition and H2A.Z acetylation (Jin et al., 2009; Le et al., 2010; Zlatanova and Thakar, 2008). The specificity of H2A.Z-related responses is due in part by it targeting to chromatin in response to cellular signals independent of nucleosome formation during replication. There has been speculation on the specific sequence characteristics that may determine H2A.Z nucleosome positioning. Large-scale analysis of the DNA sequences that immunoprecipitate with H2A.Z by ChlP-chip, or by a massive DNA sequencing analysis of ChIP DNA fragments (ChlP-seq) (Venters and Pugh, 2009) have provided a multitude of information on H2A.Z in chromatin. Using previously obtained data from ChlP-chip and Chip-seq experiments, bioinformatics analyses have shown that H2A.Z-containing nucleosomes protect a smaller region of DNA in both yeast an humans (120bp as compared to 147 in H2A-containing nucleosomes), and that the underlying sequence is more GC-rich and more rigid (Fu et al., 2008; Gervais and Gaudreau, 2009; Tolstorukov et al., 2009). However, a recent genome-wide analyses of sequences from purified nuclesomes in human HeLa cells has further determined that nucleosomes containing only H2A.Z are rich in more flexible AT motifs, while "double-variant" nucleosomes (H2A.Z and H3.3), the nucleosomes that are most present at gene regulatory areas, are more GC-rich (Jin et al., 2009; Le et al., 2010). Also, it appears that DNA methylation will also affect the deposition of H2A.Z into chromatin, as they are anti-correlated in plant, mouse and human genomes (Conerly et al., 2010; Edwards et al., 2010; Kobor and Lorincz, 2009; Zemach et al., 2010; Zilberman et al., 2008). The main determining factor of H2A.Z presence in chromatin remains is its deposition as an H2A.Z/H2B dimer by the ATP-dependent remodelling CRC Swrl.com in yeast, and SRCAP or p400/Tip60 complexes in metazoans (Cai et al., 2005; Gevry et al., 2007; Kobor et al., 2004; Krogan et al., 2003; Mizuguchi et al., 2004; Ruhl et al., 2006). In yeast, in addition to the copurification of H2A.Z, Swrl, and Swrl.com components, ChIP assays in strains lacking swrl or other components of the complex showed a decrease in 12 the presence of H2A.Z in euchromatin that borders silenced areas of chromatin (Kobor et al., 2004; Krogan et al., 2003). The role of Swrl.com in the catalysis of the exchange of H2A/H2B dimers for H2A.Z/H2B dimers was confirmed in vitro, using an exchange assay with reconstituted nucleosomes in the presence of ATP (Mizuguchi et al., 2004). This activity appears to be genome-wide, as shown by the Swrl-dependent localization of H2A.Z in chromatin (Li et al., 2005; Zhang et al., 2005a). The existence of heterotypic "ZA" nucleosomes in S. cerevisiae and Drosophila melanogaster suggests a mechanism by which the exchange occurs in a stepwise manner, replacing one dimer at a time (Ishibashi et al., 2009; Luk et al., 2010; Weber et al., 2010). Orthologs of the catalytic subunit Swrl in metazoan cells were suggested to be SRCAP and p400 (Cai et al., 2005; Wu et al., 2005). The H2A.Z protein was present in an SRCAP immunoprecipitated complex, and the ATP-dependent exchange of H2A/H2B dimers for H2A.Z/H2B by the SRCAP complex was demonstrated in vitro (Cai et al., 2005; Ruhl et al., 2006). Although not present in the p400/Tip60 immunoprecipitated complex (Fuchs et al., 2001), H2A/H2B dimers can be exchanged for H2A.Z/H2B dimers by p400/Tip60 in vitro (Gevry et al., 2007). Once deposited into chromatin, the H2A.Z-containing nucleosome confers distinct properties to the chromatin environment. Genome expression and ChIP analysis of an htzl knockout strain suggested that H2A.Z was important in close proximity to telomeres in yeast (Guillemette et al., 2005; Kobor et al., 2004; Krogan et al., 2004; Krogan et al., 2003; Meneghini et al., 2003). These clusters are referred to as Htzl-activated domains, serving to protect the spread of the Sir-dependent repressive effect (Meneghini et al., 2003). Immunofluorescence and ChIP studies in mouse and human cells showed an association between H2A.Z and HP la in constitutive and facultative heterochromatin, as well as in important staining at the silent X chromosome (Fan et al., 2004; Rangasamy et al., 2003; Sarcinella et al., 2007). However, H2A.Z is also present in a punctuate manner throughout the chromosomes (Sarcinella et al., 2007). Accordingly, H2A.Z was found to have a role in the prevention of heterochromatic spreading at insulator regions of the 13 chicken P-globin locus, regions of highly compacted chromatin that define chromatin domains within the euchromatic regions of DNA (Bruce et al., 2005). The role of H2A.Z in insulator definition is supported by the correlation between H2A.Z and the insulator protein CTCF in human cells (Barski et al., 2007; Fu et al., 2008; van de Nobelen et al., 2010). Along the same lines, the genome-wide ChlP-seq profiling of Plasmodium falciparum showed that H2A.Z was found to demarcate intergenic regions and correlated with H3K4me3 and H3K9ac (Bartfai et al., 2010). However, this localisation could not be associated with a specific activity since it was stably present throughout the developmental stages and no deletion analyses were performed (Bartfai et al., 2010). So, early studies on H2A.Z positioning in the metazoan system corroborated yeast studies that claimed H2A.Z was most important in heterochromatic areas of chromatin. However, the majority of studies on H2A.Z confer a crucial role of this histone variant in the control of gene expression in all model organisms, which will be discussed in more detail in the section 1.2. Also, nucleosomes containing H2A.Z can be modified by the posttranslational modificaiton of this histone, as is the case for the canonical histone, discussed in the following section. 1.1.4. Post-translational histone modifications The post-translational modification of histones in the nucleosome has shown to be one of the most important epigenetic marks, affecting chromatin compaction, gene regulation, and lineage determination in multi-cellular organisms (Kouzarides, 2007). The association of nucleosomes with chromatin remodeling complexes and complexes involved in gene expression is often affected by markers created by the post-translational modification of histone proteins (Tarakhovsky, 2010). This results in major effects on protein function and structure of the nucleosome by affecting the ability to fold or by creating a new surface for protein interaction (Figure 1-3) (Tarakhovsky, 2010). The 14 main types of modifications that histones are subjected to are: acetylation, methylation, phosphorylation and ubiquitinylation (Kouzarides, 2007). The abbreviated nomenclature used for identifying histone marks begins with the histone that is modified, followed by the residue, the modification and the number of marks placed on the residue (Kouzarides, 2007). For example, the tri-methylation of histone H3 on lysine 27 is identified as H3K27me3. The integration of acetyl, methyl and phosphorylation marks on the canonical histone as well as their variants creates what can be known as an "epigenetic signature" of different transcriptional states and cell lines (Lee et al., 2010). The crosstalk between these modifications can affect the establishment of these different signatures in the process of differentiation or the development of different cancers, an area of great interest in recent research. Writing Erasing Acetylases, methylases Deacetylases, demethylases. Reading Bromodomain, chromodomain Figure 1-3 : Epigenetic tools The post-translational modification of histones in the nucleosome starts with the "writing" of these marks by enzymes, such as acetylases and methylases. Following these modifications, they can be removed by "erasers" (deacetylases or demethylases) or serve as signals for the binding of proteins to the chromatin template through the presence of domains such as bromo- and chromodomains. Adapted from (Tarakhovsky, 2010) 15 The acetylation of histones was one of the first studied histone modifications, due to the observation that the acetylation of chromatin led to a more relaxed, therefore accessible, structure (Mellor, 2005). The acetylation of lysine residues on histone tails neutralises the positive charge and releases possible interactions with DNA and neighbouring nucleosomes, "opening" the chromatin structure in the area of histone acetylation (Mellor, 2005). However, the change in charge is not the only purpose of histone acetylation, as this modification can also lead to the recruitment of regulatory proteins (or complexes containing regulatory proteins) that possess a bromodomain (Mellor, 2005; Sanchez and Zhou, 2009) (Figure 1-3). Histone acetylation is performed by complexes that contain HAT (Histone Acetyl-Transferase) activity of which there are three main families in mammalian cells, each with various substrates: GNAT (Gcn5-related acteyltransferase); MYST (MOZ, Ybf2p/Sas3p, Sas2p, Tip60) and p300/CBP (CREBbinding protein) (Kouzarides, 2007; Marmorstein, 2001; Sterner and Berger, 2000). All four canonical histones can be multiply acetylated in their N-terminal tails (Kouzarides, 2007). The most common acetyl marks that have been studied to date are H3K9ac, H3K14ac, H3K27ac, and H4K16ac (Lee et al., 2010). In addition to the canonical histones, histone variants can also be modified, adding another dimension to the variantcontaining nucleosome. For example, H2A.Z was shown to be acetylated in yeast and chicken in areas of transcriptional activation and in regions required for the maintenance of genome integrity and heterochromatin boundaries (Babiarz et al., 2006; Bruce et al., 2005; Fan et al., 2002; Keogh et al., 2006; Millar et al., 2006). Histone acetylation is not a permanent modification, and the removal of histone acetylation is associated with decreased gene expression. The action of class I and II HDAC (Histone Deacetylase) and class III Sir-family NAD-dependent enzyme complexes will remove the acetyl marks on histone tails (Boffa et al., 1978; Kouzarides, 2007; Workman and Kingston, 1998). The deacetylation of regions of chromatin can also lead to the susceptibility to the methylation of lysine residues or to the methylation of DNA (Dobosy and Selker, 2001; Rice and Allis, 2001). Both the actions of HATs and HDACs are considered to have multiple substrate specificity, leading to a global effect on chromatin structure. 16 Histone methylation has varied effects on the chromatin state without altering the charge of the histone tail. The effect of the methylation of histone tails varies depending on which residue is modified, how many methyl groups are added, cellular context, other modifications present in the nucleosome and the protein complexes that are recruited to the modified nucleosome. The action of HMT (Histone Methyltransferase) complexes adds methyl groups to lysine and arginine residues, with the mono-, di- or tri-methylation of lysines on H3 and H4 becoming the subject of recent interest: H3K4, H3K9, H3K27, H3K36, H3K79, and H4K20 (Sawan and Herceg, 2010). The three main classes of HMTs are: the SET (Su(var)3-9, Enhancer-of-zeste, Trithorax)-domain family; the nonSET domain enzyme family, and the PRMT family (protein arginine methyltransferase) (Wu and Zhang, 2009). The SET family contains members, of the MLL (Mixed Lineage Leukaemia) group, which are important in the mono-, di-, and tri-methylation of H3K4, an important mark in gene regulation (Ansari and Mandal, 2010). Other members of the SET family, Polycomb (PcG) Repressive complex (PRC) and Trithorax group (trxG), are important in heterochromatin formation by the trimethylation of H3K9me3 and H3K27me3 (Ng et al., 2009; Wu and Zhang, 2009). The heterochromatic protein HPla binds to both H3K9me3 and H3K27me3 via its chromodomain, leading to further DNA compaction (Zeng et al., 2010). Of interest, the PRC and trxG complexes were also identified as important regulators of homeotic (hox) gene expression in Drosophila, and have been shown to be very important in mammalian development and cell identity (Richly et al., 2010; Soshnikova and Duboule, 2009). The interplay between the two complexes on related loci occurs due to the capacity of PRC to bind H3K27me3 and trxG to bind H3K4me3 in the balance between repression and activation of developmental genes, discussed in section 1.2.5 (Cao and Zhang, 2004; Czermin et al., 2002; Egli et al., 2008; Kuzmichev et al., 2002; Muller et al., 2002; Niessen et al., 2009; Richly et al., 2010; Soshnikova and Duboule, 2009). 17 Once considered a non-reversible chromatin mark associated with heterochromatic or repressed regions, the discovery of lysine demethylases (KDM) has shown that this mark is dynamically regulated. To date, there are two main families of KDMs: the KDM1/LSD1 (Lysine specific demethylase) and JmjC (Jumonji C) domain families (Pedersen and Helin, 2010). The JmjC domain family is composed of five different subfamilies: KDM2, KDM3, KDM4, KDM5, KDM6, PHF and JMJD6 (Pedersen and Helin, 2010). The actions of KDMs have been shown to be pivotal in the regulation of differentiation, by altering the balance of histone modification in key gene regulatory areas, resulting in important cell fate decisions. For example, the depletion of members KDM6A (UTX) and KDM6B (JMJD3) of the KDM6 subfamily led to developmental defects in several systems in human and porcine cells, due to the loss of H3K27me3 demethylation on specific genes during the developmental process (Agger et al., 2007; Dai et al., 2010; Gao et al., 2010; Lan et al., 2007; Seenundun et al., 2010). Taken together, studies have shown that although a very important modification, histone methylation has a more specific rather than generalised effect on chromatin architecture within euchromatin. The phosphorylation and ubiquitinylation of histone tails has been noted to some extent, yet remains less characterised when compared to acetylation or methylation. The addition of a phosphate group to serine or threonine residues on histone tails is aided by the action of kinases and can render the histone more sensitive to acetylation (Barratt et al., 1994). All of the core histones are found to be phosphorylated, yet the phosphorylation of H3 at residues S10, S28, and Tl 1 have been the most studied seeing as they are important in cell cycle progression (Clayton and Mahadevan, 2003; Goto et al., 1999; Gurley et al., 1978; Preuss et al., 2003). In addition, the histone variant H2A.X is subject to phosphorylation in response to DNA damage in several model organisms and serves to mark the sites of DNA double-strand breaks (DSB) (Dickey et al., 2009). Ubiquitinylation is a post-translational modification that adds one to several ubiquitin (Ub) proteins to the target protein, which may lead to the degradation of the target protein 18 via the proteasome (Pickart, 2004). Histones H2A and H2B are known to be modified by the addition of Ub in their C-terminal tails (Margueron et al., 2005). There have been some indications in the mammalian system that H2A.Z can be Ub (Chen et al., 2006; Sarcinella et al., 2007). Furthermore, immunoflourescence analysis of H2A.Z and mutant forms localized mono-Ub H2A.Z to the inactive X chromosome in female cells, suggesting that this modification could direct H2A.Z to specific chromatin environments (Sarcinella et al., 2007). In summary, histone phosphorylation and ubiquitinylation serve important roles in affecting histone function and may define different chromatin domains. 1.2. Chromatin architecture and regulatabie gene expression The architecture of chromatin is such that it is generally not conducive to gene expression, or the transcription of genes. It is obvious that not all genes in the eukaryotic genome are expressed at all times, and a large majority of genes are regulatabie in response to the presence (or absence) of extra- and intracellular stimuli (Weake and Workman, 2010). Transcription requires the fine-tuned orchestration of several different players that ultimately all modify the binding or activity of the basal transcription apparatus, known as regulatabie gene expression (Weake and Workman, 2010). The study of chromatin structure genome-wide by ChlP, ChlP-chip, ChlP-seq, and ChlP-PET (ChlP-paired end diTag) has clarified the functioning of regulated gene expression in vivo (Venters and Pugh, 2009). Most importantly, these techniques have permitted us to elucidate the role of regulatory sequences that either activate or repress transcription via their interaction with regulatory factors. In addition to the regulation of the initiation of transcription, the underlying architecture of the structure of the eukaryotic genome, chromatin, plays one of the most important roles in the regulation of expression. 19 1.2.1. RNA Polymerase II transcription of genes If one were to imagine DNA as the simple double helix structure devoid of nucleosomes, the transcription process would be fairly simple. Transcription begins in the crucial 5' region of a gene, the core promoter which consists of the transcription start site, known as + 1 or TSS; the initiator region (Inr), the area that will open to permit transcription of the gene; and occasionally a TATA box, at approximately -25 bp in metazoans, serving as a recognition site for the basal transcription apparatus (Figure 1-4) (Juven-Gershon et al., 2008; Levine and Tjian, 2003; Sandelin et al., 2007). However, for transcription to occuer, genes require the use of up/downstream elements that are controlled by the binding of different regulators, including chromatin remodelling complexes, transcription factors and coactivators and repressors (Figure 1-4) (Juven-Gershon et al., 2008; Levine and Tjian, 2003; Sandelin et al., 2007). Basal transcription in eukaryotes of protein-encoding genes is performed by the preinitiation complex (PIC), composed of the RNA polymerase II holoenzyme complex (RNAPII), general transcription factors and coactivator complexes (Buratowski, 2009; Conaway et al., 2005; Malik and Roeder, 2010). RNAPII is composed of: catalytic subunits that catalyze the addition of ribonucleotides (Rpbl and Rpb2) which also form a channel through which the DNA-RNA hybrid moves during the transcription process (Cramer, 2004a, b; Zhang et al., 1999); proteins with endonuclease activity that are important for "proofreading" activity; and proteins required for the interaction with transcription initiation and elongation coregulators (Malik and Roeder, 2000). The largest subunit of RNAPII, Rpbl, is generally responsible for the initiation of elongation via the phosphorylation of its C-terminal tail (Buratowski, 2009; Reese, 2003). The general transcription factors are major components of the holoenzyme and have roles in recognition of the promoter, initiation and elongation of transcription (Figure 1-4; 20 (Koleske and Young, 1994)). They are designated TFII, for transcription factor for RNAPII, and have multiple roles in promoter recognition (Reese, 2003). The most characterised to date are the TFIID and TFIIH complexes. The general transcription factor complex TFIID is composed of several subunits: TBP (TATA-Binding Protein) which binds to the TATA region distorting the DNA, and the TAFs (TBP-Associated Proteins) which have multiple roles in promoter selectivity in TATA and TATA-less promoters (Chen and Hampsey, 2002). The multiple subunits of TFIIH (Cdk7/cyclin H in humans) contain ATP-dependent helicase activity needed to unwind the DNA template and the kinase activity to phosphorylate RNAPII at serine 2 in the C-terminal domain during transcriptional elongation. Transcription continues following the phosphorylation of RNAPII at serine 5 by the factor positive transcription elongation factor b (p-TEFb) (Dvir et al., 2001; Garriga and Grana, 2004). Although transcription generally does involve these simple steps, the specific regulation of gene expression is a very important process in order to control cellular proliferation, differentiation and response to stimuli in multicellular organisms. So, to this process we add the concerted action of several complexes that bind to multiple regulatory regions of genes and to the core promoter, which serve as modifiers of chromatin and activators or repressors of transcription (Levine and Tjian, 2003). Although basal transcription may occur through the core promoter, the key elements of gene regulation lie in areas surrounding the TSS (proximal regulatory elements), and sometimes several kilobases (kb) from the core promoter (distal regulatory elements) (Levine and Tjian, 2003). 21 Figure 1-4 : Gene promoter structure in regulatable gene expression The representation of a gene promoter and the multiple possible regulatory elements, including proximal (response elements (RE), TATA, INR, +1) and distal elements (enhancers, insulators). Adapted from (Levine and Tjian, 2003) 1.2.2. Transcription factor mediated gene regulation There are numerous fundamental mechanisms in the control of regulatable gene expression. First, within the DNA sequence itself, there are c/s-acting regulatory sequences in areas surrounding the gene: response elements (RE) that permit the binding of specific proteins (transcription factors, or activators); and enhancers that are bound by positive transcriptional regulators and/or negative transcriptional regulators (Figure 1-4; (Villard, 2004; Weake and Workman, 2010)). Both of these regulatory elements can be found proximal or distal to the TSS. The binding of activators to their RE is an essential step in transcription activation (Weake and Workman, 2010). These factors generally have two main domains: a DNAbinding domain (DBD) that includes usually a dimerisation domain that permits the 22 formation of homo- or heterodimers; and an activating domain (AD) that binds to the proteins of the transcriptional machinery (Kumar and Thompson, 1999; Weake and Workman, 2010) Some activators have ligand-binding domains (LBD) that respond to cellular signals such as hormone presence (Kumar and Thompson, 1999). The ensemble of regions bound by one transcription factor in the genome has been recently come to be known as its "cistrome" (Lupien et al., 2008). Activator binding to a RE generally activates transcription by interacting directly or indirectly with the transcription machine (Ptashne, 2005; Weake and Workman, 2010). For example, presence of the hormone estrogen (E2) in mammalian cells will bind the estrogen receptor (ER) transcription factor, permitting their dimerisation, nuclear transport and subsequent interaction with estrogen response elements (ERE) on DNA, resulting in the transcriptional activation of target genes (further detailed in section 1.3) (Beekman et al., 1993; Welboren et al., 2009). Also, regulatory factors often do not act alone, utilizing different types of coregulatory proteins to respond to specific cell signals. Repressors can bind regulatory sequences and prevent the binding of the transcriptional machinery or can also act indirectly by interfering with the action of activators (Beekman et al., 1993; Kumar and Thompson, 1999; Weake and Workman, 2010; Welboren et al., 2009). The activators ERa and p53 notably recruit the help of histone modifiers CBP/p300, PRMT and CARM1 during induction of their target genes (An et al., 2004; Gu et al., 1997; Lill et al., 1997; Metivier et al., 2004; Shang et al., 2000). The action of these regulatory proteins is not restricted to promoter proximal elements, but can also be observed at numerous distal elements. Distal response elements that influence transcription once bound by a trans-acting factor and coregulatory proteins are known as enhancers. These areas are often large in size, from 100 bp up to several kb, and can be located up- or downstream of the TSS in variable positions and orientations with regard to the core promoter (Mitchell and Tjian, 1989; Weake and Workman, 2010). Some coregulator complexes prepare the regulatory areas for the binding of different factors, and help form the bridge between activators and 23 RNAPII, aiding in the formation of the PIC (Malik and Roeder, 2010). These bridges can result in the creation of specific 3-dimensional (3-D) structures, chromatin loops, that affect the accessibility of the transcriptional machinery to the TSS and other promoter elements (Bondarenko et al., 2003). This phenomenon is an area of much interest in recent studies, and in part explains how distal elements will influence transcription of a gene (Bondarenko et al., 2003; Hou et al., 2008; Ling et al., 2006; Splinter et al., 2006). Similar structures are created at insulator regions, which define gene regions and limit the interactions of enhancers with other promoters (Hou et al., 2008). The protein CTCF has been shown by ChIP and chromosome conformation capture (3C) assays to be a master regulator in the creation of insulator regions, of which H2A.Z is an important component (Barski et al., 2007; Fu et al., 2008; Hou et al., 2008; Ling et al., 2006; Splinter et al., 2006). Enhancer function and chromatin looping demonstrates the importance of chromatin structure in the gene regulation process. 1.2.3. Chromatin architecture at regulatory elements It has become widely accepted that main criteria in controlling regulatable gene expression is the modification of the chromatin structure that surrounds the promoter region of a gene. The architecture of a promoter is known as the composition of the DNA-protein complex that surrounds the TSS and regulatory elements (Cairns, 2009). The application of high-resolution genome-wide analyses performed targeting histone modifications and histone variants has provided a "chromatin signature" of enhancers and promoters in human cells (Barski et al., 2007; Fu et al., 2008; Guenther et al., 2007; Jin et al., 2009; Lupien et al., 2008; Mikkelsen et al., 2007; Schones et al., 2008; Sharov and Ko, 2007; Zhou et al., 2010). Generally, there exist three different transcriptional states for a promoter: active, in which the chromatin is organised and modified to be permissive to transcription; repressed, where repressive chromatin marks dominate; and poised, a 24 state in which the promoter can be activated or repressed (Table 1-1; (Sakabe and Nobrega, 2010; Zhou et al., 2010)). Numerous different chromatin modifications will define these states, but this section will explore in more detail the effects on the fate of transcription of one of the most influential histone variants, H2A.Z (1.2.4), and the modification of H3K4 and H3K27 methylation (1.2.5). Table 1-1: Chromatin conformations at different promoter types Different histone modifications define inactive, poised or active promoters, and inactive or active enhancers. Adapted from (Sakabe and Nobrega, 2010). Genomic Element Enrichment of Methylated Histories Active genes (around TSS) H3K4me1 H3K4me2 H3K4me3 (me1, me2, me3 H2AK9ac, H2BK5ac. H3K9ac, H3K18ac, increase from 3' to 5') H3K27ac, H3K36ac H4K91ac Enrichment of Acetylated Histories H3K9me1 H2A.Z H2BK12ac. H2BK20ac, H2BK120ac, H3K4ac. H4K5ac, H4K8ac, H4K12ac and H4K16ac Active genes (transcribed regions) H2BK5me1 (5' end) H3K27me1 (5'end) H4K20Mel (5' end) H3K36me3 (3" end) H2BK12ac, H2BK203C, H2BK120ac, H3K4ac, H4K5ac, H4K8ac, H4K12ac and H4K16ac Enhancers H3K4me1 (H3K4me3)* H2A.Z H3K27ac Repressed genes H3K27me2, H3K27me3 H3K79me3 H3K9me2, H3K9me3 (weak correlation) Bivalent domains'1 H3K4me3 'activating' H3K27me3 'repressive' 1.2.4. Mechanisms of transcriptional activation and roles of H2A.Z in gene expression Active promoters are generally defined as having an open promoter conformation, defined by "available" regulatory sites (TSS, RE, or enhancers). This availability is achieved by the epigenetic signature that is present at these promoters: highly acetylated histone tails, and the presence of H3K4me3, H3.3 and H2A.Z in nucleosomes surrounding the TSS (Azuara et al., 2006; Barski et al., 2007; Dreijerink et al., 2006; Fu 25 et al., 2008; Guenther et al., 2007; Jin et al., 2009; Lupien et al., 2008; Mikkelsen et al., 2007; Schones et al., 2008; Sharov and Ko, 2007; Zhang et al., 2005b; Zhou et al., 2010). First, transcriptionally active areas of chromatin are generally known to be hyperacetylated and enriched in H3K4 methylation (Mellor, 2005; Zhou et al., 2010). Interestingly, several coactivators of transcription are actually HAT-containing complexes that effect transcription, and transcriptional activators have been shown to interact with and recruit chromatin remodelling complexes to promoters, inducing either the displacement or modification of nucleosomes (Szutorisz et al., 2005). For example, the p300/CBP complex is a coactivator of transcription that interacts with the basal transcriptional machinery and several known transcription factors (Kalkhoven, 2004), yet also contains HAT activity that targets K12 and K15 of H2B, K14 and K18 of H3 and K5 and K8 of H4 (Schiltz et al., 1999). Notably, the p300/CBP complex colocalises with H3K4 methylation, and specific methylation of H3K4 has rapidly become one of the most recognised determinants of gene activity (Azuara et al., 2006; Barski et al., 2007; Dreijerink et al., 2006; Fu et al., 2008; Guenther et al., 2007; Jin et al., 2009; Lupien et al., 2008; Mikkelsen et al., 2007; Schones et al., 2008; Sharov and Ko, 2007; Zhang et al., 2005b; Zhou et al., 2010). More specifically, active promoters are defined by H3K4me3 in mammalian cells, where enhancers exhibit H3K4mel/2, H3K27ac and p300/CBP (Azuara et al., 2006; Barski et al., 2007; Dreijerink et al., 2006; Fu et al., 2008; Guenther et al., 2007; Jin et al., 2009; Lupien et al., 2008; Mikkelsen et al., 2007; Schones et al., 2008; Sharov and Ko, 2007; Zhang et al., 2005b; Zhou et al., 2010). In addition to these histone modifications, the histone variant H2A.Z has generally been shown to be very important in transcriptional regulation, and several lines of evidence suggest its incorporation in chromatin promotes an active state. Genome-wide analyses in yeast shed new light on the positioning of H2A.Z and its role in gene activation in this model system. H2A.Z was mainly present at the 5' ends of genes genome-wide, in the promoter regions in the nucleosomes that border the 26 nucleosome-free region around the TSS (Guillemette et al., 2005; Li et al., 2005; Millar et al., 2006; Raisner et al., 2005; Segal et al., 2006; Zhang et al., 2005a), as well as several replication origins (Dhillon et al., 2006; Guillemette et al., 2005). Early studies in yeast aimed to clarify the role of H2A.Z in promoting transcriptional activity, showing that H2A.Z is present in chromatin at the PH05, GAL1, and PUR5 promoters in uninduced conditions, and its presence negatively correlates with the activation state of these genes (Adam et al., 2001; Larochelle and Gaudreau, 2003; Santisteban et al., 2000). Although seemingly counterintuitive, the theory that arose from these studies was that H2A.Z is important in the poising of promoters for gene activation, because the htzl knockout strain exhibits defects in the transcriptional activation of these genes (Adam et al., 2001; Larochelle and Gaudreau, 2003; Santisteban et al., 2000), as well as the cellcycle-regulated genes CLN5 and CLB2 (Dhillon et al., 2006). An inverse correlation between H2A.Z presence and gene transcription was found in the majority of these studies (Guillemette et al., 2005; Li et al., 2005; Millar et al., 2006; Zhang et al., 2005a) and in follow-up studies that verified H2A.Z presence during specific gene induction (Zanton and Pugh, 2006), drawing a parallel with results previously seen in model gene expression analyses. The prevailing inference of these studies is that H2A.Z presence at the specific locations in promoters could create a transcriptionally poised state in yeast cells. The majority of the genomic analyses of H2A.Z in metazoan cells have shown the association of H2A.Z with active or poised promoters. H2A.Z was first associated with transcriptionally active areas of the nuclei in T. thermophila and Drosophila (Allis et al., 1980; Leach et al., 2000; Stargell et al., 1993). H2A.Z is associated genome-wide in Caenorhabditis elegans, Drosophila, and human cells with promoters that have wellpositioned nucleosomes that exhibit low occupancy close to the TSS and a wellestablished "nucleosome-free region", shown by ChlP-chip and ChlP-seq (Mavrich et al., 2008b; Schones et al., 2008; Tirosh and Barkai, 2008; Whittle et al., 2008). The "nucleosome-free region" of active promoters originally proposed in yeast suggests that 27 two well-positioned nucleosomes around the TSS in genes are occupied by H2A.Z (Guillemette et al., 2005; Raisner et al., 2005; Yuan et al., 2005). This model has recently been contested in metazoan cells by the discovery of highly unstable H2A.Z/H3.3 nucleosomes (Jin et al., 2009; Le et al., 2010). It seems that the transient presence of this type of nucleosome at the TSS renders serves to inhibit the occupation of these areas by more stable nucleosomes (Jin et al., 2009; Le et al., 2010). Thus, the promoter is available for transcription due to the increased capacity of activators to remove these types of nucleosomes (Jin et al., 2009; Le et al., 2010). So, it would seem that although the TSS may appear to be nucleosome-free, it may just be a technical difficulty in the detection of such transient nucleosomes. Therefore, it is possible that H2A.Z positions nucleosomes around the TSS and RE, which are rapidly evicted upon activation. In mammalian euchromatin areas genomewide, H2A.Z can be randomly deposited in transcribed gene areas in the absence of gene activity, but RNAPII transcriptional activation and elongation results in the preferential localization of H2A.Z to promoter areas and its depletion within the transcribed gene (Barski et al., 2007; Hardy et al., 2009). High resolution mononucleosome positioning assays show that the presence of H2A.Z in the ERa target gene TFF1 stabilizes the positions of proximal promoter nucleosomes, allowing ideal placement of nucleosomes for the binding of the transcriptional machinery (Gevry et al., 2009), an idea that was first brought forward in yeast (Guillemette et al., 2005). Another interesting study has observed that H2A.Z positioning changes during the progression of mitosis, present at TSS-proximal nucleosomes when genes are active prior to mitosis and shifting to cover the TSS to correlate with gene silencing during the mitotic process (Kelly et al., 2010). The importance of H2A.Z in the development of multicellular organisms could depend on its role in establishing a specific promoter structure for tissue-specific gene regulation by defining insulator and enhancer regions. In support of this, a high-resolution analysis of nucleosome occupancy and composition at a model gene of the class I major 28 histocompatibility complex family in kidney, spleen, and brain tissue from the mouse revealed that H2A.Z is present at TSS-associated nucleosomes, at different levels in each tissue (Kotekar et al., 2008). In addition, H2A.Z has been located at distal DNase I hypersensitive regulatory areas, a characteristic indicative of enhancer regions, and its presence at these areas correlates with transcriptional activity (Barski et al., 2007; Gevry et al., 2009; John et al., 2008). ChIP analysis of several glucocorticoid receptor (GR)responsive promoters revealed that H2A.Z was present at GR-responsive sites including enhancers, with a dramatic exchange occurring following activation of GR by ligand binding (John et al., 2008). John and colleagues (2008) propose an intriguing model in which cell-specific positioning of H2A.Z would determine the gene expression program, a model first introduced by work performed on the p53-dependent positioning of H2A.Z at the p21WAFl/C!Pl promoter (Gevry et al., 2007). In mammalian cells the regulation of several gene promoters by context-specific activators p53 and ERa depends on the p400/Tip60 complex and the deposition of H2A.Z (Chan, 2005; Gevry et al., 2007; Gevry et al., 2009; Legube et al., 2004). Also, H2A.Z is present at ERa-responsive promoters and enhancers, and is required for ERa gene regulation in breast cancer cells (Gevry et al., 2009). Finally, a systematic annotation of different gene regulation states has recently clarified the specific localization of numerous histone modifications in the human genome by analyzing the largest data set obtained by ChlP-seq, and associated H2A.Z with active intergenic regions, which include enhancers (Barski et al., 2007; Ernst and Kellis, 2010; Wang et al., 2008). Taken together, H2A.Z positioning in proximal and distal regulatory elements can contribute to the positive regulation of transcriptional activity, depending on the cellular context. 1.2.5. Gene silencing and the resolution of poised chromatin states Repressive mechanisms implicate the higher order folding of DNA achieved by a high nucleosome density, H3K9me3 and H3K27me3 (Zhou et al., 2010). In addition, the 29 binding of HPl (heterochromatic protein 1) to H3K9me3 encourages the compaction of the chromatin fibre (Bannister et al., 2001; Lachner et al., 2001). Also, the incorporation of the histone variant macroH2A into chromatin will often lead to repression of transcription (Angelov et al., 2003). The establishment of the H3K27me3 repressive mark occurs through polycomb-mediated repression. The polycomb repressive complex-2 (PRC2) binds nucleosomes and trimethylates H3K27 through the enzymatic activity of HMT enhancer of zeste 2 (EZH2), leads to the recruitment of PRC1 and silencing of target genes (Figure 1-5; (Cao and Zhang, 2004; Czermin et al., 2002; Egli et al., 2008; Kuzmichev et al., 2002; Muller et al., 2002; Niessen et al., 2009)). Interestingly, the binding of PRC1 alone inhibits ATPdependent nucleosome remodelling on chromatin templates in vitro (Shao et al., 1999). The activity of PRC2 is defined by EZH2, whose activity and affinity for its substrate is dependent on the PRC2 subunit Su(z)-12 (Niessen et al., 2009). However, the activity and affinity of EZH2 for its substrate can be inhibited by the post-translational phosphorylation of serine 21 by the PI3K/Akt (phosphatidyl-inositol 3 kinase/Akt) pathway (Figure 1-5) (Niessen et al., 2009). Originally associated only with heterochromatin, it is now known that H3K27me3 also maps to the poised but silent promoters of many developmentally important genes in euchromatic regions (Agger et al., 2007; Cao and Zhang, 2004; Lan et al., 2007; Muegge et al., 2008). In particular, the tri-methylation of H3K27 is implicated in mammalian X chromosome inactivation, germline development, cell-cycle regulation and cancer (Agger et al., 2007; Cao and Zhang, 2004; Lan et al., 2007) and is a marker of repressed or inactive chromatin (Craig, 2005; Sims et al., 2003). PRC-mediated repression leads to the formation of a repressive 3D chromatin structure at the GATA4 gene (Tiwari et al., 2008). Also, EZH2-dependent chromatin looping controls the transcription of the INK4a and INK4b loci during human progenitor cell differentiation and cellular senescence (Kheradmand Kia et al., 2009). Of note, recent studies have closely linked the increase in 30 the expression of JMJD3 with the removal of H3K27me3 and subsequent activation of INK4a (Agger et al., 2009; Barradas et al., 2009). The KDMs JMJD3 and UTX of the KDM6 family contain a well-conserved JmjC domain in their C-terminal regions which catalyzes the transition of H3K27me3 and H3K27me2 to H3K27mel, changing the chromatin state from a repressive to an active conformation during developmental processes (Agger et al., 2007; De Santa et al., 2007; Swigut and Wysocka, 2007; Xiang et al., 2007). In summary, repressive chromatin structure at promoters is defined by the presence of certain histone modifications, namely H3K27me3, but can be altered to permit transcriptional activation by the loss of H3K27me3 (Tiwari et al., 2008). Interestingly, H3K27me3 colocalises with H3K4me3 at the promoters and H3K4mel at the enhancers of silent developmental^ related genes in mouse embryos (Figure 1-5) (Azuara et al., 2006; Bernstein et al., 2006; Ku et al., 2008; Mikkelsen et al., 2007; Muegge et al., 2008). These so-called "bivalent", or poised, genes may vary in composition but are generally characterised by the concomitant presence of H3K27me3, H3K4me3 and RNAPII at promoters, which is anchored to the promoter region by PRC1mediated ubiquitination of H2A by subunits RING 1A and RING IB (H2AK119ubl) (Figure 1-5) (Stock et al., 2007). The resolution of promoter bivalency rests in the decision between the H3K27me3 and H3K4me3 epigenetic marks and the recent identification of KDMs clarified the gene regulation patterns in determining cell identity and gene regulatory decisions. The trithorax group proteins MLL1-3 maintain gene activity by methylating H3K4, and this complex interacts with UTX (Lee et al., 2007a; Smith et al., 2008). Conversely, PRC2 interacts with KDM5A (RBP2), a H3K4me2/3 demethylase (Christensen et al., 2007; Pasini et al., 2008). The interplay between these histone-modifying complexes demonstrates the precise control of gene regulation by the balance of epigenetic modifications on gene promoters. The specificity of the recruitment of these complexes remains in the hands of lineagedeterminant transcription factors and coactivators. During the developmental process, the 31 T-box family activator T-bet interacts with an H3K4 methyltransferase complex and JMJD3, regulating T-bet-dependent target gene expression (Lewis et al., 2007; Miller et al., 2010; Miller and Weinmann, 2009, 2010). However, this phenomenon is not necessarily reserved for developmental processes. For example, the hormone-dependent nuclear receptor ERa physically interacts with MLL2 during E2-mediated gene activation, and MLL2 is required for the activation of certain ERa target genes (Dreijerink et al., 2006; Mo et al., 2006). It is also possible that the role of the MLL complex at poised promoters is not only to methylate H3K4me3, but to recruit HATs (Pasini et al., 2008; Pasini et al., 2010; Tie et al., 2009). Recently a lot of attention has been placed on H3K27ac, which has been shown to define enhancer regions (Creyghton et al., 2010; Gatta and Mantovani, 2010; Pasini et al., 2010; Rada-Iglesias et al., 2010; Schwartz et al., 2010; Tie et al., 2009). In human embryonic stem cells (hESCs), H3K27me3 and H3K27ac are inversely correlated at enhancer regions, where H3K27me3 defines poised enhancers, and H3K27ac are predictive of active enhancers (Creyghton et al., 2010; Rada-Iglesias et al., 2010). The loss of PRC2 and H3K27me3 in Drosophila and mouse cells increases p300/CBP-mediated H3K27 acetylation genome-wide, suggesting that while H3K27me3 antagonises this acetylation, H3K27ac replaces the methyl mark during gene activation (Pasini et al., 2010; Tie et al., 2009). These studies also put forward that these two histone modifications present a greater predictive potential for gene activity than H3K4 methylation status. Therefore, the coordinated control of antagonising epigenetic marks H3K4mel/H3K27ac and H3K27me3 via the recruitment of histone modifying complexes by transcription factors significantly affects gene expression in processes such as development, cell cycle regulation and other hormone stimulated gene activities. 