L'INFLUENCE DU RECEPTEUR A L'OESTROGENE a SUR LA HORMONO-DEPENDENTS

L'INFLUENCE DU RECEPTEUR A L'OESTROGENE a SUR LA
DYNAMIQUE CHROMATINIENNE DANS LES CANCERS DU SEIN
HORMONO-DEPENDENTS
PAR
AMY SVOTELIS
These soumis au Departement de biologie
pour I'obtention du diplome de philosophiae doctor (Ph.D.)
FACULTE DES SCIENCES
UNIVERSITE DE SHERBROOKE
Sherbrooke, Quebec, Canada, mai 2011
Library and Archives
Canada
Bibliotheque et
Archives Canada
Published Heritage
Branch
Direction du
Patrimoine de I'edition
395 Wellington Street
Ottawa ON K1A 0N4
Canada
395, rue Wellington
Ottawa ON K1A 0N4
Canada
Your file Votre reference
ISBN:
978-0-494-83329-2
Our file Notre reference
ISBN:
NOTICE:
978-0-494-83329-2
AVIS:
The author has granted a nonexclusive license allowing Library and
Archives Canada to reproduce,
publish, archive, preserve, conserve,
communicate to the public by
telecommunication or on the Internet,
loan, distrbute and sell theses
worldwide, for commercial or noncommercial purposes, in microform,
paper, electronic and/or any other
formats.
L'auteur a accorde une licence non exclusive
permettant a la Bibliotheque et Archives
Canada de reproduire, publier, archiver,
sauvegarder, conserver, transmettre au public
par telecommunication ou par Plnternet, preter,
distribuer et vendre des theses partout dans le
monde, a des fins commerciales ou autres, sur
support microforme, papier, electronique et/ou
autres formats.
The author retains copyright
ownership and moral rights in this
thesis. Neither the thesis nor
substantial extracts from it may be
printed or otherwise reproduced
without the author's permission.
L'auteur conserve la propriete du droit d'auteur
et des droits moraux qui protege cette these. Ni
la these ni des extraits substantiels de celle-ci
ne doivent etre imprimes ou autrement
reproduits sans son autorisation.
In compliance with the Canadian
Privacy Act some supporting forms
may have been removed from this
thesis.
Conformement a la loi canadienne sur la
protection de la vie privee, quelques
formulaires secondares ont ete enleves de
cette these.
While these forms may be included
in the document page count, their
removal does not represent any loss
of content from the thesis.
Bien que ces formulaires aient inclus dans
la pagination, il n'y aura aucun contenu
manquant.
Canada
Le27mai2011
lejury a accepte la these de Madame Amy Svotelis
dans sa version finale.
Membres du jury
Professeur Nicolas Gevry
Directeur de recherche
Departement de biologie
Professeur Luc R. Gaudreau
Codirecteur de recherche
Departement de biologie
Professeur Daniel Lafontaine
Membre
Departement de biologie
Professeur Andre Tremblay
Membre externe
Universite de Montreal, CHU Ste-Justine
Professeur Viktor Steimle
President rapporteur
Departement de biologie
TABLE OF CONTENTS
ABSTRACT
iv
RESUME
VI
ACKNOWLEDGEMENTS
LIST OF ABBREVIATIONS
VIII
X
LIST OF TABLES
XII
LIST OF FIGURES
XIII
CHAPTER 1
1
I.
1
INTRODUCTION
1.1.
T H E EUKARYOTIC GENOME
1
/. /. /.
Structure of the eukaryotic genome
2
1.1.2.
Chromatin remodelling via A TP-dependent complexes
5
1.1.3.
Incorporation ofhistone variants into the nucleosome
7
1.1.3.1.
1.1.4.
1.2.
The his tone variant H2A.Z
Post-translational h iston e modifications
CHROMATIN ARCHITECTURE AND REGULATABLE GENE EXPRESSION
10
14
19
1.2.1.
RNA Polymerase II transcription of genes
20
1.2.2.
Transcription factor mediated gene regulation
22
1.2.3.
Chromatin architecture at regulatory elements
24
1.2.4.
Mechanisms of transcriptional activation and roles ofH2A.Z in gene expression
25
1.2.5.
Gene silencing and the resolution of poised chromatin states
29
1.3.
NUCLEAR RECEPTOR MEDIATED TRANSCRIPTION
1.3.1.
ERa-regulated gene expression
37
1.3.1.1.
The ERa genomic pathway
37
1.3.1.2.
Non-classical ERa pathways
40
1.3.2.
1.4.
34
ERa-dependent breast cancer and anti-estrogen resistance
RESEARCH PROJECT AND OBJECTIVES
41
44
ii
CHAPTER II
II.
47
REGULATION OF GENE EXPRESSION AND CELLULAR PROLIFERATION BY
HISTONEH2A.Z
II.l.
PREAMBLE
H.2.
MANUSCRIPT
47
47
49
CHAPTER HI
III.
78
H2A.Z OVEREXPRESSION PROMOTES CELLULAR PROLIFERATION OF BREAST
CANCER CELLS
78
111.1.
PREAMBLE
78
111.2.
MANUSCRIPT
80
CHAPTER IV
IV.
101
H3K27 DEMETHYLATION BY JMJD3 AT A POISED ENHANCER OF ANTI-
APOPTOTIC GENE BCL2 DETERMINES ERa LIGAND-DEPENDENCY
IV. 1.
PREAMBLE
IV.2.