32 Poised promoters PRC2 PRC1 PHC „ H3K27m.2 -«. H3IC27lT»3 + _ | ^ ^ H3K27m.3 w repression HMKmUM Derepression AKT H3K27me2 - * H3K27me3 H3K27me2 - X » H3K27me3 OR 41 Mettiyfgroups • Ac«y< groups Figure 1-5 : Polycomb-mediated repression and model of cell fate decision on poised promoters Poised promoters are defined by the concomitant presence of H3K4me3, H3K27me3, RNAPII and H2AK119Ubl. Derepression can occur through the phosphorylation of EZH2 by the PI3K/Akt pathway or by the demethylation of H3K27me3 by JmjC-domain containing KDMs (JMJD3 or UTX). Adapted from (Pasini et al., 2008) and (Niessen et al., 2009). 33 1.3. Nuclear receptor mediated transcription Hormone-dependent transcription is one of the most commonly used types of gene regulation systems in multicellular organisms, dependent on the activity of nuclear receptors (NR), a super family of ligand-dependent transcription factors. NR structure is generalised across the large family, each domain having a specific function (Figure 1-6A). The A/B domain, or the N-terminal regulatory domain, contains the ligandindependent activation function 1 (AF-1), responsible for basal transcriptional activation. The C domain contains the DNA-binding domain (DBD). The D domain is defined by the hinge region, a flexible region that connects the DBD and LBD of the E/F domain. The E/F also contains dimerisation region and the ligand-dependent activation function 2 (AF-2), which synergises with AF-1 for hormone-dependent gene activation (Kumar and Thompson, 1999). NRs are defined as transcription factors that bind to regulatory elements on DNA to act as activators of transcription by recruiting coregulatory complexes to the promoter and enhancer elements of hormone-responsive genes (Mangelsdorf et al., 1995). There are different subfamilies of NR, often associated with a different mechanism of action: Type I (steroid receptors), which dimerise and translocate to the nucleus upon ligand binding to bind hormone response elements (HRE) and induce transcription; Type II (retinoid X receptor (RXR) heterodimers), which are located in the nucleus and complexed with corepressors prior to ligand binding; Type III (dimeric orphan receptors), the orphan receptors whom have unknown ligands and bind inverted repeat HREs, but otherwise act similarly to Type I; and Type IV (monomeric orphan receptors), which are known to bind DNA as either monomers or dimers (Mangelsdorf et al., 1995). In general, once bound by their ligand, NR undergo a conformational change that leads to either DNA binding (Type I) or release of corepressors (Type II) (Biddie et al., 2010). The different types of NR can be further divided into 6 subfamilies according to their sequence homologies: 34 Thyroid hormone receptor-1 ike; RXR-like; ER-like; Nerve Growth Factor IB-like; Steroidogenic Factor-like; Germ Cell Nuclear Factor-like; and miscellaneous (Nuclear Receptor Nomenclature Committee, 1999; Germain et al., 2006). Of the NR subfamilies, the ER-like NR are of particular interest since estrogen (E2)dependent physiological processes regulate many key pathways in growth and development of the reproductive tract, cardiovascular system and central nervous system in females (Katzenellenbogen, 1996). As a result, modulation of E2 signaling has varying effects in females, possibly leading to pathophysiologies such as breast cancer (Anderson, 2002). Although all of the NR in the ER-like subfamily respond to E2 stimulation, the most studied actions of E2 are those accomplished through its diffusion through the cell membrane and binding to its receptors ERa and ERp (Green et al., 1986; Greene et al., 1986; Kumar et al., 1987). ERa and ERp are structurally very similar and bind with comparable affinity to their ligands, leading to the formation of homodimers, and less frequently ERa/ERp heterodimers (Cowley et al., 1997; Kuiper et al., 1997). The greatest differences between the two receptors lie in the resulting physiological responses of their actions, illustrated by the opposing phenotypes in mouse knockout studies (Krege et al., 1998). ERa is responsable for the E2-dependent proliferative effects in the development of the reproductive tract and mammary gland. However, ERp knockout mice demonstrate hyperplasia, and the overexpression of ERp in breast and colon cancer cells inhibits cancer cell proliferation and tumor formation in mouse xenograft models, suggesting that ERp inhibits cellular proliferation (Hartman et al., 2006; Hartman et al., 2009; Paruthiyil et al., 2004; Strom et al., 2004). These opposing physiological responses in certain tissues suggest different gene targets of the receptors in response to E2 stimulation, and the tissue-specific response may depend on the balance of ERa/ERP in the cell (Fox et al., 2008; Pearce and Jordan, 2004). Thus, an increase in the ERa response and/or expression of its target genes leads to the uncontrolled proliferation observed in many different types of breast cancer cell lines. 35 A) FUNCTIONS A D NH2' B) Ligand binding Dimerisation Activation domain AF2 Activation DNA binding domain AF1 Dimerisation ERE: E/F -COOH - * spacer •*- AGGTCA (N)3 TGACCT C) Figure 1-6 : NR structure and different pathways of gene regulation by ERa A) Nuclear receptor structure is conserved throughout the whole superfamily, defined by the A/B N-terminal domain, the DBD domain in C, the hinge domain in D, and the LBD, dimerisation and AF-2 domain present in E/F. (B) The consensus sequence upon which ERs bind. (C) E2 stimulation leads to 3 different ERa-related outcomes: (1) the classical genomic pathway where ERa binds to ERE; (2) the non-classical pathways genomic pathway where ERa interacts with other transcription factors (TF) bound to their binding site (TFBS); or (3) the non-classical non-genomic pathway in which membrane-bound ERa activates protein kinase signaling cascades. Adapted from (Bjornstrom and Sjoberg, 2005; Kumar and Thompson, 1999, Ruff et al., 2000). 36 1.3.1. ERa-regulated gene expression The exposure of an ERa-positive cell to E2 results in the modification of ERa-dependent gene regulation. ERa is an activator that affects many different pathways in mammalian cells in ways that are typical of a ligand-dependent activator by the classical genomic pathway. However, ERa can act on gene expression by various indirect mechanisms through what is known as the non-classical pathway (both genomic and non-genomic; Figure 1-6) (Welboren et al., 2009). 1.3.1.1. The ERa genomic pathway In the classical genomic pathway, E2 binding to the LBD leads to dimerisation and association of the receptor to the palindromic ERE (Figure 1-6; (Ruff et al., 2000; Welboren et al., 2009)). More specifically, to promote transcriptional activity, ligand binding leads to a conformational change in the ERa E/F region allowing the association with EREs in promoter or enhancer regions and the formation of an AF-2 coactivator binding site (Bjornstrom and Sjoberg, 2005). The binding of an antagonist (for example, tamoxifen or fulvestrant) to ERa disrupts the AF-2 region and does not permit coactivator recruitment, although DNA-binding is not necessarily compromised (Brzozowski et al., 1997; Pike et al., 2000a; Pike et al., 2000b). Coactivator recruitment occurs through direct interaction of the receptor with an LXXLL motif present in the coactivator, and known coactivors include the steroid receptor coactivator 1 (SRC-1), SRC-2 and SRC-3 (also known as amplified in breast cancer 1 (AIB-1)) (Pearce and Jordan, 2004). Coactivator function is essential in ERa-mediated gene regulation at proximal and distal regulatory elements. Recuitment dynamics at ERa model gene trefoil factor 1 (TFF1) revealed the timely deposition of cofactors in cycles, such as CRCs (CBP/p300, 37 p400/Tip60, Swi/Snf), and members of the PIC, RNAPII, TBP, and TFI1B (Gevry et al., 2009; Metivier et al., 2003; Shang et al., 2000) during the activation cycle. The activation cycle of this gene was notably controlled in part by the p400-dependent deposition of H2A.Z in promoter-proximal areas and the subsequent stabilization of proximal nucleosomes (Gevry et al., 2009). Genome-wide, H2A.Z colocalizes to ERabinding sites, supporting the observations at TFF1 (Gevry et al., 2009). The transcriptional regulation of an important majority of ERa-regulated genes is dependent on the binding of the transcription factor FoxAl, thought to be a pioneer factor by contributing to the recruitment of ERa and gene regulation (Carroll et al., 2005; Joseph et al., 2010). However, the p400-dependent deposition of H2A.Z is essential in the recruitment of FoxAl to ERa-responsive enhancers, whereas the depletion of FoxAl did not affect the targeting of H2A.Z to chromatin (Gevry et al., 2009). The creation of a more permissive chromatin structure at ERa target genes is also achieved by the interaction of ERa with multiple histone modifying complexes during gene activation. Components of the SWI/SNF complex Brahma (BRM) and Brahma related gene-1 (BRG-1) are also recruited to ERa target genes upon hormone stimulation, and serve to create a more open chromatin conformation (Belandia et al., 2002; DiRenzo et al., 2000; John et al., 2008). Contributing to this open conformation is the acetylation of histones by the p300/CBP complex, enhancing ERa activity when coupled with pi60 (SRC-3) family binding (Smith et al., 1996). In addition to histone acetylation, ERa interacts physically with MLL2, a H3K4 methyltransferase, and this interaction is required for the activation of TFF1, HOXC13 and CTSD (Ansari et al., 2009; Ansari and Mandal, 2010; Dreijerink et al., 2006; Mo et al., 2006). Interestingly, although ChlP-seq analysis did not reveal any global decrease in H3K9me3 and H3K27me3 repressive marks following E2 exposure (Joseph et al., 2010), it is known that the repressive H3K9me mark is removed by LSD1 at certain loci during ERa-regulated gene expression (Garcia-Bassets et al., 2007; Perillo et al., 2008). This suggests that ERa-mediated gene 38 expression also requires the activity of KDMs to remove repressive marks, in addition to its role in promoting an active chromatin marks. In order to define the genome-wide effects of ERa, binding sites were analyzed genomewide by ChlP-chip, ChlP-seq, and ChlP-PET, revealing that, in addition to it role at promoter-proximal elements, a large percentage of ERa binding sites are at distal enhancer regions (Carroll et al., 2005; Carroll et al., 2006; Hurtado et al., 2008; Krum et al., 2008; Lin et al., 2007a; Lin et al., 2007b; Lupien et al., 2008). Notably, many predicted EREs are not occupied by ERa in vivo, which suggests the requirement of external influences on ERa association to DNA (Carroll et al., 2006; Hurtado et al., 2008; Lin et al., 2007a; Welboren et al., 2009). Recent genome-wide analyses have defined that the optimum prediction of ER binding at any specific site in MCF7 cells is the pre-ligand occupancy of H3K4mel/2 and the factor FoxAl, and an open chromatin configuration defined by activation-related histone marks and RNAPII at the future stie of ER binding (Joseph et al., 2010; Lupien et al., 2008). Taken together, large-scale analysis of ERa binding sites have answered many questions, but may not provide all of the answers on ERa-dependent gene regulation during specific cellular processes. For example, gene regulation by enhancer elements can include the formation of chromatin loops, and distal enhancer EREs associate with proximal promoter regions to enhance gene expression ERa-regulated model genes TFF1 and GREB1, as well as proliferation-associated genes CCND1 and BCL2 (Engel and Tanimoto, 2000; Pan et al., 2008; Perillo et al., 2008; Theo Sijtse Palstra, 2009). RNAPII was also important in the formation of such loops, given that they interact with the transcription start sites (TSSs) (Fullwood et al., 2009; Pan et al., 2008). However, many questions remain on what is required to create these loops, and how ERa may participate in the destruction of repressive loops. Overall, in the presence of it ligand, ERa associates genome-wide with EREs present in enhancer and promoter areas, creating a modified 3D chromatin structure that is permissive to transcription. 39 1.3.1.2. Non-classical ERa pathways Interestingly, genome-wide expression profiling and binding site analyses have shown that many ERa-regulated genes do not contain ERE-like sequences (O'Lone et al., 2004). This can be explained by the use of two non-classical pathways: ERa binding gene regulatory regions indirectly through its interaction with other transcription factors (genomic); or membrane-bound ERa can rapidly affect cellular response by activating protein kinase signaling cascades (non-genomic) (Bjornstrom and Sjoberg, 2005). In the genomic non-classical pathways, E2 stimulation of genes that do not contain EREs, by interaction with other transcription factors such as AP-1 and SP1 (Levin, 2005). Membrane-associated ERa can participate in rapid cellular responses via the activation of cytoplasmic signaling cascades (Figure 1-6) (Kelly and Levin, 2001; Razandi et al., 1999). E2 stimulation rapidly activates the Src-mitogen-activated protein kinase (MAPK) signaling cascade in breast cancer cells, contributing to proliferation (Song et al., 2002). In addition, adapter proteins have been shown to link membrane-bound ERa with Src and stimulate Src-dependent responses (Edwards and Boonyaratanakornkit, 2003). Also, membrane-associated ERa has been associated with phosphotidylinositol-3 kinase (PI3K)/Akt during gene activation (Ahmad et al., 1999; Campbell et al., 2001; Klotz et al., 2002; Marquez and Pietras, 2001; Martin et al., 2000). The PI3K/Akt pathway is responsible for the mediation of gene regulation through the eventual phosphorylation of transcription factors (Castaneda et al., 2010). ERa is known to be subject to Akt-mediated phosphorylation, which decreases its transcriptional activity, possibly the result of a negative feedback loop to control E2-dependent responses, possibly explaining the decrease in binding of ERa genome-wide in the presence of Akt overexpression (Bhat-Nakshatri et al., 2008; Park et al., 2008; Sun et al., 2001). Interestingly, the action of PI3K/Akt can increase ERa transcriptional activity in the absence of E2, suggesting a role in breast cancer development and resistance to therapy 40 (Campbell et al., 2001; Pietras and Marquez-Garban, 2007). The PI3K/Akt pathway is also closely linked to breast cancer in that it is activated by the epithelial growth factor receptor (EGFR) family member HER2, whose overexpression in breast cancers leads to constitutive activation of these pathways (Lehnes et al., 2007; Stoica et al., 2005). 1.3.2. ERa-dependent breast cancer and anti-estrogen resistance The general definition of a cancerous cell is a cell that has become insensitive to various signals in cell cycle causing continued, uncontrolled proliferation due to an accumulation of multiple mutagenic events (Hanahan and Weinberg, 2000). The majority of cancers are caused by the overexpression or mutation of genes that affect the regulation of the cell cycle, known as oncogenes or tumour suppressors respectively (Hanahan and Weinberg, 2000). E2 and ERa play a well characterized role in cellular proliferation, so naturally activation of ERa-regulated pathways in conjunction with other mutations of tumor suppressors or oncogenes will lead to breast cancer progression. ERa regulates genes that are important in proliferation and cancer progression: cell cycle entry genes (CCNDl, E2F target genes), anti-apoptotic genes (BCL2, FasL), and genes involved in cell migration (TFF1) (Cooper and Foster, 2009; Ding et al., 2006; Ding and Kleer, 2006; Jones, 2007; Seligson et al., 2005). Also, the modification of ERa coactivators are typical in breast cancer cells and have shown to be important prognostic factors in the severity of breast cancers. SRC-3 is a known ERa coactivator that is amplified in breast cancer, leading to cancer progression and poor prognosis when co-expressed with HER2 (Gojis et al., 2010; Kuang et al., 2004; Osborne et al., 2003). Also, the expression of histone variant H2A.Z, associated genome-wide with ERa binding, is upregulated by the E2-mediated binding of the transcription factor Myc in its promoter region, and correlates with decreased survival in breast cancer patients (Hua et al., 2008). 41 Despite being an important inducer of cellular proliferation, ERa presence in breast cancers is often prognostic of an increased survival rate (Badve and Nakshatri, 2009), in part due to the development of antiestrogens (AE), synthetic molecules that compete with E2 for binding to its ERa, that have proved to be a successful treatment in ERa-positive breast cancers (Doisneau-Sixou et al., 2003; Normanno et al., 2005). While AE (for example, tamoxifen (TAM) or fulvestrant (ICI182780) have proven to be beneficial to a large number of patients, resistance to these drugs is a major problem in the treatment of breast cancer (Normanno et al., 2005; Riggins et al., 2007). Interestingly, patients can exhibit resistance in response to the initial treatment, or can develop resistance after prolonged exposure to AE (Badia et al., 2007). Both types of AE-resistant breast cancers show a deregulation in their ERa gene expression program, resulting in E2-independent proliferation (Badia et al., 2007; Naughton et al., 2007; Normanno et al., 2005; Riggins et al., 2007; Sommer and Fuqua, 2001). EGFR and HER2 are overexpressed in a wide variety of tumors, leading to the uncontrolled activation of these receptors (Kumar et al., 1996). In addition, ERft status and HER2 expression levels are inversely correlated in breast cancer aggressivity, with HER2 overexpression observed in approximately 30% of breast cancers, mainly those with poor prognosis and overall survival (Shou et al., 2004). In particular, it has been found associated with increased metastatic potential and resistance to chemotherapeutic agents (Shou et al., 2004). Activated HER2 will activate the PI3K/Akt pathway, known to promote non-classical non-genomic ERa regulated cellular responses (Ahmad et al., 1999; Lehnes et al., 2007; Stoica et al., 2003a; Stoica et al., 2003b; Stoica et al., 2005). Of note, the PI3K/Akt pathway is linked to H3K27 methylation by the post-translational modification of EZH2 (section 1.2.5). Several studies suggest that EZH2 is a promising prognostic biomarker in breast cancer (Collect et al. 2006; Raaphorst et al. 2003; Buchmann et al. 2006), showing a strong correlation with a more aggressive ER-negative breast cancer subtype and breast cancer invasion (Cao et al., 2008; Gonzalez et al., 2009). However, breast cancer patients with low expression of H3K27me3 had significantly 42 shorter overall survival time when compared with those with high H3K27me3 expression (Wei et al., 2008). Also, the H3K27 demethylase JMJD3 has been shown to be upregulated in hormone-dependent breast cancer (Xiang et al., 2007). The specificity in the recruitment of HMT and KDM to certain genes and the precise regulation of transcriptional programs in different cell types may provide an explanation for these seemingly contradictory findings. All in all, the link between ERa gene regulation, chromatin remodelling and the development of breast cancer is strong. Taken together, the deregulation of E2-responsive pathways in ERa-dependent breast cancer and the acquisition of AE resistance may be due to the accumulation of errors in ERa classical and non-classical pathways, altering the epigenetic signature of target genes. 43 1.4. Research project and objectives The chromatin environment surrounding gene regulatory areas will significantly influence target gene expression, and this so-called "epigenetic signature" is orchestrated by the interplay between cellular response specific transcription factors and coactivators. It is now widely accepted that the epigenetic state of a cell will significantly influence the cellular outcome, as well as its transformation potential. ERa is a key regulator of normal breast development and its pathways are drastically affected in breast cancer. In addition, many studies have shown the E2-independent activation of these pathways in the development of AE resistance. An essential chromatin modification in ERa target gene expression is H2A.Z deposition (Gevry et al., 2009). Interestingly, several studies have provided evidence that H2A.Z may be implicated in carcinogenesis. Studies in yeast have shown that the double mutation of H2A.Z and genes involved in replication and S phase checkpoint control confers severe growth defects in these strains and the simple deletion of H2A.Z renders yeast cells hypersensitive to cell cycle arrest, leading to a delay in the start of the cell cycle (Dhillon et al., 2006). In addition, specific knockdown of H2A.Z expression in p53-dependent breast cancer cells promotes an increase in p21WAFl/CIPl expression, thus the controlled cell cycle arrest by cellular senescence, suggesting an inhibitory role of H2A.Z in cell-cycle arrest (Gevry et al., 2007). The p21 and pl6 proteins are cell-cycle inhibitors that, through their capacity to bind and inactivate several cyclin-CdK complexes, will stop progression through to the next phase of the cell cycle, typically in Gl (Zhang, 2007). Chan et al. (2005) revealed that the p400 subunit of the p400/Tip60 complex negatively affects the induction of the senescence pathway by decreasing p21WAFl/CIPl expression via its localization at p53 binding sites in the p21WAFl/CIPl promoter (Chan, 2005). The precise deposition of H2A.Z at the distal p53-binding site by the p400 complex accounts for the adverse effects of p400 on the senescence response 44 explained by Chan et al. (Chan, 2005; Gevry et al., 2007). This repressive characteristic of H2A.Z presence in chromatin is contrary to many findings concerning the histone variant, yet demonstrates that the specific location of H2A.Z in gene regulatory regions yields different effects. Of note, the overexpression of H2A.Z has been observed in colorectal cancers, undifferentiated cancers, and breast metastatic cancer cells, but not in normal cells (Dunican et al., 2002; Hua et al., 2008; Rhodes et al., 2004; Zucchi et al., 2004). We thus hypothesized that the histone variant H2A.Z interacts with proteins at the chromatin level in order to promote cellular proliferation and transcriptional activation in mammalian cells, and the deregulation of the expression of H2A.Z could lead to possible oncogenic effects in the cell. Our hypotheses are outlined in the second chapter of this thesis, in a published review manuscript entitled "Regulation of gene expression and cellular proliferation by histone H2A.Z" (Svotelis et al., 2009). We aimed to verify if the exogenous overexpression of H2A.Z in breast cancer ceils would promote increased proliferation. The second manuscript presented in this thesis in Chapter III is entitled "H2A.Z overexpression promotes cellular proliferation of breast cancer cells". This published manuscript presents our observations on the link between ERa and H2A.Z, as well as the possible role of H2A.Z in promoting E2independent proliferation (Svotelis et al., 2010). We first show by ChIP that E2- dependent increased expression of H2A.Z is partly due to the binding of ERa to the H2A.Z promoter. In addition, we observe by immunohistochemistry a correlation between H2A.Z and ERa levels in low grade breast cancer. Using proliferation assays we also show that the exogenous overexpression of H2A.Z in the MCF7 breast cancer cell line leads to increased proliferation in low levels of E2 and in the presence of TAM. E2-independent proliferation is a phenomenon also observed in AE resistant cells. Considering the interesting link between ERa, PRC and trxG-related chromatin modifiers, and the influence of HER2/PI3K/Akt on PRC-mediated repression, we 45 hypothesized that ERa-mcdiated transcription in normal and AE-resistant breast cancer implicates the modification of H3K27 methylation status. The results of our investigation into the role of chromatin modifications on ERa target gene expression in breast cancer progression are presented in Chapter IV, entitled "The control of H3K27 methylation status affects the apoptotic program in hormone-dependent breast cancer and anti-estrogen resistance". This manuscript is under revision in EMBO Journal. Using cell cycle analysis, RT-qPCR, and ChIP techniques, we present results that support a model in which a repressive chromatin state following stimulation by E2 in ERa-dependent cancerous cells caused by H3K27 methylation is permissive for the regulation of BCL2 transcription by a mechanism that comprises the interdependent recruitment of ERa and JMJD3. However, the phosphorylation of EZH2 caused by the overexpression of HER2 in AE-resistant breast cancer cells prevents the methylation of H3K27 surrounding the enhancer region of BCL2, allowing the formation of an active chromatin conformation and constitutive activation of BCL2. 46 CHAPTER II II. REGULATION OF GENE EXPRESSION AND CELLULAR PROLIFERATION BY HISTONE H2A.Z II.1. Preamble In early H2A.Z research, several avenues were explored concerning its role in the yeast model system. These studies shed light on its role in transcriptional activation, heterchromatin formation, and genome stability, and also determined that the Swrl complex regulated the specific deposition of H2A.Z in chromatin. First, it was important to identify the complex that deposited H2A.Z in chromatin. The p400/Tip60 complex was the most likely candidate in mammalian cells. The p400/Tip60 complex has been associated with several important transcription factors involved the control of cell proliferation, such as E2F1, p53, and Myc (Chan, 2005; Kim et al., 2005; Nagl et al., 2007; Samuelson et al., 2005; Taubert et al., 2004). Tip60 has been shown to participate in the activation of pHWAFl/CIPl expression (Berns et al., 2004; Legube et al., 2004; Tyteca et al., 2006a). The p21 WAF1/CIP1 gene is known to be silenced in several types of cancer by the adoption of a generally repressive chromatin state of the promoter region (Fang and Lu, 2002; Shin et al., 2000). An intriguing study had shown that the depletion of p400 leads to the p53-dependent senescence response by increasing p21 WAF1/CIP1 expression in primary human fibroblasts (Chan, 2005). 47 The connection between p400, H2A.Z, and cellular senescence was clarified (Gevry et al., 2007), but questions remained on the interplay between Tip60 and p400 and the role of H2A.Z in cellular proliferation and carcinogenesis. In light of the role of H2A.Z in the development and proliferation of cells in many mammalian systems, a review of the literature along with related hypotheses is presented in this manuscript, published in Biochemistry and Cell Biology in January 2009. I wrote the review and contributed to the conception of the figure presented, aided by discussions and corrections from Drs. Nicolas Gevry and Luc Gaudreau, and Dr. Benoit Leblanc for the creation of the artwork. 48 11.2. Manuscript Regulation of gene expression and cellular proliferation by histone H2A.Z Amy Svotelis, Nicolas Gevry, and Luc Gaudreau Departement de biologie, Faculte des Sciences, Universite de Sherbrooke, Sherbrooke, Quebec, Canada Address correspondence to: Luc Gaudreau, Departement de biologie, Faculte des Sciences, Universite de Sherbrooke, Sherbrooke, Quebec, Canada, JIK 2R1 Tel: 819821-8000 ext. 62081; Fax: 819-821-8049; E-Mail: [email protected] Svotelis, A., Gevry, N., and Gaudreau, L. (2009). Regulation of gene expression and cellular proliferation by histone H2A.Z. Biochem Cell Biol 87, 179-188. 49 Abstract The mammalian genome is organized into a structure of DNA and proteins known as chromatin. In general, chromatin presents a barrier to gene expression which is regulated by several pathways, namely by the incorporation of histone variants into the nucleosome. In yeast, H2A.Z is a H2A histone variant that is incorporated into nucleosomes as a H2A.Z/H2B dimer by the Swrl complex and by the SRCAP and p400/Tip60 complexes in mammalian cells. H2A.Z has been associated with the poising of genes for transcriptional activation in the yeast model system, and is essential for development in higher eukaryotes. Recent studies in our laboratory have demonstrated a p400-dependent deposition of H2A.Z at the promoter of p21mFI/CIPi', a consequence that prevents the activation of the gene by p53, therefore inhibiting p53-dependent replicative senescence, a form of cell cycle arrest crucial in the prevention of carcinogenic transformation of cells. Moreover, H2A.Z is overexpressed in several different types of cancers and its overexpression has been associated functionally with the proliferation state of cells. Therefore, we suggest that H2A.Z is an important regulator of gene expression, and its deregulation may lead to the increased proliferation of mammalian cells. Key words: Chromatin, histone variant H2A.Z, transcription, gene expression, cancer 50 Resume L'ensemble des genes du genome est organise dans une structure d'ADN et de proteines nomme la chromatine. La chromatine presente une barriere a I'acces aux genes pendant l'expression genique. L'incorporation des variants d'histone dans les nucleosomes, notamment le variant H2A.Z, joue un role important dans l'activation et la repression des genes. H2A.Z est incorpore a la chromatine via le complexe Swrl chez la levure et via les complexes SRCAP et p400/Tip60 chez les mammiferes. Ce variant a ete associe avec la preparation des promoteurs pour l'activation des genes et la proliferation cellulaire chez la levure. De plus, il est essentiel dans le developpement des eukaryotes superieurs. Des etudes dans notre laboratoire ont demontre que 1'incorporation de H2A.Z au promoteur de p21WAFI/cwl est effectuee par le complexe p400/Tip60, et que cette incorporation est importante dans la regulation de la transcription d e / ^ / ^ ' ^ ^ d e p e n d a n t e de p53. Cette regulation de p21WAF,/apl par la presence de H2A.Z interfere avec la senescence replicative induit par p53. De plus, la surexpression de H2A.Z est observee dans plusieurs types de cancer. Le variant d'histone H2A.Z aurait done un role important non seulement dans l'expression genique, mais aussi dans la progression du cycle cellulaire. 51 Introduction The organization of DNA into chromatin is separated into several levels and the first level of chromatin organization is defined by the nucleosome. Additional levels of DNA packaging exist in order to organize the genetic information more efficiently and to preserve the DNA during cell division (Polo and Almouzni, 2006). Changes in nucleosomal structure, composition and positioning are critical in facilitating DNA replication and transcription control (Lusser and Kadonaga, 2003). There are three known ways in which the eukaryotic cell overcomes the chromatin barrier: chromatin remodeling by ATP-dependent "chromatin remodeling complexes", post-translational modification of the histones, and incorporation of histone variants into the nucleosome. Each of these mechanisms is crucial for proper cellular function and the equilibrium between these mechanisms is essential for proper gene regulation. The specific incorporation of histone variants into nucleosomes conveys a special characteristic to the chromatin fiber, and one of the most characterized histone variants to date is the H2A variant H2A.Z. Histone H2A.Z biology The existence of variants of H2A was determined in mammalian cells first in a study that demonstrated two as yet unidentified forms of H2A via gel and peptide analysis (West and Bonner, 1980). H2A is the major form of histone H2A proteins in cells, with the variants H2A.X and H2A.Z constituting a minor fraction of total H2A in S phase(Wu and Bonner, 1981). Following its identification in several organisms, it was found that H2A.Z is significantly more conserved across species (90% sequence identity) than H2A (Iouzalen et al., 1996; Jiang et al., 1998). A noteworthy analysis of H2A.Zcontaining nucleosomes by Suto and colleagues demonstrated the subtle yet important changes of between H2A and H2A.Z chromatin (Suto et al., 2000). Despite a homology of only 60% between the primary protein structures of H2A.Z and H2A, crystal structure analysis of reconstituted nucleosomes containing mouse H2A.Z demonstrated only a few major differences from those of H2A. The LI loop, the region responsible for interaction 52 between H2A proteins in the nucleosome, differs slightly between H2A and H2A.Z, creating a steric hindrance between H2A/H2B and H2A.Z/H2B dimers, which would seemingly lead to nucleosomes that contain either H2A.Z or H2A in metazoan cells (Suto et al., 2000). However, the yeast nucleosome core particle differs from its metazoan counterpart, notably in the LI loop region of H2A where significant amino acid differences in Saccharomyces cerevisiae H2A lead to a decreased interaction between the two H2A-H2B dimers (White et al., 2001), creating therefore less possibility of a clash between H2A-H2B and H2A.Z-H2B dimers in the same nucleosome. Also of important note, the C-terminus of H2A.Z creates an extended uninterrupted acidic patch with its interaction with H2B on the surface of the nucleosome as compared to the H2Acontaining nucleosomes (Suto et al., 2000). This extended acidic patch is important in the highly folded nucleosomal arrays created by the cooperation of H2A.Z and HPla, a heterochromatic protein, seeing as a mutant H2A.Z carrying equivalent H2A residues that disrupt the patch are similar to H2A arrays (Fan et al., 2004). The extension of the acidic patch in the C-terminal region could also suggest the possibility of an essential area of protein interaction by which H2A.Z could recruit factors important in gene transcription, explaining its unique role as compared to H2A. Many unresolved issues remain concerning the particularities of the stability of the H2A.Z-containing nucleosome particle, which is eloquently discussed elsewhere (Zlatanova and Thakar, 2008). H2A.Z is an essential gene that provides a function distinct from that of H2A in several model organisms. In Saccharomyces cerevisiae and Saccharomyces pombe, the deletion of htzl, the yeast H2A.Z-encoding gene, is not lethal but leads to multiple phenotypes including transcriptional defects and increased chromosome loss (Adam et al., 2001; Carr et al., 1994; Jackson and Gorovsky, 2000; Krogan et al., 2004; Larochelle and Gaudreau, 2003; Santisteban et al., 2000). H2A.Z is essential for viability in metazoan models, such as Tetrahemena thermophila, Xenopus laevis, Drosophila melanogaster and Mus musculus (Faast et al., 2001; Iouzalen et al., 1996; Liu et al., 1996b; van Daal et al., 1988). Early complementation assays in both yeast and metazoan cells illustrate the importance of H2A.Z and its distinct role in the cell. The lethal 53 phenotype of H2A.Z knockout embryos can be rescued in Drosophila by the injection of H2A.Z in early larval stages (van Daal et al., 1988). However, the overexpression of H2A.Z in the H2A yeast gene knockout strains (Ahtal/Ahta2) could not rescue the lethal phenotype associated with this strain, and the overexpression of either H2A genes could not rescue the Ahtzl phenotypes (Jackson and Gorovsky, 2000; Santisteban et al., 2000). Moreover, a chimeric construct of H2A.Z with the C-terminal region of H2A introduced into Drosophila embryos lacking the wild-type histone variant leads to lethality, or major developmental defects (Clarkson et al., 1999). Other areas of H2A.Z seem interchangeable with those in H2A, which suggests that crucial differences between these two histones lies within the C-terminal region (Clarkson et al., 1999). Also, replacement of the C-terminus of H2A.Z with the equivalent region in H2A could not rescue the Ahtzl phenotype while a fusion of the H2A.Z C-terminus with H2A lacking its C-terminus restored wild type function (Adam et al., 2001). David Tremethick's group was the first to employ the now widely used RNAi technology to decrease H2A.Z expression, showing that H2A.Z is important for chromosome segregation and mitosis (Rangasamy et al., 2003). Taken together, it has become increasingly clear that H2A.Z possesses unique functions distinct from canonical H2A, and that is involved in important cellular functions. Post-translational modifications ofH2A.Z Another major way to modify chromatin is the post-translational modification of histones in the nucleosome core particle. Many histone modifications have now become "classical", such as the methylation of H3K4, a proven mark of active promoters, and the methylation of H3K9, a marker for transcriptionally silent genes (Kouzarides, 2007). The integration of acetate and phosphate in peptides derived from H2A.Z and the importance of the lysine residues of the N-terminus in the model organism T. thermophila provided early indications of acetylation and phosphorylation (Allis et al., 1980; Ren and Gorovsky, 2001). Recently it has been demonstrated that H2A.Z is multiply acetylated on its N-terminal tail in yeast by the NuA4 and SAGA histone acetyltransferase 54 complexes (Babiarz et al., 2006; Keogh et al., 2006; Millar et al., 2006). Mutation of the residues that were found to be acetylated resulted in defects in growth, chromosome transmission and H2A.Z deposition in chromatin. Also, studies in chicken cells demonstrated by ChIP that the acetylated form of H2A.Z was present at the 5' end of active gene loci as compared to the non-acetylated form (Bruce et al., 2005). Previous studies demonstrated the inability of H2A.Z nucleosomes to participate in internucleosomal interactions due to a decrease in the oligomerisation of N-terminal tails, characteristic of acetylated N-terminal tails, impeding the formation of highly condensed chromatin (Fan et al., 2002). Taken together, these studies show that the acetylation of H2A.Z is necessary in the maintenance of genome integrity and heterochromatin boundaries, possibly playing a role in gene activation. There have been some indications in the mammalian system that H2A.Z can be ubiquitylated, a modification that can both be involved in cell signalling and in degradation of the protein marked by this modification (Mukhopadhyay and Riezman, 2007). The first indication appeared when the study of cardiac myocytes in the mouse showed that Sir2-dependent deacetylation of H2A.Z led to the degradation of H2A.Z via the ubiquitin-proteasome pathway (Chen et al., 2006). This effect was lost when the lysines 15, 115 and 121 were mutated into non-acetable, non-ubiquitylable residues. This study did not demonstrate the direct ubiquitylation of H2A.Z, while a more recent study using mouse and human cell lines identified a slower migrating form of H2A.Z on gel electrophoresis and immuno-blotting assay, which corresponds to the weight of a monoubiquitylated H2A.Z protein (Sarcinella et al., 2007). This theory was confirmed when the authors cotransfected HA-tagged ubiquitin into cells and detected the presence of the tag in the slower migrating H2A.Z band, and mutation analysis showed that both K120 and K121 are ubiquitylated. Furthermore, immunoflourescence analysis of H2A.Z and mutant forms localised monoubiquitylated H2A.Z to the inactive X chromosome in female cells (Sarcinella et al., 2007), suggesting that this modification could direct H2A.Z to specific chromatin environments. 55 Deposition ofH2A.Z within chromatin A very unique feature of H2A.Z is that it is incorporated within chromatin as an H2A.Z-H2B dimer by the Swrl .com complex in yeast, named after the catalytic subunit Swrl, a member of the Swi2/Snf2 family of ATPases. Unlike H2A, H2A.Z is deposited into chromatin in a replication-independent manner. In yeast cells, in addition to the copurification of H2A.Z and Swrl and Swrl.com components, chromatin immunoprecipitation assays in yeast strains lacking swrl or other components of the complex showed a decrease in the presence of H2A.Z in euchromatin that borders silenced areas of chromatin (Kobor et al., 2004; Krogan et al., 2003). The role of Swrl .com in the catalysis of the transfer of H2A/H2B dimers for H2A.Z/H2B dimers was confirmed in vitro using an exchange assay with reconstituted nucleosomes in the presence of ATP (Mizuguchi et al., 2004). This activity appears to be genome-wide, as shown by the Swrl-dependent localization of H2A.Z in chromatin (Li et al., 2005; Zhang et al., 2005a). Orthologs of the catalytic subunit Swrl in metazoan cells are suggested to be SRCAP and p400 (Cai et al., 2005; Wu et al., 2005). During identification of the SRCAP complex by immunoprecipitation, the H2A.Z protein was identified among the peptides analyzed by mass spectrometry (Cai et al., 2005), although this is not the case for p400 immunoprecipitated complex (Fuchs et al., 2001). Furthermore, the ATP-dependent exchange of H2A/H2B dimers for H2A.Z/H2B by the SRCAP complex was demonstrated in vitro (Ruhl et al., 2006). Of note, it has recently been suggested that the Swrl-dependent deposition of H2A.Z requires a prior acetylation of chromatin by the NuA4 complex (Auger et al., 2008). Seeing as there is no known histone acetyltransferase (HAT) associated with the SRCAP complex, it is possible that this complex would be responsible for acetylation-independent H2A.Z deposition (Auger et al., 2008). The human p400/Tip60 complex appears to be a fusion of the yeast NuA4 and Swrl complexes and would be a more likely candidate to deposit H2A.Z into chromatin in an acetylation-dependent fashion (Auger et al., 2008). To date, we know that the Drosophila p400/Tip60 complex is responsible for the exchange of phosphorylated H2Av 56 with unphosphorylated H2Av by first acetylating the histone, then catalyzing the exchange (Kusch et al., 2004). The role of the human p400/Tip60 complex remained elusive until a recent study in our laboratory determined that H2A/H2B dimers can be exchanged for H2A.Z/H2B dimers by p400 in vitro (Gevry et al., 2007), in line with findings concerning the Saccharomyces cerevisiae Swrl complex. In addition, it has been suggested that H2A.Z may be involved in a Brg-1 containing Swi/Snf complex chromatin remodeling activity, with or without the contribution of the p400/Tip60 or SRCAP complexes, yet this speculation remains to be verified (John et al., 2008). The question that remains then is, why incorporate this histone variant into chromatin and how is this incorporation directed? Localization of H2A.Z and gene expression Several lines of evidence suggest that the incorporation of the histone variant H2A.Z within chromosomes promotes an active chromatin state. H2A.Z was first isolated in the model organism T. thermophila in association with the transcriptionally active macronucleus, namely during peak transcriptional activity, but not the inactive micronucleus, providing an indication that H2A.Z correlates with active chromatin (Allis et al., 1980; Stargell et al., 1993). Immunostaining of cells demonstrated that H2A.Z localized to active areas of polytene chromosomes in Drosophila (Leach et al., 2000). Early studies in yeast aimed to clarify the role of H2A.Z in promoting transcriptional activity, showing that H2A.Z is present in chromatin at the PH05, GAL1 and PURS promoters in uninduced conditions, and its presence negatively correlates with the activation state of these genes (Adam et al., 2001; Larochelle and Gaudreau, 2003; Santisteban et al., 2000). Although seemingly counter-intuitive, the theory that arose from these studies was that H2A.Z is important in the poising of promoters for gene activation, seeing as the htzl knockout strain exhibits defects in the transcriptional activation of these genes (Adam et al., 2001; Larochelle and Gaudreau, 2003; Santisteban et al., 2000), as well as cell-cycle regulated genes CLN5 and CLB2 (Dhillon et al., 2006). However, genome expression and ChIP analysis of a H2A.Z knockout strain suggested 57 that H2A.Z was important mainly as a barrier to the Sir-dependent repressive effect in areas in close proximity to telomeres where H2A.Z is present in clusters in yeast cells, referred to as Htzl-activated domains (HZADs), undermining its importance in the rest of the genome (Meneghini et al., 2003). This phenomenon was also addressed during the characterization of the Swrl-dependent deposition of H2A.Z into chromatin (Kobor et al., 2004; Krogan et al., 2003; Zhang et al., 2005a). In addition, a similar role for H2A.Z in the prevention of heterochromatic spreading was proposed following the finding of its presence in insulator regions of the chicken P-globin locus (Bruce et al., 2005) and the correlation between H2A.Z and the insulator protein CTCF in human cells (Barski et al., 2007; Fu et al., 2008). Further genome-wide analyses in yeast shed new light on the positioning of H2A.Z, confirming its presence in telomere-proximal areas (Guillemette et al., 2005), yet showing that H2A.Z was mainly present at the 5' ends of genes genome-wide, in the promoter regions in the nucleosomes that border the nucleosome-free region (NFR) around the transcription start site (TSS) (Guillemette et al., 2005; Li et al., 2005; Millar et al., 2006; Raisner et al., 2005; Segal et al., 2006; Zhang et al., 2005a), as well as several replication origins (Dhillon et al., 2006; Guillemette et al., 2005). In some studies, no obvious correlations between H2A.Z presence and gene expression were found, possibly due to the scale of the study performed, as only the yeast chromosome III was tiled by microarray (Liu et al., 2005; Raisner et al., 2005; Yuan et al., 2005). However, an inverse correlation between H2A.Z presence and gene transcription was found in the majority of these studies (Guillemette et al., 2005; Li et al., 2005; Millar et al., 2006; Zhang et al., 2005a) and in follow-up studies that verified H2A.Z presence during specific gene induction (Zanton and Pugh, 2006), drawing a parallel with results previously seen in model gene expression analyses. Intriguingly, later detailed analyses of the yeast genome confirmed that positioning of H2A.Z at yeast promoters is more defined at TATA-less promoters, while its positioning is more variable at TATA-containing promoters (Albert et al., 2007). In addition, H2A.Z has recently been shown to be associated with both yeast and human promoters that have Depleted Proximal-Nucleosomes (DPN), which are 58 well-positioned nucieosomes that exhibit low occupancy close to the TSS and greater occupancy at distal regions creating a well-established NFR, yet it is not shown in this study if H2A.Z could be responsible for the creation of such a promoter architecture (Tirosh and Barkai, 2008). The proposed "promoter poising" activity of H2A.Z could also be related to the structure of H2A.Z nucieosomes and their ability to prevent internucleosomal interactions (Fan et al., 2002), promoting a more open chromatin conformation that is characteristic of transcriptionally poised genes. It remains that the prevailing inference of these studies is that H2A.Z presence at the specific regions in yeast promoters could create a transcriptionally poised state in yeast cells, leading to a more in-depth analysis of the role of H2A.Z positioning in the regulation of expression of mammalian genes. Similar positioning of H2A.Z rings true in the genomes of higher eukaryotes, yet correlation with gene activity is seemingly more complex. The early studies of H2A.Z positioning in the metazoan system corroborated yeast studies that claimed H2A.Z was most important in heterochromatic areas of chromatin. Immunofluorescence and ChIP studies in the mouse embryo showed an association between H2A.Z and HP la, a known heterochromatic protein, in constitutive heterochromatin (Fan et al., 2004; Rangasamy et al., 2003). However, these studies did not observe H2A.Z at facultative heterochromatin such as the silent X chromosome, while a recent publication localized H2A.Z to the silent X chromosome and clearly showed the counter-staining of H2A.Z with HP la in constitutive heterochromatin, with H2A.Z staining in a punctuate manner throughout the chromosomes (Sarcinella et al., 2007). The important nuance here is that the early studies were performed in the developing mouse embryo, while Cheung's group used differentiated mouse and human cells (Sarcinella et al., 2007). Furthermore, immunofluorescence staining of H2A.Z and different histone modifications during the epigenetic reprogramming of mouse progenitor germ cells during development showed that the strong but diffuse staining of H2A.Z is lost during the reprogramming process, and this loss correlates with the critical erasure of epigenetic memory (Hajkova et al., 2008). This transition of H2A.Z localization could explain many phenomena observed in 59 the literature to date. The importance of H2A.Z in the development of multicellular organisms could depend on its role in the formation of heterochromatic areas, while more differentiated cells require the use of H2A.Z in establishing a specific promoter structure for tissue-specific gene regulation. For example, a thorough ChlP-chip analysis in the developing Caenorhabditis elegans embryo associated H2A.Z with TSS, Pol II (read transcriptional activity), and transcript levels, namely at growth and developmentallyrelated genes (Whittle et al., 2008). The majority of the genomic analyses of H2A.Z in metazoan cells have shown the association of H2A.Z with active or poised promoters. The analysis of mononucleosomelength fragments from resting and T-cell receptor signaling activated human CD4+ T cells by ChlP-sequencing provided a high-resolution profile of nucleosomes across the genome of these cells (Schones et al., 2008). Genome-wide, H2A.Z was shown to be present at several nucleosomes surrounding the TSS, nucleosomes that are very wellpositioned relative to other regions of the genome, yet preferentially lost at the -1 nucleosomes upon gene induction (Schones et al., 2008), providing more evidence of the role of H2A.Z in promoter poising first shown in yeast. Also, global nucleosome positioning of H2A.Z-containing nucleosomes in the Drosophila genome revealed similar results as in yeast, with H2A.Z mapping to the TSS at the majority of promoters (Mavrich et al., 2008b). Of note, this presence was most detected at the +1 nucleosome situated at approximately position +62, the area at which RNA Polymerase II (RNA PolII) pauses during the transcription cycle (Mavrich et al., 2008b). H2A.Z had also previously been found to bind the promoter region of Myc, but is lost during induction of the gene by 11-2 (Farris et al., 2005). Interestingly, the presence of H2A.Z in the coding region of Myc can inhibit transcriptional activity (Farris et al., 2005), raising an important issue on the influence of the specific positioning of H2A.Z on its role in gene regulation. For example, H2A.Z has been located at distal DNasel hypersensitive regulatory areas, often indicating enhancer areas important in gene regulation, and its presence at these areas correlates with transcriptional activity (Barski et al., 2007; John et al., 2008). A recent high-resolution analysis of nucleosome occupancy and composition at model gene of the 60 class I major histocompatibility complex (MHC) family in kidney, spleen and brain tissue from the mouse revealed that H2A.Z is present at TSS-associated nucleosomes, at different levels in each tissue (Kotekar et al., 2008). The most interesting example in this study is the gene activation in the kidney, where the gene is weakly active. H2A.Z occupancy is highest here, and although the authors claim that tissue-specific presence of H2A.Z at this specific locus does not correlate with or change upon gene activation, one can observe a slight decrease in H2A.Z presence once the gene is activated tissue (Kotekar et al., 2008). Moreover, ChIP analysis of several GR-responsive promoters revealed that H2A.Z was present at GR-responsive sites, with a dramatic exchange occurring following activation of GR by ligand binding (John et al., 2008). The authors propose an intriguing model in which cell-specific positioning of H2A.Z would determine the gene expression program (John et al., 2008), a model first introduced by the work performed in our laboratory on the p53-dependent positioning of H2A.Z at the p2jWAFi/ciPi p r o m o t e r (Qevry et al., 2007). So, it is evident that the positioning of H2A.Z in chromatin and its specific location within gene regulatory areas can contribute both to the positive or negative regulation of transcriptional activity. One can also easily hypothesize on the role of transcriptional activators in the deposition of this histone variant into chromatin. Transcriptional activators readily interact with and recruit chromatin remodeling complexes to promoters, inducing either the displacement or modification of nucleosomes (Szutorisz et al., 2005). It is known that several coactivators of transcription are actually complexes that contain histone modifying enzymes which affect transcription (Brownell et al., 1996). Our laboratory and others have determined that the yeast transcriptional co-activators Spt-Ada-Gcn5Acetyl transferase (SAGA), Mediator, Swi/Snf complex and RNA PolII subunits are recruited to the GALI promoter, and that H2A.Z is required for the recruitment of these factors (Adam et al., 2001; Gligoris et al., 2007; Lemieux and Gaudreau, 2004; Lemieux et al., 2008). In addition, genome-wide studies have shown the correlation between H2A.Z presence and certain histone modifications. High-resolution ChlP-sequencing of histone methylations and H2A.Z in human T cells associated enhancers and promoters of 61 active genes with H3K4 methylation, H2A.Z, and mono-methylated H3K9, with binding levels correlating with gene activity (Barski et al., 2007). Interestingly, in yeast, Setl, a H3K.4 methytransferase, and H2A.Z were shown to have redundant roles in the establishment of a chromatin barrier to Sir-mediated silencing, as shown by an increased repression of genes genome-wide in the double mutant strain of Ahtzl/Asetl (Venkatasubrahmanyam et al., 2007). This suggests that these two mechanisms are overlapping, in that the presence of either H2A.Z or the H3K4 methyl mark are not dependent on the presence of one another, yet H2A.Z occupancy was significantly decreased at certain genes in strains that were mutated for Setl and certain key histone modifications (Venkatasubrahmanyam et al., 2007; Zhang et al., 2005a). Of importance to our studies, the interplay between chromatin remodeling complexes and histone modifying enzymes is illustrated by the interaction in mammalian cells at the p21WAFI/CIPI promoter between p53 and the p400/Tip60 complex, a complex that contains both HAT activity (Tip60 subunit) and ATPase subunits (p400) (Erkine, 2004; Gevry et al., 2007; Legube et al., 2004). This same complex is now known to be responsible for the loading of H2A.Z into nucleosomes, showing a dynamic interplay between the ATPase subunit p400 and the HAT subunit Tip60, and has been the subject of recent research performed in our laboratory (Gevry et al., 2007). Taken together, these studies lead to a question similar to the chicken and the egg scenario: it is a causal relationship in which we should ask which comes first, the histone modifications or H2A.Z? Or do these "epigenetic marks" exist in the same regions of chromatin without influencing the presence of one another? Is it possible that the complex or complexes that are involved in the remodeling of H2A.Z within chromatin also are involved in the establishment of histone modifications? Although many bioinformatics analyses have calculated correlations and determined signatures of H2A.Z-containing nucleosomes ((Fu et al., 2008); A. Gervais and L.G., unpublished data), we are unable as of yet to determine the importance of H2A.Z in the establishment of such marks, or the significance of the marks in the targeting of H2A.Z to chromatin. 62 H2A.Z and the p53/p21 senescence pathway The link between replicative senescence, transcriptional control and chromatin remodeling complexes was explored by Chan et al. (2005) where they focused on the role of p400 in the p53/p21 senescence response. Replicative senescence occurs when the cell encounters severe stresses, such as the overexpression of oncogenes or DNA damage, provoking the activation of p53 and the pl6 pathways, causing a cell cycle arrest that is irreversible (Campisi, 2005; Narita and Lowe, 2005). The maintenance of cell cycle arrest leads to replicative senescence and important morphological changes in the cell, changes in chromatin structure, and the maintenance of simple basal metabolic levels (Cristofalo et al., 2004; Zhang, 2007). The effect of p53 on the cell cycle is somewhat indirect, binding to the regulatory region of the p2]WAFI/CIP1 gene, activating its transcription (Dulic et al., 1994; el-Deiry et al., 1994). The p21 and pl6 proteins are cell cycle inhibitors which, through their capacity to bind and inactivate several cyclin-CdK complexes, will stop the progression through to the next phase of the cell cycle, typically in Gl (reviewed in (Zhang, 2007)). Chan et al. (2005) revealed that the p400 subunit of the p400/Tip60 complex effects negatively the induction of the senescence pathway (Chan et al. 2005) by decreasing p21WAF1/CIPl expression via its localization at p53 binding sites in the p21WAFI/ap' promoter (Chan et al. 2005). We have recently demonstrated the importance of the presence of H2A.Z in chromatin on cell cycle progression via the p53/p21 pathway (Gevry et al., 2007). Our group demonstrated that deposition of H2A.Z at the distal p53-binding site by the p400 complex accounts for the adverse effects of p400 on the senescence response explained by Chan et al. (2005). Specific knockdown of H2A.Z expression promotes cellular senescence and an increase in p21 WAFl/CIP ' expression, suggesting an inhibitory role of H2A.Z in cell cycle arrest (Gevry et al., 2007). Moreover, the decrease in the expression of both H2A.Z and p400 in human fibroblasts caused the formation of senescenceassociated heterochromatic foci (SAHF), the p-galactosidase staining of nuclei and change in morphology that are characteristic of senescent cells (Gevry et al., 2007). This repressive characteristic of H2A.Z presence in chromatin is contrary to many findings 63 concerning the histone variant, yet demonstrates that the specific location of H2A.Z in gene regulatory regions yields different effects. The effects on cellular senescence demonstrated in these experiments were then attributed to the p53-dependent deposition of H2A.Z by the p400/Tip60 complex on the promoter of p21WAF,/apI. ChIP analysis revealed the colocalisation of H2A.Z and p400 to the promoter of p21WAFI/apl at the distal and proximal p53-binding sites in human breast cancer cell lines, a localisation which is lost in the p53"" cell line SaOS2 (Gevry et al., 2007). This localisation of H2A.Z definitely linked to the repressive state of p21WAF1/CIPI, seeing as induction of the gene via the p53 pathway led to the eviction of H2A.Z from the chromatin of the promoter (Gevry et al., 2007). In addition, this loading of H2A.Z by p400 is independent of its association with Tip60, seeing as they show inversely proportional occupation of the promoter, at opposing times in the expression pattern (Gevry et al., 2007). This result explains the opposing effects of p400 and Tip60 on p53-dependent p2lWAFl/CIPI expression, and suggests the existence of two separate complexes, as is seen in yeast. Interestingly, following the "clearing" of the promoter from all pre-bound RNA PolII by a-amanitin, and p53"A cells in which RNA PolII is not pre-bound (Espinosa et al., 2003), H2A.Z is detected at the initiator region (Gevry et al., 2007). The oncogene Myc is known to repress p21WAF1/apl expression when present at the initiator region of the gene (Seoane et al., 2002), and the presence of H2A.Z at the same region leads us to study the association of H2A.Z with the oncogene Myc. H2A.Z and the oncogene Myc There is much evidence linking the oncogene Myc and the overall state of chromatin in the cell. The overexpression of Myc influences global chromatin structure by both widespread binding of Myc to chromatin and a possible recruitment of various chromatin remodelling complexes (Knoepfler et al., 2006). Myc is known to bind and recruit the p400/Tip60 complex to chromatin (Frank et al., 2003; Fuchs et al., 2001; Samuelson et al., 2005). We show in our most recent study that the overexpression of Myc not only represses p21WA /apl expression, but increases the loading of H2A.Z at the 64 initiator region of p21 expression, concordant with an increase in the binding of Myc and p400 at the same region in the absence of p53 (Gevry et al., 2007). Most recently another link has been made between Myc and H2A.Z, in that Myc stimulates H2A.Z expression in breast cancer cells by binding the promoter of H2A.Z (Hua et al., 2008). Taken together, these studies suggest a mechanism in which, in a type of feedback loop, the proliferative effect of Myc would begin with an increase in the amount of H2A.Z, leading to the repression of p21WAF1/api expression by the incorporation of this variant into the chromatin environment of thep21WAF1/c,pl promoter. H2A.Z and carcinogenesis The p400/Tip60 complex has been associated with the control of expression of several important transcription factors involved in the control of cell proliferation, such as E2F1, p53, KAIl and Myc (Chan, 2005; Kim et al., 2005; Nagl et al., 2007; Samuelson et al., 2005; Taubert et al., 2004). Tip60 has been shown to participate in the activation of p2lwAFi/cwi e x p r e s s i o n (Berns et al; 2004; Legube et al., 2004; Tyteca et al., 2006b). In line with this, Tip60 acts as a haplo-insufficient tumour suppressor, wherein Tip60 heterozygous mice are more sensitive to Myc-induced lymphomas (Gorrini et al., 2007). These mice show defects in the DNA-damage response, yet the defects are not due to a deregulation of p53- or Myc-induced transcription (Gorrini et al., 2007), which suggests an additional unknown function of Tip60 in the cell cycle. The interplay between Tip60 and p400 remains to be determined, seeing as they appear to have opposing roles in cell cycle arrest and carcinogenesis. The connection between p400, H2A.Z and cellular senescence is clear, yet questions remain concerning the role of H2A.Z in cellular proliferation and carcinogenesis. In addition, the importance of Tip60 in the deposition of H2A.Z and the possibility of two separate complexes must be addressed. In light of the role of H2A.Z in the development and proliferation of cells in many mammalian systems, could it be that the overexpression of this histone variant presents an alteration that will contribute to the cancerous transformation of mammalian cells, as is the case for many oncogenes? The 65 overexpression of H2A.Z has been observed in colorectal cancers, undifferentiated cancers and breast metastatic cancer cells as compared to normal cells ((Dunican et al., 2002; Hua et al., 2008; Rhodes et al., 2004; Zucchi et al., 2004), N.G. and L.G., unpublished data). The double knockout of H2A.Z and certain genes involved in replication and S phase checkpoint control in yeast confers severe growth defects in these strains (Dhillon et al., 2006). Of note, the simple deletion of H2A.Z renders yeast cells hypersensitive to checkpoints, leading to a delay in the start of the cell cycle. One can hypothesize that H2A.Z plays a role in pushing the cell through its checkpoints, promoting proliferation. Following our demonstration of the importance of H2A.Z in the control of the senescence response, we have recently hypothesized upon its correlation with carcinogenesis and the malignancy of tumors, as well as its role in the establishment of these cancers. In support of this hypothesis, we have recently demonstrated the importance of H2A.Z in the estrogen receptor a (ERa) signaling pathway and in ERdependent breast cancer proliferation. These intriguing results demonstrate that the cyclic incorporation of H2A.Z at ERa-dependent genes stabilizes chromatin architecture and allows the activation of the gene (N. Gevry, S. Hardy, P.-E. Jacques, L. Laflamme, G. Grondin, F. Robert and Gaudreau, submitted for publication). The specific knockdown of H2A.Z in synchronized cells results in a Gl block which cannot be rescued by serum stimulation, as compared to control cells. To further support the supposition that H2A.Z aids in the establishment of cellular transformation, we observe that the overexpression of H2A.Z causes increased proliferation, and the pro-proliferative effects of H2A.Z seem to be caused by a deregulation in the cell cycle, most apparent in a P16"'" background. Interestingly, E2F1 can recruit the p400/Tip60 complex to chromatin at the promoters of cell-cycle related genes during the Gl/S transition (Kramps et al., 2004; Nagl et al., 2007; Taubert et al., 2004). One can imagine a model similar to the one illustrated in Figure 1, in which the incorporation of H2A.Z into the chromatin of promoters will provoke a decrease mp21WAFI/apl expression, in addition to an increase in the expression of certain genes that are important in the promotion of cell cycle 66 progression through the Gl/S transition, such as E2F1- regulated genes, in a chromatin remodeling response that is context-specific. Therefore, based on these studies, we can conclude that H2A.Z could have a direct role in the control of cellular proliferation, and potentially in cancer progression. The direct and decisional role of H2A.Z in the establishment of the transformed state requires further investigation and is a fascinating aspect of H2A.Z function. 67 Acknowledgements The authors would like to thank Marc Larochelle, Liette Laflamme and Julie Carrier for their comments on this manuscript, and a special thanks to Benoit Leblanc for the production of Figure 1 and many significant discussions. A.S. is a recipient of a doctoral studentship from the Natural Sciences and Engineering Research Council of Canada (NSERC). L.G. holds a Canada Research Chair on Mechanisms of gene transcription. CIHR and the Canadian Cancer Society provided funding for the unpublished work cited in this review. 68 Figure 2-1 : Proposed model for the control of cellular proliferation by H2A.Z in mammalian cells. The incorporation of H2A.Z into promoter chromatin of p21WAFI/apl inhibits p53dependent replicative senescence. In addition, we propose that H2A.Z regulates both cellular proliferation through the Gl/S transition and ER-dependent cellular proliferation. We surmise that the deposition of H2A.Z at the promoters of certain genes that are important in the promotion of cell cycle progression through Gl/S transition, such as E2F1- regulated genes, will regulate their expression by poising the genes for activation, leading to increased proliferation. 69 References Adam, M., Robert, F., Larochelle, M, and Gaudreau, L. 2001. H2A.Z is required for global chromatin integrity and for recruitment of RNA polymerase II under specific conditions. Mol Cell Biol 21(18): 6270-6279. Albert, I., Mavrich, T.N., Tomsho, L.P., Qi, J., Zanton, S.J., Schuster, S.C., and Pugh, B.F. 2007. Translational and rotational settings of H2A.Z nucleosomes across the Saccharomyces cerevisiae genome. Nature 446(7135): 572-576. Allis, CD., Glover, C.V., Bowen, J.K., and Gorovsky, M.A. 1980. Histone variants specific to the transcriptionally active, amitotically dividing macronucleus of the unicellular eucaryote, Tetrahymena thermophila. Cell 20(3): 609-617. Auger, A., Galarneau, L., Altaf, M., Nourani, A., Doyon, Y., Utley, R.T., Cronier, D., Allard, S., and Cote, J. 2008. Eafl is the platform for NuA4 molecular assembly that evolutionarily links chromatin acetylation to ATP-dependent exchange of histone H2A variants. Mol Cell Biol 28(7): 2257-2270. Babiarz, J.E., Halley, J.E., and Rine, J. 2006. Telomeric heterochromatin boundaries require NuA4-dependent acetylation of histone variant H2A.Z in Saccharomy cescerevisiae. Genes Dev 20(6): 700-710. Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G., Chepelev, I., and Zhao, K. 2007. High-resolution profiling of histone methylations in the human genome. Cell 129(4): 823-837. Berns, K., Hijmans, E.M., Mullenders, J., Brummelkamp, T.R., Velds, A., Heimerikx, M., Kerkhoven, R.M., Madiredjo, M., Nijkamp, W., Weigelt, B., Agami, R., Ge, W., Cavet, G., Linsley, P.S., Beijersbergen, R.L., and Bernards, R. 2004. A largescale RNAi screen in human cells identifies new components of the p53 pathway. Nature 428(6981): 431-437. Brownell, J.E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D.G., Roth, S.Y., and Allis, CD. 1996. Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell 84(6): 843-851. Bruce, K.., Myers, F.A., Mantouvalou, E., Lefevre, P., Greaves, I., Bonifer, C, Tremethick, D.J., Thorne, A.W., and Crane-Robinson, C. 2005. The replacement histone H2A.Z in a hyperacetylated form is a feature of active genes in the chicken. Nucleic Acids Res 33(17): 5633-5639. Cai, Y., Jin, J., Florens, L., Swanson, S.K., Kusch, T., Li, B., Workman, J.L., Washburn, M.P., Conaway, R.C, and Conaway, J.W. 2005. The mammalian YL1 protein is a shared subunit of the TRRAP/TIP60 histone acetyltransferase and SRCAP complexes. J Biol Chem 280(14): 13665-13670. Campisi, J. 2005. Suppressing cancer: the importance of being senescent. Science 309(5736): 886-887. Carr, A.M., Dorrington, S.M., Hindley, J., Phear, G.A., Aves, S.J., and Nurse, P. 1994. Analysis of a histone H2A variant from fission yeast: evidence for a role in chromosome stability. Mol Gen Genet 245(5): 628-635. 70 Chan, H.M., M. Narita, S. W. Lowe, and D. M. Livingston. . 2005. The p400 E1Aassociated protein is a novel component of the p53 --> p21 senescence pathway. . Genes Dev 19. Chen, I.Y., Lypowy, J., Pain, J., Sayed, D., Grinberg, S., Alcendor, R.R., Sadoshima, J., and Abdellatif, M. 2006. Histone H2A.z is essential for cardiac myocyte hypertrophy but opposed by silent information regulator 2alpha. J Biol Chem 281(28): 19369-19377. Clarkson, M.J., Wells, J.R., Gibson, F., Saint, R., and Tremethick, D.J. 1999. Regions of variant histone His2AvD required for Drosophila development. Nature 399(6737): 694-697. Cristofalo, V.J., Lorenzini, A., Allen, R.G., Torres, C, and Tresini, M. 2004. Replicative senescence: a critical review. Mech Ageing Dev 125(10-11): 827-848. Dhillon, N., Oki, M., Szyjka, S.J., Aparicio, O.M., and Kamakaka, R.T. 2006. H2A.Z functions to regulate progression through the cell cycle. Mol Cell Biol 26(2): 489501. Dulic, V., Kaufmann, W.K., Wilson, S.J., Tlsty, T.D., Lees, E., Harper, J.W., Elledge, S.J., and Reed, S.I. 1994. p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced Gl arrest. Cell 76(6): 1013-1023. Dunican, D.S., McWilliam, P., Tighe, O., Parle-McDermott, A., and Croke, D.T. 2002. Gene expression differences between the microsatellite instability (MIN) and chromosomal instability (CIN) phenotypes in colorectal cancer revealed by highdensity cDNA array hybridization. Oncogene 21(20): 3253-3257. el-Deiry, W.S., Harper, J.W., O'Connor, P.M., Velculescu, V.E., Canman, C.E., Jackman, J., Pietenpol, J.A., Burrell, M., Hill, D.E., Wang, Y., and et al. 1994. WAF1/CIP1 is induced in p53-mediated Gl arrest and apoptosis. Cancer Res 54(5): 11691174. Erkine, A.M. 2004. Activation domains of gene-specific transcription factors: are histones among their targets? Biochem Cell Biol 82(4): 453-459. Espinosa, J.M., Verdun, R.E., and Emerson, B.M. 2003. p53 functions through stressand promoter-specific recruitment of transcription initiation components before and after DNA damage. Mol Cell 12(4): 1015-1027. Faast, R., Thonglairoam, V., Schulz, T.C., Beall, J., Wells, J.R., Taylor, H., Matthaei, K., Rathjen, P.D., Tremethick, D.J., and Lyons, I. 2001. Histone variant H2A.Z is required for early mammalian development. Curr Biol 11(15): 1183-1187. Fan, J.Y., Gordon, F., Luger, K., Hansen, J.C., and Tremethick, D.J. 2002. The essential histone variant H2A.Z regulates the equilibrium between different chromatin conformational states. Nat Struct Biol 9(3): 172-176. Fan, J.Y., Rangasamy, D., Luger, K.., and Tremethick, D.J. 2004. H2A.Z alters the nucleosome surface to promote HP 1 alpha-mediated chromatin fiber folding. Mol Cell 16(4): 655-661. Farris, S.D., Rubio, E.D., Moon, J.J., Gombert, W.M., Nelson, B.H., and Krumm, A. 2005. Transcription-induced chromatin remodeling at the c-myc gene involves the local exchange of histone H2A.Z. J Biol Chem 280(26): 25298-25303. 71 Frank, S.R., Parisi, T., Taubert, S., Fernandez, P., Fuchs, M., Chan, H.M., Livingston, D.M., and Amati, B. 2003. MYC recruits the TIP60 histone acetyltransferase complex to chromatin. EMBO Rep 4(6): 575-580. Fu, Y., Sinha, M, Peterson, C.L., and Weng, Z. 2008. The insulator binding protein CTCF positions 20 nucleosomes around its binding sites across the human genome. PLoSgenetics 4(7): el000138. Fuchs, M., Gerber, J., Drapkin, R., Sif, S., Ikura, T., Ogryzko, V., Lane, W.S., Nakatani, Y., and Livingston, D.M. 2001. The p400 complex is an essential E1A transformation target. Cell 106(3): 297-307. Gevry, N., Chan, H.M., Laflamme, L., Livingston, D.M., and Gaudreau, L. 2007. p21 transcription is regulated by differential localization of histone H2A.Z. Genes Dev 21(15): 1869-1881. Gligoris, T., Thireos, G., and Tzamarias, D. 2007. The Tupl corepressor directs Htzl deposition at a specific promoter nucleosome marking the GAL1 gene for rapid activation. Mol Cell Biol 27(11): 4198-4205. Gorrini, C, Squatrito, M., Luise, C, Syed, N., Perna, D., Wark, L., Martinato, F., Sardella, D., Verrecchia, A., Bennett, S., Confalonieri, S., Cesaroni, M., Marchesi, F., Gasco, M., Scanziani, E., Capra, M., Mai, S., Nuciforo, P., Crook, T., Lough, J., and Amati, B. 2007. Tip60 is a haplo-insufficient tumour suppressor required for an oncogene-induced DNA damage response. Nature 448(7157): 1063-1067. Guillemette, B., Bataille, A.R., Gevry, N., Adam, M., Blanchette, M., Robert, F., and Gaudreau, L. 2005. Variant histone H2A.Z is globally localized to the promoters of inactive yeast genes and regulates nucleosome positioning. PLoS Biol 3(12): e384. Hajkova, P., Ancelin, K., Waldmann, T., Lacoste, N., Lange, U.C., Cesari, F., Lee, C, Almouzni, G., Schneider, R., and Surani, M.A. 2008. Chromatin dynamics during epigenetic reprogramming in the mouse germ line. Nature 452(7189): 877-881. Hua, S., Kallen, C.B., Dhar, R., Baquero, M.T., Mason, C.E., Russell, B.A., Shah, P.K., Liu, J., Khramtsov, A., Tretiakova, M.S., Krausz, T.N., Olopade, O.I., Rimm, D.L., and White, K.P. 2008. Genomic analysis of estrogen cascade reveals histone variant H2A.Z associated with breast cancer progression. Molecular systems biology A: 188. Iouzalen, N., Moreau, J., and Mechali, M. 1996. H2A.ZI, a new variant histone expressed during Xenopus early development exhibits several distinct features from the core histone H2A. Nucleic Acids Res 24(20): 3947-3952. Jackson, J.D. and Gorovsky, M.A. 2000. Histone H2A.Z has a conserved function that is distinct from that of the major H2A sequence variants. Nucleic Acids Res 28(19): 3811-3816. Jiang, W., Guo, X., and Bhavanandan, V.P. 1998. Histone H2A.F/Z subfamily: the smallest member and the signature sequence. Biochem Biophys Res Commun 245(2): 613-617. John, S., Sabo, P.J., Johnson, T.A., Sung, M.H., Biddie, S.C., Lightman, S.L., Voss, T.C., Davis, S.R., Meltzer, P.S., Stamatoyannopoulos, J.A., and Hager, G.L. 2008. 72 Interaction of the glucocorticoid receptor with the chromatin landscape. Mol Cell 29(5): 611-624. Keogh, M.C., Mennella, T.A., Sawa, C, Berthelet, S., Krogan, N.J., Wolek, A., Podolny, V., Carpenter, L.R., Greenblatt, J.F., Baetz, K., and Buratowski, S. 2006. The Saccharomyces cerevisiae histone H2A variant Htzl is acetylated by NuA4. Genes Dev 20(6): 660-665. Kim, J.H., Kim, B., Cai, L., Choi, H.J., Ohgi, K.A., Tran, C, Chen, C, Chung, C.H., Huber, O., Rose, D.W., Sawyers, C.L., Rosenfeld, M.G., and Baek, S.H. 2005. Transcriptional regulation of a metastasis suppressor gene by Tip60 and betacatenin complexes. Nature 434(7035): 921-926. Knoepfler, P.S., Zhang, X.Y., Cheng, P.F., Gafken, P.R., McMahon, S.B., and Eisenman, R.N. 2006. Myc influences global chromatin structure. Embo J 25(12): 27232734. Kobor, M.S., Venkatasubrahmanyam, S., Meneghini, M.D., Gin, J.W., Jennings, J.L., Link, A.J., Madhani, H.D., and Rine, J. 2004. A protein complex containing the conserved Swi2/Snf2-related ATPase Swrlp deposits histone variant H2A.Z into euchromatin. PLoS Biol 2(5): El31. Kotekar, A.S., Weissman, J.D., Gegonne, A., Cohen, H., and Singer, D.S. 2008. Histone Modifications, But Not Nucleosomal Positioning, Correlate With MHC Class I Promoter Activity In Different Tissues In Vivo. Mol Cell Biol. Kouzarides, T. 2007. Chromatin modifications and their function. Cell 128(4): 693-705. Kramps, C, Strieder, V., Sapetschnig, A., Suske, G., and Lutz, W. 2004. E2F and Spl/Sp3 Synergize but are not sufficient to activate the MYCN gene in neuroblastomas. J Biol Chem 279(7): 5110-5117. Krogan, N.J., Baetz, K., Keogh, M.C., Datta, N., Sawa, C, Kwok, T.C., Thompson, N.J., Davey, M.G., Pootoolal, J., Hughes, T.R., Emili, A., Buratowski, S., Hieter, P., and Greenblatt, J.F. 2004. Regulation of chromosome stability by the histone H2A variant Htzl, the Swrl chromatin remodeling complex, and the histone acetyltransferaseNuA4.ProcAta/A™r&/ USA 101(37): 13513-13518. Krogan, N.J., Keogh, M.C., Datta, N., Sawa, C, Ryan, O.W., Ding, H., Haw, R.A., Pootoolal, J., Tong, A., Canadien, V., Richards, D.P., Wu, X., Emili, A., Hughes, T.R., Buratowski, S., and Greenblatt, J.F. 2003. A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htzl. Mol Cell 12(6): 15651576. Kusch, T., Florens, L., Macdonald, W.H., Swanson, S.K., Glaser, R.L., Yates, J.R., 3rd, Abmayr, S.M., Washburn, M.P., and Workman, J.L. 2004. Acetylation by Tip60 is required for selective histone variant exchange at DNA lesions. Science 306(5704): 2084-2087. Larochelle, M. and Gaudreau, L. 2003. H2A.Z has a function reminiscent of an activator required for preferential binding to intergenic DNA. Embo J 22(17): 4512-4522. Leach, T.J., Mazzeo, M., Chotkowski, H.L., Madigan, J.P., Wotring, M.G., and Glaser, R.L. 2000. Histone H2A.Z is widely but nonrandomly distributed in chromosomes of Drosophila melanogaster. J Biol Chem 275(30): 23267-23272. 73 Legube, G., Linares, L.K., Tyteca, S., Caron, C, Scheffner, M., Chevillard-Briet, M., and Trouche, D. 2004. Role of the histone acetyl transferase Tip60 in the p53 pathway. J Biol Chem 279(43): 44825-44833. Lemieux, K. and Gaudreau, L. 2004. Targeting of Swi/Snf to the yeast GAL1 UAS G requires the Mediator, TAF lis, and RNA polymerase II. Embo J 23(20): 40404050. Lemieux, K., Larochelle, M., and Gaudreau, L. 2008. Variant histone H2A.Z, but not the HMG proteins Nhp6a/b, is essential for the recruitment of Swi/Snf, Mediator, and SAGA to the yeast GAL1 UAS(G). Biochem Biophys Res Commun 369(4): 11031107. Li, B., Pattenden, S.G., Lee, D., Gutierrez, J., Chen, J., Seidel, C, Gerton, J., and Workman, J.L. 2005. Preferential occupancy of histone variant H2AZ at inactive promoters influences local histone modifications and chromatin remodeling. Proc NatlAcadSci USA 102(51): 18385-18390. Liu, C.L., Kaplan, T., Kim, M., Buratowski, S., Schreiber, S.L., Friedman, N., and Rando, O.J. 2005. Single-nucleosome mapping of histone modifications in S. cerevisiae. PLoS Biol 3(10): e328. Liu, X., Li, B., and GorovskyMa. 1996. Essential and nonessential histone H2A variants in Tetrahymena thermophila. Mol Cell Biol 16(8): 4305-4311. Lusser, A. and Kadonaga, J.T. 2003. Chromatin remodeling by ATP-dependent molecular machines. Bioessays 25(12): 1192-1200. Mavrich, T.N., Jiang, C, Ioshikhes, LP., Li, X., Venters, B.J., Zanton, S.J., Tomsho, L.P., Qi, J., Glaser, R.L., Schuster, S.C., Gilmour, D.S., Albert, I., and Pugh, B.F. 2008. Nucleosome organization in the Drosophila genome. Nature 453(7193): 358-362. Meneghini, M.D., Wu, M., and Madhani, H.D. 2003. Conserved histone variant H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin. Cell 112(5): 725-736. Millar, C.B., Xu, F., Zhang, K., and Grunstein, M. 2006. Acetylation of H2AZ Lys 14 is associated with genome-wide gene activity in yeast. Genes Dev 20(6): 711-722. Mizuguchi, G., Shen, X., Landry, J., Wu, W.H., Sen, S., and Wu, C. 2004. ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science 303(5656): 343-348. Mukhopadhyay, D. and Riezman, H. 2007. Proteasotne-independent functions of ubiquitin in endocytosis and signaling. Science 315(5809): 201-205. Nagl, N.G., Jr., Wang, X., Patsialou, A., Van Scoy, M., and Moran, E. 2007. Distinct mammalian SWI/SNF chromatin remodeling complexes with opposing roles in cell-cycle control. EmboJ26(3): 752-763. Narita, M. and Lowe, S.W. 2005. Senescence comes of age. Nat Med 11(9): 920-922. Polo, S.E. and Almouzni, G. 2006. Chromatin assembly: a basic recipe with various flavours. Curr Opin Genet Dev 16(2): 104-111. Raisner, R.M., Hartley, P.D., Meneghini, M.D., Bao, M.Z., Liu, C.L., Schreiber, S.L., Rando, O.J., and Madhani, H.D. 2005. Histone variant H2A.Z marks the 5' ends of both active and inactive genes in euchromatin. Cell 123(2): 233-248. 74 Rangasamy, D., Berven, L., Ridgway, P., and Tremethick, D.J. 2003. Pericentric heterochromatin becomes enriched with H2A.Z during early mammalian development. Embo J 22(7): 1599-1607. Ren, Q. and Gorovsky, M.A. 2001. Histone H2A.Z acetylation modulates an essential charge patch. Mol Cell 7(6): 1329-1335. Rhodes, D.R., Yu, J., Shanker, K., Deshpande, N., Varambally, R., Ghosh, D., Barrette, T., Pandey, A., and Chinnaiyan, A.M. 2004. Large-scale meta-analysis of cancer microarray data identifies common transcriptional profiles of neoplastic transformation and progression. Proc Natl Acad Sci USA 101(25): 9309-9314. Ruhl, D.D., Jin, J., Cai, Y., Swanson, S., Florens, L., Washburn, M.P., Conaway, R.C., Conaway, J.W., and Chrivia, J.C. 2006. Purification of a Human SRCAP Complex That Remodels Chromatin by Incorporating the Histone Variant H2A.Z into Nucleosomes. Biochemistry 45(17): 5671-5677. Samuelson, A.V., Narita, M., Chan, H.M., Jin, J., de Stanchina, E., McCurrach, M.E., Narita, M., Fuchs, M., Livingston, D.M., and Lowe, S.W. 2005. p400 is required for El A to promote apoptosis. J Biol Chem 280(23): 21915-21923. Santisteban, M.S., Kalashnikova, T., and Smith, M.M. 2000. Histone H2A.Z regulats transcription and is partially redundant with nucleosome remodeling complexes. Cell 103(3): 411-422. Sarcinella, E., Zuzarte, P.C., Lau, P.N., Draker, R., and Cheung, P. 2007. Monoubiquitylation of H2A.Z distinguishes its association with euchromatin or facultative heterochromatin. Mol Cell Biol 27(18): 6457-6468. Schones, D.E., Cui, K., Cuddapah, S., Roh, T.Y., Barski, A., Wang, Z., Wei, G., and Zhao, K. 2008. Dynamic regulation of nucleosome positioning in the human genome. Cell 132(5): 887-898. Segal, E., Fondufe-Mittendorf, Y., Chen, L., Thastrom, A., Field, Y., Moore, I.K., Wang, J.P., and Widom, J. 2006. A genomic code for nucleosome positioning. Nature 442(7104): 772-778. Seoane, J., Le, H.V., and Massague, J. 2002. Myc suppression of the p21(Cipl) Cdk inhibitor influences the outcome of the p53 response to DNA damage. Nature 419(6908): 729-734. Stargell, L.A., Bowen, J., Dadd, C.A., Dedon, P.C., Davis, M., Cook, R.G., Allis, CD., and Gorovsky, M.A. 1993. Temporal and spatial association of histone H2A variant hvl with transcriptionally competent chromatin during nuclear development in Tetrahymena thermophila. Genes Dev 7(12B): 2641-2651. Suto, R.K., Clarkson, M.J., Tremethick, D.J., and Luger, K. 2000. Crystal structure of a nucleosome core particle containing the variant histone H2A.Z. Nat Struct Biol 7(12): 1121-1124. Szutorisz, H., Dillon, N., and Tora, L. 2005. The role of enhancers as centres for general transcription factor recruitment. Trends Biochem Sci 30(11): 593-599. Taubert, S., Gorrini, C, Frank, S.R., Parisi, T., Fuchs, M., Chan, H.M., Livingston, D.M., and Amati, B. 2004. E2F-dependent histone acetylation and recruitment of the Tip60 acetyltransferase complex to chromatin in late Gl. Mol Cell Biol 24(10): 4546-4556. 75 Tirosh, I. and Barkai, N. 2008. Two strategies for gene regulation by promoter nucleosomes. Genome research 18(7): 1084-1091. Tyteca, S., Vandromme, M., Legube, G., Chevillard-Briet, M., and Trouche, D. 2006. Tip60 and p400 are both required for UV-induced apoptosis but play antagonistic roles in cell cycle progression. EmboJ25(8): 1680-1689. van Daal, A., White, E.M., Gorovsky, M.A., and Elgin, S.C. 1988. Drosophila has a single copy of the gene encoding a highly conserved histone H2A variant of the H2A.F/Z type. Nucleic Acids Res 16(15): 7487-7497. Venkatasubrahmanyam, S., Hwang, W.W., Meneghini, M.D., Tong, A.H., and Madhani, H.D. 2007. Genome-wide, as opposed to local, antisilencing is mediated redundantly by the euchromatic factors Setl and H2A.Z. Proc Natl Acad Sci US A 104(42): 16609-16614. West, M.H. and Bonner, W.M. 1980. Histone 2B can be modified by the attachment of ubiquitin. Nucleic Acids Res 8(20): 4671-4680. White, C.L., Suto, R.K., and Luger, K. 2001. Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions. Embo J 20(18): 5207-5218. Whittle, CM., McClinic, K.N., Ercan, S., Zhang, X., Green, R.D., Kelly, W.G., and Lieb, J.D. 2008. The genomic distribution and function of histone variant HTZ-1 during C. elegans embryogenesis. PLoSgenetics 4(9): el000187. Wu, R.S. and Bonner, W.M. 1981. Separation of basal histone synthesis from S-phase histone synthesis in dividing cells. Cell 27(2 Pt 1): 321-330. Wu, W.H., Alami, S., Luk, E., Wu, C.H., Sen, S., Mizuguchi, G., Wei, D., and Wu, C. 2005. Swc2 is a widely conserved H2AZ-binding module essential for ATPdependent histone exchange. Nat Struct Mol Biol 12(12): 1064-1071. Yuan, G.C., Liu, Y.J., Dion, M.F., Slack, M.D., Wu, L.F., Altschuler, S.J., and Rando, O.J. 2005. Genome-scale identification of nucleosome positions in S. cerevisiae. Science 309(5734): 626-630. Zanton, S.J. and Pugh, B.F. 2006. Full and partial genome-wide assembly and disassembly of the yeast transcription machinery in response to heat shock. Genes Dev 20(16): 2250-2265. Zhang, H. 2007. Molecular signaling and genetic pathways of senescence: Its role in tumorigenesis and aging. Journal of cellular physiology 210(3): 567-574. Zhang, H., Roberts, D.N., and Cairns, B.R. 2005. Genome-wide dynamics of Htzl, a histone H2A variant that poises repressed/basal promoters for activation through histone loss. Cell 123(2): 219-231. Zlatanova, J. and Thakar, A. 2008. H2A.Z: view from the top. Structure 16(2): 166-179. Zucchi, I., Mento, E., Kuznetsov, V.A., Scotti, M., Valsecchi, V., Simionati, B., Vicinanza, E., Valle, G., Pilotti, S., Reinbold, R., Vezzoni, P., Albertini, A., and Dulbecco, R. 2004. Gene expression profiles of epithelial cells microscopically isolated from a breast-invasive ductal carcinoma and a nodal metastasis. Proc Natl Acad Sci USA 101(52): 18147-18152. 76 77 CHAPTER III III.H2A.Z OVEREXPRESSION PROMOTES CELLULAR PROLIFERATION OF BREAST CANCER CELLS III.1. Preamble H2A.Z is expressed at high levels in colorectal cancers, undifferentiated cancers, and breast metastatic cancer cells, but not in normal cells (Dunican et al., 2002; Hua et al., 2008; Rhodes et al., 2004; Zucchi et al., 2004). A study by Hua et al. observed that increased H2A.Z expression is significantly associated with lymph node metastasis and decreased breast cancer survival using tissue microarray screening (TMA), and H2A.Z expression is stimulated by E2-dependent binding of Myc (Hua et al., 2008). In addition to the importance of H2A.Z in the control of the senescence response (Gevry et al., 2007), we shortly thereafter observed that H2A.Z is crucial in E2-dependent transcriptional regulation by the cyclic p400-dependent incorporation of H2A.Z which stabilizes chromatin architecture at ERa target genes (Gevry et al., 2009). In this study, we also observed that the depletion of H2A.Z decreases E2-dependent cellular proliferation in the breast cancer cell line MCF7 (Gevry et al., 2009). The manuscript in this chapter presents the results obtained following our questioning on the correlation of H2A.Z with ERa-dependent breast cancer and hormone-dependent cellular proliferation. We first show that E2-dependent increased expression of H2A.Z is 78 partly due to the binding of ERa to the H2A.Z promoter. In addition, we observe a correlation between H2A.Z and ERa levels in low grade breast cancer, and that the exogenous overexpression of H2A.Z in the MCF7 breast cancer cell line leads to increased proliferation in low levels of E2 and in the presence of TAM. This manuscript was published in the peer-reviewed journal Cell Cycle in January 2010, and the artwork from the article was featured on the cover of the journal (Svotelis, A., Gevry, N., Grondin, G., and Gaudreau, L. (2010). H2A.Z overexpression promotes cellular proliferation of breast cancer cells. Cell Cycle 9, 364-370.). The contribution to the conception and execution of the experiments were equally shared between Dr. Nicolas Gevry and myself, with the help of Gilles Grondin in the execution of the immunohistochemistry presented in Figure 3.2 and 3.3. I wrote the manuscript, aided by discussions and corrections from Drs. Nicolas Gevry and Luc Gaudreau, cocorresponding authors for the manuscript. 79 III.2. Manuscript H2A.Z overexpression promotes cellular proliferation of breast cancer cells Amy Svotelis*, Nicolas Gevry* °°, Gilles Grondin, and Luc Gaudreau00 Departement de biologie, Faculte des Sciences, Universite de Sherbrooke, Sherbrooke, Quebec, Canada * These authors contributed equally to this work. 00 Address correspondence to: Nicolas Gevry or Luc Gaudreau, Departement de biologie, Faculte des Sciences, Universite de Sherbrooke, Sherbrooke, Quebec, Canada, JIK 2R1 Tel: 819-821-8000 ext. 62081; Fax: 819-821-8049; E-Mail: Nicolas.Gevrv(2),USherbrooke.ca. or [email protected] Key words: Estrogen receptor, breast cancer, chromatin, histone variant H2A.Z, transcription, proliferation Svotelis, A., Gevry, N., Grondin, G., and Gaudreau, L. (2010). H2A.Z overexpression promotes cellular proliferation of breast cancer cells. Cell Cycle 9, 364-370. 80 Abstract We recently showed that histone H2A.Z, as well as members of the ATP-dependent p400 chromatin remodeling complex (p400.com), are essential components of estrogen receptor a (ERa) signaling. More specifically, we showed that H2A.Z and p400.com are incorporated into the promoter regions of ERa target genes only upon gene induction, and also in a cyclic fashion. RNAi-mediated cellular depletion of H2A.Z and p400.com strongly impedes estrogen-dependent growth of breast cancer cells as well as strongly affects ERa-target gene expression. Two mechanisms emerged from our studies of how H2A.Z incorporation within ERa-target regulatory regions can actually regulate estrogen-mediated signaling: 1) by stabilizing nucleosomes within the translational DNA axis, a process that allows general transcription factors to be efficiently recruited to promoter regions; 2) by allowing estrogen-responsive enhancer function. In the current study, we now show that in MCF7 cells, ectopic overexpression of H2A.Z increases proliferation, and such in conditions where estrogen levels are low. Also, immunohistochemical studies of breast cancer biopsies show that the presence of H2A.Z correlates highly with that of ERa, but is associated with high-grade ER-negative cancers. Finally we show that ERa directly associates to the H2A.Z promoter, and consequently modulates its expression. Our study provides a possible link between H2A.Z and endocrine resistance by showing that H2A.Z overexpression leads to increased growth, particularly when estrogen levels are very low. 81 Introduction Breast cancer is the one of the leading causes of death in females, second only to lung Cancer ("Canadian Cancer Society/National Cancer Institute of Canada: Canadian Cancer Statistics 2008, Toronto, Canada, 2008."April 2008, ISSN 0835-2976). Although treatment of the disease is increasingly possible, the incidence of breast cancer continues to grow and resistance to common chemotherapy is common. Breast cancer is generally categorized by either estrogen receptor (ER)-positive or ER-negative cancers. The ER is a nuclear receptor that is activated by its ligand estrogen (E2) which, once activated, promotes transcriptional activation of gene targets that contain estrogen response elements (ERE) '. There exists both ERa and ERp, and many of ERa target genes are involved in cellular proliferation . Notably, recent studies have suggested that ERa receptors can stimulate transcription of RNA polymerase II target genes by promoting modification of chromatin, creating favorable promoter architecture for the establishment of stable initiation complexes 3. Chromatin is now considered an extremely dynamic structure that changes to control gene expression 4. H2A.Z is a histone variant that has been implicated principally in inducing local changes in chromatin structure and subsequently the regulation of gene expression 5"7. H2A.Z is an essential gene in metazoan models, such as Tetrahemena Q 1 I thermophila, Xenopus laevis, Drosophila melanogaster and Mus musculus ' , and is required for the proper regulation of many cellular processes. The deposition of H2A.Z into chromatin genome-wide has been shown to be associated with and regulated by the SRCAP and p400/Tip60 complexes in mammalian cells 12 14 7 15 " . The positioning of H2A.Z in chromatin and its specific location in gene regulatory areas and promoters can contribute both to the positive or negative regulation of transcriptional activity ' . We have recently shown that H2A.Z is important in the regulation of ERa-dependant transcription and estrogen-specific cell proliferation . The incorporation of H2A.Z within the chromatin positions nucleosomes in the promoter area of TFF1, an ERadependant model gene. In addition, H2A.Z is essential in estrogen-responsive enhancer function by allowing the recruitment of the factor FoxAl. 82 In addition to the recent insights on the mechanistic function of H2A.Z, it has been observed that increased expression of H2A.Z has been observed in colorectal cancers, undifferentiated cancers and breast metastatic cancer cells as compared to normal cells ,7"20. Recent studies published by our group not only showed that the depletion of H2A.Z expression causes cellular senescence, but that H2A.Z is required for E2-dependent cellular proliferation ' . Taken together, these studies suggest that H2A.Z is important in promoting proliferation. We thus hypothesized on the correlation of H2A.Z with carcinogenesis and the malignancy of tumors, namely in ERa-positive and ERa-negative cancers, as well as its role in the establishment of these cancers. In this report we show that H2A.Z promotes growth in breast cancer cells, and such, in an estrogen-independent manner. Also, H2A.Z correlates with ERa in low grade breast cancers, but is preferentially expressed in high grade cancers, in which we no longer observe an association with ERa. Finally, we show that the ERa directly regulates H2A.Z expression. 83 Results The overexpression of H2A.Z promotes the proliferation of breast cancer cells To determine whether H2A.Z expression levels influence breast cancer progression, we overexpressed H2A.Z in the ERcc-positive MCF7 breast cancer cell line using a lentiviral vector, using the overexpression of canonical histone H2A as a control. The protein and mRNA overexpression levels were verified by Western blot and quantitative PCR (qPCR) (Figure 1A and 4B). The in vitro growth potential of the different cell lines in the absence and presence of E2 or tamoxifen (TAM) was verified. Cell counts were performed at different time intervals (day 0, 2, 4, 6 and 8). Interestingly, H2A.Z overexpression promotes significantly proliferation in the absence of E2 (Figure 1C) and in the presence of TAM (Figure IE) when compared to the empty vector control (WPI) or H2A overexpression, whereas E2-dependent cell population growth is similar for all cell lines (Figure ID). To determine if the presence of ERa is required for H2A.Z to affect proliferation, we performed similar experiments in the MCF10A mammary epithelial cell line, which are ER-negative. As seen in Figure IF, the overexpression of H2A.Z has no effect on the proliferative capacity of these cells. Similar results were obtained in the MDA-MB-231 ER-negative breast cancer cells (data not shown). Taken together, these results suggest that increased H2A.Z expression leads to increased cellular proliferation and this effect is better visualized when estrogen levels are very low. Increased expression ofH2A.Z is observed in breast cancer To determine a link between increased H2A.Z expression and transformed cells, we verified the expression of H2A.Z and its correlation with breast cancer in several different manners. First, the expression of H2A.Z mRNA was verified using a cDNA panel generated using tissue from normal and breast cancer biopsy tissue. The relative expression of H2A.Z mRNA was calculated using H2A, and correlated to the reported expression of ERa. As seen in Figure 2A, increased H2A.Z expression correlates with high ERa expression in cancerous breast tissue and common breast cancer cell lines 84 MCF7, T47D, and MDA-MB-231. Basal levels of H2A.Z expression are observed in A B Expression of H2A.Z in MCF7 cell lines (n=4) 20' Q 18& 16' g o 14 1 § 12£ Overexpression: CTL _ IB: anti-H2A.Z H2A H2A.Z _ „ « — IB: arrti-FLAG «—H2A Z-FLAG •-endogenous H2A2 — — • U* - » 8 6 4& 20 WPI- D -E2 WPI-H2A WPI-H2A.Z (cellli •E2(1<J 8 M) 400 1 ^ §, 300 I 25° / 1 200 / ' /W,/' & 150 I 50 — , — , — , ,-r,-m-f--,— 6 -•-WPI *H2A »H2AZ / 6 8 (days) 8 (rj a ys) Growth of MCF10A cells Growth in presence of Tamoxifen (10 " M) 300 250 ~WP| »H2A *H2AZ 200 150 100 50 i>^ • . • • i K—,- 6 8 (days) 6 8 (days) Figure 3-1 : The overexpression of H2A.Z promotes E2-independent cell growth. Overexpressed H2A.Z was scored by immunoblotting H2A.Z and FLAG in histone extracts of MCF7 cell lines (A) and by RT-qPCR using oligonucleotide primers specific for H2A.Z (B; normalized using GAPDH as a control). The overexpression of H2A.Z increases proliferation of MCF7 cells in the absence of E2 (C) and in the presence of TAM (E), but does not affect E2-dependent growth (D). The overexpression of H2A.Z in ERa-negative MCF10A cells does not affect proliferation (F). 85 %N &$>+** $ **%sv%s* Normal Breast B MW#^>VW Breast Cancer Hoechst />°/ ^ ^ Merge ER+ Tumor ERTumor Figure 3-2 : H2A.Z is overexpressed in several different cancerous cell lines and tissues and correlates with ERa levels. (A) A cDNA panel created from normal and cancerous breast tissues (Origene) was quantified for H2A.Z RNA levels in as well as in different invasive cell lines (T47D, MCF7, and MD-AMB-231), normalized using GAPDH as a control. (B) Coimmunolocalisation of both H2A.Z and ERa by immunochemistry in tissues obtained from biopsies of ERa-positive and ERa-negative breast cancers shows a strong colocalisation pattern exists between H2A.Z and ERa. 86 normal breast tissue. The correlation observed between H2A.Z and ERa increased expression led us to investigate protein levels and co-immunolocalisation of both H2A.Z and ERa by immunochemistry in tissues obtained from biopsies of ERa-positive and ERa-negative breast cancers. Figure 2B shows that strong protein levels of H2A.Z are observed in ERa-positive tumors with lower levels present in ERa-negative tumors, and a strong colocalisation pattern exists between H2A.Z and ERa. Increased expression of H2A.Z correlates with ERa levels in low grade breast tumors whereas high grade breast cancer shows only high levels ofH2A.Z To further investigate correlative patterns between H2A.Z and ERa, we obtained a tissue array that contained 208 spots of normal and cancerous biopsy tissue, from which pathology reports are provided containing information on location and tumor grade. Antibodies specific for H2A.Z and ERa were hybridized to the array in order to determine correlations between H2A.Z, ERa and severity of breast cancer. As seen in table 1, in low grade cancers we observe a strong correlation (72%) between the expression of H2A.Z and ERa. This correlation diminishes drastically with increased tumor grade, and we observe that 70% of grade 3 tumors (50%) that are only positive for H2A.Z expression and 5 % for ERa. Furthermore, none of the biopsy tissues investigated showed co-expression of H2A.Z and ERa for the grade 3 tumors. Representative images of each grade are shown in Figure 3. These results indicate that, although we observe strong correlations between H2A.Z and ERa in low grade carcinoma (Fig. 2B, Table 1), the highest proportion of high grade tumor tissues are positive for H2A.Z and negative for ERa (Table 1). Relating back to the observations in figure 1, we can suggest that increased H2A.Z expression could lead to independence of E2-controlled cellular proliferation. In addition, a bioinformatics analysis of available microarray data from the literature shows that H2A.Z expression in breast cancer is highly correlated with increased expression of several cell-cycle related genes such as cyclin B2, cyclin A2, cyclin Bl and PCNA (see table 2). These results point toward a link between ERa and 87 H2A.Z in cancerous tissues, as well as a strong correlation between increased H2A.Z expression and the proliferative capacity of cells. Hoechst Merge Figure 3-3 : High grade breast cancer correlates with high levels of H2A.Z. A tissue array containing 208 spots of normal and cancerous biopsy tissue was analysed for H2A.Z and ERa protein levels. Here we present representative examples of biopsies of grade 1, 2 and 3 tissues. The analysis showed that the highest proportion of high grade tumor tissues is positive for H2A.Z and negative for ERa. Table 3-2 : High grade breast cancer correlates with high levels of H2A.Z. The results from the immunocolocalisation analysis of H2A.Z and ERa from a tissue array containing 208 spots of normal and cancerous biopsy tissue are illustrated below. We observe strong correlations between H2A.Z and ERa in low grade carcinoma the highest proportion of high grade tumor tissues are positive for H2A.Z and negative for ERa. T u m o r grade Grade 1 Grade 1-2 Grade 2 Grade 2-3 Grad*3 H2A.Zand ERalpha 72 14 5 20 0 50 HMZ 14 28 19 20 ERalpha 0 14 6 0 6 Undetectable 14 44 70 60 44 Total 100 100 100 100 100 Percentage of >osittve samples Table 3-3 : High levels of H2A.Z correlate with high levels of important cell cycle regulators. A bioinformatics analysis of available microarray data from the literature shows that H2A.Z expression in breast cancer is highly correlated with increased expression of several cell-cycle related genes such as cyclin B2, cyclin A2, cyclin Bl and PCNA. Gene No. studies % studies Gene name H2AFZ 20 100% H2A hittone family, member Z CDC2 13 65% cell division cycle 2, G, to S and GjtoM CCNB2 13 65% cyclin B2 CCNA2 12 60% cyclin A2 AURKA 12 60% aurora kinase A PCNA it 55% proliferating cell nuclear antigen CCNBI n 55% cyclin Bl 89 ERa regulates the expression ofH2A.Z in breast cancer cells Considering that H2A.Z levels are high in ERa-positive breast cancers (Hua et al., 2008, Fig. 2A), we set out to determine whether ERa could directly regulate the expression of H2A.Z in breast cancer cells. First, we verified if E2 could induce H2A.Z expression in MCF7 cells. Figure 4B shows that after 4 h of E2 treatment, H2A.Z expression increases more than 2.5 fold. Figure 4A shows a graphical representation of the H2A.Z promoter that includes the localization of putative regulatory elements described by Hatch and Bonner (Hatch and Bonner 1995; Hatch and Bonner 1996), as well as regulatory elements scored by a bioinformatics analysis using the TransFac database. Our in silico approach did not detect the presence of an ERE, but has nevertheless revealed two Spl sites and one AP-1 site, two factors that have been shown to be able to recruit ERa to promoters by a non-classical pathway (Figure 4A) 2 . To further characterize the implication of the E2 signaling pathway, we investigated the recruitment of ERa at the H2A.Z promoter in MCF7 cells by ChIP assay. Figure 4C shows a ChIP experiment performed with an antiERa antibody in which we observe that the receptor begins to accumulate at the H2A.Z promoter after 15 minutes of E2 treatment, reaching a peak at 30 minutes (Figure 4C), and proportionally decreasing thereafter. This interesting result suggests that ERa can also engage in coordinated cycles at H2A.Z. In Figure 4C, amplicon "O" was used as a negative control, and indeed shows no significant enrichment in ERa binding. Taken together, our results show that ERa and H2A.Z are involved in a positive feedback loop that appears important for ERa signaling under normal and pathological conditions. 90 +1^ Q.O<CLUDLO -2.2 kb 1//u 5 woowotoo P TnnoMnnr -0.2 kb B Figure 3- 4 : ERa regulates the expression of H2A.Z in breast cancer cells. (A) Representation of the H2A.Z promoter with the putative cis-acting elements and primers used for qPCR. (B) H2A.Z mRNA expression levels after 4 h of E2 treatment in MCF7 cells. (C) ChIP assay showing the binding of ERa at the H2A.Z promoter at different time after E2 activation. Discussion Our data supports a strong link between H2A.Z and ERa-dependent breast tumor proliferation. Several lines of evidence argue for such a possibility: 1) H2A.Z is essential component of E2-dependent breast cancer cell growth l6; 2) H2A.Z and ERa levels have been shown to correlate in several breast cancer samples tested; and 3) ERa directly regulates H2A.Z gene expression. Although the link between H2A.Z and breast cancer has recently been addressed l7, many questions remained following this study. A recent study demonstrated the link between H2A.Z and breast cancer more concretely, and that H2A.Z expression is stimulated by E2-dependent binding of Myc l7. First of all, 91 we show here for the first time that E2-dependent increased expression of H2A.Z is partly due to the binding of ERa to the H2A.Z promoter. It has never before been shown which factors directly bind to the H2A.Z promoter area and regulate its expression. ERa is known to stimulate expression of cell-cycle related genes and promote proliferation. The expression of H2A.Z has often been considered not regulated throughout the cell cycle, yet we know that there is a peak of H2A.Z expression at the Gl/S transition during the cell cycle (data not shown, ). In addition, the increased expression observed of H2A.Z in breast cancers is associated with increased expression of several cell-cycle related genes (see Table 2). The association between ERa and H2A.Z is also evident with the high levels of correlation between ERa and H2A.Z protein levels in low-grade breast cancers (Table 1 and Fig. 3). Interestingly, although the incidence of ERa-related breast cancers decrease with increased grade, the levels of H2A.Z expression increases, in line with a previous study . Furthermore, the p400/Tip60 complex, who incorporate H2A.Z into chromatin, has been associated with the control of expression of several important transcription factors involved in the control of cell proliferation, such as E2F1, p53, KAI1 and Myc " . Tip60 has been shown to participate in the activation of p21 expression 27"29. In line with this, Tip60 acts as a haplo-insufficient tumour suppressor, in wherein Tip60 heterozygous mice are more sensitive to Myc-induced lymphomas . These mice show defects in the DNA-damage response, yet the defects are not due to a deregulation of p53- or Myc-induced transcription , which suggests an additional unknown function of Tip60 in the cell cycle. The interplay between Tip60 and p400 has recently been investigated, showing that the balance between the two proteins affects carcinogenesis 31. Of most importance in this study is our demonstration that increased H2A.Z expression promotes cellular proliferation, namely when E2 levels are low and during tamoxifen treatment. Although several studies have shown increased levels of H2A.Z in breast cancer 17'32'33, no group has yet modified the expression of H2A.Z to determine its role in the regulation of cellular proliferation besides ours (Fig. 4, 7 ' l 6 ). In this study we 92 provide evidence that not only does H2A.Z correlate with increased cellular proliferation, but may be a causal factor. Interestingly, the effects of increased H2A.Z expression in MCF7 cells leads to increased growth notably in the absence of E2 and in the presence of tamoxifen. Tamoxifen is widely used to treat breast cancer due to its capacity to bind ERa and inhibit the activation potential of the nuclear receptor. Our study shows that, as expected, MCF7 cells do not proliferate well in the presence of tamoxifen, but the overexpression of H2A.Z overrides the toxic potential of tamoxifen. This result, in combination with the observation that H2A.Z is highly associated with high grade ERnegative breast cancers (Table 1 and Fig. 3) indicates that H2A.Z could possibly be a factor important in the transformation of breast cancer cells and the establishment of endocrine resistance. This is a concern that is of major clinical importance in the treatment of breast cancers, and the control of H2A.Z expression could be at the heart of the issue. 93 Experimental procedures Cell culture and lentiviral infection. MCF7 cells were maintained in DMEM (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS) and antibiotics. MCF10A cells were maintained in DMEM-F12 (Invitrogen) with 5% horse serum (Invitrogen), containing a growth factor mix (human epithelial growth factor at 20 ng/ml, hydrocortisone at 0.5 ug/ml, and insulin at 10 ug/ml, SIGMA-ALDRICH, St. Louis, MO, USA) and antibiotics. 17n-estradiol (SIGMA-ALDRICH) and tamoxifen (SIGMA-ALDRICH) were used at concentrations of lOOnM and luM, respectively. Constructs overexpressing H2A or H2A.Z were inserted into MCF7 and MCF10A cells using lentiviral infections as described previously (in7,2fi). Efficiency of lentiviral infection was verified by detection of GFP by fluorescence microscopy and immunoblotting using antibodies specific for the overexpressed proteins, or FLAG M2 monoclonal antibody (SIGMA). Cell proliferation assay The cell proliferation assay has been described previously, with slight modifications 7. Briefly, 1 x 104 cells were seeded in a 48-well plate. Twelve hours after plating, one plate was trypsinized for counting. At the indicated time points, other assay plates were also trypsinized and counted. The values were normalized to those of the time zero plate. Each data point presented is the average value of triplicate samples. RNA extraction and RT-qPCR Total RNA was isolated using the GenElute Mammalian Total RNA kit (SIGMA). RNA was reverse-transcribed into first-strand cDNA using MMLV reverse transcriptase (Promega, Madison, WI, USA). Samples were subjected to Q-PCR using MX3000P (Stratagene, Cedar Creek, TX, USA). The cDNA panel created from normal and cancerous breast tissues originates from Origene (Rockville, MD, USA). Q-PCR for 36B4 (which encodes a ribosomal protein subunit) and GAPDH mRNA were used as 94 internal controls. The relative abundance of target mRNA (or other test genes) was calculated following normalization using 36B4 mRNA, where relative expression levels were calculated as 2"01", where CT = (CT test gene -CT 36B4). ChIP assays MCF7 cells were deprived of hormonal stimulation for at least 3 days and then treated with 100 nM of 17p-estradiol for the indicated time. ChIP assays were performed essentially as described previously (7'16,26 with a panel of specific polyclonal antibodies generated in-house or from commercial sources, as well as preimmune and no antibody controls. Samples were sonicated to generate DNA fragments <500 bp. PCR was performed using a set of primers relevant to the promoter regions of the H2A.Z and analyzed by Q-PCR. Immunochemistry Paraffin embedded tissue was cut at 4 urn thickness, deparaffinized and rehydrated. Antigenicity lost during fixation and embedding process was retrieved by heat treatment in a pressure cooker for 9 min in ImM EDTA, 10 mM Tris-HCl ph 8.0. Tissue sections were permeabilized with 50% methanol at - 20° C for 5 min and in PBSP (PBS with 2% normal goat serum, 2% BSA and 0.45 % of fish gelatin) for 10 min. Tissue sections were incubated for overnight at 4°C with primary antibodies, ER mouse monoclonal and H2A.Z at dilutions 1:100 in PBSB. Control tissue sections were incubated similarly with a nonspecific immune serum. Primary antibodies were detected by incubation with Alexa Fluor 488 goat anti-mouse IgG (Invitrogen) and Alexa Fluor 546 goat anti-rabbit IgG (Invitrogen) at a dilution of 1:200 in PBSB for 2 h at room temperature. After several washes, the nuclei were stained 10 min with Hoechst 33342 (Invitrogen) at 1:5000 dilution for epifluorescence or with To-Pro-3 iodine (Invitrogen) at 1:1000 dilution for confocal microscopy. Finally, sections were mounted in Prolong Gold anti-fade reagent (Invitrogen). Pictures were taken with using an inverted Olympus IX 70 microscope with a Cool SNAP-Pro cf monochrome camera and Image-Pro Plus software or with Olympus 95 Fluoview FV 300 confocal system. For the cell and tissue array labeling, the same protocol was used, omitting the deparaffinisation, hydration and heat retrieval steps. The tissue array used in this study was the BR2085a array obtained from US Biomax, Inc., Rockville, MD, USA. Antibodies The ERD polyclonal (HC20), ERp monoclonal (N20), and RNA pol II antibodies (N20) were purchased from Santa Cruz Biotechnology, Santa Cruz, CA, USA. Polyclonal antibodies to H2A.Z (07-594) were from Upstate Biotechnology (Millipore, Billerica, MA, USA). Histone H3 (ab 1791) and H2A.Z (ab4174) were purchased from Abeam (Cambridge, MA, USA). Lentiviral constructions A FLAG-peptide was cloned to the 3'-end of the coding regions of H2A and H2A.Z, and the constructs were inserted into the multiple cloning site of pcDNA4-TO (Invitrogen) using BamHI and EcoRI. The resulting constructs were then digested using Pmel in order to sub-clone into the pWPI vector. 293T cells were transfected with our pWPI constructs and the packaging vectors MD2G and PAX2 (gift from Dr. Didier Trono) and viruses contained in the cell medium were collected 48h following transfection. 96 Acknowledgements: We thank Brian Wilson for biostatistical insight on our study. The authors acknowledge support from the Canadian Cancer Society and from the Canadian Institutes of Health Research. L.G. holds a Canada Research Chairs on Mechanisms of Gene Transcription. A.S. was a recipient of a doctoral studentship from the Natural Sciences and Engineering Research Council of Canada. 97 References: 1. Bjornstrom L, Sjoberg M. Mechanisms of estrogen receptor signaling: convergence of genomic and nongenomic actions on target genes. Mol Endocrinol 2005; 19:833-42. 2. Matthews J, Gustafsson JA. Estrogen signaling: a subtle balance between ER alpha and ER beta. Mol Interv 2003; 3:281-92. 3. Metivier R, Huet G, Gallais R, Finot L, Petit F, Tiffoche C, Merot Y, LePeron C, Reid G, Penot G, Demay F, Gannon F, Flouriot G, Salbert G. Dynamics of estrogen receptor-mediated transcriptional activation of responsive genes in vivo: apprehending transcription in four dimensions. Advances in experimental medicine and biology 2008; 617:129-38. 4. Li B, Carey M, Workman JL. The role of chromatin during transcription. Cell 2007; 128:707-19. 5. Guillemette B, Bataille AR, Gevry N, Adam M, Blanchette M, Robert F, Gaudreau L. Variant histone H2A.Z is globally localized to the promoters of inactive yeast genes and regulates nucleosome positioning. PLoS Biol 2005; 3:e384. 6. Svotelis A, Gevry N, Gaudreau L. Regulation of gene expression and cellular proliferation by histone H2A.Z. Biochem Cell Biol 2009; 87:179-88. 7. Gevry N, Chan HM, Laflamme L, Livingston DM, Gaudreau L. p21 transcription is regulated by differential localization of histone H2A.Z. Genes Dev 2007; 21:1869-81. 8. van Daal A, White EM, Gorovsky MA, Elgin SC. Drosophila has a single copy of the gene encoding a highly conserved histone H2A variant of the H2A.F/Z type. Nucleic Acids Res 1988; 16:7487-97. 9. Liu X, Li B, GorovskyMa. Essential and nonessential histone H2A variants in Tetrahymena thermophila. Mol Cell Biol 1996; 16:4305-11. 10. Iouzalen N, Moreau J, Mechali M. H2A.ZI, a new variant histone expressed during Xenopus early development exhibits several distinct features from the core histone H2A. Nucleic Acids Res 1996; 24:3947-52. 11. Faast R, Thonglairoam V, Schulz TC, Beall J, Wells JR, Taylor H, Matthaei K, Rathjen PD, Tremethick DJ, Lyons I. Histone variant H2A.Z is required for early mammalian development. CurrBiol 2001; 11:1183-7. 12. Cai Y, Jin J, Florens L, Swanson SK, Kusch T, Li B, Workman JL, Washburn MP, Conaway RC, Conaway JW. The mammalian YL1 protein is a shared subunit of the TRRAP/TIP60 histone acetyltransferase and SRCAP complexes. J Biol Chem 2005; 280:13665-70. 13. Wu WH, Alami S, Luk E, Wu CH, Sen S, Mizuguchi G, Wei D, Wu C. Swc2 is a widely conserved H2AZ-binding module essential for ATP-dependent histone exchange. Nat Struct Mol Biol 2005; 12:1064-71. 14. Ruhl DD, Jin J, Cai Y, Swanson S, Florens L, Washburn MP, Conaway RC, Conaway JW, Chrivia JC. Purification of a Human SRCAP Complex That Remodels Chromatin by Incorporating the Histone Variant H2A.Z into Nucleosomes. Biochemistry 2006;45:5671-7. 98 15. John S, Sabo PJ, Johnson TA, Sung MH, Biddie SC, Lightman SL, Voss TC, Davis SR, Meltzer PS, Stamatoyannopoulos JA, Hager GL. Interaction of the glucocorticoid receptor with the chromatin landscape. Mol Cell 2008; 29:611-24. 16. Gevry N, Hardy S, Jacques PE, Laflamme L, Svotelis A, Robert F, Gaudreau L. Histone H2A.Z is essential for estrogen receptor signaling. Genes & development 2009; 23:1522-33. 17. Hua S, Kallen CB, Dhar R, Baquero MT, Mason CE, Russell BA, Shah PK, Liu J, Khramtsov A, Tretiakova MS, Krausz TN, Olopade 01, Rimm DL, White KP. Genomic analysis of estrogen cascade reveals histone variant H2A.Z associated with breast cancer progression. Molecular systems biology 2008; 4:188. 18. Zucchi I, Mento E, Kuznetsov VA, Scotti M, Valsecchi V, Simionati B, Vicinanza E, Valle G, Pilotti S, Reinbold R, Vezzoni P, Albertini A, Dulbecco R. Gene expression profiles of epithelial cells microscopically isolated from a breast-invasive ductal carcinoma and a nodal metastasis. Proc Natl Acad Sci U S A 2004; 101:18147-52. 19. Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T, Pandey A, Chinnaiyan AM. Large-scale meta-analysis of cancer microarray data identifies common transcriptional profiles of neoplastic transformation and progression. Proc Natl Acad Sci U S A 2004; 101:9309-14. 20. Dunican DS, McWilliam P, Tighe O, Parle-McDermott A, Croke DT. Gene expression differences between the microsatellite instability (MIN) and chromosomal instability (CIN) phenotypes in colorectal cancer revealed by high-density cDNA array hybridization. Oncogene 2002; 21:3253-7. 21. Hatch CL, Bonner WM. Sequence of cDNAs for mammalian H2A.Z, an evolutionarily diverged but highly conserved basal histone H2A isoprotein species. Nucleic Acids Res 1988; 16:1113-24. 22. Nagl NG, Jr., Wang X, Patsialou A, Van Scoy M, Moran E. Distinct mammalian SWI/SNF chromatin remodeling complexes with opposing roles in cell-cycle control. Embo J 2007; 26:752-63. 23. Taubert S, Gorrini C, Frank SR, Parisi T, Fuchs M, Chan HM, Livingston DM, Amati B. E2F-dependent histone acetylation and recruitment of the Tip60 acetyltransferase complex to chromatin in late Gl. Molecular and cellular biology 2004; 24:4546-56. 24. Samuelson AV, Narita M, Chan HM, Jin J, de Stanchina E, McCurrach ME, Narita M, Fuchs M, Livingston DM, Lowe SW. p400 is required for El A to promote apoptosis. J Biol Chem 2005; 280:21915-23. 25. Kim JH, Kim B, Cai L, Choi HJ, Ohgi KA, Tran C, Chen C, Chung CH, Huber O, Rose DW, Sawyers CL, Rosenfeld MG, Baek SH. Transcriptional regulation of a metastasis suppressor gene by Tip60 and beta-catenin complexes. Nature 2005; 434:9216. 26. Chan HM, M. Narita, S. W. Lowe, and D. M. Livingston. . The p400 E1Aassociated protein is a novel component of the p53 --> p21 senescence pathway. . Genes & development 2005; 19. 99 27. Legube G, Linares LK, Tyteca S, Caron C, Scheffner M, Chevillard-Briet M, Trouche D. Role of the histone acetyl transferase Tip60 in the p53 pathway. J Biol Chem 2004; 279:44825-33. 28. Tyteca S, Vandromme M, Legube G, Chevillard-Briet M, Trouche D. Tip60 and p400 are both required for UV-induced apoptosis but play antagonistic roles in cell cycle progression. Embo J 2006; 25:1680-9. 29. Berns K, Hijmans EM, Mullenders J, Brummelkamp TR, Velds A, Heimerikx M, Kerkhoven RM, Madiredjo M, Nijkamp W, Weigelt B, Agami R, Ge W, Cavet G, Linsley PS, Beijersbergen RL, Bernards R. A large-scale RNAi screen in human cells identifies new components of the p53 pathway. Nature 2004; 428:431-7. 30. Gorrini C, Squatrito M, Luise C, Syed N, Perna D, Wark L, Martinato F, Sardella D, Verrecchia A, Bennett S, Confalonieri S, Cesaroni M, Marchesi F, Gasco M, Scanziani E, Capra M, Mai S, Nuciforo P, Crook T, Lough J, Amati B. Tip60 is a haploinsufficient tumour suppressor required for an oncogene-induced DNA damage response. Nature 2007; 448:1063-7. 31. Mattera L, Escaffit F, Pillaire MJ, Selves J, Tyteca S, Hoffmann JS, Gourraud PA, Chevillard-Briet M, Cazaux C, Trouche D. The p400/Tip60 ratio is critical for colorectal cancer cell proliferation through DNA damage response pathways. Oncogene 2009; 28:1506-17. 32. Camp RL, Chung GG, Rimm DL. Automated subcellular localization and quantification of protein expression in tissue microarrays. Nat Med 2002; 8:1323-7. 33. van de Vijver MJ, He YD, van't Veer LJ, Dai H, Hart AA, Voskuil DW, Schreiber GJ, Peterse JL, Roberts C, Marton MJ, Parrish M, Atsma D, Witteveen A, Glas A, Delahaye L, van der Velde T, Bartelink H, Rodenhuis S, Rutgers ET, Friend SH, Bernards R. A gene-expression signature as a predictor of survival in breast cancer. The New England journal of medicine 2002; 347:1999-2009. 100 CHAPTER IV IV. H3K27 DEMETHYLATION BY JMJD3 AT A POISED ENHANCER OF ANTI-APOPTOTIC GENE BCL2 DETERMINES E R a LIGAND-DEPENDENCY IV. 1. Preamble Our observations on the role of H2A.Z in ERa-positive breast cancer cells (MCF7) and their estrogen-independent growth (Gevry et al., 2009; Svotelis et al., 2009; Svotelis et al., 2010) led us to hypothesize on other important chromatin modifications in ERadependent transcriptional response in breast cancer. E2 cellular stimulation results in an ERa-mediated genomic response in which ERa interacts with several coactivators at target genes, as well as a rapid non-genomic response where ERa associates with protein kinase signalling pathways such as that of PI3K/Akt (Ordonez-Moran and Munoz, 2009). One known coactivator of ERa is MLL2, present in a complex that may also contain the H3K27me3 KDM UTX and JMJD3 (Issaeva et al., 2007). We thus put forward the theory that H3K27 demethylation may have a role in the expression of ERa target genes. In this manuscript we present results that show the importance of H3K27me3 dynamics in the essential process of apoptosis control in E2-positive breast cancer. We propose a model in which a repressive chromatin state following stimulation by E2 in ERadependent cancerous cells caused by H3K27 methylation is permissive for the regulation of BCL2 transcription by a mechanism that comprises the interdependent recruitment of ERa and JMJD3. However, the phosphorylation of EZH2 caused by the overexpression 101 of HER2 in AE-resistant breast cancer cells prevents the methylation of H3K27 surrounding the enhancer region of BCL2, allowing the formation of an active chromatin conformation and constitutive activation of BCL2. We believe these findings are of great significance since we show that fundamental epigenetic mechanisms and the signature of epigenetic marks on chromatin can provide important clues on AE-resistance and breast cancer. This manuscript is under revision in EMBO Journal. I performed the majority of the experiments presented in the manuscript. Dr. Stephanie Bianco contributed to the execution and analysis of the microarray in Figure 4.2. Gabrielle Huppe provided an important contribution to the execution of certain Western blot, RT-qPCR and FACS analyses. Jason Madore and Dr. Anne-Marie Mes-Masson performed the breast cancer TMA analysis and Alexei Nordell Markovits contributed to the clustering analysis of the TMA. I wrote the manuscript in collaboration with Dr. Gevry, aided by discussions and corrections from co-authors. 102 IV.2. Manuscript H3K27 demethylation by JMJD3 at a poised enhancer of antiapoptotic gene BCL2 determines ERa ligand-dependency Amy Svotelis , Stephanie Bianco , Jason Madore Gabrielle Huppe , Alexei NordellMarkovits1, Anne-Marie Mes-Masson2 and Nicolas Gevry1'3 'Departement de biologie, Faculte des sciences, Universite de Sherbrooke, 2500 boulevard de PUniversite, Sherbrooke, Quebec J1K 2R1, Canada 2 Institut du cancer de Montreal, 1560 Sherbrooke Est, Montreal, Quebec, H2L 4M1, Canada Correspondence: [email protected]; Tel. (819) 821-8000 ext. 66013; Fax: (819)821-8049 Submitted to EMBO Journal March 15th, 2011, under revision since April 8th, 2011 103 Abstract Chromatin represents a repressive barrier to the process of ligand-dependent transcriptional activity of nuclear receptors. Here we show that H3K27 methylation imposes ligand dependent regulation of the estrogen receptor a (ERa)-dependent apoptotic response via Bcl-2 in breast cancer cells. The activation of BCL2 transcription is dependent on the simultaneous inactivation of the H3K27 methyltransferase, EZH2, and the demethylation of H3K27 at the poised enhancer by the ERa-dependent recruitment of JMJD3 in hormone-dependent breast cancer cells. Interestingly, we also provide evidence that this pathway is modified in cells resistant to anti-estrogen (AE), which constitutively express BCL2. We show that the lack of H3K27 methylation at BCL2 regulatory elements due to the inactivation of EZH2 by the HER2 pathway leads to this constitutive activation of BCL2 in these AE-resistant cells. Our results describe a novel mechanism in which the epigenetic state of chromatin affects ligand dependency during ERa-regulated gene expression. 104 Introduction Estrogens (E2) are physiologically important steroid hormones that influence proliferation, differentiation, and apoptosis in hormone-dependent breast cancer (Pearce and Jordan, 2004). The functions of E2 are mainly mediated by ERa, a ligand-dependent transcription factor that functions in conjunction with coregulator proteins to control gene expression by binding to gene regulatory regions that contain an estrogen response element (ERE) (Pearce and Jordan, 2004). Despite being an important inducer of cellular proliferation, ERa presence in breast cancers is often prognostic of an increased survival rate (Badve and Nakshatri, 2009). This is in part due to the development of antiestrogens (AE), synthetic molecules that compete with E2 for binding to ERa, which have shown to be a successful treatment in ERa-positive breast cancers (Doisneau-Sixou et al., 2003; Normanno et al., 2005). While AE (for example, tamoxifen (TAM) or fulvestrant (ICI182780)) can be beneficial to a large number of patients, resistance to these drugs is a major problem in the treatment of breast cancer (Normanno et al., 2005; Riggins et al., 2007). Interestingly, patients can exhibit resistance in response to the initial treatment, or can develop resistance after prolonged exposure to AE (Badia et al., 2007). Both types of AE-resistant breast cancers show a deregulation in their ERa gene expression program resulting in E2-independent proliferation (Badia et al., 2007; Naughton et al., 2007; Normanno et al., 2005; Riggins et al., 2007; Sommer and Fuqua, 2001). However, the genomic events involved in the development of AE resistance in breast cancer are not clearly defined. ERa regulates target gene transcription by recruiting coactivator proteins to favor the recruitment of the basal transcriptional machinery (Pearce and Jordan, 2004). More specifically, current models of ERa action suggest that this receptor stimulates transcription of RNA polymerase II (RNAPII) target genes by promoting favourable alterations in promoter structure and the formation of stable transcriptional pre-initiation complexes on hormone-responsive promoters embedded in chromatin (Mellor, 2005). The majority of EREs are present in enhancers that are distal from the transcription start 105 site (TSS), and lead to the formation of chromatin loops by associating with proximal promoter regions to enhance gene expression of ERa-regulated genes (Fullwood et al., 2009). E2 stimulation in cells can also lead to a non-genomic response, in which ERa target gene expression is modified by actions outside the nucleus implicating the association of ERa with membrane proteins or cytoplasmic signalling proteins, such as AKT (Ordonez-Moran and Munoz, 2009; Razandi et al., 2002; Russell et al., 2000). These effects are known to stimulate cell-cycle progression and inhibit apoptosis in MCF7 cells (Arold et al., 2001; Castoria et al., 2001). Interestingly, recent research alludes to the crossover between the genomic and non-genomic pathways of estrogen action in the control of chromatin remodelling (Bredfeldt et al., 2010). The dynamic nature of chromatin has been brought to light in the last decade, showing that the once believed static nature of regularly spaced nucleosomes along DNA is actually constantly changing in response to the cellular environment. The modifications of histones affects nucleosome structure and determine the state of gene regulatory areas such as promoters and enhancers (Kouzarides, 2007; Luger, 2003; Zhou et al., 2010). In particular, several studies have highlighted the importance of histone methylation on specific lysine residues in maintaining transcriptional programs and determining cell fate and identity (Benevolenskaya, 2007; Cloos et al., 2008; Pasini et al., 2004). For example, methylation of histone H3 lysine 27 (H3K.27) is an important epigenetic modification found at the promoters of many developmentally important genes and is involved in mammalian X chromosome inactivation, germline development, cellcycle regulation and cancer (Agger et al., 2007; Cao and Zhang, 2004; Lan et al., 2007). Histone H3 tri-methylated lysine 27 (H3K27me3) contributes to the recruitment of the Polycomb repressive complexes (PRCI and PRC2) on chromatin, which in turn mediate gene silencing (Lund and van Lohuizen, 2004; Simon and Kingston, 2009). In the protein complex PRC2, EZH2 is the mammalian methylase that adds a methyl group to H3K27, which leads to the recruitment of other Polycomb-group proteins and silencing of target genes (Cao and Zhang, 2004; Czermin et al., 2002; Kuzmichev et al., 2002; Muller 106 et al., 2002). However, the demethylases JMJD3 and UTX of the KDM6 family contain a weII-conserved JmjC domain in their C-terminal regions which catalyzes the transition of H3K27me3 and H3K27me2 to H3K27mel, therefore from a repressive to an active chromatin conformation (Agger et al., 2007; De Santa et al., 2007; Swigut and Wysocka, 2007; Xiang et al., 2007). This histone demethylase activity can antagonize the recruitment of the PRC complex, playing a decisive role between cellular proliferation and differentiation in the establishment of cell fate during development (Agger et al., 2007; De Santa et al., 2007; Jones, 2007). Genes important in the developmental process are often considered poised, or bivalent, in that both silencing (H3K27me3) and activating (mono and trimethylation of histone H3 lysine 4; H3K4mel/me3) marks are present at promoter and enhancer regions (Azuara et al., 2006; Bernstein et al., 2006; Mikkelsen et al., 2007; Rada-lglesias et al., 2011). The simultaneous presence of H3K4me3 and H3K27me3 is characteristic of poised promoters (Azuara et al., 2006; Bernstein et al., 2006; Mikkelsen et al., 2007) while the combination of H3K4mel and H3K27me3 marks poised enhancers (Rada-lglesias et al., 2011). Moreover, it has also been suggested that the perturbation of both EZH2 and JMJD3 expression and activity, hence potentially H3K27 methylation, is implicated in carcinogenesis (Cooper and Foster, 2009; Ding et al., 2006; Ding and Kleer, 2006; Jones, 2007; Seligson et al., 2005). Despite the growing evidence for a prominent role of H3K27 methylation status in transcriptional regulation and cellular function, the understanding of their contribution in establishment of hormone-dependent cancer, is still limited. In this study we show that the anti-apoptotic ERa target gene, BCL2, is differentially regulated in different breast cancer cell types, due to a modification in the chromatin template at a poised enhancer element. In hormone-responsive breast cancer cells (MCF7), JMJD3 and ERa work in concert to remove the repressive H3K27me3 mark from the poised (yet silent) enhancer region to permit appropriate gene activation and anti-apoptotic effects following E2 stimulation. However, in cells that are no longer responsive to hormones, resistant to AE and overexpress HER2, the balance shifts 107 towards a non-genomic constitutive activation of BCL2 by the prolonged HER2/AKT mediated inactivation of the methyltransferase EZH2. In this case the structure of the enhancer region is no longer poised but active due to a lack of H3K.27 methylation, and the participation of JMJD3 is no longer required. Therefore, we propose a model in which the modification of the chromatin environment of the BCL2 enhancer region imposes ligand dependency in hormone-responsive cells, and this epigenetic mark is deregulated in the acquisition of AE resistance in breast cancer. Results Depletion of JMJD3 induces apoptosis in ERa-dependent breast cancer. To investigate the role of JMJD3 and its H3K27 demethylase activity in E2-dependent cell proliferation, we first proceeded with short hairpin-RNA (shRNA)-mediated knockdown of JMJD3 and analysed cell cycle distribution using fluorescent activated cell sorting (FACS) in the ERa-positive breast cancer cell line, MCF7. The shJMJD3-l and shJMJD3-2 constructions efficiently depleted both mRNA and protein levels of JMJD3 as compared to the scrambled shRNA (shCTL) and the non-functional construction shJMJD3-nf controls (Figure 1A-B). Following depletion of JMJD3 expression in MCF7 cells in complete media, we observed by fluorescent activated cell sorting (FACS) analysis the presence of sub-Gl fluorescence (21% as compared to 0,4 % in the shCTL and 0.6% in shJMJD3-nf cells), characteristic of DNA degradation and indicative of cell death. A representative FACS analysis and the overall analysis are depicted in Supplemental Figure 1A and B. Considering that E2 has been shown to inhibit apoptosis in the mammary gland during menstrual cycle and in breast cancer MCF7 cells (Ferguson and Anderson, 1981; Kyprianou et al., 1991; Teixeira et al., 1995), we investigated whether the degraded DNA content seen in the FACS analysis was due to apoptosis. As described previously, staining for annexin-V/PI followed by FACS analysis showed the inhibitory effect of E2 on this marker of apoptosis in MCF7 cells (approximately 19.8% of apoptotic cells to 1.4% in E2-treated cells; Figure 1C-D). However, cellular depletion of JMJD3 using the shJMJD3-l and shJMJD3-2 constructs dramatically increased 108 JMJD3 mm~~mm>m»> ER« . « * « » w Actin s<? SWMJ03-1 »hJMJD3-2 +E2 100 10' 102 io 5 IOMO 0 10* ib 2 ib 3 ibMb 0 ib* 1b2 io 3 ib4 Vo° io 1 10* ~io* - Annextn-V io 4 • Figure 4- 1: JMJD3 causes apoptosis in ERa-positive breast cancer cells. The shRNA construct shJMJD3-l and shJMJD3-2 efficiently reduce both RNA (A) (shown by qPCR) and protein (B) (shown by Western blotting) levels of JMJD3 in MCF7 cells. ERa and Actin have been used to show the specificity of the JMJD3 knockdown and as a loading control. (C) Representative apoptosis analysis using annexin-V/PI staining and flow cytometry of MCF7 cells depleted with shCTL, shJMJD3-l, shJMJD32 or shJMJD3-nf treated with vehicle (-E2) or 17p-estradiol (+E2) for 24h. Flow cytometry profile represents annexin-V staining in x axis and PI in y axis. (D) The graphical representation annexin-V/PI staining and flow cytometry of MCF7 cells (data shown are the mean ± S.E. of three independent experiments). 109 apoptosis in E2-treated cells (33.9% and 24.7 respectively) compared to the shCTL (1.4%) and shJMJD3-nf (0.9%)(Figure 1C-D). Moreover, ERa-negative MDA-MB-231 cells did not undergo apoptosis following JMJD3 depletion (Figure S2A), suggesting that the effect of JMJD3 is specific to E2 responsive cells. Taken together, these observations suggest that JMJD3 plays an important role in the control of apoptosis in ERa-dependent breast cancer cells. JMJD3 controls the apoptotic program through the transcriptional regulation of the anti-apoptotic gene BCL2. In order to discern the E2-dependent transcription program associated with the observed apoptotic response, we investigated global gene expression in MCF7 cells depleted or not of JMJD3. Surprisingly, 151 of 274 E2-upregulated genes (55%) are negatively affected by the loss of JMJD3 (Figure 2A and Table SI). As shown in Figure 2B, cellular depletion of JMJD3 was found to significantly reduce the E2-dependent induction of well-known ERa-regulated genes, such as PR, TFF1, GREB1, IGFBP4 and CCND1, while the GAPDH housekeeping gene remains unaffected. We next classified the mRNA enriched in each subclass on the basis of gene ontology (GO) annotation using the PANTHER classification system and searched for a functional enrichment in the apoptosis related genes. Notably, the GO analysis revealed functions related to cellular (19.8%) and metabolic process (23.3%), as well as the cell cycle (11%) and communication (9.1%) (Figure 2C). More specifically, we observed an enrichment in a small subset of genes implicated in apoptosis (2.6%). Since JMJD3 mostly plays a positive role in gene activation and its depletion causes apoptosis, we then considered genes implicated in the inhibition of apoptosis (Table S2). Interestingly, in this subset of genes, we observed the presence of BCL2, one of the most important anti-apoptotic genes regulated by ERa in MCF7 breast cancer cells (Perillo et al., 2008). Consistent with the previous observation on the positive role of JMJD3 on the regulation of ERa-regulated genes, specific depletion of JMJD3 by shRNA-mediated knockdown blocked the ERa- 110 E2-upregulated genes shJMJD3-repressed genes OshCTL-E2 • shCTL +E2 BshJMJD3-1 -E2 • shJMJD3-1 +E2 TFF1 GREB1 IGFBP4 CCND1 GAPDH • Apoptosls • Cell communication • Cellular process D Localization D Transport • Cellular component organization • System process M Reproduction • Response to stimulus • Regulation of biological process D Homeostatic process B Developmental process • Generation of precursor metabolites m Metabolic process • Cell cycle • Immune system process and energy -E2 +E2 Q-E2 Bcl-2 • +E2 GAPDH ¥ ^ ShCTL ¥¥ #> <? shJMJD3-1 shJMJD3-nf D shCTL • shJMJD3-1 Bcl-2 GAPDH vector Bd-2 111 Figure 4- 2: JMJD3 regulates BCL2 gene transcription in ERa-positive cells. (A) Venn diagram showing the number of E2 upregulated genes significantly affected by the knockdown of JMJD3 in MCF7 cells. (B) Expression levels of PR, TFF1, GREB1, IGFBP4, CCND1 and GAPDH in MCF7 cells depleted or not of JMJD3, and in absence or presence of E2 for 4h. mRNA expression levels were determined by qPCR and normalized against expression levels of the 36B4 ribosomal gene. (C) Pie chart showing gene ontology composition of genes affected by the knockdown of JMJD3 after E2 treatment in MCF7 cells. (D) Relative expression of BCL2 in MCF7 cells treated with vehicle or E2 and depleted or not in JMJD3 using specific shRNA constructs. (E) Immunoblot assay showing the effect of JMJD3 and UTX depletion on BCL2 protein expression in MCF7 cells (GAPDH used as loading control). (F) Immunoblot assay showing the overexpression of the Bcl-2 protein MCF7 cells as compared to the empty vector control (GAPDH used as loading control). (G) The graphical representation annexin-V/PI staining and flow cytometry of MCF7 cells that overexpress Bcl-2 following the depletion of JMJD3 (data shown are the mean ± S.E. of three independent experiments). dependent activation of BCL2 expression in MCF7 cells in an ERa-specific manner (Figure 2D-E), while no effect was observed on BCL2 by depletion of JMJD3 in MDAMB-231 cells (Figure S2B). Importantly, this effect was specific to the knockdown of JMJD3, as the shRNA-mediated depletion of UTX, another H3K27me3 demethylase of the same family, did not have the same effect (Figure S3 and 2E). To confirm that the apoptotic program affected by JMJD3 depletion is due to the anti-apoptotic effects of Bcl-2, we over-expressed Bcl-2 in JMJD3-depleted MCF7 cells (Figure 2F). We show by FACS analysis following annexin-V/PI staining that the addition of Bcl-2 renders the cells resistant to apoptosis observed in JMJD3-depleted cells (Figure 2G). Collectively, these results suggest that JMJD3 prevents ERa-positive breast cancer cells from entering apoptosis via its control of E2-dependent BCL2 gene expression. 112 JMJD3 is recruited to the surrounding binding region of ERa in the BCL2 enhancer region upon E2 signalling. To gain insight into how JMJD3 regulates BCL2 expression, chromatin immunoprecipitation (ChIP) assays were used to identify the preferential localization of JMJD3 within or near the BCL2 promoter region. Based on the report indicating that BCL2 is regulated by 2 different promoters, PI (the principal promoter) and P2 and has two estrogen response elements (ERE) in the enhancer present in the coding region of the gene (Perillo et al., 2008) (Figure 3A), we surveyed these BCL2 regulatory regions by ChIP. To determine the transcriptional program of BCL2 following ERa-dependent activation, ChIP assays were performed at 0 and 30 minutes after E2-stimulation in MCF7 cells. As expected, ERa was recruited to the ERE sites in the coding region of BCL2 as well as at the PI promoter area (Figure 3B). JMJD3 colocalised with ERa at both the active PI promoter and the ERE enhancer regions (Figure 3C). Moreover, this recruitment of JMJD3 upon E2 treatment was associated with a decrease in H3K27me3 (Figure 3D) in proximity of the ERE enhancer region of BCL2. Since H3K27me3 is a transcriptionally repressive chromatin mark that has been associated with poised promoters and enhancers at important developmental genes (Bernstein et al., 2006; Burgold et al., 2008; Jorgensen et al., 2006; Sharov and Ko, 2007), we verified the presence of active transcriptional marks such as RNAPII, H3K4me3, H3K4mel, and histone variant H2A.Z, using histone H3 to control nucleosome density. The results demonstrate that RNAPII (Figure 3E), H3K4me3 (Figure 3F) and H2A.Z (Figure 3G) were present before E2 treatment at the PI promoter and increased at the ERE after induction. The simultaneous presence of ERa, JMJD3, RNAPII, H3K4me3 and H2A.Z at the PI promoter and the ERE enhancer region after E2 treatment may be at least partly a consequence of the formation of an active DNA loop, an event that has been previously shown to be an important step in BCL2 gene activation in response to E2 (Perillo et al., 113 TSS -1599 -1599 TSS ERE2 ERE2 -1599 TSS ERE2 -1599 TSS ERE2 -1599 TSS ERE2 0 8n D-E2 • +E2 £•06o 04. 2 0 2- 5& 3 a 0£ 00. -1599 TSS ERE2 • -E2 • +E2 N a -1599 TSS ERE2 2- Figure 4-3 : JMJD3 colocalizes with ERa at the BCL2 promoter. (A) Diagram of the BCL2 promoter regions (PI and P2), its regulatory elements (ERE), and segments used for qPCR. (B-G) ChIP analysis showing the location of ERa (B), JMJD3 (C), H3K27me3 (D), RNAPII (E), H3K4me3 (F), and H2A.Z (G) at the BCL2 promoter treated with vehicle or E2 for 30 minutes in MCF7 cells. 114 2008). Furthermore, H3K4mel, indicative of a poised enhancer, colocalized with H3K27me3 at the BCL2 enhancer region (Figure 3H). Another characteristic of enhancers is their relative nucleosomal depletion compared to surrounding regions (He et al.). Using formaldehyde-assisted isolation of regulatory elements (FAIRE), we observed that the BCL2 enhancer region is nucleosome-depleted both before and after E2 activation, as well as both before and after H3K27me3 removal by JMJD3 (Figure S4). Taken together, these results show that JMJD3 is recruited to the surrounding binding region of ERa in the BCL2 enhancer region, and that the repressive H3K27me3 mark is actively removed upon E2 treatment. The presence of ERa and JMJD3 at the BCL2 enhancer region are interdependent. Many studies have shown that ERa can target the recruitment of histone modifying enzymes such as p400, CBP/p300, Tip60, CARM-1, and RNAPII to gene promoters (Gevry et al., 2009; Metivier et ai., 2003). To establish the order in which ERa and JMJD3 are recruited to the BCL2 enhancer region, we performed ChIP analyses at 0, 15, 30, 45 minutes after E2 stimulation. The results show that ERa, RNAPII, and JMJD3 were concomitantly recruited, with maximal recruitment after 15 minutes, followed by reduction to pre-treatment levels after 45 minutes (Figure 4A). Furthermore, the recruitment of JMJD3 corresponded to an increase in H3K27mel after 15 minutes of induction and a decrease in H3K27me3, suggesting that JMJD3 could be responsible for the transformation of the repressive H3K27me3 mark into transcriptionally-permissive H3K27mel (Figure 4A). Surprisingly, H3K27mel and H3K27me3 were depleted after 45 minutes of induction (Figure 4A). Considering that the ERE binding sites are located in exon 2 of the BCL2 gene (Perillo et al., 2008), our observation might be explained by the dynamics of H3K27mel replacement by an unmodified histone H3 during transcriptional elongation by RNAPII. Because these results did not permit us to clearly determine the active recruitment hierarchy of JMJD3 and ERa to the BCL2 enhancer region, we examined the recruitment of JMJD3, ERa and H3K27me3 at the ERE following treatment with the estrogen receptor antagonists, ICI182780 (ICI) or tamoxifen 115 (TAM). Mechanistically, ICI causes rapid degradation of ERa by the ubiquitin/proteasome pathway(Fan et al., 2003; McClelland et al., 1996). TAM acts by competing with E2 as a ligand for ERa thus inducing a conformational change in the AF2 domain of ERa, which then blocks its interaction with coactivators such as SRC-1, D ICI+E2 shCTL shJMJD3-1 shCTL shJMJD3-1 Figure 4-4 : Presence of ERa and JMJD3 at BCL2 are interdependent. (A) Recruitment kinetics of ERa, RNAPII, JMJD3, H3K27me3 and H3K27mel after E2 treatment in MCF7 cells. (B) ChIP analysis of ERa, H3K27me3 and JMJD3 recruitment before and after treatment with E2 or tamoxifen (TAM) for 30 minutes, or ICI 180,782 for 24hr followed by E2 for 30 minutes. (C-F) ChIP assay showing the effect of JMJD3 depletion on the recruitment of JMJD3 (C), H3K27me3 (D), ERa (E), and RNAPII (F). The primers used in these experiments correspond to the ERE (ERE2) of the BCL2 gene. 116 GRIP1 and CBP/p300 (Shang et al., 2000). As expected, TAM treatment induced recruitment of ERa to the enhancer region of BCL2, while the pre-incubation of MCF7 cells with ICI following E2 treatment abolished its recruitment (Figure 4B). JMJD3 recruitment was affected by TAM or ICI treatments, and H3K27 methylation status remained unchanged (Figure 4B). These results suggest that JMJD3 recruitment and H3K27me3 demethylation at the BCL2 enhancer region are regulated in an ERa liganddependent manner. Since H3K27me3 is a repressive mark in transcriptional processes, we investigated the role of JMJD3 and H3K27me3 demethylation in the transcriptional regulation of BCL2 in response to E2 by ChIP experiments in cells depleted in JMJD3. Using antibodies directed against JMJD3 (as a control), H3K27me3, ERa and RNAPII, we observed that depletion of JMJD3 specifically abolished the recruitment of JMJD3 and the demethylation of H3K27me3 at the enhancer region upon E2 treatment (Figure 4C-D). Notably, JMJD3 depletion in MCF7 cells reduced the recruitment of both ERa (Figure 4E) and RNAPII (Figure 4F) in presence of E2. Together, these results suggest that localization of JMJD3 and ERa at the enhancer region of BCL2 are co-dependent, and that both are simultaneously required for proper E2-dependent BCL2 transcriptional activation. Inactivation of EZH2 methy transferase activity by non-genomic pathways controls BCL2 transcription and apoptosis in AE-sensitive and AE-resistant breast cancer cells. The removal of H3K27me3 on chromatin is not entirely dependent on the activity of demethylases, as the phosphorylation of serine 21 of EZH2 (pEZH2) via the AKT pathway impedes EZH2 binding to histone H3, resulting in a global decrease in H3K27me3 (Cha et al., 2005). Of note, the AKT pathway is involved in the non-genomic effects associated with ERa target gene expression (Bredfeldt et al., 2010; Castaneda et al., 2010; Sun et al., 2001). In AE-resistant breast cancer cells the overexpression of HER2 is sufficient to activate the AKT pathway (Jones, 2007; Kumar et al., 1996; Schiff et al., 2004). To observe the possibility of a negative relationship between HER2 levels 117 (thus, implicating the AKT pathway) and H3K27me3 in different types of breast cancer, we performed immunohistochemistry analysis on a breast cancer tissue microarray (TMA) composed of surgical breast samples. Using a scale from 0-3, we scored the intensity of immunostaining for H3K27me3 and HER2 and categorised the samples into two main groups, low (0-1) or high (2-3). Hierarchical clustering using Euclidian distance was performed on the data segregating the tumors into four groups based on these two markers. Heatmap visualisation reveals the largest cluster to present a high presence of H3K27me3 versus a low presence of HER2 with 67/118 samples, or 56.8% (Figure 5A). Representative immunostaining examples of each group are shown in Figure 5B. Furthermore, a Chi-Square test of independence on the expression levels show the presence of equivalent levels does not follow a random distribution (X2 (1, N = 118) = 7.627, p = 0.006), suggesting a relationship between H3K27me3 and HER2 levels. Considering the link between HER2, AKT pathway, pEZH2 and H3K27 methylation and the importance of HER2 in the development of AE resistance, we next aimed to investigate the effects of the deregulation of H3K27me3 in the ERa-dependent apoptotic response in AE-resistant cells that overexpress HER2. Since no data on AE resistance is available in the TMA, we used three different MCF7-derived AE-resistant cell lines: MCF7/LCC2 (LCC2), which were developed by the selection of MCF7 cells resistant to TAM (Brunner et al., 1993), MCF7/LCC9 (LCC9) cells that are resistant to TAM and ICI (Brunner et al., 1997) and MCF7/HER2-18 (HER2), which artificially overexpress HER2 (Benz et al., 1992). All of these cell lines show a high level of AKT activation and have an E2-independent phenotype, despite that they express ERa (Wang et al., 2006). Interestingly, we observed that JMJD3 knockdown in the AE-resistant cell lines LCC2, LCC9 and HER2 did not affect cell survival, as determined by annexin-V/PI and FACS analysis (Figure 5C). To link these observations with those from our TMA, we sought to use cell lines representative of the high-low and low-high clusters. MCF7 are known to exhibit low levels of HER2 (Wang et al., 2006), so these cells may correspond to the high-low cluster from the TMA. The non-genomic E2 response leads 118 to the rapid AKT-mediated pEZH2 in MCF7 cells, which we confirmed by analysis of pEZH2 following E2 treatment of 30 minutes (Figure 5D). This correlated with a global decrease in H3K27me3 after 16h treatment with E2 (longer E2 treatment was necessary to observe a change in H3K27me3 status due to the stability of this chromatin mark (Jones, 2007)), which was inhibited by the pre-treatment of MCF7 with the AKT inhibitor LY294002 (Figure 5D). We monitored the levels of pEZH2 in LCC2 cells under basal media conditions and found that they were much higher in LCC2 than in MCF7 cells, accompanied by a general decrease in H3K27me3 levels in LCC2 cells (Figure 5D). Therefore, MCF7 cells mimic the high-low cluster from the TMA, while MCF7/LCC2 cells represent the low-high category. 119 HWJTroeS H«J 4(h D • • D MCF7 E2 LY HER2 LCC2 MCF7 + + + •m* — i H3K27me3 1pEZH2 EZH2 LCC2 - LY • - jH3K27me3 ^IWPP" ^Wff!^ ^^^^^^ ^^^^^ B LCC9 LCC2 + i^WMBSfci milMCF7 - E2 shCTL shCTL+E2 shJMJD3-1 SWMJD3-1+E2 H3 Her-2 D shCTL • shCTL+E2 • shJMJD3-1 D shJMJD3-1+E2 MCF7 LCC2 120 Figure 4-5 : AE-resistant cells have a modified H3K27me3 chromatin signature that alters BCL2 transcriptional activity. (A) Heat map representing the hierarchical cluster analysis performed on the breast cancer TMA, separated into four different clusters based on H3K27me3 and Her2 immunoreactivity scores from 0-3: low-low, high-low, low-high, and high-high. Percentages were calculated from the number of patients in a category divided by the total number of patients. Representative immunostaining of each cluster is shown in (B). (C) Representative plots of annexin-V/PI staining and flow cytometry analysis of AE resistant cells MCF7/LCC2, MCF7/Herl8, and MCF7/LCC9 depleted with shCTL or shJMJD3-l and treated with vehicle or E2 for 24h. (D) Immunoblot assay showing the levels of phospho-EZH2 (pEZH2) as compared to total EZH2 and H3K27me3 (H3 as a loading control) in MCF7 cells treated with vehicle or E2 for 30 min (pEZH2) or 16h (H3K27me3) and LCC2 treated with Akt inhibitor LY294002 for 72h. (E) Comparison of BCL2 mRNA expression levels in MCF7 and LCC2 cells depleted or not of JMJD3, and in absence or presence of E2 for 4h. In order to further investigate the influence of HER2/AK.T and H3K27 methylation status on the development of AE resistance, we employed LY294002 to inhibit EZH2 phosphorylation in LCC2 cells. The levels of pEZH2 greatly decreased to an almost undetectable level in the presence of LY294002 in LCC2 cells, which resulted in a corresponding increase in global H3K27me3 (Figure 5D). We then asked whether JMJD3 depletion has an effect on BCL2 expression in AE-resistant LCC2 cells. We found that AE-resistant cells constitutively express high levels of BCL2 that are not altered by E2 or TAM treatments (Figure 5E and S4). Moreover, when JMJD3 was depleted in MCF7/LCC2, we did not observe downregulation of BCL2 compared to MCF7 cells (Figure 5E), suggesting that the JMJD3-mediated transcriptional regulation of BCL2 does not occur in the AE-resistant cell line. Overall, these results suggest the simultaneous implication of the non-genomic and genomic pathways in the control of 121 H3K27me status and perturbation of one of these pathways may affect BCL2 expression and the apoptosis response. Inactivation of the EZH2 methyltransferase activity bypasses the need for JMJD3 in the transcriptional regulation of BCL2 in breast cancer cells. In light of our observations in the LCC2 cell line, we hypothesized that the H3K27me3 repressive mark is absent at the BCL2 promoter in these cells, leading to uncontrolled constitutive activation of BCL2. In support of this hypothesis, by interfering with the activity of EZH2 by the depletion of its essential partner SUZ12 (Pasini et al., 2004), we observed an increase the basal expression levels of BCL2 in MCF7 cells (Figure S6). Furthermore, a ChIP assay comparing the enhancer region of BCL2 in MCF7 and LCC2 cells (Figure 6A) showed not only that ERa and RNAPII are present without E2 stimulation, but also that the repressive H3K27me3 mark is clearly absent, a result consistent with the lower levels of EZH2 binding to the BCL2 enhancer observed in our ChIP assays in LCC2 (Figure 6B). These findings indicate that the absence of the repressive H3K27me3 mark renders the presence of JMJD3 obsolete. We then blocked EZH2 phosphorylation with LY294002 treatment and observed by ChIP assays that we were able to restore a repressive state to the BCL2 enhancer region (Figure 6C) and decrease gene expression (Figure S7). When AKT activity was inhibited in absence of E2 stimulation, we observed that the binding of ERa and RNAPII were decreased to basal levels in LCC2 (Figure 6C). More importantly, the level of H3K27me3 increased and the binding of EZH2 was restored (Figure 6C and 6D). To confirm the importance of EZH2 phosphorylation status on the Bcl-2 regulated apoptotic program in breast cancer cells and AE resistance, we investigated the effects of EZH2 mutants in MCF7 cells. The mutants were created by converting serine 21 either into alanine to block any potential phosphorylation (EZH2-S21A), or into aspartic acid to imitate the phosphorylated state (EZH2-S21D) (Cha et al., 2005). The overexpression of EZH2-S21D in JMJD3-depleted MCF7 cells did not lead to apoptosis, while the 122 overexpression of wild type EZH2 or EZH2-S21A still showed the typical apoptotic pattern of JMJD3-depleted MCF7 cells (Figure 6E-F). This result is corroborated by a restoration of induced levels of BCL2 in JMJD3-depleted MCF7 cells that overexpress EZH2-S21D (Figure 6G). So, a decrease in H3K27me3 due to EZH2 phosphorylation is, at least in part, responsible for the increased expression of Bcl-2, resulting cell survival. To further link these observations to AE resistance, we performed these tests in MCF7 cells in the presence of increasing concentrations of tamoxifen (0, 5, 10, 15, 20 and 25 uM) for 48h. Concentration-dependent apoptosis was observed in the presence of tamoxifen (Figure S8). Due to the high levels of cell death in increased concentrations FACS analysis following annexinV/PI staining was measured in the cell lines exposed to 0, 5 and 10 uM tamoxifen,. Of note, the overexpression of EZH2-21D and Bcl-2 led to a resistance to tamoxifen-induced apoptosis (Figure 6H). Taken together, these results show that perturbation of H3K27 methylation by the phosphorylation of EZH2 affects BCL2 gene expression and the regulation of the apoptotic pathway, thus contributing to the acquisition of AE resistance in breast cancer. 123 CD Relative BCL2 mRNA levels tow MM m ERa,H3K27me3 (% Input) O ERa. JMJD3, H3K27me3 (% Input) Figure 4-6 : Inactivation of the EZH2 methyltransferase activity by the HER2/AKT pathway bypasses the need for JMJD3 at the BCL2 enhancer region in AE-resistant cells. (A) ChIP analysis comparing the levels of ERa, JMJD3, RNAPII and H3K27me3 in MCF7 and LCC2 cells in the absence of E2. The qPCR analysis was performed using primers corresponding to the ERE (ERE2) of the BCL2 gene. (B) ChIP assays showing the levels EZH2 in MCF7 and LCC2 cells at ERE binding site in absence of E2. (C-D) ChIP experiments showing the effects of AKT inhibitor (LY294002) on the recruitment of ERa, RNAPII, H3K27me3 (C), and EZH2 (D) at the ERE2 BCL2 binding site in LCC2 cells. (E) Immunoblot assay showing the overexpression of myc-tagged wild type EZH-2 (EZH2) and mutants EZH2-21A and EZH2-21D proteins in MCF7 cells as compared to the empty vector control using the antibody against the Myc tag (GAPDH used as loading control). The graphical representation of annexin-V/PI staining and flow cytometry (F) and qPCR analysis of mRNA expression of BCL2 (G) in MCF7 cells that overexpress EZH2 and mutants following the depletion of JMJD3 (data shown are the mean ± S.E. of three independent experiments). (H) Annexin-V/PI staining and flow cytometry analyses of EZH2 and EZH2 mutant MCF7 cell lines following treatment with 0, 5, and lOuM TAM for 48h (data shown are the mean ± S.E. of three independent experiments). Discussion In breast cancer, E2 both promotes proliferation of abnormal cells by regulating the expression of cell cycle-related genes, and prevents apoptosis in these cells by increasing the expression of the anti-apoptotic gene BCL2 (Perillo et al., 2008; Teixeira et al., 1995). Bcl-2, a key player in the regulation of cell cycle and development of carcinogenesis, is often highly expressed in cancer and is associated with ERa status and more malignant breast cancers (Perillo et al., 2008; Teixeira et al., 1995). In this study, we show that the importance of the modification of an epigenetic mark, H3K27me3, to allow proper ligand-dependent regulation of BCL2 in breast cancer cells. We observed 125 that during the E2-mediated apoptotic response in MCF7 cells, the co-recruitment of ERa and JMJD3 to the enhancer of the anti-apoptotic gene BCL2 results in H3K27me3 demethylation and subsequent gene activation. Therefore, we propose that the repressive chromatin state caused by H3K27 methylation in ERcc-dependent cancerous cells is permissive for the regulation of BCL2 following stimulation by E2 transcription by a mechanism that comprises the interdependent recruitment of ERa and JMJD3. The knockdown of JMJD3 in this context causes apoptosis, since the cells are rendered more sensitive to apoptotic demise in the absence of expression of the anti-apoptotic gene BCL2. It is of interest that the enhancer region of BCL2 in unstimulated MCF7 cells mirrors a poised enhancer signature (H3K4mel/H3K27me3) similar to what is observed in a subset of key developmental regulatory genes (Rada-Iglesias et al., 2011). Studies into the control of poised promoters in developmental genes (H3K4me3/H3K27me3) show that their activation requires the actions of cell signals to recruit transcription factors which can bind to and recruit JMJD3 to chromatin (Bernstein et al., 2006; Jorgensen et al., 2006; Sharov and Ko, 2007). Our results are in agreement with research on developmentally regulated genes, yet provide an interesting novel role of the demethylation of H3K27me3 outside this subset of genes. We show here for the first time the involvement of a demethylase, JMJD3, in the resolution of a poised enhancer region by its association with a hormone-dependent transcription factor, ERa, on the chromatin template to regulate a gene that is critical in cell survival. Our finding that H3K27me3 acts as a barrier to the binding of ERa in the ERE enhancer region suggests a twofold role of JMJD3 in the proper regulation of BCL2 and apoptosis in E2-dependent breast cancer cells. JMJD3 could first act by tightly regulating the accessibility to DNA in important distal control regions, and second by altering chromatin structure to permit communication between distal regulatory elements and the proximal promoter region (Figure 7). 126 We also observed that the binding of H2A.Z was pre-bound at BCL2 and colocalised with ERa and JMJD3 binding following E2 stimulation (Figure 4). It is possible that, in addition to JMJD3, H2A.Z is required for the activation of BCL2 in response to E2 in breast cancer cells, contributing to the anti-apoptotic characteristic of these cells. Interestingly, H2A.Z binds SUZ12 target genes in mouse embryonic stem cells, and the specific depletion in this context leads to the derepression of PcG targets (Creyghton et al., 2008). H2A.Z has been highly associated with gene activity in mammalian cells, so this result was surprising. However, it is possible that H2A.Z colocalisation to these areas promotes the bivalency of such genes, poising the promoter for activation. One avenue that remains to be explored is the role of H2A.Z in preventing apoptosis. The depletion of p400, catalytic protein responsible of the H2A.Z incorporation into chromatin, has been shown to lead to apoptosis in several cancer cell lines (Mattera et al., 2010; Mattera et al., 2009), and we observed in increase in TAMinduced apoptosis in MCF7 cells in the absence of H2A.Z (A. Svotelis, unpublished results). The role of H2A.Z in pro- and anti-apoptotic gene regulation would be interesting to pursue, especially considering the known association of H2A.Z with p53 and ERa, two known regulators of apoptotic genes (Gevry et al., 2007; Gevry et al., 2009; Svotelis etal., 2010). Our studies also demonstrate that the perturbation of the H3K27 methylation pathway considerably affects the apoptosis program in breast cancer cells. Polycomb group proteins have been associated with carcinogenesis, namely by the control of senescence via the repression of the INK4/ARF locus (Agger et al., 2009; Barradas et al., 2009). In this case, JMJD3 derepresses this locus, leading to cell cycle arrest and suggesting a tumor-suppressive role for JMJD3. Conversely, our results suggest that in the context of ERa-dependent breast cancer, JMJD3 promotes cellular growth by promoting the expression of the anti-apoptotic gene BCL2. Our results with JMJD3 are supported by the increase in the basal expression levels of BCL2 shown by depletion of SUZ12 in MCF7 cells (Figure S5). Recently, overexpression of JMJD3 and demethylase 127 activity has been shown to contribute to the pathogenesis of Hodgkin's Lymphoma (Anderton et al.). In addition, several studies suggest that EZH2 is a promising prognostic biomarker in breast cancer (Collett et al. 2006; Raaphorst et al. 2003; Buchmann et al. 2006). Moreover, decreased survival is observed in patients with low H3K27me3 levels (Wei et al., 2008). In fact, EZH2 overexpression is related more with the aggressive ER-negative breast cancer subtype and breast cancer invasion (Cao et al., 2008; Gonzalez et al., 2009; Wei et al., 2008). However, we (and others (Bredfeldt et al., 2010)) have shown that the overexpression of HER2 leads to Akt-mediated phosphorylation of EZH2 in more severe, AE-resistant breast cancer, decreasing global H3K27me3 levels. The levels of pEZH2 and global H3K27me3 in the aggressive breast cancers that exhibit increased EZH2 were not verified in previous studies, so it is possible that EZH2 overexpression in conjunction with HER2 overexpression does not lead to increased H3K27me3. Interestingly, we also observe a negative relationship in breast biopsy samples between H3K27me3 and HER2, a marker of AE-resistant breast cancer (Figure 5A and B). These results suggest a context-dependent role for JMJD3 and H3K27me3 in different cell types, and led us to speculate on the role of the HER2/AKT inactivation of EZH2 by phosphorylation in AE-resistant cells. The HER2/Akt dependent modification of EZH2 decreases H3K27 methylation (Cha et al., 2005) which has been strongly implicated in the development of AE resistance in breast cancer cells (Schiff et al., 2004; Shou et al., 2004). The phosphorylation of EZH2 caused by the overexpression of HER2 in AE-resistant breast cancer cells prevents the methylation of H3K27 surrounding the enhancer region of BCL2, allowing the formation of an active chromatin conformation and constitutive activation of BCL2. The overall consequence is a bypass of the need for JMJD3 for transcriptional activation (Figure 5E). It is of particular interest that the constitutive expression of the proto-oncogene BCL2 has been shown to prevent apoptosis after AE treatment in breast cancer cells (Figure 5H). Taken together, our results strongly suggest that the regulation of BCL2 expression in AE-sensitive breast cancer 128 cells requires the simultaneous and coordinated implication of the genomic and nongenomic pathway in the regulation of BCL2 by the implication of the effectors of H3K27 methylation, EZH2 and JMJD3. In AE-sensitive cells, upon E2 induction, both pathways converge rapidly to activate the BCL2 gene transcription by suppressing the methyltransferase activity of EZH2 and by recruiting JMJD3 through ERa to remove the H3K27 mark at the enhancer region of BCL2. This regulation is sensitive to AE, as observed by a lack in BCL2 activation in presence of tamoxifen. However, in the acquisition of AE resistance, BCL2 becomes constitutively activated due to the overactivation of the HER2/AKT pathway which results in a global decrease in H3K27me3 that circumvents the requirement of JMJD3 at the BCL2 enhancer region. To summarise, we propose that there exists a balance between the genomic and the non-genomic pathways in the epigenetic regulation of transcription of ERa target genes during cellular stimulation with E2, as is the case for BCL2 in our E2-responsive MCF7 cell line (Figure 7). MCF7 cells remain responsive to external stimuli, such as E2, which results in the rapid regulation of BCL2 expression. First, the induction of AKT activity by the ERa non-genomic pathway results in the phosphorylation of EZH2 and its subsequent removal from the chromatin template, preventing further H3K27 methylation (Figure 7). Secondly, the ERa genomic response leads to the concomitant binding of ERa and JMJD3 at the BCL2 enhancer region and the demethylation of H3K27me3, favoring a transcriptionally active state. The contribution of HER2 remains negligible in E2-responsive cells, seeing as HER2 levels are low and the activation of AKT by the ERa non-genomic response is favored. However, the disruption of the balance between ERa and HER2 signalling by the overexpression of HER2 often observed in AE-resistant cancer cells results in the superactivation of the end result of the ERa non-genomic pathway (pEZH2 by AKT) in the absence of extracellular stimuli. Thus, the continual phosphorylation of EZH2 leads to a global decrease in H3K27me3, affecting the ERa transcriptional program. Our findings show that not only modifications in cellular signalling pathways are required to transform cancerous cells into AE-resistant cells, but 129 that an important key to understand this phenomenon lie in the fundamental epigenetic mechanisms and the signature of epigenetic marks on chromatin. This study may also provide JMJD3 and H3K27me3 as alternatives to current detection methods and chemotherapy treatments in breast cancer. Tamoxifen-sensitive breast cancer cells Tamoxifen-resistant breast cancer cells Figure 4- 7: Summary model of the role of JMJD3 and H3K27 methylation in the control of BCL2 gene expression in tamoxifen sensitive and resistant breast cancer cells. Materials and methods Cell culture and shRNA lentiviral transduction MCF7, MDA-MB-231, 293T and MCF7/HER2-18 (gift from Mien-Chie Hung, University of Texas, USA) cell lines were maintained in DMEM (Wisent) containing 10% fetal bovine serum (FBS) and antibiotics. Prior to their use in E2 treatment experiments, MCF7 cells were grown in DMEM without phenol red (Wisent) and supplemented with 5% charcoal-dextran treated FBS for at least 3 days. The LCC2 cells (gift from Robert Clarke, Georgetown University Medical Center, USA) were cultured in 130 DMEM without phenol red containing 5% charcoal-dextran-treated FBS. All cells were mycoplasma-free and were kept in a humidified chamber at 37°C in 5% CO2. 17(3estradiol, tamoxifen and ICI 182,780 (Sigma) were used at concentrations of 100 nM, 1 u.M and 100 nM respectively, unless otherwise stated. The shRNA sequences designed to inhibit JMJD3 (#1, GAGACCTCGTGTGGATTAA; #2, GCGCTCGTGTATGTACATT) were cloned into the pLVTHM backbone (gift from Didier Trono, University of Geneva, Switzerland). The shRNA against UTX were purchased from Open Biosystems in the pLKO.l vector and shRNA lentiviruses were obtained by cotransfection of pLVTHM or pLKO.l vectors, pMDVSV-G, and psPAX2 into human 293T cell line. The pcDNA3 constructs overexpressing Bcl-2, EZH2, EZH221 A, EZH2-21D were transfected in MCF7 cells as described previously(Gevry et al., 2009). Apoptosis analysis For sub-Gl analysis, cells were harvested and fixed in 70% ethanol. Fixed cells were stained with propidium iodide (PI, 50 ug/mL) after treatment with RNase (100 ng/mL). Stained cells were analyzed for DNA content by FACS in a FACS Calibur (BD Biosciences). For annexin-V/PI analysis, cells were stained with annexin-V coupled to the fluorophore Cy5 according to the manufacturer's instructions (Abeam) and cells positive for annexin-V detection were measured using the CellQuest software (BD Biosciences). ChIP and FAIRE assays MCF7 cells were hormone-deprived for at least 3 days and then treated with 100 nM of E2 for the indicated time. ChIP assays were performed essentially as described previously (Gevry et al., 2007) with a panel of specific polyclonal antibodies generated in-house or from commercial sources, as well as pre-immune, and controls without antibodies. FAIRE experiments were performed as previously described (Eeckhoute et al., 2009). Samples were sonicated to generate DNA fragments <400 bp. qPCR was 131 performed using a set of primers relevant to the promoter regions of the BCL2 gene. The primers used in qPCR are listed in Table S3. RNA and microarray analysis Total RNA was isolated from MCF7 cells grown in E2-free medium using the GenElute mammalian total RNA miniprep kit (Sigma). RNA was reverse-transcribed into firststrand cDNA using MMLV reverse transcriptase (Promega). Samples were subjected to qPCR using CFX-96 (BioRad) and qPCR for 36B4 and GAPDH mRNA were used as an internal controls. The relative abundance of BCL2 mRNA (or other test genes) was calculated after normalization using 36B4 mRNA, where relative expression levels were calculated as 2~ACT where ACT = CT test gene - CT 36B4. Primers used are listed in Supplementary Table S3. Microarray analysis using BeadChip Human Genome (Illumina, HT-12) was performed at the Centre d'innovation at Genome Quebec (McGill University, Montreal, QC, Canada). Data were analyzed using the FlexArray 1.5 software and as described previously(Blazejczyk et al., 2007). Analysis of the breast cancer TMA 141 cases were selected from consented patients who had undergone surgical resectioning with auxiliary lymph node dissection for breast cancer, at the Centre hospitalier de TUniversite de Montreal - Hotel Dieu (CHUM-HD), between 2003 and 2007. Formalin-fixed, paraffin-embedded archival tissue blocks were obtained from the surgical archives at CHUM-HD. Immunohistochemistry for HER2 and H3K27me3 were performed on representative tumor areas, annotated by a pathologist and two single core tissue-microarrays were constructed in parallel. Hierarchical clustering was done using the Cluster 3.0 program, Euclidian distance and complete centroid linkage. The original dataset was filtered to eliminate individuals with incomplete staining (16 of 142). Data visualization was done using the Java TreeView program(Saldanha, 2004). To test the distribution of the equivalent levels of expression, data was first transformed into high (2, 3) or low values (0, 1). Where expression values where equivalent (high-high or low- 132 low), we attributed a value of 1 to the sample, 0 otherwise. A Chi-Square test of independence with this sample was then run using a random distribution as our hypotheses. Antibodies A complete list of antibodies used in the present study in ChIP and Western blot analysis are shown in Supplemental Table S4. Acknowledgments We thank Alain Lavigueur, Viktor Steimle, Bruce Murphy and Mylene Brunelle for critical comments on the manuscript and Benoit Leblanc for the artwork included in Figure 7. We are also grateful to Robert Clark, Mien-Chie Hung and Didier Trono for providing reagents. We would also like to thank Viktor Steimle for the use of the FACS and important advice concerning the analysis, and Luc Paquette for advice on statistical analysis of the breast TMA. This work was supported with funds from the Cancer Research Society Inc. to N.G. N.G. holds a holds a Chercheur boursier (junior 1) award from the FRSQ. A.S. was the recipient of a doctoral fellowship from NSERC and Reseau Quebecois en reproduction. 133 shCTL SWMJD3-1 160- If 1?(V soio shJMJD3-nf sub-G1 20.9% M4 1 Ml 1 f~m IJ " ' 26J 400 8 0 0 8 0 0 - Propidium Iodide - 1 H Figure 4-S1: The shRNA-mediated knockdown of JMJD3 affects apoptosis in MCF7 cells. (A) Graphical representation of FACS analysis of the percentage of cells in sub-Gl, indicative of MCF7 cell death in complete media, following knockdown of JMJD3. Percent of cells in sub-Gl is shown in the upper left corner of each fluorogram. (B) Bar graph of cell cycle patterns of MCF7 cells depleted for JMJD3. Fluorograms and bar graphs are representative of three experiments. (C) Summary graph of annexin-V/PI analysis from panel A. The data shown are the mean ± S.E. of three independent experiments. 134 shCTL f 1<rt shJMJD3-1 0 78% |iaa 101 10? ~£££^. 2 0 355% 10°' 10' lb 10 W I O 0 10' -Annexln-V- _ua%J 102 103 104 Figure 4-S2 : The effect of JMJD3 knockdown is specific to ERa-positive ceils. (A) Representative analysis of annexin-V/PI analysis in ERa-negative MDA-MB-231 cells showing lack of effect of JMJD3 knockdown on cell survival. (B) The shRNA construct shJMJD3-l is shown to have no effect on the expression BCL2 (shown by qPCR) in MDA-MB-231 cells. 250- « 6 D-E2 •+E2 -200- : 150- (E 0- on shCTL -E2 shUTX-1 shUTX-2 +E2 Figure 4-S3 : The H3K27me3 demethylase UTX does not affect BCL2 expression. The shRNA constructs shUTX-1 and shUTX-2 both efficiently reduce RNA levels of UTX (A) but do not affect induced expression levels of BCL2 (B), as shown by qPCR. 135 60- - » - -E2 - * • + E2 «\ \\ «S-<40E * c \ <\ \ >\ A 91 UJ OC 20-J A <f u. 0- ! -1599 T i TSS ERE2 Figure 4-S4 : H3K27me3 status does not affect chromatin remodelling at the BCL2 enhancer region. FAIRE-qPCR experiments were performed in MCF7 cells to monitor nucleosome depletion before and after E2 treatment at the indicated BCL2 promoter regions. Relative enrichment are normalized on a control region (+13 000 relative to the TSS). The primers used in these experiments correspond to the -1599, TSS and the ERE2 regions as shown in Figure 3A of the BCL2 gene. This graph is representative of three independent experiments. a M • 0 MCF7 -E2/-TAM +E2/-TAM -E2/+TAM +E2/+TAM LCC2 Figure 4-S5: Anti-estrogen resistant cells exhibit an altered epigenetic pattern and regulation of BCL2. As shown by qPCR, induced BCL2 expression levels are restored to baseline levels in MCF7 cells with the addition of tamoxifen. MCF7/LCC2 cells demonstrate induced levels of BCL2 in the absence of E2 stimulation which is not affected by the addition of E2 or tamoxifen. 136 D -E2 • + E2 shCTL shSUZ12 shCTL shSUZ12 Figure 4-S6 : Depletion of PRC complex member SUZ12 induces expression of BCL2. RT-qPCR analysis showing the effect of SUZ12 depletion (A) on the expression levels of BCL2 in MCF7 cells treated or not with E2 (B), normalised using 36B4. > < 08| 06. 0 I "2 X .1 ° *oo. 4^ ^ • & Figure 4-S7 : Inhibition of pEZH2 in AE resistant cells decreases BCL2 expression. The addition of the AKT inhibitor LY294002 in MCF7/LCC2 cells decreases RNA expression levels ofBCL2, shown by qPCR analysis normalised using 36B4. 137 0 5 10 15 20 25 EZH2 EZH221A EZH221D Figure 4-S8 : A decrease in H3K27me3 due to EZH2 phosphorylation leads to resistance to tamoxifen-induced apoptosis. MCF7 cells overexpressing EZH2, mutant EZH2 (EZH2-21A and EZH2-21D), or BcI-2 were exposed to increasing concentrations of tamoxifen (0, 5, 10, 15, 20, and 25 uM) for 48h. Concentration-dependent apoptosis was observed in the presence of tamoxifen for control, EZH2 and EZH2-21A, but not in the cell lines overexpressing EZH2-21D and Bcl-2. 138 (uM) Table 4-Sl : E2-regulated genes negatively affected by the knockdown of JMJD3 Global gene expression in MCF7 cells depleted of JMJD3 following vehicle or E2 treatment shows 151 of 274 E2-upregulated genes (55%) are negatively affected by the loss of JMJD3. EPDRl ADAMTSL5 TUBB2B FGFRIOP SLC22A5 LOCI 00134266 EGR3 COQ4 LOC727941 MIR574 FABP5 GADD45GIP1 SLC6A6 GAL POLR3G UNCI 19 KCNF1 ACOX2 LOC643161 ELOVL2 MYBL1 LOC643479 C90RF95 TFF2 IL24 IGFBP4 C60RF221 ALDOC PDLIM3 PKIB SFXN2 LRG1 LOC643150 DPYSL4 ZNF185 SDK2 FAM25A FGFBP2 CCDC110 GPRIN1 LOC730167 GPR68 HS.537742 MAPT LHX4 TFF1 LOC730274 C10ORF119 CYP4F11 PPP2R2C AP1B1 GPR77 SERP1NE2 DEGS2 MGC16121 DCAF16 NR5A2 ARL3 SLC25A25 SGK1 LOC647993 AFF3 LOC100131727 CDC25A MPPED2 KIF12 LOC647987 SNX24 CXCL12 RERG C40RF43 CELSR2 MSMB PRKCE HS.151692 SGK RAPGEFL1 B4GALT1 TOE1 RET SGK3 TIMM10 SUSD3 LRP8 GREB1 APOA1 NP BCL2 LOCI 54860 SSR3 SIAH2 CDCA7 ADORA1 WAPAL HS.224678 IFIH1 PLAC1 REEP1 ZNF533 PDZK1P1 PODXL PTGES SLITRK4 TH NBL1 TIFA HPDL PDZK1 ANKRD37 RBM24 RBBP8 GALE KCTD6 LOC493869 LOCI 00134009 TUBA3D UST LOC100134073 HS.562504 SPOCD1 HERC5 OLFML3 JAK2 VWF SCNN1G LOC727831 TMEM229B RAB31 LOC441484 LOC731954 SPINK4 NRIP1 TUBA3E KIAA1881 DEPDC6 IL20 PGLYRP2 PCP4 CHAF1A DTL SMTNL2 GALNT4 CEP135 RPRML OSTF1 FSIP1 RASGRP1 ZNF385B C20ORF160 TGFA THBS1 FARP1 139 Table 4-S2 : Potential anti-apoptotic genes negatively regulated by the knockdown ofJMJD3 The subset of genes implicated in the inhibition of apoptosis in the group of E2-regulated genes negatively affected by the knockdown of JMJD3. In this subset of genes, we observed the presence of BCL2, one of the most important anti-apoptotic genes. BCL2 Apoptosis regulator Bcl-2 TK1 Fibroblast growth factor receptor homolog 1 FGFR3 Fibroblast growth factor receptor 3 FGFR5 Fibroblast growth factor receptor 5 FKBP11 FK506-binding protein 11 LHX4 LIM/homeobox protein Lhx4 IL20 lnterleukin-20 1L24 lnterleukin-24 MYBL1 Myb-related protein A MYB Myb proto-oncogene protein RLN2 Relaxin A chain TTC9C Tetratricopeptide repeat protein 9C SGK1 Serine/threonine-protein kinase Sgk1 SGK3 Serine/threonine-protein kinase Sgk3 RET Proto-oncogene tyrosine-protein kinase receptor ret MLKL Mixed lineage kinase domain-like protein MYB Telomere length regulator tazl FGFR5 Fibroblast growth factor receptor 4 140 Table 4-S3 : List of primers used in this study. Primer name GAPDH-FWD Application Sequence RT-qPCR CTCTGCTCCTCCTGTTCGAC GAPDH REV RT-qPCR TGACTCCGACCTTCACCTTC 36B4 FWD 36B4 REV JMJD3 FWD RT-qPCR GCGACCTGGAAGTCCAACTA ATCTGCTGCATCTGCTTGG CACCCACTGTGGTCTGTTGT GTCTCCGCCTCAGTAACAGC GTGTTCCGCGTGATTGAAGAC CCCCAGAGAAAGAAGAGGAGTTATAA JMJD3 REV BCL2 FWD BCL2 REV GREB1-FWD RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR CTCTGCCTGAAGGATGCTGT GREB1-REV TFF1-FWD TFF1-REV PR-FWD PR-REV RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR GCAGATCCCTGCAGAAGTGT CGCGCTCTACCCTGCACTC TGAATCCGGCCTCAGGTAGTT IGFBP4-FWD IGFBP4-REV CCND1-FWD CCND1-REV UTX Fwd UTX Rev SUZ12 Fwd SUZ12Rev BCL2-1599 Fwd BCL2-1599 Rev BCL2 -698(TSS) Fwd RT-qPCR RT-qPCR RT-qPCR RT-qPCR CCCACGAGGACCTCTACATC ATCCAGAGCTGGGTGACACT GCTGTGCATCTACACCGACA CCACTTGAGCTTGTTCACCA RT-qPCR RT-qPCR RT-qPCR AATTCCCGCAGAGCTTACCT GGATGTGACACAGCATGTCC GGATATTCATCGCCAACCTG RT-qPCR ChIP ChIP ChIP ChIP ChIP ChIP GACATGCTTGCTTTTGTTCG GCTCAGAGGAGGGCTCTTT TGCCTGTCCTCTTACTTCATTCT GTCTGGGAATCGATCTGGAA GCAACGATCCCATCAATCTT CACCTGTGGTCCACCTGAC CTGAAGAGCTCCTCCACCAC BCL2 -698(TSS) Rev BCL2 ERE2 Fwd BCL2 ERE2 Rev CGTTGGAAATGGAGACAAGG GTGCAAATAAGGGCTGCTGT 141 References Agger, K., Cloos, P.A., Christensen, J., Pasini, D., Rose, S., Rappsilber, J., Issaeva, I., Canaani, E., Salcini, A.E. and Helin, K. (2007) UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development. Nature, 449,731-734. Agger, K., Cloos, P.A., Rudkjaer, L., Williams, K., Andersen, G., Christensen, J. and Helin, K. (2009) The H3K27me3 demethylase JMJD3 contributes to the activation of the INK4A-ARF locus in response to oncogene- and stress-induced senescence. Genes Dev, 23, 1171-1176. Anderton, J.A., Bose, S., Vockerodt, M., Vrzalikova, K., Wei, W., Kuo, M., Helin, K., Christensen, J., Rowe, M., Murray, P.G. and Woodman, C.B. The H3K27me3 demethylase, KDM6B, is induced by Epstein-Barr virus and over-expressed in Hodgkin's Lymphoma. Oncogene. Arold, S.T., Ulmer, T.S., Mulhern, T.D., Werner, J.M., Ladbuty, J.E., Campbell, I.D. and Noble, M.E. (2001) The role of the Src homology 3-Src homology 2 interface in the regulation of Src kinases. J Biol Chem, 276, 17199-17205. Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jorgensen, H.F., John, R.M., Gouti, M., Casanova, M., Warnes, G., Merkenschlager, M. and Fisher, A.G. (2006) Chromatin signatures of pluripotent cell lines. Nat Cell Biol, 8, 532-538. Badia, E., Oliva, J., Balaguer, P. and Cavailles, V. (2007) Tamoxifen resistance and epigenetic modifications in breast cancer cell lines. Curr Med Chem, 14, 30353045. Badve, S. and Nakshatri, H. (2009) Oestrogen-receptor-positive breast cancer: towards bridging histopathological and molecular classifications. J Clin Pathol, 62, 6-12. Barradas, M., Anderton, E., Acosta, J.C., Li, S., Banito, A., Rodriguez-Niedenfuhr, M., Maertens, G., Banck, M., Zhou, M.M., Walsh, M.J., Peters, G. and Gil, J. (2009) Histone demethylase JMJD3 contributes to epigenetic control of INK4a/ARF by oncogenic RAS. Genes Dev, 23, 1177-1182. Benevolenskaya, E.V. (2007) Histone H3K4 demethylases are essential in development and differentiation. Biochem Cell Biol, 85, 435-443. Benz, C.C, Scott, G.K., Sarup, J.C., Johnson, R.M., Tripathy, D., Coronado, E., Shepard, H.M. and Osborne, C.K. (1992) Estrogen-dependent, tamoxifen-resistant tumorigenic growth of MCF-7 cells transfected with HER2/neu. Breast Cancer Res Treat, 24, 85-95. Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., Jaenisch, R., Wagschal, A., Feil, R., Schreiber, S.L. and Lander, E.S. (2006) A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell, 125, 315-326. Blazejczyk, M., Miron, M. and Nadon, R. (2007) FlexArray: A statistical data analysis software for gene expression microarrays., http://genomequebec.mcgiIl.ca/FIexArray 142 Bredfeldt, T.G., Greathouse, K.L., Safe, S.H., Hung, M.C., Bedford, M.T. and Walker, C.L. (2010) Xenoestrogen-induced regulation of EZH2 and histone methylation via estrogen receptor signaling to PI3K/AKT. Mol Endocrinol, 24, 993-1006. Brunner, N., Boysen, B., Jirus, S., Skaar, T.C., Holst-Hansen, C, Lippman, J., Frandsen, T., Spang-Thomsen, M., Fuqua, S.A. and Clarke, R. (1997) MCF7/LCC9: an antiestrogen-resistant MCF-7 variant in which acquired resistance to the steroidal antiestrogen ICI 182,780 confers an early cross-resistance to the nonsteroidal antiestrogen tamoxifen. Cancer Res, 57, 3486-3493. Brunner, N., Frandsen, T.L., Holst-Hansen, C, Bei, M., Thompson, E.W., Wakeling, A.E., Lippman, M.E. and Clarke, R. (1993) MCF7/LCC2: a 4-hydroxytamoxifen resistant human breast cancer variant that retains sensitivity to the steroidal antiestrogen ICI 182,780. Cancer Res, 53, 3229-3232. Burgold, T., Spreafico, F., De Santa, F., Totaro, M.G., Prosperini, E., Natoli, G. and Testa, G. (2008) The histone H3 lysine 27-specific demethylase Jmjd3 is required for neural commitment. PLoS One, 3, e3034. Cao, Q., Yu, J., Dhanasekaran, S.M., Kim, J.H., Mani, R.S., Tomlins, S.A., Mehra, R., Laxman, B., Cao, X., Yu, J., Kleer, C.G., Varambally, S. and Chinnaiyan, A.M. (2008) Repression of E-cadherin by the polycomb group protein EZH2 in cancer. Oncogene, 27, 7274-7284. Cao, R. and Zhang, Y. (2004) The functions of E(Z)/EZH2-mediated methylation of lysine 27 in histone H3. Curr Opin Genet Dev, 14, 155-164. Castaneda, C.A., Cortes-Funes, H., Gomez, H.L. and Ciruelos, E.M. (2010) The phosphatidyl inositol 3-kinase/AKT signaling pathway in breast cancer. Cancer Metastasis Rev, 29, 751-759. Castoria, G., Migliaccio, A., Bilancio, A., Di Domenico, M., de Falco, A., Lombardi, M., Fiorentino, R., Varricchio, L., Barone, M.V. and Auricchio, F. (2001) PI3-kinase in concert with Src promotes the S-phase entry of oestradiol-stimulated MCF-7 cells. Embo J, 20, 6050-6059. Cha, T.L., Zhou, B.P., Xia, W., Wu, Y., Yang, C.C, Chen, C.T., Ping, B., Otte, A.P. and Hung, M.C. (2005) Akt-mediated phosphorylation of EZH2 suppresses methylation of lysine 27 in histone H3. Science, 310, 306-310. Cloos, P.A., Christensen, J., Agger, K. and Helin, K. (2008) Erasing the methyl mark: histone demethylases at the center of cellular differentiation and disease. Genes Dev, 22, 1115-1140. Cooper, C.S. and Foster, C.S. (2009) Concepts of epigenetics in prostate cancer development. Br J Cancer, 100, 240-245. Creyghton, M.P., Markoulaki, S., Levine, S.S., Hanna, J., Lodato, M.A., Sha, K., Young, R.A., Jaenisch, R. and Boyer, L.A. (2008) H2AZ is enriched at polycomb complex target genes in ES cells and is necessary for lineage commitment. Cell, 135,649-661. Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A. and Pirrotta, V. (2002) Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell, 111, 185-196. 143 De Santa, F., Totaro, M.G., Prosperini, E., Notarbartolo, S., Testa, G. and Natoli, G. (2007) The histone H3 lysine-27 demethylase Jmjd3 links inflammation to inhibition of polycomb-mediated gene silencing. Cell, 130, 1083-1094. Ding, L., Erdmann, C, Chinnaiyan, A.M., Merajver, S.D. and Kleer, C.G. (2006) Identification of EZH2 as a molecular marker for a precancerous state in morphologically normal breast tissues. Cancer Res, 66, 4095-4099. Ding, L. and Kleer, C.G. (2006) Enhancer of Zeste 2 as a marker of preneoplastic progression in the breast. Cancer Res, 66, 9352-9355. Doisneau-Sixou, S.F., Sergio, CM., Carroll, J.S., Hui, R., Musgrove, E.A. and Sutherland, R.L. (2003) Estrogen and antiestrogen regulation of cell cycle progression in breast cancer cells. Endocr Relat Cancer, 10, 179-186. Eeckhoute, J., Lupien, M., Meyer, C.A., Verzi, M.P., Shivdasani, R.A., Liu, X.S. and Brown, M. (2009) Cell-type selective chromatin remodeling defines the active subset of FOXA1-bound enhancers. Genome Res, 19, 372-380. Fan, M., Bigsby, R.M. and Nephew, K.P. (2003) The NEDD8 pathway is required for proteasome-mediated degradation of human estrogen receptor (ER)-alpha and essential for the antiproliferative activity of ICI 182,780 in ERalpha-positive breast cancer cells. Mol Endocrinol, 17, 356-365. Ferguson, D.J. and Anderson, T.J. (1981) Morphological evaluation of cell turnover in relation to the menstrual cycle in the "resting" human breast. Br J Cancer, 44, 177-181. Fullwood, M.J., Liu, M.H., Pan, Y.F., Liu, J., Xu, H., Mohamed, Y.B., Orlov, Y.L., Velkov, S., Ho, A., Mei, P.H., Chew, E.G., Huang, P.Y., Welboren, W.J., Han, Y., Ooi, H.S., Ariyaratne, P.N., Vega, V.B., Luo, Y., Tan, P.Y., Choy, P.Y., Wansa, K.D., Zhao, B., Lim, K.S., Leow, S.C, Yow, J.S., Joseph, R., Li, H., Desai, K.V., Thomsen, J.S., Lee, Y.K., Karuturi, R.K., Herve, T., Bourque, G., Stunnenberg, H.G., Ruan, X., Cacheux-Rataboul, V., Sung, W.K., Liu, E.T., Wei, C.L., Cheung, E. and Ruan, Y. (2009) An oestrogen-receptor-alpha-bound human chromatin interactome. Nature, 462, 58-64. Gevry, N., Chan, H.M., Lafiamme, L., Livingston, D.M. and Gaudreau, L. (2007) p21 transcription is regulated by differential localization of histone H2A.Z. Genes Dev, 21, 1869-1881. Gevry, N., Hardy, S., Jacques, P.E., Lafiamme, L., Svotelis, A., Robert, F. and Gaudreau, L. (2009) Histone H2A.Z is essential for estrogen receptor signaling. Genes Dev, 23, 1522-1533. Gonzalez, M.E., Li, X., Toy, K., DuPrie, M., Ventura, A.C., Banerjee, M., Ljungman, M., Merajver, S.D. and Kleer, C.G. (2009) Downregulation of EZH2 decreases growth of estrogen receptor-negative invasive breast carcinoma and requires BRCA1. Oncogene, 28, 843-853. He, H.H., Meyer, C.A., Shin, H., Bailey, ST., Wei, G., Wang, Q., Zhang, Y., Xu, K., Ni, M., Lupien, M., Mieczkowski, P., Lieb, J.D., Zhao, K., Brown, M. and Liu, X.S. Nucleosome dynamics define transcriptional enhancers. Nat Genet, 42, 343-347. Jones, R.S. (2007) Epigenetics: reversing the 'irreversible'. Nature, 450, 357-359. 144 Jorgensen, H.F., Giadrossi, S., Casanova, M, Endoh, M, Koseki, H., Brockdorff, N. and Fisher, A.G. (2006) Stem cells primed for action: polycomb repressive complexes restrain the expression of lineage-specific regulators in embryonic stem cells. Cell Cycle, 5, 1411-1414. Kouzarides, T. (2007) Chromatin modifications and their function. Cell, 128, 693-705. Kumar, R., Mandal, M., Lipton, A., Harvey, H. and Thompson, C.B. (1996) Overexpression of HER2 modulates bcl-2, bcl-XL, and tamoxifen-induced apoptosis in human MCF-7 breast cancer cells. Clin Cancer Res, 2, 1215-1219. Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst, P. and Reinberg, D. (2002) Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes Dev, 16, 2893-2905. Kyprianou, N., English, H.F., Davidson, N.E. and Isaacs, J.T. (1991) Programmed cell death during regression of the MCF-7 human breast cancer following estrogen ablation. Cancer Res, 51, 162-166. Lan, F., Bayliss, P.E., Rinn, J.L., Whetstine, J.R., Wang, J.K., Chen, S., Iwase, S., Alpatov, R., Issaeva, I., Canaani, E., Roberts, T.M., Chang, H.Y. and Shi, Y. (2007) A histone H3 lysine 27 demethylase regulates animal posterior development. Nature, 449, 689-694. Luger, K. (2003) Structure and dynamic behavior of nucleosomes. Curr Opin Genet Dev, 13,127-135. Lund, A.H. and van Lohuizen, M. (2004) Epigenetics and cancer. Genes Dev, 18, 23152335. Mattera, L., Courilleau, C, Legube, G., Ueda, T., Fukunaga, R., Chevillard-Briet, M., Canitrot, Y., Escaffit, F. and Trouche, D. (2010) The ElA-associated p400 protein modulates cell fate decisions by the regulation of ROS homeostasis. PLoS Genet, 6,el 000983. Mattera, L., Escaffit, F., Pillaire, M.J., Selves, J., Tyteca, S., Hoffmann, J.S., Gourraud, P.A., Chevillard-Briet, M., Cazaux, C. and Trouche, D. (2009) The p400/Tip60 ratio is critical for colorectal cancer cell proliferation through DNA damage response pathways. Oncogene, 28, 1506-1517. McClelland, R.A., Manning, D.L., Gee, J.M., Anderson, E., Clarke, R., Howell, A., Dowsett, M., Robertson, J.F., Blarney, R.W., Wakeling, A.E. and Nicholson, R.I. (1996) Effects of short-term antiestrogen treatment of primary breast cancer on estrogen receptor mRNA and protein expression and on estrogen-regulated genes. Breast Cancer Res Treat, 41,31-41. Mellor, J. (2005) The dynamics of chromatin remodeling at promoters. Mol Cell, 19, 147157. Metivier, R., Penot, G., Hubner, M.R., Reid, G., Brand, H., Kos, M. and Gannon, F. (2003) Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell, 115, 751-763. Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P., Brockman, W., Kim, T.K., Koche, R.P., Lee, W., Mendenhall, E., O'Donovan, A., Presser, A., Russ, C, Xie, X., Meissner, A., Wernig, M., Jaenisch, R., 145 Nusbaum, C, Lander, E.S. and Bernstein, B.E. (2007) Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature, 448, 553-560. Muller, J., Hart, CM., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L., O'Connor, M.B., Kingston, R.E. and Simon, J.A. (2002) Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell, 111, 197-208. Naughton, C, MacLeod, K., Kuske, B., Clarke, R., Cameron, D.A. and Langdon, S.P. (2007) Progressive loss of estrogen receptor alpha cofactor recruitment in endocrine resistance. Mol Endocrinol, 21, 2615-2626. Normanno, N., Di Maio, M., De Maio, E., De Luca, A., de Matteis, A., Giordano, A. and Perrone, F. (2005) Mechanisms of endocrine resistance and novel therapeutic strategies in breast cancer. Endocr Relat Cancer, 12, 721-747. Ordonez-Moran, P. and Munoz, A. (2009) Nuclear receptors: genomic and non-genomic effects converge. Cell Cycle, 8, 1675-1680. Pasini, D., Bracken, A.P., Jensen, M.R., Lazzerini Denchi, E. and Helin, K. (2004) Suzl2 is essential for mouse development and for EZH2 histone methyltransferase activity. Embo J, 23, 4061 -4071. Pearce, S.T. and Jordan, V.C. (2004) The biological role of estrogen receptors alpha and beta in cancer. Crit Rev Oncol Hematol, 50, 3-22. Perillo, B., Ombra, M.N., Bertoni, A., Cuozzo, C, Sacchetti, S., Sasso, A., Chiariotti, L., Malorni, A., Abbondanza, C. and Avvedimento, E.V. (2008) DNA oxidation as triggered by H3K9me2 demethylation drives estrogen-induced gene expression. Science, 319, 202-206. Rada-Iglesias, A., Bajpai, R., Swigut, T., Brugmann, S.A., Flynn, R.A. and Wysocka, J. (2011) A unique chromatin signature uncovers early developmental enhancers in humans. Nature, 470, 279-283. Razandi, M., Oh, P., Pedram, A., Schnitzer, J. and Levin, E.R. (2002) ERs associate with and regulate the production of caveolin: implications for signaling and cellular actions. Mol Endocrinol, 16, 100-115. Riggins, R.B., Schrecengost, R.S., Guerrero, M.S. and Bouton, A.H. (2007) Pathways to tamoxifen resistance. Cancer Lett, 256, 1-24. Russell, K.S., Haynes, M.P., Sinha, D., Clerisme, E. and Bender, J.R. (2000) Human vascular endothelial cells contain membrane binding sites for estradiol, which mediate rapid intracellular signaling. Proc Natl Acad Sci USA, 97, 5930-5935. Saldanha, A.J. (2004) Java Treeview—extensible visualization of microarray data. Bioinformatics, 20, 3246-3248. Schiff, R., Massarweh, S.A., Shou, J., Bharwani, L., Mohsin, S.K. and Osborne, C.K. (2004) Cross-talk between estrogen receptor and growth factor pathways as a molecular target for overcoming endocrine resistance. Clin Cancer Res, 10, 331S336S. Seligson, D.B., Horvath, S., Shi, T., Yu, H., Tze, S., Grunstein, M. and Kurdistani, S.K. (2005) Global histone modification patterns predict risk of prostate cancer recurrence. Nature, 435, 1262-1266. 146 Shang, Y., Hu, X., DiRenzo, J., Lazar, M.A. and Brown, M. (2000) Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell, 103, 843-852. Sharov, A.A. and Ko, M.S. (2007) Human ES cell profiling broadens the reach of bivalent domains. Cell Stem Cell, 1, 237-238. Shou, J., Massarweh, S., Osborne, C.K., Wakeling, A.E., Ali, S., Weiss, H. and Schiff, R. (2004) Mechanisms of tamoxifen resistance: increased estrogen receptorHER2/neu cross-talk in ER/HER2-positive breast cancer. J Natl Cancer Inst, 96, 926-935. Simon, J.A. and Kingston, R.E. (2009) Mechanisms of polycomb gene silencing: knovvns and unknowns. Nat Rev Mol Cell Biol, 10, 697-708. Sommer, S. and Fuqua, S.A. (2001) Estrogen receptor and breast cancer. Semin Cancer Biol, 11, 339-352. Sun, M., Paciga, J.E., Feldman, R.I., Yuan, Z., Coppola, D., Lu, Y.Y., Shelley, S.A., Nicosia, S.V. and Cheng, J.Q. (2001) PhosphatidyIinositol-3-OH Kinase (PI3K)/AKT2, activated in breast cancer, regulates and is induced by estrogen receptor alpha (ERalpha) via interaction between ERalpha and PI3K. Cancer Res, 61,5985-5991. Svotelis, A., Gevry, N., Grondin, G. and Gaudreau, L. (2010) H2A.Z overexpression promotes cellular proliferation of breast cancer cells. Cell Cycle, 9, 364-370. Swigut, T. and Wysocka, J. (2007) H3K27 demethylases, at long last. Cell, 131, 29-32. Teixeira, C, Reed, J.C. and Pratt, M.A. (1995) Estrogen promotes chemotherapeutic drug resistance by a mechanism involving Bcl-2 proto-oncogene expression in human breast cancer cells. Cancer Res, 55, 3902-3907. Wang, L.H., Yang, X.Y., Zhang, X., An, P., Kim, H.J., Huang, J., Clarke, R., Osborne, C.K., Inman, J.K., Appella, E. and Farrar, W.L. (2006) Disruption of estrogen receptor DNA-binding domain and related intramolecular communication restores tamoxifen sensitivity in resistant breast cancer. Cancer Cell, 10,487-499. Wei, Y., Xia, W., Zhang, Z., Liu, J., Wang, H., Adsay, N.V., Albarracin, C, Yu, D., Abbruzzese, J.L., Mills, G.B., Bast, R.C., Jr., Hortobagyi, G.N. and Hung, M.C. (2008) Loss of trimethylation at lysine 27 of histone H3 is a predictor of poor outcome in breast, ovarian, and pancreatic cancers. Mol Carcinog, 47, 701-706. Xiang, Y., Zhu, Z., Han, G., Lin, H., Xu, L. and Chen, CD. (2007) JMJD3 is a histone H3K27 demethylase. Cell Res, 17, 850-857. Zhou, V.W., Goren, A. and Bernstein, B.E. (2010) Charting histone modifications and the functional organization of mammalian genomes. Nat Rev Genet, 12, 7-18. 147 CHAPTER V V. DISCUSSION The general definition of a cancerous cell is a cell that has become insensitive to various signals in cell cycle causing continued, uncontrolled proliferation, resulting from a normal eukaryotic cell that has accumulated a number of mutations (Vogelstein and Kinzler, 1993). There are numerous possible alterations made in a cancerous cell leading the cell to continue throughout the cell cycle without being controlled at any point (Hanahan and Weinberg, 2000; Boehm and Hahn, 2005). The presence of only one of these alterations renders the cell pre-cancerous, yet multiple mutagenic events normally occur in order for the cell to become cancerous. In breast cancer, ERa both promotes proliferation of abnormal cells by regulating the expression of cell cycle-related genes and apoptosis prevention in these cells (Doisneau-Sixou et al., 2003; Perillo et al., 2008; Teixeira et al., 1995). The E2-stimulated ERa cellular response leads to the convergence of transcriptional and protein signalling pathways involved in chromatin regulation. Depending on the genetic context, the ERa response leads to multiple effects in breast cancer cells. For example, numerous CRCs and histone modifications implicated in ERa pathways have been shown to be affected in various tumour types, notably in breast tissues. MLL2, an ERa coactivator that methylates H3K4 and interacts with H3K27 demethylase UTX and JMJD3, is aberrantly upregulated in breast cancer (Lan et al., 2007; Natarajan et al., 2010). Several studies suggest that EZH2 is a promising prognostic biomarker in breast cancer (Collett et al. 2006; Raaphorst et al. 2003; Buchmann et al. 2006). Overall, the totality of the observations made during my doctoral thesis suggests that two important epigenetic marks with opposing roles in transcriptional 148 activation, H2A.Z and H3K27me3, are both linked to ERa during the typical E2 response, and these pathways are modified leading to proliferative effects and progression towards AE resistance. V.l. ERa modulation of chromatin signatures affects the cell cycle Our results suggest that in the context of ERa-dependent breast cancer, the removal of H3K27me3 by JMJD3 promotes cellular proliferation by the activation of the antiapoptotic gene BCL2. This suggests a context-dependent role for JMJD3 and H3K27me3 in different cancer types. In normal cells, a subset of key developmental regulatory genes contain both the active H3K4me3 at promoter and repressive H3K27me3 modifications and are pre-bound by RNAPII (Bernstein et al., 2006; Jorgensen et al., 2006; Sharov and Ko, 2007). This poised transcriptional state requires the action of H3K27me3 demethylases such as JMJD3 to initiate gene expression (Agger et al., 2007; De Santa et al., 2007; Hong et al., 2007; Lan et al., 2007; Xiang et al., 2007). Many of these developmental genes require the actions of cell signals to recruit transcription factors which bind to and recruit JMJD3 to chromatin. For example, JMJD3 association with Smads2/3 is essential in the activation of Nodal-Smads2/3 target genes during development (Dahle et al., 2010). Our results are in agreement with this research, yet provide an interesting novel role of the demethylation of H3K27me3 outside this subset of genes in which JMJD3 cooperates with ERa to regulate a gene that is critical in carcinogenesis. The unstimulated BCL2 promoter region in MCF7 cells shows a chromatin conformation similar to bivalent genes, and H3K27me3 prevents ERa binding to the ERE enhancer region of the BCL2 gene (Figure 4.3). Prior to activation of BCL2, the promoter appears to be poised for activation, with pre-bound H3K4me3, RNAPII and H2A.Z (Figure 4.3). E2 stimulation leads to the JMJD3-mediated depletion of H3K27me3 and the possible formation of an active loop between the distal and proximal 149 regulatory elements, exhibited by the increase in H3K4me3 and H2A.Z at the ERE enhancer region. It is possible that in the case of oncogene-induced JMJD3-dependent activation of the pl6INK4a locus, a similar same mechanism may be employed, but in response to different cellular stimuli. So, in the context of breast cancer cells, JMJD3 is important in establishing the activation of an anti-apoptotic response gene, therefore contributing to the oncogenic properties of these cells. We also observed the presence of H2A.Z at the poised enhancer of BCL2. We observed that the binding of H2A.Z and H3K4me3 were pre-bound at BCL2 and colocalised with ERa and JMJD3 binding following E2 stimulation (Figure 4.3). It is possible that, in addition to JMJD3, H2A.Z is required for the activation of BCL2 in response to E2 in breast cancer cells, contributing to the anti-apoptotic phenotype of these cells. Interestingly, H2A.Z binds Su(z)12 target genes in mouse embryonic stem cells, and the specific depletion in this context leads to the derepression of PcG targets (Creyghton et al., 2008). H2A.Z has been highly associated with gene activity in mammalian cells, so this result was surprising. However, it is possible that H2A.Z colocalisation to these areas promotes the bivalency of such genes, poising the promoter for activation. Notably, p400 binding is known to closely mirror H3K4me3, and when H3K4me3 is reduced by depletion of Ash21, a subunit of SET 1-family methyltransferase complexes, p400 binding to its target genes is also reduced (Fazzio et al., 2008). One avenue that remains to be explored is the role of H2A.Z in preventing apoptosis. The depletion of p400 has been shown to lead to apoptosis in several cancer cell lines (Mattera et al., 2010; Mattera et al., 2009), and we observed an increase in TAM-induced apoptosis in MCF7 cells in the absence of H2A.Z (A. Svotelis, unpublished results). The role of H2A.Z in pro- and antiapoptotic gene regulation would be interesting to pursue, especially considering the known association of H2A.Z with p53 and ERa, two known regulators of apoptotic genes (Gevry et al., 2007; Gevry et al., 2009; Svotelis et al., 2010). Therefore, our observations at BCL2 in MCF7 cells suggest an important interplay between epigenetic marks that leads to an oncogenic anti-apoptotic response. 150 In addition to the modulation of anti-apoptotic genes, an important requirement for cellular proliferation is the expression of genes that promote the crucial transition in the cell cycle from the resting phase (Gl) to the DNA replication phase (S). The p53/p21 and pi6 pathways are negative regulators of cell cycle progression, namely through the Gl/S transition. The p400/Tip60 complex is known to regulate the expression of these cell cycle inhibitors (pl6INK4a and p21WAFl/CIPl), acting primarily through the p53 pathway (Gevry et al., 2007; Legube et al., 2004; Park and Roeder, 2006; Tang et al., 2006; Tyteca et al., 2006a). H2A.Z is required for the p400-induced repression of p21WAFl/CIPl (Gevry et al., 2007). Our studies show that H2A.Z overexpression promotes cellular proliferation in breast cancer cells (Svotelis et al., 2010), possibly through the regulation of cell cycle arrest by repressing p21 WAF1/CIP1 (Gevry et al., 2007). In addition, the kinetics of H3K27 methylation at the p21WAFl/CIPl promoter would be interesting to observe following E2 stimulation. For the pl6INK4a locus, the specific knockdown of p400 leads to increased transcription ofpl6INK4a (Mattera et al., 2010), suggesting a similar role for the p400-mediated deposition of H2A.Z as observed at p21WAFl/CIPl. A recent study has shown that the presence of H2A.Z and insulator protein CTCF are lost at the silenced pl6INK4a in breast cancer cells (Witcher and Emerson, 2009). Of note, this locus is also repressed by PcG proteins (Agger et al., 2009; Barradas et al., 2009). In this case, JMJD3 derepresses this locus in response to oncogenic stress in fibroblasts, leading to cell cycle arrest and suggesting a tumorsuppressive role for JMJD3. Considering that our studies concerning these two epigenetic marks in breast cancer proliferation were performed in a pl6INK4a-lbackground (MCF7 cells), it would be interesting to observe the ERa-dependent kinetics of H3K27 methylation and H2A.Z deposition during the regulation of this locus in breast cancer cells. All in all, the interplay between epigenetic marks at cell-cycle inhibitors is an important step in breast cancer progression. 151 Cancerous cells also generally demonstrate an increase in the expression of genes that are important in the promotion of cell-cycle progression through the Gl/S transition, such as E2F1-regulated genes (Svotelis et al., 2009). Although the expression of H2A.Z has not been considered regulated throughout the cell cycle, we know that there is a peak of H2A.Z expression at the Gl/S transition during the cell cycle (A. Svotelis, unpublished results; (Hatch and Bonner, 1988)). In addition, we observed that the overexpression of H2A.Z causes increased proliferation, and the pro-proliferative effects of H2A.Z seem to be caused by a deregulation in the cell cycle, most apparent in the MCF7 breast cancer cell line (Figure 3.1) (Svotelis et al., 2010). The p400/Tip60 complex has been associated with cell proliferation due to its association with activators such as p53, E2F1, Myc, and ERa (Chan, 2005; Gevry et al., 2009; Kim et al., 2005; Nagl et al., 2007; Samuelson et al., 2005; Taubert et al., 2004). Interestingly, E2F1 can recruit the p400/Tip60 complex to chromatin at the promoters of cell-cycle-related genes during the Gl/S transition (Kramps et al., 2004; Nagl et al., 2007; Taubert et al., 2004). However, the depletion of H2A.Z did not significantly affect E2F-1 dependent genes in human fibroblasts and breast cancer cells in our investigations (A. Svotelis, unpublished results), whereas H2A.Z depletion significantly affects ERa-regulated genes in MCF7 breast cancer cells (Gevry et al., 2009). Although several studies have shown increased levels of H2A.Z in breast cancer (Camp et al., 2002; Hua et al., 2008; van de Vijver et al., 2002), no group has yet modified the expression of H2A.Z to determine its role in the regulation of cellular proliferation besides ours (Gevry et al., 2007; Gevry et al., 2009). Thus, it would be interesting to further pursue the modulation of gene expression patterns by the exogenous overexpression of H2A.Z. 152 V.2. The role of epigenetic signatures in anti-estrogen resistance In our results the overexpression of H2A.Z overrides the toxic potential of the AE TAM, and leads to increased cellular proliferation in the absence of E2 stimulation (Figure 3.1). TAM is widely used to treat breast cancer due to its capacity to bind ERa and inhibit the activation potential of the nuclear receptor, but some patients exhibit resistance to this treatment, which has also been attributed to the constitutive activation of ERa target genes (Badia et al., 2007; Shou et al., 2004). E2-independent growth is typical of more severe breast cancers that have constitutively activated ERa target genes (Anderson, 2002). This suggests a possible activation of genes involved in cellular proliferation (or repression of cell cycle arrest genes) that are normally controlled by E2-dependent pathways. Therefore, H2A.Z could serve as an important prognostic factor in determining not only cancer severity, but could help guide clinical treatments as a marker of possible resistance to AE therapy. Considering the important effect H2A.Z in ERapositive breast cancer cells (MCF7) and their estrogen-independent growth (Gevry et al., 2009; Svotelis et al., 2009; Svotelis et al., 2010), it would be interesting to explore the role of H2A.Z in AE-resistant cell lines. We also observed increased levels of H2A.Z in breast cancers, with a notable correlation between ERa and H2A.Z in low-grade breast cancers (Table 3.1 and Figure 3.3). Expectedly, ERa levels decrease with increasing cancer severity (Pearce and Jordan, 2004), but we also observed that the highest levels of H2A.Z associate with more severe cancers, in line with a previous study (Hua et al., 2008). What is the role of increased levels of H2A.Z on its existing target genes? Does overexpression lead to constitutive activation? H2A.Z has been suggested to be important in cell-specific responses, possibly due to activator-specific p400-deposition of H2A.Z at target genes (Gevry et al., 2007; Gevry et al., 2009). We (and others (Bredfeldt et al., 2010)) have shown that the overexpression of HER2 leads to Akt-mediated phosphorylation of EZH2 in more severe, 153 AE-resistant breast cancer, decreasing global H3K27me3 levels. However, decreased survival is observed in patients with low H3K27me3 levels (Wei et al., 2008). In fact, EZH2 overexpression is related more with the aggressive ER-negative breast cancer subtype and breast cancer invasion (Cao et al., 2008; Gonzalez et al., 2009; Wei et al., 2008). The levels of pEZH2 and global H3K27me3 in the aggressive breast cancers that exhibit increased EZH2 were not verified, so it is possible that EZH2 overexpression in conjunction with HER2 overexpression does not lead to increased H3K27me3. In relation with our findings on a global H3K27 demethylation, the absence of this repressive regulation and the "overloading" of H2A.Z in chromatin could lead to activation in the absence of cellular stimuli such as E2. In this case, both the genomic (H2A.Z presence) and non-genomic (H3K27 demethylation by pEZH2) pathways of ERa regulation are active during conditions that should normally promote inactivation. Our results also lead us to propose that AE resistant cells exhibit a chromatin signature that is permissive for BCL2 transcription in the absence of stimulation. E2 cellular stimulation results in an ERa-mediated genomic response in which ERa interacts with several coactivators at target genes, as well as a rapid non-genomic response where ERa associates with protein kinase signalling pathways such as that of PI3K/Akt (OrdonezMoran and Munoz, 2009). The use of AE will block E2 binding to ERa, preventing the activation of either pathway. In AE-sensitive cells, the JMJD3/ERa-dependent regulation of H3K27 methylation is required for BCL2 activation, but is blocked in the presence of the AE TAM (Figure 4.4). The HER2/Akt dependent phosphorylation of EZH2 decreases H3K27 methylation (Cha et al., 2005) which has been strongly implicated in the development of AE resistance in breast cancer cells (Schiff et al., 2004; Shou et al., 2004). We show that the pEZH2 caused by the overexpression of HER2 in AE-resistant breast cancer cells specifically prevents the methylation of H3K27 surrounding the enhancer region of BCL2, allowing the formation of an active chromatin conformation and constitutive activation of BCL2. The overall consequence is a bypass of the need for JMJD3 for transcriptional activation (Figure 4.5 and 4.6). It is of particular note that the 154 constitutive expression of BCL2, has been shown to prevent apoptosis after AE treatment in breast cancer cells (Crawford et al., ; Kumar et al., 1996; Wang and Phang, 1995; Yde et al., 2007), which we confirm by the introduction of exogenous BCL2 expression in the MCF7 cell line (Figure 4.6). We believe these findings are of great significance since we show that fundamental epigenetic mechanisms and the signature of epigenetic marks on chromatin can provide important clues on AE-resistance and breast cancer. In cells that overexpress H2A.Z, we observed an increased amount of H2A.Z protein when extracting histone proteins from precipitated chromatin, suggesting that more H2A.Z is deposited into chromatin when overexpressed (Figure 3.1) (Svotelis et al., 2010). Notably, an increase in p400 levels has never been observed in cancer, but it has been suggested that histone chaperones that are important in replication-dependent nucleosome assembly NAP1 may deposit H2A.Z/H2B dimers into chromatin templates in yeast (Luk et al., 2007; Mazurkiewicz et al., 2006). Random H2A.Z incorporation could be a causal factor in chromosomal defects and translocation in breast cancer by the creation of confusion between heterochromatic regions in euchromatic areas, resulting in devastating effects during the transcriptional process. The random deposition of H2A.Z at low levels in euchromatin has already been observed in genome-wide in human cells, and is suggestive of silenced or heterochromatic areas in which genes are not transcribed, and the removal of H2A.Z in gene bodies is required for gene activation (Hardy et al., 2009). So, the overexpress ion of H2A.Z may also lead to a decreased capacity to distinguish between heterochromatin and repressed or poised genes, leading to the aberrant spreading of HP1 and H3K9me3 over normally expressed genes. Of importance here is the fact that H2A.Z and CpG methylation are significantly anti-correlated in certain mouse and human cell lines (Conerly et al., 2010; Kobor and Lorincz, 2009; Zilberman et al., 2008). CpG methylation at promoter and regulatory areas is associated with H3K27me3 and gene silencing (Kobor and Lorincz, 2009). In addition, hypomethylation of promoters regulating growth stimulatory pathways has been observed in AE-resistant cell lines (Fan et al., 2006). Thus, our observations that demonstrate 155 increased H2A.Z incorporation associated with increased tamoxifen resistance (Chapter III) and decreased global H3K27me3 in AE-resistant cell lines (Chapter IV) is suggestive of an overall epigenetic signature in AE resistance. It would be interesting to correlate these marks genome-wide in AE-resistant cell lines as well as in cases of AE resistance in breast cancer patients. V.3. General conclusions and perspectives My investigation into epigenetic mechanisms involved in breast cancer has lead me to the following conclusions: (1) Epigenetic modifications, such as H2A.Z overexpression and H3K27 methylation status, may be useful prognostic markers for breast cancer severity; (2) Epigenetic modifications are pivotal in the regulation of cell cycle progression related genes and the overactivation of pathways that affect this epigenetic marks in certain cells leads to carcinogenesis; (3) Continued deregulation of multiple pathways that affect the modulation of epigenetic marks can lead to more severe breast cancer and AE resistance. However, with every answer, there comes a new question. What type of genomic instability is caused by the modulation of epigenetic marks? First, the analysis of H2A.Z-overexpressing cancer cells by immunohistochemistry or FISH would provide us with information concerning any chromosomal abnormalities. Also, comparing the ChlP-chip or ChlP-seq profiles of H2A.Z and heterochromatic markers HP1 and H3K9me3 in non-transformed breast epithelial cells with those of several different breast cancer cell lines in which H2A.Z is overexpressed would be of interest. To more clearly determine the role of H2A.Z overexpression or global H3K27 demethylation in tumour formation and genomic instability it would be interesting to develop transgenic mouse models that conditionally overexpress H2A.Z or JMJD3 in a dose-dependent fashion specifically in breast tissue. 156 How do the expression profiles of normal cells compare to breast cancer cells? Increased random H2A.Z incorporation may result in an increase in cryptic transcription by the recruitment of RNAPII to alternate transcription initiation sites, or by the incapacity to reestablish closed chromatin conformation in gene bodies (Farris et al., 2005; Hardy et al., 2009; Williams and Tyler, 2007). Comparing total RNA expression patterns by the newly developed transcriptome sequencing (RNA-seq) in non-transformed breast epithelial cells with those of several different breast cancer cell lines in which H2A.Z is overexpressed would provide us with some indications of cryptic transcription (van Bakel and Hughes, 2009; Wang et al., 2009). It would be interesting to compare mRNA expression patterns in cell lines exhibiting different levels of H3K27me3. Together with ChlP-seq analysis of H2A.Z and H3K27me3 binding, these results would provide us with a map of the genomic effects of the modulation of these marks. It would be especially interesting to determine the states of these marks by immunohistochemistry and ChlP-seq in triple-negative breast cancers (ERa-/PR-/HER2-), a very severe breast cancer with low survival rates. It has been suggested that ERa-negative breast cancer may evolve from ERa-positive precursors (Allred et al., 2004), and our observations concerning the development of E2 independence by an imbalance in the chromatin signature may support this model. How does the presence of H2A.Z or the demethylation of H3K27 affect long range chromatin interactions between regulatory elements? JMJD3 and H2A.Z may both have roles in the modification of chromatin structure to permit communication between distal regulatory elements and the proximal promoter region. A recent analysis by ChlA-PET of ERa long-range interactions during E2 stimulation in MCF7 cells, showing the existence of several ERa-dependent loops at BCL2, in addition to those previously described (Fullwood et al., 2009; Perillo et al., 2008). It would also be intriguing to compare the chromatin landscape prior to and following E2 stimulation by ChlA-PET of H2A.Z, JMJD3 and H3K27me3. 157 The studies presented in this thesis support a model in which epigenetic marks H2A.Z and H3K27me3 will strongly affect the outcome of a breast cancer cell, and these marks may present novel prognostic tools in the discrimination between different types of breast cancer by affecting genomic instability, gene regulation and the development of AE resistance. 158 VI. REFERENCES Adam, M., Robert, F., Larochelle, M., and Gaudreau, L. (2001). H2A.Z is required for global chromatin integrity and for recruitment of RNA polymerase II under specific conditions. Mol Cell Biol 21, 6270-6279. Agger, K., Cloos, P.A., Christensen, J., Pasini, D., Rose, S., Rappsilber, J., Issaeva, I., Canaani, E., Salcini, A.E., and Helin, K. (2007). UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development. Nature 449, 731-734. Agger, K., Cloos, P.A., Rudkjaer, L., Williams, K., Andersen, G., Christensen, J., and Helin, K. (2009). The H3K27me3 demethylase JMJD3 contributes to the activation of the INK4A-ARF locus in response to oncogene- and stress-induced senescence. Genes Dev 23,1171-1176. Ahmad, S., Singh, N., and Glazer, R.I. (1999). Role of AKT1 in 17beta-estradiol- and insulin-like growth factor I (IGF-I)-dependent proliferation and prevention of apoptosis in MCF-7 breast carcinoma cells. Biochem Pharmacol 58, 425-430. Albert, I., Mavrich, T.N., Tomsho, L.P., Qi, J., Zanton, S.J., Schuster, S.C., and Pugh, B.F. (2007). Translational and rotational settings of H2A.Z nucleosomes across the Saccharomyces cerevisiae genome. Nature 446, 572-576. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002). Molecular Biology of the Cell, 4th edn (New York, Garland Science). Allis, CD., Glover, C.V., Bowen, J.K., and Gorovsky, M.A. (1980). Histone variants specific to the transcriptionally active, amitotically dividing macronucleus of the unicellular eucaryote, Tetrahymena thermophila. Cell 20, 609-617. Allred, D.C., Brown, P., and Medina, D. (2004). The origins of estrogen receptor alphapositive and estrogen receptor alpha-negative human breast cancer. Breast Cancer Res 6, 240-245. An, W., Kim, J., and Roeder, R.G. (2004). Ordered cooperative functions of PRMT1, p300, and CARM1 in transcriptional activation by p53. Cell 117, 735-748. Anderson, E. (2002). The role of oestrogen and progesterone receptors in human mammary development and tumorigenesis. Breast Cancer Res 4, 197-201. 159 Angelov, D., Molla, A., Perche, P.Y., Hans, F., Cote, J., Khochbin, S., Bouvet, P., and Dimitrov, S. (2003). The histone variant macroH2A interferes with transcription factor binding and SWI/SNF nucleosome remodeling. Mol Cell 11, 1033-1041. Ansari, K.I., Kasiri, S., Hussain, I., and Mandal, S.S. (2009). Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13. FEBS Journal 276, 7400-7411. Ansari, K.I., and Mandal, S.S. (2010). Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing. FEBS Journal 277, 1790-1804. Arents, G., Burlingame, R.W., Wang, B.C., Love, W.E., and Moudrianakis, E.N. (1991). The nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein assembly and a left-handed superhelix. Proc Natl Acad Sci U S A 88, 10148-10152. Auger, A., Galarneau, L., Altaf, M., Nourani, A., Doyon, Y., Utley, R.T., Cronier, D., Allard, S., and Cote, J. (2008). Eafl is the platform for NuA4 molecular assembly that evolutionarily links chromatin acetylation to ATP-dependent exchange of histone H2A variants. Mol Cell Biol 28, 2257-2270. Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jorgensen, H.F., John, R.M., Gouti, M., Casanova, M., Warnes, G., Merkenschlager, M., et al. (2006). Chromatin signatures of pluripotent cell lines. Nat Cell Biol 8, 532-538. Babiarz, J.E., Halley, J.E., and Rine, J. (2006). Telomeric heterochromatin boundaries require NuA4-dependent acetylation of histone variant H2A.Z in Saccharomy cescerevisiae. Genes Dev 20, 700-710. Badia, E., Oliva, J., Balaguer, P., and Cavailles, V. (2007). Tamoxifen resistance and epigenetic modifications in breast cancer cell lines. Curr Med Chem 14, 3035-3045. Badve, S., and Nakshatri, H. (2009). Oestrogen-receptor-positive breast cancer: towards bridging histopathological and molecular classifications. J Clin Pathol 62, 6-12. Bannister, A.J., Zegerman, P., Partridge, J.F., Miska, E.A., Thomas, J.O., Allshire, R.C., and Kouzarides, T. (2001). Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410, 120-124. Barradas, M., Anderton, E., Acosta, J.C., Li, S., Banito, A., Rodriguez-Niedenfuhr, M., Maertens, G., Banck, M., Zhou, M.M., Walsh, M.J., et al. (2009). Histone demethylase 160 JMJD3 contributes to epigenetic control of lNK4a/ARF by oncogenic RAS. Genes Dev 23, 1177-1182. Barratt, M.J., Hazzalin, C.A., Cano, E., and Mahadevan, L.C. (1994). Mitogen-stimulated phosphorylation of histone H3 is targeted to a small hyperacetylation-sensitive fraction. ProcNatl Acad Sci U S A 91,4781-4785. Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G., Chepelev, I., and Zhao, K. (2007). High-resolution profiling of histone methylations in the human genome. Cell 129, 823-837. Bartfai, R., Hoeijmakers, W.A., Salcedo-Amaya, A.M., Smits, A.H., Janssen-Megens, E., Kaan, A., Treeck, M., Gilberger, T.W., Francoijs, K.J., and Stunnenberg, H.G. (2010). H2A.Z Demarcates Intergenic Regions of the Plasmodium falciparum Epigenome That Are Dynamically Marked by H3K9ac and H3K4me3. PLoS Pathog 6, el001223. Beekman, J.M., Allan, G.F., Tsai, S.Y., Tsai, M.J., and O'Malley, B.W. (1993). Transcriptional activation by the estrogen receptor requires a conformational change in the ligand binding domain. Mol Endocrinol 7, 1266-1274. Belandia, B., Orford, R.L., Hurst, H.C., and Parker, M.G. (2002). Targeting of SWI/SNF chromatin remodelling complexes to estrogen-responsive genes. Embo J 21, 4094-4103. Benz, C.C., Scott, G.K., Sarup, J.C., Johnson, R.M., Tripathy, D., Coronado, E., Shepard, H.M., and Osborne, C.K. (1992). Estrogen-dependent, tamoxifen-resistant tumorigenic growth of MCF-7 cells transfected with HER2/neu. Breast Cancer Res Treat 24, 85-95. Bernad, R., Sanchez, P., and Losada, A. (2009). Epigenetic specification of centromeres by CENP-A. Exp Cell Res 315, 3233-3241. Berns, K., Hijmans, E.M., Mullenders, J., Brummelkamp, T.R., Velds, A., Heimerikx, M., Kerkhoven, R.M., Madiredjo, M., Nijkamp, W., Weigelt, B., et al. (2004). A largescale RNAi screen in human cells identifies new components of the p53 pathway. Nature 425,431-437. Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., et al. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315-326. Bhat-Nakshatri, P., Wang, G., Appaiah, H., Luktuke, N., Carroll, J.S., Geistlinger, T.R., Brown, M., Badve, S., Liu, Y., and Nakshatri, H. (2008). AKT alters genome-wide 161 estrogen receptor alpha binding and impacts estrogen signaling in breast cancer. Mol Cell Biol 28, 7487-7503. Biddie, S.C, John, S., and Hager, G.L. (2010). Genome-wide mechanisms of nuclear receptor action. Trends Endocrinol Metab 21, 3-9. Bjornstrom, L., and Sjoberg, M. (2005). Mechanisms of estrogen receptor signaling: convergence of genomic and nongenomic actions on target genes. Mol Endocrinol 19, 833-842. Blazejczyk, M., Miron, M., and Nadon, R. (2007). FlexArray: A statistical data analysis software for gene expression microarrays. http://genomequebec.mcgill.ca/FlexArray Boffa, L.C, Vidali, G., Mann, R.S., and Allfrey, V.G. (1978). Suppression of histone deacetylation in vivo and in vitro by sodium butyrate. J Biol Chem 253, 3364-3366. Bondarenko, V.A., Liu, Y.V., Jiang, Y.I., and Studitsky, V.M. (2003). Communication over a large distance: enhancers and insulators. Biochem Cell Biol 81, 241-251. Bredfeldt, T.G., Greathouse, K.L., Safe, S.H., Hung, M.C, Bedford, M.T., and Walker, C.L. (2010). Xenoestrogen-induced regulation of EZH2 and histone methylation via estrogen receptor signaling to PI3K7AKT. Mol Endocrinol 24, 993-1006. Brownell, J.E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D.G., Roth, S.Y., and Allis, CD. (1996). Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell 84, 843-851. Bruce, K., Myers, F.A., Mantouvalou, E., Lefevre, P., Greaves, I., Bonifer, C, Tremethick, D.J., Thorne, A.W., and Crane-Robinson, C. (2005). The replacement histone H2A.Z in a hyperacetylated form is a feature of active genes in the chicken. Nucleic Acids Res 33, 5633-5639. Brunner, N., Boysen, B., Jirus, S., Skaar, T.C, Holst-Hansen, C, Lippman, J., Frandsen, T., Spang-Thomsen, M., Fuqua, S.A., and Clarke, R. (1997). MCF7/LCC9: an antiestrogen-resistant MCF-7 variant in which acquired resistance to the steroidal antiestrogen ICI 182,780 confers an early cross-resistance to the nonsteroidal antiestrogen tamoxifen. Cancer Res 57, 3486-3493. Brunner, N., Frandsen, T.L., Holst-Hansen, C, Bei, M., Thompson, E.W., Wakeling, A.E., Lippman, M.E., and Clarke, R. (1993). MCF7/LCC2: a 4-hydroxytamoxifen 162 resistant human breast cancer variant that retains sensitivity to the steroidal antiestrogen 1CI 182,780. Cancer Res 53, 3229-3232. Brzozowski, A.M., Pike, A.C., Dauter, Z., Hubbard, R.E., Bonn, T., Engstrom, O., Ohman, L., Greene, G.L., Gustafsson, J.A., and Carlquist, M. (1997). Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389, 753-758. Bulger, M., Schubeler, D., Bender, M.A., Hamilton, J., Farrell, CM., Hardison, R.C, and Groudine, M. (2003). A complex chromatin landscape revealed by patterns of nuclease sensitivity and histone modification within the mouse beta-globin locus. Mol Cell Biol 23, 5234-5244. Buratowski, S. (2009). Progression through the RNA polymerase II CTD cycle. Mol Cell 36, 541-546. Burgold, T., Spreafico, F., De Santa, F., Totaro, M.G., Prosperini, E., Natoli, G., and Testa, G. (2008). The histone H3 lysine 27-specific demethylase Jmjd3 is required for neural commitment. PLoS One 3, e3034. Bustin, M., Catez, F., and Lim, J.H. (2005). The dynamics of histone HI function in chromatin. Mol Cell 17, 617-620. Cai, Y., Jin, J., Florens, L., Swanson, S.K., Kusch, T., Li, B., Workman, J.L., Washburn, M.P., Conaway, R.C, and Conaway, J.W. (2005). The mammalian YL1 protein is a shared subunit of the TRRAP/TIP60 histone acetyltransferase and SRCAP complexes. J Biol Chem 280, 13665-13670. Cairns, B.R. (2009). The logic of chromatin architecture and remodelling at promoters. Nature 45/, 193-198. Camp, R.L., Chung, G.G., and Rimm, D.L. (2002). Automated subcellular localization and quantification of protein expression in tissue microarrays. Nat Med 8, 1323-1327. Campbell, R.A., Bhat-Nakshatri, P., Patel, N.M., Constantinidou, D., Ali, S., and Nakshatri, H. (2001). Phosphatidylinositol 3-kinase/AKT-mediated activation of estrogen receptor alpha: a new model for anti-estrogen resistance. J Biol Chem 276, 9817-9824. Campisi, J. (2005). Suppressing cancer: the importance of being senescent. Science 309, 886-887. 163 Cao, Q., Yu, J., Dhanasekaran, S.M., Kim, J.H., Mani, R.S., Tomlins, S.A., Mehra, R., Laxman, B., Cao, X., Yu, J., et al. (2008). Repression of E-cadherin by the polycomb group protein EZH2 in cancer. Oncogene 27, 7274-7284. Cao, R., and Zhang, Y. (2004). The functions of E(Z)/EZH2-mediated methylation of lysine 27 in histone H3. Curr Opin Genet Dev 14, 155-164. Carr, A.M., Dorrington, S.M., Hindley, J., Phear, G.A., Aves, S.J., and Nurse, P. (1994). Analysis of a histone H2A variant from fission yeast: evidence for a role in chromosome stability. Mol Gen Genet 245, 628-635. Carroll, J.S., Liu, X.S., Brodsky, A.S., Li, W., Meyer, C.A., Szary, A.J., Eeckhoute, J., Shao, W., Hestermann, E.V., Geistlinger, T.R., et al. (2005). Chromosome-wide mapping of estrogen receptor binding reveals long-range regulation requiring the forkhead protein FoxAl. Cell 122, 33-43. Carroll, J.S., Meyer, C.A., Song, J., Li, W., Geistlinger, T.R., Eeckhoute, J., Brodsky, A.S., Keeton, E.K., Fertuck, K.C., Hall, G.F., et al. (2006). Genome-wide analysis of estrogen receptor binding sites. Nat Genet 38, 1289-1297. Castaneda, C.A., Cortes-Funes, H., Gomez, H.L., and Ciruelos, E.M. (2010). The phosphatidyl inositol 3-kinase/AKT signaling pathway in breast cancer. Cancer Metastasis Rev 29, 751-759. Cha, T.L., Zhou, B.P., Xia, W., Wu, Y., Yang, C.C., Chen, C.T., Ping, B., Otte, A.P., and Hung, M.C. (2005). Akt-mediated phosphorylation of EZH2 suppresses methylation of lysine 27 in histone H3. Science 310, 306-310. Chan, H.M., M. Narita, S. W. Lowe, and D. M. Livingston. (2005). The p400 E1Aassociated protein is a novel component of the p53 --> p21 senescence pathway. Genes Dev 19. Chen, B.S., and Hampsey, M. (2002). Transcription activation: unveiling the essential nature of TFIID. Curr Biol 12, R620-622. Chen, I.Y., Lypowy, J., Pain, J., Sayed, D., Grinberg, S., Alcendor, R.R., Sadoshima, J., and Abdellatif, M. (2006). Histone H2A.Z is essential for cardiac myocyte hypertrophy but opposed by silent information regulator 2alpha. J Biol Chem 281, 19369-19377. Christensen, J., Agger, K., Cloos, P.A., Pasini, D., Rose, S., Sennels, L., Rappsilber, J., Hansen, K.H., Salcini, A.E., and Helin, K. (2007). RBP2 belongs to a family of 164 demethylases, specific for tri-and dimethylated lysine 4 on histone 3. Cell 128, 10631076. Clapier, C.R., and Cairns, B.R. (2009). The biology of chromatin remodeling complexes. Annu Rev Biochem 78, 273-304. Clarkson, M.J., Wells, J.R., Gibson, F., Saint, R., and Tremethick, D.J. (1999). Regions of variant histone His2AvD required for Drosophila development. Nature 399, 694-697. Clayton, A.L., and Mahadevan, L.C. (2003). MAP kinase-mediated phosphoacetylation of histone H3 and inducible gene regulation. FEBS Lett 546, 51-58. Nuclear Receptor Nomenclature Committee (1999). A unified nomenclature system for the nuclear receptor superfamily. Cell 97,161-163. Conaway, R.C., Sato, S., Tomomori-Sato, C, Yao, T., and Conaway, J.W. (2005). The mammalian Mediator complex and its role in transcriptional regulation. Trends Biochem Sci 30, 250-255. Conerly, M.L., Teves, S.S., Diolaiti, D., Ulrich, M., Eisenman, R.N., and Henikoff, S. (2010). Changes in H2A.Z occupancy and DNA methylation during B-cell lymphomagenesis. Genome Res 20, 1383-1390. Cooper, C.S., and Foster, C.S. (2009). Concepts of epigenetics in prostate cancer development. Br J Cancer 100, 240-245. Cowley, S.M., Hoare, S., Mosselman, S., and Parker, M.G. (1997). Estrogen receptors alpha and beta form heterodimers on DNA. J Biol Chem 272, 19858-19862. Craig, J.M. (2005). Heterochromatin—many flavours, common themes. Bioessays 27, 1728. Cramer, P. (2004a). RNA polymerase II structure: from core to functional complexes. Curr Opin Genet Dev 14, 218-226. Cramer, P. (2004b). Structure and function of RNA polymerase II. Adv Protein Chem 67, 1-42. 165 Crawford, A.C., Riggins, R.B., Shajahan, A.N., Zwart, A., and Clarke, R. Co-inhibition of BCL-W and BCL2 restores antiestrogen sensitivity through BECN1 and promotes an autophagy-associated necrosis. PLoS One 5, e8604. Creyghton, M.P., Cheng, A.W., Welstead, G.G., Kooistra, T., Carey, B.W., Steine, E.J., Hanna, J., Lodato, M.A., Frampton, G.M., Sharp, P.A., et al. (2010). Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci USA. Creyghton, M.P., Markoulaki, S., Levine, S.S., Hanna, J., Lodato, M.A., Sha, K., Young, R.A., Jaenisch, R., and Boyer, L.A. (2008). H2AZ is enriched at polycomb complex target genes in ES cells and is necessary for lineage commitment. Cell 135, 649-661. Cristofalo, V.J., Lorenzini, A., Allen, R.G., Torres, C, and Tresini, M. (2004). Replicative senescence: a critical review. Mech Ageing Dev 125, 827-848. Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. (2002). Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell 111, 185-196. Dahle, O., Kumar, A., and Kuehn, M.R. (2010). Nodal signaling recruits the histone demethylase Jmjd3 to counteract polycomb-mediated repression at target genes. Sci Signal 3, ra48. Dai, J.P., Lu, J.Y., Zhang, Y., and Shen, Y.F. (2010). Jmjd3 activates Mashl gene in RAinduced neuronal differentiation of P19 cells. J Cell Biochem 110, 1457-1463. De Santa, F., Totaro, M.G.,-Prospering E., Notarbartolo, S., Testa, G., and Natoli, G. (2007). The histone H3 lysine-27 demethylase Jmjd3 links inflammation to inhibition of polycomb-mediated gene silencing. Cell 130,1083-1094. Delmas, V., Stokes, D.G., and Perry, R.P. (1993). A mammalian DNA-binding protein that contains a chromodomain and an SNF2/SWI2-like helicase domain. Proc Natl Acad SciUSA90,2414-2418. Dhillon, N., Oki, M., Szyjka, S.J., Aparicio, O.M., and Kamakaka, R.T. (2006). H2A.Z functions to regulate progression through the cell cycle. Mol Cell Biol 26, 489-501. Dickey, J.S., Redon, C.E., Nakamura, A.J., Baird, B.J., Sedelnikova, O.A., and Bonner, W.M. (2009). H2AX: functional roles and potential applications. Chromosoma 118, 683692. 166 Ding, L., Erdmann, C, Chinnaiyan, A.M., Merajver, S.D., and Kleer, C.G. (2006). Identification of EZH2 as a molecular marker for a precancerous state in morphologically normal breast tissues. Cancer Res 66, 4095-4099. Ding, L., and Kleer, C.G. (2006). Enhancer of Zeste 2 as a marker of preneoplastic progression in the breast. Cancer Res 66, 9352-9355. DiRenzo, J., Shang, Y., Phelan, M., Sif, S., Myers, M., Kingston, R., and Brown, M. (2000). BRG-1 is recruited to estrogen-responsive promoters and cooperates with factors involved in histone acetylation. Mol Cell Biol 20, 7541-7549. Dobosy, J.R., and Selker, E.U. (2001). Emerging connections between DNA methylation and histone acetylation. Cell Mol Life Sci 58, 721-727. Doisneau-Sixou, S.F., Sergio, CM., Carroll, J.S., Hui, R., Musgrove, E.A., and Sutherland, R.L. (2003). Estrogen and antiestrogen regulation of cell cycle progression in breast cancer cells. Endocr Relat Cancer 10, 179-186. Dreijerink, K.M., Mulder, K.W., Winkler, G.S., Hoppener, J.W., Lips, C.J., and Timmers, H.T. (2006). Menin links estrogen receptor activation to histone H3K4 trimethylation. Cancer Res 66, 4929-4935. Dulic, V., Kaufmann, W.K., Wilson, S.J., Tlsty, T.D., Lees, E., Harper, J.W., Elledge, S.J., and Reed, S.I. (1994). p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced Gl arrest. Cell 76, 1013-1023. Dunican, D.S., McWilliam, P., Tighe, O., Parle-McDermott, A., and Croke, D.T. (2002). Gene expression differences between the microsatellite instability (MIN) and chromosomal instability (CIN) phenotypes in colorectal cancer revealed by high-density cDNA array hybridization. Oncogene 21, 3253-3257. Dvir, A., Conaway, J.W., and Conaway, R.C. (2001). Mechanism of transcription initiation and promoter escape by RNA polymerase II. Curr Opin Genet Dev 11, 209-214. Eberharter, A., and Becker, P.B. (2004). ATP-dependent nucleosome remodelling: factors and functions. J Cell Sci 117, 3707-3711. Edwards, D.P., and Boonyaratanakornkit, V. (2003). Rapid extranuclear signaling by the estrogen receptor (ER): MNAR couples ER and Src to the MAP kinase signaling pathway. Mol Interv 3, 12-15. 167 Edwards, J.R., O'Donnell, A.H., Rollins, R.A., Peckham, H.E., Lee, C, Milekic, M.H., Chanrion, B., Fu, Y., Su, T., Hibshoosh, H., et al. (2010). Chromatin and sequence features that define the fine and gross structure of genomic methylation patterns. Genome Res 20, 972-980. Egli, D., Birkhoff, G., and Eggan, K. (2008). Mediators of reprogramming: transcription factors and transitions through mitosis. Nat Rev Mol Cell Biol 9, 505-516. Eirin-Lopez, J.M., Gonzalez-Romero, R., Dryhurst, D., Ishibashi, T., and Ausio, J. (2009). The evolutionary differentiation of two histone H2A.Z variants in chordates (H2A.Z-1 and H2A.Z-2) is mediated by a stepwise mutation process that affects three amino acid residues. BMC Evol Biol 9, 31. el-Deiry, W.S., Harper, J.W., O'Connor, P.M., Velculescu, V.E., Canman, C.E., Jackman, J., Pietenpol, J.A., Burrell, M., Hill, D.E., Wang, Y., et al. (1994). WAF1/CIP1 is induced in p53-mediated Gl arrest and apoptosis. Cancer Res 54, 1169-1174. Elsaesser, S.J., Goldberg, A.D., and Allis, CD. (2010). New functions for an old variant: no substitute for histone H3.3. Curr Opin Genet Dev 20, 110-117. Engel, J.D., and Tanimoto, K. (2000). Looping, linking, and chromatin activity: new insights into beta-globin locus regulation. Cell 100, 499-502. Erkine, A.M. (2004). Activation domains of gene-specific transcription factors: are histones among their targets? Biochem Cell Biol 82, 453-459. Ernst, J., and Kellis, M. (2010). Discovery and characterization of chromatin states for systematic annotation of the human genome. Nat Biotechnol 28, 817-825. Espinosa, J.M., Verdun, R.E., and Emerson, B.M. (2003). p53 functions through stressand promoter-specific recruitment of transcription initiation components before and after DNA damage. Mol Cell 12, 1015-1027. Faast, R., Thonglairoam, V., Schulz, T.C., Beall, J., Wells, J.R., Taylor, H., Matthaei, K., Rathjen, P.D., Tremethick, D.J., and Lyons, I. (2001). Histone variant H2A.Z is required for early mammalian development. Curr Biol //, 1183-1187. Fan, H.Y., He, X., Kingston, R.E., and Narlikar, G.J. (2003a). Distinct strategies to make nucleosomal DNA accessible. Mol Cell 11, 1311-1322. 168 Fan, J.Y., Gordon, F., Luger, K., Hansen, J.C., and Tremethick, D.J. (2002). The essential histone variant H2A.Z regulates the equilibrium between different chromatin conformational states. Nat Struct Biol 9, 172-176. Fan, J.Y., Rangasamy, D., Luger, K., and Tremethick, D.J. (2004). H2A.Z alters the nucleosome surface to promote HP 1 alpha-mediated chromatin fiber folding. Mol Cell 16, 655-661. Fan, M., Bigsby, R.M., and Nephew, K.P. (2003b). The NEDD8 pathway is required for proteasome-mediated degradation of human estrogen receptor (ER)-alpha and essential for the antiproliferative activity of ICI 182,780 in ERalpha-positive breast cancer cells. Mol Endocrinol 17, 356-365. Fan, M, Yan, P.S., Hartman-Frey, C, Chen, L., Paik, H., Oyer, S.L., Salisbury, J.D., Cheng, A.S., Li, L., Abbosh, P.H., et al. (2006). Diverse gene expression and DNA methylation profiles correlate with differential adaptation of breast cancer cells to the antiestrogens tamoxifen and fulvestrant. Cancer Res 66, 11954-11966. Fang, J.Y., and Lu, Y.Y. (2002). Effects of histone acetylation and DNA methylation on p21( WAF1) regulation. World J Gastroenterol 8, 400-405. Farris, S.D., Rubio, E.D., Moon, J.J., Gombert, W.M., Nelson, B.H., and Krumm, A. (2005). Transcription-induced chromatin remodeling at the c-myc gene involves the local exchange of histone H2A.Z. J Biol Chem 280, 25298-25303. Fazzio, T.G., Huff, J.T., and Panning, B. (2008). An RNAi screen of chromatin proteins identifies Tip60-p400 as a regulator of embryonic stem cell identity. Cell 134, 162-174. Fazzio, T.G., and Tsukiyama, T. (2003). Chromatin remodeling in vivo: evidence for a nucleosome sliding mechanism. Mol Cell 12, 1333-1340. Felsenfeld, G., and McGhee, J.D. (1986). Structure of the 30 nm chromatin fiber. Cell 44, 375-377. Feng, Q., and Zhang, Y. (2003). The NuRD complex: linking histone modification to nucleosome remodeling. Curr Top Microbiol Immunol 274, 269-290. Ferguson, D.J., and Anderson, T.J. (1981). Morphological evaluation of cell turnover in relation to the menstrual cycle in the "resting" human breast. Br J Cancer 44, 177-181. 169 Field, Y., Fondufe-Mittendorf, Y., Moore, I.K., Mieczkowski, P., Kaplan, N., Lubling, Y., Lieb, J.D., Widom, J., and Segal, E. (2009). Gene expression divergence in yeast is coupled to evolution of DNA-encoded nucleosome organization. Nat Genet 41, 438-445. Field, Y., Kaplan, N., Fondufe-Mittendorf, Y., Moore, I.K., Sharon, E., Lubling, Y., Widom, J., and Segal, E. (2008). Distinct modes of regulation by chromatin encoded through nucleosome positioning signals. PLoS Comput Biol 4, el000216. Fox, E.M., Davis, R.J., and Shupnik, M.A. (2008). ERbeta in breast cancer—onlooker, passive player, or active protector? Steroids 73, 1039-1051. Frank, S.R., Parisi, T., Taubert, S., Fernandez, P., Fuchs, M., Chan, H.M., Livingston, D.M., and Amati, B. (2003). MYC recruits the TIP60 histone acetyltransferase complex to chromatin. EMBO Rep 4, 575-580. Fu, Y., Sinha, M., Peterson, C.L., and Weng, Z. (2008). The insulator binding protein CTCF positions 20 nucleosomes around its binding sites across the human genome. PLoS Genet ¥, el000138. Fuchs, M., Gerber, J., Drapkin, R., Sif, S., Ikura, T., Ogryzko, V., Lane, W.S., Nakatani, Y., and Livingston, D.M. (2001). The p400 complex is an essential E1A transformation target. Cell 106, 297-307. Fullwood, M.J., Liu, M.H., Pan, Y.F., Liu, J., Xu, H., Mohamed, Y.B., Orlov, Y.L., Velkov, S., Ho, A., Mei, P.H., et al. (2009). An oestrogen-receptor-alpha-bound human chromatin interactome. Nature 462, 58-64. Gao, Y., Hyttel, P., and Hall, V.J. (2010). Regulation of H3K27me3 and H3K4me3 during early porcine embryonic development. Mol Reprod Dev 77, 540-549. Garcia-Bassets, I., Kwon, Y.S., Telese, F., Prefontaine, G.G., Hutt, K.R., Cheng, C.S., Ju, B.G., Ohgi, K.A., Wang, J., Escoubet-Lozach, L., et al (2007). Histone methylationdependent mechanisms impose ligand dependency for gene activation by nuclear receptors. Cell 128, 505-518. Garriga, J., and Grana, X. (2004). Cellular control of gene expression by T-type cyclin/CDK9 complexes. Gene 337, 15-23. Gatta, R., and Mantovani, R. (2010). Single nucleosome ChlPs identify an extensive switch of acetyl marks on cell cycle promoters. Cell Cycle 9. 170 Germain, P., Staels, B., Dacquet, C, Spedding, M., and Laudet, V. (2006). Overview of nomenclature of nuclear receptors. Pharmacol Rev 58, 685-704. Gervais, A.L., and Gaudreau, L. (2009). Discriminating nucleosomes containing histone H2A.Z or H2A based on genetic and epigenetic information. BMC Mol Biol 10, 18. Gevry, N., Chan, H.M., Laflamme, L., Livingston, D.M., and Gaudreau, L. (2007). p21 transcription is regulated by differential localization of histone H2A.Z. Genes Dev 21, 1869-1881. Gevry, N., Hardy, S., Jacques, P.E., Laflamme, L., Svotelis, A., Robert, F., and Gaudreau, L. (2009). Histone H2A.Z is essential for estrogen receptor signaling. Genes Dev 23, 1522-1533. Gligoris, T., Thireos, G., and Tzamarias, D. (2007). The Tupl corepressor directs Htzl deposition at a specific promoter nucleosome marking the GALl gene for rapid activation. Mol Cell Biol 27, 4198-4205. Gojis, O., Rudraraju, B., Gudi, M., Hogben, K., Sousha, S., Coombes, R.C., Cleator, S., and Palmieri, C. (2010). The role of SRC-3 in human breast cancer. Nat Rev Clin Oncol 7, 83-89. Gonzalez, M.E., Li, X., Toy, K., DuPrie, M., Ventura, A.C., Banerjee, M., Ljungman, M., Merajver, S.D., and Kleer, C.G. (2009). Downregulation of EZH2 decreases growth of estrogen receptor-negative invasive breast carcinoma and requires BRCA1. Oncogene 28, 843-853. Gorrini, C, Squatrito, M., Luise, C, Syed, N., Perna, D., Wark, L., Martinato, F., Sardella, D., Verrecchia, A., Bennett, S., et al. (2007). Tip60 is a haplo-insufficient tumour suppressor required for an oncogene-induced DNA damage response. Nature 448, 1063-1067. Goto, H., Tomono, Y., Ajiro, K., Kosako, H., Fujita, M., Sakurai, M., Okawa, K., Iwamatsu, A., Okigaki, T., Takahashi, T., et al. (1999). Identification of a novel phosphorylation site on histone H3 coupled with mitotic chromosome condensation. J Biol Chem 274, 25543-25549. Green, S., Walter, P., Kumar, V., Krust, A., Bornert, J.M., Argos, P., and Chambon, P. (1986). Human oestrogen receptor cDNA: sequence, expression and homology to v-erbA. Nature 320, 134-139. 171 Greene, G.L., Gilna, P., Waterfield, M., Baker, A., Hort, Y., and Shine, J. (1986). Sequence and expression of human estrogen receptor complementary DNA. Science 231, 1150-1154. Gu, W., Shi, X.L., and Roeder, R.G. (1997). Synergistic activation of transcription by CBP and p53. Nature 387, 819-823. Guenther, M.G., Levine, S.S., Boyer, L.A., Jaenisch, R., and Young, R.A. (2007). A chromatin landmark and transcription initiation at most promoters in human cells. Cell 130, 77-88. Guillemette, B., Bataille, A.R., Gevry, N., Adam, M, Blanchette, M., Robert, F., and Gaudreau, L. (2005). Variant histone H2A.Z is globally localized to the promoters of inactive yeast genes and regulates nucleosome positioning. PLoS Biol 3, e384. Gurley, L.R., D'Anna, J.A., Barham, S.S., Deaven, L.L., and Tobey, R.A. (1978). Histone phosphorylation and chromatin structure during mitosis in Chinese hamster cells. Eur J Biochem<W, 1-15. Hajkova, P., Ancelin, K., Waldmann, T., Lacoste, N., Lange, U.C., Cesari, F., Lee, C, Almouzni, G., Schneider, R., and Surani, M.A. (2008). Chromatin dynamics during epigenetic reprogramming in the mouse germ line. Nature 452, 877-881. Hake, S.B., and Allis, CD. (2006). Histone H3 variants and their potential role in indexing mammalian genomes: The "H3 barcode hypothesis". Proc Natl Acad Sci USA. Hall, J.A., and Georgel, P.T. (2007). CHD proteins: a diverse family with strong ties. Biochem Cell Biol 85, 463-476. Hanahan, D., and Weinberg, R.A. (2000). The hallmarks of cancer. Cell 100, 57-70. Hardy, S., Jacques, P.E., Gevry, N., Forest, A., Fortin, M.E., Laflamme, L., Gaudreau, L., and Robert, F. (2009). The euchromatic and heterochromatic landscapes are shaped by antagonizing effects of transcription on H2A.Z deposition. PLoS Genet 5, el 000687. Hartman, J., Lindberg, K., Morani, A., Inzunza, J., Strom, A., and Gustafsson, J.A. (2006). Estrogen receptor beta inhibits angiogenesis and growth of T47D breast cancer xenografts. Cancer Res 66, 11207-11213. Hartman, J., Strom, A., and Gustafsson, J.A. (2009). Estrogen receptor beta in breast cancer-diagnostic and therapeutic implications. Steroids 74, 635-641. 172 Hatch, C.L., and Bonner, W.M. (1988). Sequence of cDNAs for mammalian H2A.Z, an evolutionarily diverged but highly conserved basal histone H2A isoprotein species. Nucleic Acids Res 16, 1113-1124. Henikoff, S., Furuyama, T., and Ahmad, K. (2004). Histone variants, nucleosome assembly and epigenetic inheritance. Trends Genet 20, 320-326. Hong, S., Cho, Y.W., Yu, L.R., Yu, H., Veenstra, T.D., and Ge, K. (2007). Identification of JmjC domain-containing UTX and JMJD3 as histone H3 lysine 27 demethylases. Proc Natl Acad Sci U S A 104, 18439-18444. Hou, C, Zhao, H., Tanimoto, K., and Dean, A. (2008). CTCF-dependent enhancerblocking by alternative chromatin loop formation. Proc Natl Acad Sci U S A 705, 2039820403. Hua, S., Kallen, C.B., Dhar, R., Baquero, M.T., Mason, C.E., Russell, B.A., Shah, P.K., Liu, J., Khramtsov, A., Tretiakova, M.S., et al. (2008). Genomic analysis of estrogen cascade reveals histone variant H2A.Z associated with breast cancer progression. Mol SystBioW, 188. Hurtado, A., Holmes, K.A., Geistlinger, T.R., Hutcheson, I.R., Nicholson, R.I., Brown, M., Jiang, J., Howat, W.J., Ali, S., and Carroll, J.S. (2008). Regulation of ERBB2 by oestrogen receptor-PAX2 determines response to tamoxifen. Nature 456, 663-666. Imbalzano, A.N., Kwon, H., Green, M.R., and Kingston, R.E. (1994). Facilitated binding of TATA-binding protein to nucleosomal DNA. Nature 370, 481-485. Iouzalen, N., Moreau, J., and Mechali, M. (1996). H2A.ZI, a new variant histone expressed during Xenopus early development exhibits several distinct features from the core histone H2A. Nucleic Acids Res 24, 3947-3952. Ishibashi, T., Dryhurst, D., Rose, K.L., Shabanowitz, J., Hunt, D.F., and Ausio, J. (2009). Acetylation of vertebrate H2A.Z and its effect on the structure of the nucleosome. Biochemistry 48, 5007-5017. Issaeva, I., Zonis, Y., Rozovskaia, T., Orlovsky, K., Croce, CM., Nakamura, T., Mazo, A., Eisenbach, L., and Canaani, E. (2007). Knockdown of ALR (MLL2) reveals ALR target genes and leads to alterations in cell adhesion and growth. Mol Cell Biol 27, 18891903. 173 Ito, T., Levenstein, M.E., Fyodorov, D.V., Kutach, A.K., Kobayashi, R., and Kadonaga, J.T. (1999). ACF consists of two subunits, Acfl and ISWI, that function cooperatively in the ATP-dependent catalysis of chromatin assembly. Genes Dev 13, 1529-1539. Jackson, J.D., and Gorovsky, M.A. (2000). Histone H2A.Z has a conserved function that is distinct from that of the major H2A sequence variants. Nucleic Acids Res 28, 38113816. Jiang, W., Guo, X., and Bhavanandan, V.P. (1998). Histone H2A.F/Z subfamily: the smallest member and the signature sequence. Biochem Biophys Res Commun 245, 613617. Jin, C, Zang, C, Wei, G., Cui, K., Peng, W., Zhao, K., and Felsenfeld, G. (2009). H3.3/H2A.Z double variant-containing nucleosomes mark 'nucleosome-free regions' of active promoters and other regulatory regions. Nat Genet 41, 941-945. Jin, J., Cai, Y., Li, B., Conaway, R.C., Workman, J.L., Conaway, J.W., and Kusch, T. (2005a). In and out: histone variant exchange in chromatin. Trends Biochem Sci 30, 680687. Jin, J., Cai, Y., Yao, T., Gottschalk, A.J., Florens, L., Swanson, S.K., Gutierrez, J.L., Coleman, M.K., Workman, J.L., Mushegian, A., et al. (2005b). A mammalian chromatin remodeling complex with similarities to the yeast INO80 complex. J Biol Chem 280, 41207-41212. John, S., Sabo, P.J., Johnson, T.A., Sung, M.H., Biddie, S.C., Lightman, S.L., Voss, T.C., Davis, S.R., Meltzer, P.S., Stamatoyannopoulos, J.A., et al. (2008). Interaction of the glucocorticoid receptor with the chromatin landscape. Mol Cell 29, 611-624. Jones, R.S. (2007). Epigenetics: reversing the 'irreversible'. Nature 450, 357-359. Jorgensen, H.F., Giadrossi, S., Casanova, M., Endoh, M., Koseki, H., Brockdorff, N., and Fisher, A.G. (2006). Stem cells primed for action: polycomb repressive complexes restrain the expression of lineage-specific regulators in embryonic stem cells. Cell Cycle 5,1411-1414. Joseph, R., Orlov, Y.L., Huss, M., Sun, W., Kong, S.L., Ukil, L., Pan, Y.F., Li, G., Lim, ML, Thomsen, J.S., et al. (2010). Integrative model of genomic factors for determining binding site selection by estrogen receptor-alpha. Mol Syst Biol 6, 456. 174 Juven-Gershon, T., Hsu, J.Y., Theisen, J.W., and Kadonaga, J.T. (2008). The RNA polymerase II core promoter - the gateway to transcription. Curr Opin Cell Biol 20, 253259. Kal, A.J., Mahmoudi, T., Zak, N.B., and Verrijzer, C.P. (2000). The Drosophila brahma complex is an essential coactivator for the trithorax group protein zeste. Genes Dev 14, 1058-1071. Kalkhoven, E. (2004). CBP and p300: HATs for different occasions. Biochem Pharmacol 65,1145-1155. Kaplan, N., Moore, I.K., Fondufe-Mittendorf, Y., Gossett, A.J., Tillo, D., Field, Y., LeProust, E.M., Hughes, T.R., Lieb, J.D., Widom, J., et al. (2009). The DNA-encoded nucleosome organization of a eukaryotic genome. Nature 458, 362-366. Katzenellenbogen, B.S. (1996). Estrogen receptors: bioactivities and interactions with cell signaling pathways. Biol Reprod 54, 287-293. Kelley, D.E., Stokes, D.G., and Perry, R.P. (1999). CHDl interacts with SSRPl and depends on both its chromodomain and its ATPase/helicase-like domain for proper association with chromatin. Chromosoma 108, 10-25. Kelly, M.J., and Levin, E.R. (2001). Rapid actions of plasma membrane estrogen receptors. Trends Endocrinol Metab 12, 152-156. Kelly, T.K., Miranda, T.B., Liang, G., Berman, B.P., Lin, J.C., Tanay, A., and Jones, P.A. (2010). H2A.Z maintenance during mitosis reveals nucleosome shifting on mitotically silenced genes. Mol Cell 39, 901-911. Keogh, M.C., Mennella, T.A., Sawa, C, Berthelet, S., Krogan, N.J., Wolek, A., Podolny, V., Carpenter, L.R., Greenblatt, J.F., Baetz, K., et al. (2006). The Saccharomyces cerevisiae histone H2A variant Htzl is acetylated by NuA4. Genes Dev 20, 660-665. Kheradmand Kia, S., Solaimani Kartalaei, P., Farahbakhshian, E., Pourfarzad, F., von Lindern, M., and Verrijzer, C.P. (2009). EZH2-dependent chromatin looping controls INK4a and INK4b, but not ARF, during human progenitor cell differentiation and cellular senescence. Epigenetics Chromatin 2, 16. Kim, J.H., Kim, B., Cai, L., Choi, H.J., Ohgi, K.A., Tran, C, Chen, C, Chung, C.H., Huber, O., Rose, D.W., et al. (2005). Transcriptional regulation of a metastasis suppressor gene by Tip60 and beta-catenin complexes. Nature 434, 921-926. 175 Klotz, D.M., Hewitt, S.C., Ciana, P., Raviscioni, M., Lindzey, J.K., Foley, J., Maggi, A., DiAugustine, R.P., and Korach, K.S. (2002). Requirement of estrogen receptor-alpha in insulin-like growth factor-1 (IGF-l)-induced uterine responses and in vivo evidence for IGF-1/estrogen receptor cross-talk. J Biol Chem 277, 8531-8537. Knezetic, J.A., and Luse, D.S. (1986). The presence of nucleosomes on a DNA template prevents initiation by RNA polymerase II in vitro. Cell 45, 95-104. Knoepfler, P.S., Zhang, X.Y., Cheng, P.F., Gafken, P.R., McMahon, S.B., and Eisenman, R.N. (2006). Myc influences global chromatin structure. Embo J 25, 2723-2734. Kobor, M.S., and Lorincz, M.C. (2009). H2A.Z and DNA methylation: irreconcilable differences. Trends Biochem Sci 34, 158-161. Kobor, M.S., Venkatasubrahmanyam, S., Meneghini, M.D., Gin, J.W., Jennings, J.L., Link, A.J., Madhani, H.D., and Rine, J. (2004). A pro*lein complex containing the conserved Swi2/Snf2-related ATPase Swrlp deposits histone variant H2A.Z into euchromatin. PLoS Biol 2, E131. Koleske, A.J., and Young, R.A. (1994). An RNA polymerase II holoenzyme responsive to activators. Nature 368, 466-469. Kornberg, R.D., and Thomas, J.O. (1974). Chromatin structure; oligomers of the histones. Science 184, 865-868. Kotekar, A.S., Weissman, J.D., Gegonne, A., Cohen, H., and Singer, D.S. (2008). Histone modifications, but not nucleosomal positioning, correlate with major histocompatibility complex class I promoter activity in different tissues in vivo. Mol Cell Biol 28, 7323-7336. Kouzarides, T. (2007). Chromatin modifications and their function. Cell 128, 693-705. Kramps, C, Strieder, V., Sapetschnig, A., Suske, G., and Lutz, W. (2004). E2F and Spl/Sp3 Synergize but are not sufficient to activate the MYCN gene in neuroblastomas. J Biol Chem 279,5110-5117. Krege, J.H., Hodgin, J.B., Couse, J.F., Enmark, E., Warner, M., Mahler, J.F., Sar, M., Korach, K.S., Gustafsson, J.A., and Smithies, O. (1998). Generation and reproductive phenotypes of mice lacking estrogen receptor beta. Proc Natl Acad Sci U S A 95, 1567715682. 176 Krogan, N.J., Baetz, K., Keogh, M.C., Datta, N., Sawa, C, Kwok, T.C., Thompson, N.J., Davey, M.G., Pootoolal, J., Hughes, T.R., et al. (2004). Regulation of chromosome stability by the histone H2A variant Htzl, the Swrl chromatin remodeling complex, and the histone acetyltransferase NuA4. Proc Natl Acad Sci U S A 101, 13513-13518. Krogan, N.J., Keogh, M.C., Datta, N., Sawa, C, Ryan, O.W., Ding, H., Haw, R.A., Pootoolal, J., Tong, A., Canadien, V., et al. (2003). A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htzl. Mol Cell 12, 1565-1576. Krum, S.A., Miranda-Carboni, G.A., Lupien, M., Eeckhoute, J., Carroll, J.S., and Brown, M. (2008). Unique ERalpha cistromes control cell type-specific gene regulation. Mol Endocrinol 22, 2393-2406. Ku, M, Koche, R.P., Rheinbay, E., Mendenhall, E.M., Endoh, M., Mikkelsen, T.S., Presser, A., Nusbaum, C, Xie, X., Chi, A.S., et al. (2008). Genomewide analysis of PRC1 and PRC2 occupancy identifies two classes of bivalent domains. PLoS Genet 4, el000242. Kuang, S.Q., Liao, L., Zhang, H., Lee, A.V., O'Malley, B.W., and Xu, J. (2004). AIB1/SRC-3 deficiency affects insulin-like growth factor I signaling pathway and suppresses v-Ha-ras-induced breast cancer initiation and progression in mice. Cancer Res 64, 1875-1885. Kuiper, G.G., Carlsson, B., Grandien, K., Enmark, E., Haggblad, J., Nilsson, S., and Gustafsson, J.A. (1997). Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 138, 863-870. Kumar, R., Mandal, M, Lipton, A., Harvey, H., and Thompson, C.B. (1996). Overexpression of HER2 modulates bcl-2, bcl-XL, and tamoxifen-induced apoptosis in human MCF-7 breast cancer cells. Clin Cancer Res 2, 1215-1219. Kumar, R., and Thompson, E.B. (1999). The structure of the nuclear hormone receptors. Steroids 64, 310-319. Kumar, V., Green, S., Stack, G., Berry, M., Jin, J.R., and Chambon, P. (1987). Functional domains of the human estrogen receptor. Cell 57, 941-951. Kusch, T., Florens, L., Macdonald, W.H., Swanson, S.K., Glaser, R.L., Yates, J.R., 3rd, Abmayr, S.M., Washburn, M.P., and Workman, J.L. (2004). Acetylation by Tip60 is required for selective histone variant exchange at DNA lesions. Science 306, 2084-2087. 177 Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst, P., and Reinberg, D. (2002). Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes Dev 16, 2893-2905. Kyprianou, N., English, H.F., Davidson, N.E., and Isaacs, J.T. (1991). Programmed cell death during regression of the MCF-7 human breast cancer following estrogen ablation. Cancer Res 57, 162-166. Lachner, M., O'Carroll, D., Rea, S., Mechtler, K., and Jenuwein, T. (2001). Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 410, 116-120. Lan, F., Bayliss, P.E., Rinn, J.L., Whetstine, J.R., Wang, J.K., Chen, S., Iwase, S., Alpatov, R., Issaeva, I., Canaani, E., et al. (2007). A histone H3 lysine 27 demethylase regulates animal posterior development. Nature 449, 689-694. Langst, G., and Becker, P.B. (2001). ISWI induces nucleosome sliding on nicked DNA. Mol Cell 8, 1085-1092. Langst, G., Bonte, E.J., Corona, D.F., and Becker, P.B. (1999). Nucleosome movement by CHRAC and ISWI without disruption or trans-displacement of the histone octamer. Cell 97, 843-852. Larochelle, M., and Gaudreau, L. (2003). H2A.Z has a function reminiscent of an activator required for preferential binding to intergenic DNA. Embo J 22, 4512-4522. Le, N.T., Ho, T.B., and Ho, B.H. (2010). Sequence-dependent histone variant positioning signatures. BMC Genomics 11 Suppl 4, S3. Leach, T.J., Mazzeo, M., Chotkowski, H.L., Madigan, J.P., Wotring, M.G., and Glaser, R.L. (2000). Histone H2A.Z is widely but nonrandomiy distributed in chromosomes of Drosophila melanogaster. J Biol Chem 275, 23267-23272. Lee, J.S., Smith, E., and Shilatifard, A. (2010). The language of histone crosstalk. Cell 142, 682-685. Lee, M.G., Villa, R., Trojer, P., Norman, J., Yan, K.P., Reinberg, D., Di Croce, L., and Shiekhattar, R. (2007a). Demethylation of H3K27 regulates polycomb recruitment and H2A ubiquitination. Science 318, 447-450. 178 Lee, W., Tillo, D., Bray, N., Morse, R.H., Davis, R.W., Hughes, T.R., and Nislow, C. (2007b). A high-resolution atlas of nucleosome occupancy in yeast. Nat Genet 39, 12351244. Legube, G., Linares, L.K., Tyteca, S., Caron, C, Scheffner, M., Chevillard-Briet, M., and Trouche, D. (2004). Role of the histone acetyl transferase Tip60 in the p53 pathway. J Biol Chem 279, 44825-44833. Lehnes, K., Winder, A.D., Alfonso, C, Kasid, N., Simoneaux, M., Summe, H., Morgan, E., Iann, M.C., Duncan, J., Eagan, M., et al. (2007). The effect of estradiol on in vivo tumorigenesis is modulated by the human epidermal growth factor receptor 2/phosphatidylinositol 3-kinase/Aktl pathway. Endocrinology 148, 1171-1180. Lemieux, K., and Gaudreau, L. (2004). Targeting of Swi/Snf to the yeast GAL1 UAS G requires the Mediator, TAF lis, and RNA polymerase II. Embo J 23, 4040-4050. Lemieux, K., Larochelle, M., and Gaudreau, L. (2008). Variant histone H2A.Z, but not the HMG proteins Nhp6a/b, is essential for the recruitment of Swi/Snf, Mediator, and SAGA to the yeast GAL1 UAS(G). Biochem Biophys Res Commun 369, 1103-1107. Levin, E.R. (2005). Integration of the extranuclear and nuclear actions of estrogen. Mol Endocrinol 19, 1951-1959. Levine, M., and Tjian, R. (2003). Transcription regulation and animal diversity. Nature 424, 147-151. Lewis, M.D., Miller, S.A., Miazgowicz, M.M., Beima, K.M., and Weinmann, A.S. (2007). T-bet's ability to regulate individual target genes requires the conserved T-box domain to recruit histone methytransferase activity and a separate family memberspecific transactivation domain. Mol Cell Biol 27, 8510-8521. Li, B., Carey, M., and Workman, J.L. (2007). The role of chromatin during transcription. Cell 128, 707-719. Li, B., Pattenden, S.G., Lee, D., Gutierrez, J., Chen, J., Seidel, C, Gerton, J., and Workman, J.L. (2005). Preferential occupancy of histone variant H2AZ at inactive promoters influences local histone modifications and chromatin remodeling. Proc Natl Acad Sci U S A 102, 18385-18390. Lill, N.L., Grossman, S.R., Ginsberg, D., DeCaprio, J., and Livingston, D.M. (1997). Binding and modulation of p53 by p300/CBP coactivators. Nature 387, 823-827. 179 Lin, C.Y., Vega, V.B., Thomsen, J.S., Zhang, T., Kong, S.L., Xie, M., Chiu, K.P., Lipovich, L., Barnett, D.H., Stossi, F., et al (2007a). Whole-genome cartography of estrogen receptor alpha binding sites. PLoS Genet 3, e87. Lin, Z., Reierstad, S., Huang, C.C., and Bulun, S.E. (2007b). Novel estrogen receptoralpha binding sites and estradiol target genes identified by chromatin immunoprecipitation cloning in breast cancer. Cancer Res 67, 5017-5024. Ling, J.Q., Li, T., Hu, J.F., Vu, T.H., Chen, H.L., Qiu, X.W., Cherry, A.M., and Hoffman, A.R. (2006). CTCF mediates interchromosomal colocalization between Igf2/H19 and Wsbl/Nfl. Science 312, 269-272. Liu, C.L., Kaplan, T., Kim, M., Buratowski, S., Schreiber, S.L., Friedman, N., and Rando, O.J. (2005). Single-nucleosome mapping of histone modifications in S. cerevisiae. PLoS Biol 3, e328. Liu, X., Bowen, J., and Gorovsky, M.A. (1996a). Either of the major H2A genes but not an evolutionarily conserved H2A.F/Z variant of Tetrahymena thermophila can function as the sole H2A gene in the yeast Saccharomyces cerevisiae. Mol Cell Biol 16,2878-2887. Liu, X., Li, B., and GorovskyMa (1996b). Essential and nonessential histone H2A variants in Tetrahymena thermophila. Mol Cell Biol 16, 4305-4311. Lorch, Y., LaPointe, J.W., and Kornberg, R.D. (1987). Nucleosomes inhibit the initiation of transcription but allow chain elongation with the displacement of histones. Cell 49, 203-210. Loyola, A., LeRoy, G., Wang, Y.H., and Reinberg, D. (2001). Reconstitution of recombinant chromatin establishes a requirement for histone-tail modifications during chromatin assembly and transcription. Genes Dev 15, 2837-2851. Luger, K. (2003). Structure and dynamic behavior of nucleosomes. Curr Opin Genet Dev 13, 127-135. Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997). Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251260. Luk, E., Ranjan, A., Fitzgerald, P.C., Mizuguchi, G., Huang, Y., Wei, D., and Wu, C. (2010). Stepwise Histone Replacement by SWR1 Requires Dual Activation with Histone H2A.Z and Canonical Nucleosome. Cell 143, 725-736. 180 Luk, E., Vu, N.D., Patteson, K., Mizuguchi, G., Wu, W.H., Ranjan, A., Backus, J., Sen, S., Lewis, M., Bai, Y., et al. (2007). Chzl, a nuclear chaperone for histone H2AZ. Mol Cell 25, 357-368. Lupien, M., Eeckhoute, J., Meyer, C.A., Wang, Q., Zhang, Y., Li, W., Carroll, J.S., Liu, X.S., and Brown, M. (2008). FoxAl translates epigenetic signatures into enhancer-driven lineage-specific transcription. Cell 132, 958-970. Lusser, A., and Kadonaga, J.T. (2003). Chromatin remodeling by ATP-dependent molecular machines. Bioessays 25, 1192-1200. Malik, H.S., and Henikoff, S. (2003). Phylogenomics of the nucleosome. Nat Struct Biol 70,882-891. Malik, S., and Roeder, R.G. (2000). Transcriptional regulation through Mediator-like coactivators in yeast and metazoan cells. Trends Biochem Sci 25, 277-283. Malik, S., and Roeder, R.G. (2010). The metazoan Mediator co-activator complex as an integrative hub for transcriptional regulation. Nat Rev Genet 11, 761-772. Mangelsdorf, D.J., Thummel, C, Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., et al. (1995). The nuclear receptor superfamily: the second decade. Cell 83, 835-839. Margueron, R., Trojer, P., and Reinberg, D. (2005). The key to development: interpreting the histone code? Curr Opin Genet Dev 15, 163-176. Marmorstein, R. (2001). Protein modules that manipulate histone tails for chromatin regulation. Nat Rev Mol Cell Biol 2, 422-432. Marquez, D.C., and Pietras, R.J. (2001). Membrane-associated binding sites for estrogen contribute to growth regulation of human breast cancer cells. Oncogene 20, 5420-5430. Martin, M.B., Franke, T.F., Stoica, G.E., Chambon, P., Katzenellenbogen, B.S., Stoica, B.A., McLemore, M.S., OHvo, S.E., and Stoica, A. (2000). A role for Akt in mediating the estrogenic functions of epidermal growth factor and insulin-like growth factor I. Endocrinology 141, 4503-4511. Mattera, L., Courilleau, C, Legube, G., Ueda, T., Fukunaga, R., Chevillard-Briet, M., Canitrot, Y., Escaffit, F., and Trouche, D. (2010). The ElA-associated p400 protein 181 modulates cell fate decisions by the regulation of ROS homeostasis. PLoS Genet 6, el 000983. Mattera, L., Escaffit, F., Pillaire, M.J., Selves, J., Tyteca, S., Hoffmann, J.S., Gourraud, P.A., Chevillard-Briet, M., Cazaux, C, and Trouche, D. (2009). The p400/Tip60 ratio is critical for colorectal cancer cell proliferation through DNA damage response pathways. Oncogene 28, 1506-1517. Matthews, J., and Gustafsson, J.A. (2003). Estrogen signaling: a subtle balance between ER alpha and ER beta. Mol Interv 3, 281-292. Mavrich, T.N., Ioshikhes, LP., Venters, B.J., Jiang, C, Tomsho, L.P., Qi, J., Schuster, S.C., Albert, 1., and Pugh, B.F. (2008a). A barrier nucleosome model for statistical positioning of nucleosomes throughout the yeast genome. Genome Res 18, 1073-1083. Mavrich, T.N., Jiang, C, Ioshikhes, LP., Li, X., Venters, B.J., Zanton, S.J., Tomsho, L.P., Qi, J., Glaser, R.L., Schuster, S.C., et al. (2008b). Nucleosome organization in the Drosophila genome. Nature 453, 358-362. Mazurkiewicz, J., Kepert, J.F., and Rippe, K. (2006). On the mechanism of nucleosome assembly by histone chaperone NAP1. J Biol Chem 281, 16462-16472. McClelland, R.A., Manning, D.L., Gee, J.M., Anderson, E., Clarke, R., Howell, A., Dowsett, M., Robertson, J.F., Blarney, R.W., Wakeling, A.E., et al. (1996). Effects of short-term antiestrogen treatment of primary breast cancer on estrogen receptor mRNA and protein expression and on estrogen-regulated genes. Breast Cancer Res Treat 41, 3141. McKittrick, E., Gafken, P.R., Ahmad, K., and Henikoff, S. (2004). Histone H3.3 is enriched in covalent modifications associated with active chromatin. Proc Natl Acad Sci US A 101, 1525-1530. Mellor, J. (2005). The dynamics of chromatin remodeling at promoters. Mol Cell 19, 147-157. Meneghini, M.D., Wu, M., and Madhani, H.D. (2003). Conserved histone variant H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin. Cell 112, 725736. Metivier, R., Huet, G., Gallais, R., Finot, L., Petit, F., Tiffoche, C, Merot, Y., LePeron, C, Reid, G., Penot, G., et al. (2008). Dynamics of estrogen receptor-mediated 182 transcriptional activation of responsive genes in vivo: apprehending transcription in four dimensions. Adv Exp Med Biol 617, 129-138. Metivier, R., Penot, G., Carmouche, R.P., Hubner, M.R., Reid, G., Denger, S., Manu, D., Brand, H., Kos, M., Benes, V., et al. (2004). Transcriptional complexes engaged by apoestrogen receptor-alpha isoforms have divergent outcomes. Embo J 23, 3653-3666. Metivier, R., Penot, G., Hubner, M.R., Reid, G., Brand, H., Kos, M., and Gannon, F. (2003). Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115, 751-763. Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P., Brockman, W., Kim, T.K., Koche, R.P., et al. (2007). Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448, 553-560. Millar, C.B., Xu, F., Zhang, K., and Grunstein, M. (2006). Acetylation of H2AZ Lys 14 is associated with genome-wide gene activity in yeast. Genes Dev 20, 711-722. Miller, S.A., Mohn, S.E., and Weinmann, A.S. (2010). Jmjd3 and UTX play a demethylase-independent role in chromatin remodeling to regulate T-box family member-dependent gene expression. Mol Cell 40, 594-605. Miller, S.A., and Weinmann, A.S. (2009). An essential interaction between T-box proteins and histone-modifying enzymes. Epigenetics 4, 85-88. Miller, S.A., and Weinmann, A.S. (2010). Molecular mechanisms by which T-bet regulates T-helper cell commitment. Immunol Rev 238, 233-246. Mitchell, P.J., and Tjian, R. (1989). Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245, 371-378. Mizuguchi, G., Shen, X., Landry, J., Wu, W.H., Sen, S., and Wu, C. (2004). ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science 303, 343-348. Mo, R., Rao, S.M., and Zhu, Y.J. (2006). Identification of the MLL2 complex as a coactivator for estrogen receptor alpha. J Biol Chem 281, 15714-15720. Muegge, K., Xi, S., and Geiman, T. (2008). The see-saw of differentiation: tipping the chromatin balance. Mol Interv 8, 15-18, 12. 183 Mukhopadhyay, D., and Riezman, H. (2007). Proteasome-independent functions of ubiquitin in endocytosis and signaling. Science 315, 201-205. Muller, J., Hart, CM., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L., O'Connor, M.B., Kingston, R.E., and Simon, J.A. (2002). Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111, 197-208. Nagl, N.G., Jr., Wang, X., Patsialou, A., Van Scoy, M., and Moran, E. (2007). Distinct mammalian SWI/SNF chromatin remodeling complexes with opposing roles in cell-cycle control. Embo J 26, 752-763. Narita, M., and Lowe, S.W. (2005). Senescence comes of age. Nat Med 11, 920-922. Natarajan, T.G., Kallakury, B.V., Sheehan, C.E., Bartlett, M.B., Ganesan, N., Preet, A., Ross, J.S., and Fitzgerald, K.T. (2010). Epigenetic regulator MLL2 shows altered expression in cancer cell lines and tumors from human breast and colon. Cancer Cell Int 10, 13. Naughton, C, MacLeod, K., Kuske, B., Clarke, R., Cameron, D.A., and Langdon, S.P. (2007). Progressive loss of estrogen receptor alpha cofactor recruitment in endocrine resistance. Mol Endocrinol 21, 2615-2626. Ng, S.S., Yue, W.W., Oppermann, U., and Klose, R.J. (2009). Dynamic protein methylation in chromatin biology. Cell Mol Life Sci 66, 407-422. Niessen, H.E., Demmers, J.A., and Voncken, J.W. (2009). Talking to chromatin: posttranslational modulation of polycomb group function. Epigenetics Chromatin 2, 10. Normanno, N., Di Maio, M., De Maio, E., De Luca, A., de Matteis, A., Giordano, A., and Perrone, F. (2005). Mechanisms of endocrine resistance and novel therapeutic strategies in breast cancer. Endocr Relat Cancer 12, 721-747. O'Lone, R., Frith, M.C., Karlsson, E.K., and Hansen, U. (2004). Genomic targets of nuclear estrogen receptors. Mol Endocrinol 18, 1859-1875. Ordonez-Moran, P., and Munoz, A. (2009). Nuclear receptors: genomic and non-genomic effects converge. Cell Cycle 8, 1675-1680. Osborne, C.K., Bardou, V., Hopp, T.A., Chamness, G.C., Hilsenbeck, S.G., Fuqua, S.A., Wong, J., Allred, D.C., Clark, G.M., and Schiff, R. (2003). Role of the estrogen receptor 184 coactivator AIB1 (SRC-3) and HER-2/neu in tamoxifen resistance in breast cancer. J Natl Cancer Inst 05, 353-361. Ozsolak, F., Song, J.S., Liu, X.S., and Fisher, D.E. (2007). High-throughput mapping of the chromatin structure of human promoters. Nat Biotechnol 25, 244-248. Pan, Y.F., Wansa, K.D., Liu, M.H., Zhao, B., Hong, S.Z., Tan, P.Y., Lim, K.S., Bourque, G., Liu, E.T., and Cheung, E. (2008). Regulation of estrogen receptor-mediated long range transcription via evolutionarily conserved distal response elements. J Biol Chem 283, 32977-32988. Park, J.H., and Roeder, R.G. (2006). GAS41 is required for repression of the p53 tumor suppressor pathway during normal cellular proliferation. Mol Cell Biol 26, 4006-4016. Park, S., Song, J., Joe, CO., and Shin, I. (2008). Akt stabilizes estrogen receptor alpha with the concomitant reduction in its transcriptional activity. Cell Signal 20, 1368-1374. Paruthiyil, S., Parmar, H., Kerekatte, V., Cunha, G.R., Firestone, G.L., and Leitman, D.C. (2004). Estrogen receptor beta inhibits human breast cancer cell proliferation and tumor formation by causing a G2 cell cycle arrest. Cancer Res 64, 423-428. Pasini, D., Hansen, K.H., Christensen, J., Agger, K., Cloos, P.A., and Helin, K. (2008). Coordinated regulation of transcriptional repression by the RBP2 H3K4 demethylase and Polycomb-Repressive Complex 2. Genes Dev 22, 1345-1355. Pasini, D., Malatesta, M., Jung, H.R., Walfridsson, J., Wilier, A., Olsson, L., Skotte, J., Wutz, A., Porse, B., Jensen, O.N., et al. (2010). Characterization of an antagonistic switch between histone H3 lysine 27 methylation and acetylation in the transcriptional regulation of Polycomb group target genes. Nucleic Acids Res 38, 4958-4969. Pearce, S.T., and Jordan, V.C. (2004). The biological role of estrogen receptors alpha and beta in cancer. Crit Rev Oncol Hematol 50, 'i-ll. Peckham, H.E., Thurman, R.E., Fu, Y., Stamatoyannopoulos, J.A., Noble, W.S., Struhl, K., and Weng, Z. (2007). Nucleosome positioning signals in genomic DNA. Genome Res 77,1170-1177. Pedersen, M.T., and Helin, K. (2010). Histone demethylases in development and disease. Trends Cell Biol 20, 662-671. 185 Perillo, B., Ombra, M.N., Bertoni, A., Cuozzo, C, Sacchetti, S., Sasso, A., Chiariotti, L., Malorni, A., Abbondanza, C, and Avvedimento, E.V. (2008). DNA oxidation as triggered by H3K9me2 demethylation drives estrogen-induced gene expression. Science 319, 202-206. Pickart, CM. (2004). Back to the future with ubiquitin. Cell 116, 181-190. Pietras, R.J., and Marquez-Garban, D.C. (2007). Membrane-associated estrogen receptor signaling pathways in human cancers. Clin Cancer Res 13,4672-4676. Pike, A.C., Brzozowski, A.M., and Hubbard, R.E. (2000a). A structural biologist's view of the oestrogen receptor. J Steroid Biochem Mol Biol 74, 261-268. Pike, A.C., Brzozowski, A.M., Walton, J., Hubbard, R.E., Bonn, T., Gustafsson, J.A., and Carlquist, M. (2000b). Structural aspects of agonism and antagonism in the oestrogen receptor. Biochem Soc Trans 28, 396-400. Polo, S.E., and Almouzni, G. (2006). Chromatin assembly: a basic recipe with various flavours. Curr Opin Genet Dev 16, 104-111. Preuss, U., Landsberg, G., and Scheidtmann, K.H. (2003). Novel mitosis-specific phosphorylation of histone H3 at Thrl 1 mediated by Dlk/ZIP kinase. Nucleic Acids Res 31, 878-885. Ptashne, M. (2005). Regulation of transcription: from lambda to eukaryotes. Trends Biochem Sci 30, 275-279. Pusarla, R.H., and Bhargava, P. (2005). Histones in functional diversification. Core histone variants. FEBS Journal 272, 5149-5168. Rada-Iglesias, A., Bajpai, R., Swigut, T., Brugmann, S.A., Flynn, R.A., and Wysocka, J. (2010). A unique chromatin signature uncovers early developmental enhancers in humans. Nature. Raisner, R.M., Hartley, P.D., Meneghini, M.D., Bao, M.Z., Liu, C.L., Schreiber, S.L., Rando, O.J., and Madhani, H.D. (2005). Histone variant H2A.Z marks the 5' ends of both active and inactive genes in euchromatin. Cell 123, 233-248. Rangasamy, D., Berven, L., Ridgway, P., and Tremethick, D.J. (2003). Pericentric heterochromatin becomes enriched with H2A.Z during early mammalian development. Embo J 22, 1599-1607. 186 Razandi, M., Pedram, A., Greene, G.L., and Levin, E.R. (1999). Cell membrane and nuclear estrogen receptors (ERs) originate from a single transcript: studies of ERalpha and ERbeta expressed in Chinese hamster ovary cells. Mol Endocrinol 13, 307-319. Reese, J.C. (2003). Basal transcription factors. Curr Opin Genet Dev 13, 114-118. Ren, Q., and Gorovsky, M.A. (2001). Histone H2A.Z acetylation modulates an essential charge patch. Mol Cell 7, 1329-1335. Rhodes, D.R., Yu, J., Shanker, K., Deshpande, N., Varambally, R., Ghosh, D., Barrette, T., Pandey, A., and Chinnaiyan, A.M. (2004). Large-scale meta-analysis of cancer microarray data identifies common transcriptional profiles of neoplastic transformation and progression. Proc Natl Acad Sci U S A 101, 9309-9314. Rice, J.C, and Allis, CD. (2001). Code of silence. Nature 414, 258-261. Richly, H., Lange, M., Simboeck, E., and Di Croce, L. (2010). Setting and resetting of epigenetic marks in malignant transformation and development. Bioessays 32, 669-679. Riggins, R.B., Schrecengost, R.S., Guerrero, M.S., and Bouton, A.H. (2007). Pathways to tamoxifen resistance. Cancer Lett 256, 1-24. Rodriguez, P., Munroe, D., Prawitt, D., Chu, L.L., Brie, E., Kim, J., Reid, L.H., Davies, C, Nakagama, H., Loebbert, R., et al. (1997). Functional characterization of human nucleosome assembly protein-2 (NAP1L4) suggests a role as a histone chaperone. Genomics 44, 253-265. Ruff, M., Gangloff, M., Wurtz, J.M., and Moras, D. (2000). Estrogen receptor transcription and transactivation: Structure-function relationship in DNA- and ligandbinding domains of estrogen receptors. Breast Cancer Res 2, 353-359. Ruhl, D.D., Jin, J., Cai, Y., Swanson, S., Florens, L., Washburn, M.P., Conaway, R.C, Conaway, J.W., and Chrivia, J.C. (2006). Purification of a Human SRCAP Complex That Remodels Chromatin by Incorporating the Histone Variant H2A.Z into Nucleosomes. Biochemistry 45, 5671-5677. Saha, A., Wittmeyer, J., and Cairns, B.R. (2006). Chromatin remodelling: the industrial revolution of DNA around histones. Nat Rev Mol Cell Biol 7, 437-447. Sakabe, N.J., and Nobrega, M.A. (2010). Genome-wide maps of transcription regulatory elements. Wiley Interdiscip Rev Syst Biol Med 2, 422-437'. 187 Samuelson, A.V., Narita, M., Chan, H.M., Jin, J., de Stanchina, E., McCurrach, M.E., Narita, M., Fuchs, M., Livingston, D.M., and Lowe, S.W. (2005). p400 is required for E1A to promote apoptosis. J Biol Chem 280, 21915-21923. Sanchez, R., and Zhou, M.M. (2009). The role of human bromodomains in chromatin biology and gene transcription. Curr Opin Drug Discov Devel 12, 659-665. Sandelin, A., Carninci, P., Lenhard, B., Ponjavic, J., Hayashizaki, Y., and Hume, D.A. (2007). Mammalian RNA polymerase II core promoters: insights from genome-wide studies. Nat Rev Genet 8,424-436. Santisteban, M.S., Kalashnikova, T., and Smith, M.M. (2000). Histone H2A.Z regulats transcription and is partially redundant with nucleosome remodeling complexes. Cell 705,411-422. Sarcinella, E., Zuzarte, P.C., Lau, P.N., Draker, R., and Cheung, P. (2007). Monoubiquitylation of H2A.Z distinguishes its association with euchromatin or facultative heterochromatin. Mol Cell Biol 27, 6457-6468. Sawan, C, and Herceg, Z. (2010). Histone modifications and cancer. Adv Genet 70, 5785. Schiff, R., Massarweh, S.A., Shou, J., Bharwani, L., Mohsin, S.K., and Osborne, C.K. (2004). Cross-talk between estrogen receptor and growth factor pathways as a molecular target for overcoming endocrine resistance. Clin Cancer Res 10, 331S-336S. Schiltz, R.L., Mizzen, C.A., Vassilev, A., Cook, R.G., Allis, CD., and Nakatani, Y. (1999). Overlapping but distinct patterns of histone acetylation by the human coactivators p300 and PCAF within nucleosomal substrates. J Biol Chem 274,1189-1192. Schones, D.E., Cui, K., Cuddapah, S., Roh, T.Y., Barski, A., Wang, Z., Wei, G., and Zhao, K. (2008). Dynamic regulation of nucleosome positioning in the human genome. Cell 132, 887-898. Schuettengruber, B., Chourrout, D., Vervoort, M., Leblanc, B., and Cavalli, G. (2007). Genome regulation by polycomb and trithorax proteins. Cell 128, 735-745. Schwartz, Y.B., Kahn, T.G., Stenberg, P., Ohno, K., Bourgon, R., and Pirrotta, V. (2010). Alternative epigenetic chromatin states of polycomb target genes. PLoS Genet 6, el 000805. 188 Schwarz, P.M., Felthauser, A., Fletcher, T.M., and Hansen, J.C. (1996). Reversible oligonucleosome self-association: dependence on divalent cations and core histone tail domains. Biochemistry 35, 4009-4015. Seenundun, S., Rampalli, S., Liu, Q.C., Aziz, A., Palii, C, Hong, S., Blais, A., Brand, M., Ge, K., and Dilworth, F.J. (2010). UTX mediates demethylation of H3K27me3 at musclespecific genes during myogenesis. Embo J 29, 1401-1411. Segal, E., Fondufe-Mittendorf, Y., Chen, L., Thastrom, A., Field, Y., Moore, I.K., Wang, J.P., and Widom, J. (2006). A genomic code for nucleosome positioning. Nature 442, 112-11%. Segal, E., and Widom, J. (2009). What controls nucleosome positions? Trends Genet 25, 335-343. Seligson, D.B., Horvath, S., Shi, T., Yu, H., Tze, S., Grunstein, M., and Kurdistani, S.K. (2005). Global histone modification patterns predict risk of prostate cancer recurrence. Nature 435, 1262-1266. Seoane, J., Le, H.V., and Massague, J. (2002). Myc suppression of the p21(Cipl) Cdk inhibitor influences the outcome of the p53 response to DNA damage. Nature 419, 729734. Shang, Y., Hu, X., DiRenzo, J., Lazar, M.A., and Brown, M. (2000). Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103, 843-852. Shao, Z., Raible, F., Mollaaghababa, R., Guyon, J.R., Wu, C.T., Bender, W., and Kingston, R.E. (1999). Stabilization of chromatin structure by PRC1, a Polycomb complex. Cell 98, 37-46. Sharov, A.A., and Ko, M.S. (2007). Human ES cell profiling broadens the reach of bivalent domains. Cell Stem Cell 1, 237-238. Shin, J.Y., Kim, H.S., Park, J., Park, J.B., and Lee, J.Y. (2000). Mechanism for inactivation of the KIP family cyclin-dependent kinase inhibitor genes in gastric cancer cells. Cancer Res 60, 262-265. Shivaswamy, S., Bhinge, A., Zhao, Y., Jones, S., Hirst, M., and Iyer, V.R. (2008). Dynamic remodeling of individual nucleosomes across a eukaryotic genome in response to transcriptional perturbation. PLoS Biol 6, e65. 189 Shou, J., Massarweh, S., Osborne, C.K., Wakeling, A.E., Ali, S., Weiss, H., and Schiff, R. (2004). Mechanisms of tamoxifen resistance: increased estrogen receptor-HER2/neu cross-talk in ER/HER2-positive breast cancer. J Natl Cancer Inst 96, 926-935. Sims, R.J., 3rd, Nishioka, K., and Reinberg, D. (2003). Histone lysine methylation: a signature for chromatin function. Trends Genet 19, 629-639. Smith, C.L., Onate, S.A., Tsai, M.J., and O'Malley, B.W. (1996). CREB binding protein acts synergistically with steroid receptor coactivator-1 to enhance steroid receptordependent transcription. Proc Natl Acad Sci U S A 93, 8884-8888. Smith, E.R., Lee, M.G., Winter, B., Droz, N.M., Eissenberg, J.C., Shiekhattar, R., and Shilatifard, A. (2008). Drosophila UTX is a histone H3 Lys27 demethylase that colocalizes with the elongating form of RNA polymerase II. Mol Cell Biol 28, 10411046. Smith, S., and Stillman, B. (1989). Purification and characterization of CAF-I, a human cell factor required for chromatin assembly during DNA replication in vitro. Cell 58, 1525. Smith, S., and Stillman, B. (1991). Stepwise assembly of chromatin during DNA replication in vitro. Embo J 10, 971-980. Sommer, S., and Fuqua, S.A. (2001). Estrogen receptor and breast cancer. Semin Cancer Biol 11, 339-352. Song, R.X., McPherson, R.A., Adam, L., Bao, Y., Shupnik, M., Kumar, R., and Santen, R.J. (2002). Linkage of rapid estrogen action to MAPK activation by ERalpha-Shc association and She pathway activation. Mol Endocrinol 16, 116-127. Soshnikova, N., and Duboule, D. (2009). Epigenetic regulation of vertebrate Hox genes: a dynamic equilibrium. Epigenetics 4, 537-540. Splinter, E., Heath, H., Kooren, J., Palstra, R.J., Klous, P., Grosveld, F., Galjart, N., and de Laat, W. (2006). CTCF mediates long-range chromatin looping and local histone modification in the beta-globin locus. Genes Dev 20, 2349-2354. Srinivasan, S., Dorighi, K.M., and Tamkun, J.W. (2008). Drosophila Kismet regulates histone H3 lysine 27 methylation and early elongation by RNA polymerase II. PLoS Genet 4, el000217. 190 Stargell, L.A., Bowen, J., Dadd, C.A., Dedon, P.C, Davis, M., Cook, R.G., Allis, CD., and Gorovsky, M.A. (1993). Temporal and spatial association of histone H2A variant hvl with transcriptionally competent chromatin during nuclear development in Tetrahymena thermophila. Genes Dev 7, 2641-2651. Sterner, D.E., and Berger, S.L. (2000). Acetylation of histones and transcription-related factors. Microbiol Mol Biol Rev 64,435-459. Stock, J.K., Giadrossi, S., Casanova, M., Brookes, E., Vidal, M., Koseki, H., Brockdorff, N., Fisher, A.G., and Pombo, A. (2007). Ring 1-mediated ubiquitination of H2A restrains poised RNA polymerase II at bivalent genes in mouse ES cells. Nat Cell Biol 9, 14281435. Stoica, G.E., Franke, T.F., Moroni, M., Mueller, S., Morgan, E., Iann, M.C., Winder, A.D., Reiter, R., Wellstein, A., Martin, M.B., et al. (2003a). Effect of estradiol on estrogen receptor-alpha gene expression and activity can be modulated by the ErbB2/PI 3-K/Akt pathway. Oncogene 22, 7998-8011. Stoica, G.E., Franke, T.F., Wellstein, A., Czubayko, F., List, H.J., Reiter, R., Morgan, E., Martin, M.B., and Stoica, A. (2003b). Estradiol rapidly activates Akt via the ErbB2 signaling pathway. Mol Endocrinol 17, 818-830. Stoica, G.E., Franke, T.F., Wellstein, A., Morgan, E., Czubayko, F., List, H.J., Reiter, R., Martin, M.B., and Stoica, A. (2005). Heregulin-betal regulates the estrogen receptoralpha gene expression and activity via the ErbB2/PI 3-K/Akt pathway. Oncogene 24, 1964. Strahl, B.D., and Allis, CD. (2000). The language of covalent histone modifications. Nature 403, 41-45. Strom, A., Hartman, J., Foster, J.S., Kietz, S., Wimalasena, J., and Gustafsson, J.A. (2004). Estrogen receptor beta inhibits 17beta-estradiol-stimulated proliferation of the breast cancer cell line T47D. Proc Natl Acad Sci U S A 101, 1566-1571. Sun, M., Paciga, J.E., Feldman, R.I., Yuan, Z., Coppola, D., Lu, Y.Y., Shelley, S.A., Nicosia, S.V., and Cheng, J.Q. (2001). Phosphatidylinositol-3-OH Kinase (PI3K)/AKT2, activated in breast cancer, regulates and is induced by estrogen receptor alpha (ERalpha) via interaction between ERalpha and PI3K. Cancer Res 61, 5985-5991. 191 Suto, R.K., Clarkson, M.J., Tremethick, D.J., and Luger, K. (2000). Crystal structure of a nucleosome core particle containing the variant histone H2A.Z. Nat Struct Biol 7, 11211124. Svotelis, A., Gevry, N., and Gaudreau, L. (2009). Regulation of gene expression and cellular proliferation by histone H2A.Z. Biochem Cell Biol 87, 179-188. Svotelis, A., Gevry, N., Grondin, G., and Gaudreau, L. (2010). H2A.Z overexpression promotes cellular proliferation of breast cancer cells. Cell Cycle 9, 364-370. Swigut, T., and Wysocka, J. (2007). H3K27 demethylases, at long last. Cell 131,29-32. Szutorisz, H., Dillon, N., and Tora, L. (2005). The role of enhancers as centres for general transcription factor recruitment. Trends Biochem Sci 30, 593-599. Talbert, P.B., and Henikoff, S. (2010). Histone variants-ancient wrap artists of the epigenome. Nat Rev Mol Cell Biol 11, 264-275. Tang, Y., Luo, J., Zhang, W., and Gu, W. (2006). Tip60-dependent acetylation of p53 modulates the decision between cell-cycle arrest and apoptosis. Mol Cell 24, 827-839. Tarakhovsky, A. (2010). Tools and landscapes of epigenetics. Nat Immunol //, 565-568. Taubert, S., Gorrini, C, Frank, S.R., Parisi, T., Fuchs, M., Chan, H.M., Livingston, D.M., and Amati, B. (2004). E2F-dependent histone acetylation and recruitment of the Tip60 acetyltransferase complex to chromatin in late Gl. Mol Cell Biol 24, 4546-4556. Teixeira, C, Reed, J.C., and Pratt, M.A. (1995). Estrogen promotes chemotherapeutic drug resistance by a mechanism involving Bcl-2 proto-oncogene expression in human breast cancer cells. Cancer Res 55, 3902-3907. Theo Sijtse Palstra, R.J. (2009). Close encounters of the 3C kind: long-range chromatin interactions and transcriptional regulation. Brief Funct Genomic Proteomic 8, 297-309. Tie, F., Banerjee, R., Stratton, C.A., Prasad-Sinha, J., Stepanik, V., Zlobin, A., Diaz, M.O., Scacheri, P.C., and Harte, P.J. (2009). CBP-mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing. Development 136, 3131-3141. Tirosh, I., and Barkai, N. (2008). Two strategies for gene regulation by promoter nucleosomes. Genome Res 18, 1084-1091. 192 Tiwari, V.K., McGarvey, K.M., Licchesi, J.D., Ohm, J.E., Herman, J.G., Schubeler, D., and Baylin, S.B. (2008). PcG proteins, DNA methylation, and gene repression by chromatin looping. PLoS Biol 6, 2911-2927. Tolstorukov, M.Y., Kharchenko, P.V., Goldman, J.A., Kingston, R.E., and Park, P.J. (2009). Comparative analysis of H2A.Z nucleosome organization in the human and yeast genomes. Genome Res 19, 967-977. Tyler, J.K., Adams, C.R., Chen, S.R., Kobayashi, R., Kamakaka, R.T., and Kadonaga, J.T. (1999). The RCAF complex mediates chromatin assembly during DNA replication and repair. Nature 402, 555-560. Tyteca, S., Legube, G., and Trouche, D. (2006a). To die or not to die: a HAT trick. Mol Cell 24, 807-808. Tyteca, S., Vandromme, M., Legube, G., Chevillard-Briet, M., and Trouche, D. (2006b). Tip60 and p400 are both required for UV-induced apoptosis but play antagonistic roles in cell cycle progression. Embo J 25, 1680-1689. Valouev, A., Ichikawa, J., Tonthat, T., Stuart, J., Ranade, S., Peckham, H., Zeng, K., Malek, J.A., Costa, G., McKernan, K., et al. (2008). A high-resolution, nucleosome position map of C. elegans reveals a lack of universal sequence-dictated positioning. Genome Res 18, 1051-1063. van Bakel, H., and Hughes, T.R. (2009). Establishing legitimacy and function in the new transcriptome. Brief Funct Genomic Proteomic 8, 424-436. van Daal, A., White, E.M., Gorovsky, M.A., and Elgin, S.C. (1988). Drosophila has a single copy of the gene encoding a highly conserved histone H2A variant of the H2A.F/Z type. Nucleic Acids Res 16, 7487-7497. van de Nobelen, S., Rosa-Garrido, M., Leers, J., Heath, H., Soochit, W., Joosen, L., Jonkers, I., Demmers, J., van der Reijden, M., Torrano, V., et al. (2010). CTCF regulates the local epigenetic state of ribosomal DNA repeats. Epigenetics Chromatin 3, 19. van de Vijver, M.J., He, Y.D., van't Veer, L.J., Dai, H., Hart, A.A., Voskuil, D.W., Schreiber, G.J., Peterse, J.L., Roberts, C, Marton, M.J., et al. (2002). A gene-expression signature as a predictor of survival in breast cancer. N Engl J Med 347, 1999-2009. 193 Venkatasubrahmanyam, S., Hwang, W.W., Meneghini, M.D., Tong, A.H., and Madhani, H.D. (2007). Genome-wide, as opposed to local, antisilencing is mediated redundantly by the euchromatic factors Setl and H2A.Z. Proc Natl Acad Sci U S A 104, 16609-16614. Venters, B.J., and Pugh, B.F. (2009). How eukaryotic genes are transcribed. Crit Rev Biochem Mol Biol 44, 117-141. Villard, J. (2004). Transcription regulation and human diseases. Swiss Med Wkly 134, 571-579. Wang, L.H., Yang, X.Y., Zhang, X., An, P., Kim, H.J., Huang, J., Clarke, R., Osborne, C.K., Inman, J.K., Appella, E., et al. (2006). Disruption of estrogen receptor DNAbinding domain and related intramolecular communication restores tamoxifen sensitivity in resistant breast cancer. Cancer Cell 10, 487-499. Wang, T.T., and Phang, J.M. (1995). Effects of estrogen on apoptotic pathways in human breast cancer cell line MCF-7. Cancer Res 55, 2487-2489. Wang, Z., Gerstein, M., and Snyder, M. (2009). RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10, 57-63. Wang, Z., Zang, C, Rosenfeld, J.A., Schones, D.E., Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Peng, W., Zhang, M.Q., et al. (2008). Combinatorial patterns of histone acetylations and methylations in the human genome. Nat Genet 40, 897-903. Weake, V.M., and Workman, J.L. (2010). Inducible gene expression: diverse regulatory mechanisms. Nat Rev Genet / / , 426-437. Weber, CM., Henikoff, J.G., and Henikoff, S. (2010). H2A.Z nucleosomes enriched over active genes are homotypic. Nat Struct Mol Biol 17,1500-1507. Wei, Y., Xia, W., Zhang, Z., Liu, J., Wang, H., Adsay, N.V., Albarracin, C, Yu, D., Abbruzzese, J.L., Mills, G.B., et al. (2008). Loss of trimethylation at lysine 27 of histone H3 is a predictor of poor outcome in breast, ovarian, and pancreatic cancers. Mol Carcinog 47,701-706. Welboren, W.J., Sweep, F.C, Span, P.N., and Stunnenberg, H.G. (2009). Genomic actions of estrogen receptor alpha: what are the targets and how are they regulated? Endocr Relat Cancer 16, 1073-1089. 194 West, M.H., and Bonner, W.M. (1980). Histone 2B can be modified by the attachment of ubiquitin. Nucleic Acids Res 8, 4671-4680. White, C.L., Suto, R.K., and Luger, K. (2001). Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions. Embo J 20, 52075218. Whittle, CM., McClinic, K.N., Ercan, S., Zhang, X., Green, R.D., Kelly, W.G., and Lieb, J.D. (2008). The genomic distribution and function of histone variant HTZ-1 during C. elegans embryogenesis. PLoS Genet 4, el000187. Williams, S.K., and Tyler, J.K. (2007). Transcriptional regulation by chromatin disassembly and reassembly. Curr Opin Genet Dev 17, 88-93. Witcher, M., and Emerson, B.M. (2009). Epigenetic silencing of the pl6(INK4a) tumor suppressor is associated with loss of CTCF binding and a chromatin boundary. Mol Cell 34,271-284. Workman, J.L., and Kingston, R.E. (1998). Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu Rev Biochem 67, 545-579. Wu, R.S., and Bonner, W.M. (1981). Separation of basal histone synthesis from S-phase histone synthesis in dividing cells. Cell 27, 321-330. Wu, S.C, and Zhang, Y. (2009). Minireview: role of protein methylation and demethylation in nuclear hormone signaling. Mol Endocrinol 23, 1323-1334. Wu, W.H., Alami, S., Luk, E., Wu, C.H., Sen, S., Mizuguchi, G., Wei, D., and Wu, C (2005). Swc2 is a widely conserved H2AZ-binding module essential for ATP-dependent histone exchange. Nat Struct Mol Biol 12, 1064-1071. Wysocka, J., Swigut, T., Xiao, H., Milne, T.A., Kwon, S.Y., Landry, J., Kauer, M., Tackett, A.J., Chait, B.T., Badenhorst, P., et al. (2006). A PHD finger of NURF couples histone H3 lysine 4 trimethylation with chromatin remodelling. Nature 442, 86-90. Xella, B., Goding, C, Agricola, E., Di Mauro, E., and Caserta, M. (2006). The ISWI and CHD1 chromatin remodelling activities influence ADH2 expression and chromatin organization. Mol Microbiol 59,1531-1541. Xiang, Y., Zhu, Z., Han, G., Lin, H., Xu, L., and Chen, CD. (2007). JMJD3 is a histone H3K27 demethylase. Cell Res 17, 850-857. 195 Yde, C.W., Gyrd-Hansen, M., Lykkesfeldt, A.E., Issinger, O.G., and Stenvang, J. (2007). Breast cancer cells with acquired antiestrogen resistance are sensitized to cisplatininduced cell death. Mol Cancer Ther 6, 1869-1876. Yuan, G.C., Liu, Y.J., Dion, M.F., Slack, M.D., Wu, L.F., Altschuler, S.J., and Rando, O.J. (2005). Genome-scale identification of nucleosome positions in S. cerevisiae. Science 309, 626-630. Zanton, S.J., and Pugh, B.F. (2006). Full and partial genome-wide assembly and disassembly of the yeast transcription machinery in response to heat shock. Genes Dev 20, 2250-2265. Zemach, A., McDaniel, I.E., Silva, P., and Zilberman, D. (2010). Genome-wide evolutionary analysis of eukaryotic DNA methylation. Science 328, 916-919. Zeng, W., Ball, A.R., Jr., and Yokomori, K. HP1: heterochromatin binding proteins working the genome. Epigenetics 5, 287-292. Zeng, W., Ball, A.R., Jr., and Yokomori, K. (2010). HP1: heterochromatin binding proteins working the genome. Epigenetics 5, 287-292. Zhang, G., Campbell, E.A., Minakhin, L., Richter, C, Severinov, K., and Darst, S.A. (1999). Crystal structure of Thermus aquaticus core RNA polymerase at 3.3 A resolution. Cell 98, 811-824. Zhang, H. (2007). Molecular signaling and genetic pathways of senescence: Its role in tumorigenesis and aging. J Cell Physiol 210, 567-574. Zhang, H., Roberts, D.N., and Cairns, B.R. (2005a). Genome-wide dynamics of Htzl, a histone H2A variant that poises repressed/basal promoters for activation through histone loss. Cell 123, 219-231. Zhang, L., Schroeder, S., Fong, N., and Bentley, D.L. (2005b). Altered nucleosome occupancy and histone H3K4 methylation in response to 'transcriptional stress'. Embo J 24, 2379-2390. Zhang, Y. (2006). It takes a PHD to interpret histone methylation. Nat Struct Mol Biol 13, 572-574. Zhou, V.W., Goren, A., and Bernstein, B.E. (2010). Charting histone modifications and the functional organization of mammalian genomes. Nat Rev Genet 12, 7-18. 196 Zilberman, D., Coleman-Derr, D., Ballinger, T., and Henikoff, S. (2008). Histone H2A.Z and DNA methylation are mutually antagonistic chromatin marks. Nature 456, 125-129. Zlatanova, J., and Thakar, A. (2008). H2A.Z: view from the top. Structure 16, 166-179. Zucchi, I., Mento, E., Kuznetsov, V.A., Scotti, M, Valsecchi, V., Simionati, B., Vicinanza, E., Valle, G., Pilotti, S., Reinbold, R., et al. (2004). Gene expression profiles of epithelial cells microscopically isolated from a breast-invasive ductal carcinoma and a nodal metastasis. ProcNatl Acad Sci U S A 101, 18147-18152. 197