MANUSCRIPT
101
101
103
CHAPTER V
148
V.
148
DISCUSSION
V.l.
ERa MODULATION OF CHROMATIN SIGNATURES AFFECTS THE CELL CYCLE
149
V.2.
T H E ROLE OF EPIGENETIC SIGNATURES IN ANTI-ESTROGEN RESISTANCE
153
V.3.
GENERAL CONCLUSIONS AND PERSPECTIVES
VI.
REFERENCES
156
159
in
ABSTRACT
The human genome is organised into a DNA-protein complex called chromatin, of which
the main repeating unit is the nucleosome. Chromatin is generally repressive to gene
expression, rendering RNA Polymerase II regulatable gene expression dependent on
chromatin remodelling complexes.
These complexes will displace nucleosomes or
change the nucleosomal structure by incorporating histone variants or by the posttranslational modification of histone. Chromatin remodelling works in concert with
transcription activators on regulatory elements of regulatable genes. The histone variant
H2A.Z has a major role in creating a permissive structure at gene regulatory elements.
Conversely, the di- and tri-methylation of histone H3 lysine 27 (H3K27) has a repressive
effect on gene regulation, but can be reversed by the recently identified demethylase,
JMJD3. The steroid hormone estrogen (E2) and its intracellular receptor estrogen
receptor a (ERa) stimulate transcription of target genes by promoting local changes in
hormone-responsive promoters embedded in chromatin.
ERa-dependent cancers
demonstrate deregulated proliferation, and the treatment of these cancers with antiestrogens (AE) occasionally leads to resistant cancer subtypes. H2A.Z overexpression
has been associated with ERa target gene expression and breast cancer. In addition, an
interesting link exists between ERa and H3K27me3 related chromatin remodelling
complexes.
We thus hypothesized that ERa-mediated transcription in normal and antiestrogenresistant breast cancer implicates the modification of chromatin signatures on target
genes and results in proliferation. We observed that H2A.Z overexpression is related to
ERa levels and leads to increased proliferation in low E2 concentrations and in the
presence of the AE tamoxifen.
We also show that the perturbation of a repressive
epigenetic mark that normally controls the expression of the proto-oncogene BCL2 in
response to E2 leads to its constitutive transcriptional activation and deregulation of the
apoptosis program in AE-resistant breast cancer cells.
iv
Therefore my doctoral studies present the following conclusions: (1) epigenetic
modifications are useful prognostic markers for breast cancer severity; (2) the
deregulation of these modifications leads to carcinogenesis; and (3) continued
deregulation of these pathways can lead to more severe breast cancer and AE resistance.
Key words: Estrogen receptor, transcription, chromatin, H2A.Z, histone modifications
V
RESUME
L'organisation du genome dans un complexe d'ADN et proteines, appele la chromatine
presente une barriere a l'expression des genes regule par l'ARN Polymerase II.
L'activite de complexes de remodelage de la chromatine sert a modifier la structure de la
chromatine pour la rendre permissive a la transcription via 1'incorporation des variants
d'histone ou la modification post-traductionnelle des histones dans le nucleosome. De
plus, ces activites sont en partie recrutees aux sequences regulatrices par des activateurs
de la transcription. La dynamique de recrutement des complexes de remodelage de la
chromatine sur les genes dependant de la recepteur a l'cestrogene a (ERa) est controlee
par un processus epigenetique antinomique qui est initie par et qui se termine par un
remodelage de la chromatine. Les cancers du sein ERa-dependent cancers demontrent
une proliferation anormale, et le traitement de ces cancers avec des anti-oestrogenes (AE)
peut mener a des cancers resistants a ces traitements. L'incorporation cyclique de H2A.Z
aux genes dependants d'ERa est necessaire a l'initiation de la transcription de ces genes.
Au contraire, la di- et tri-methylation de l'histone H3 sur la lysine 27 (H3K27) jouent un
role important dans la formation d'une structure de la chromatine ayant un effet negatif
sur la transcription, et cette marque peut etre enlevee par la demethylase JMJD3.
L'objectif general de ce projet de recherche est d'ameliorer les connaissances sur les
mecanismes moleculaires qui gouvernent l'expression des genes dependants de ERa et
ce, dans le contexte de la structure de la chromatine et l'etablissement du cancer du sein
et la resistance aux traitements AE. On a demontre que la surexpression de H2A.Z existe
dans les cancers du sein, et celle-ci est liee avec l'expression d'ERa. La surexpression de
H2A.Z dans les cellules de cancer du sein hormono-dependent augmente la proliferation
des cellules dans des conditions depourvue d'oestrogene et en presence d'un AE
tamoxifene. Aussi, on a demontre la regulation du gene anti-apoptotique BCL2 par ERa
et JMJD3 via la demethylation de H3K27me3, une regulation qui est perdue dans les
cancers resistant aux AE.
VI
En resume, mes etudes doctorales m'ont amene a proposer les conclusions suivantes: (1)
les modifications epigenetique sont des outils interessant dans la detection de cancer du
sein avec un mauvais pronostique; (2) la deregulation de ces modifications peut mener a
la carcinogenese; et (3) une deregulation prolongee des voies qui affectent ces
modifications peut mener aux cancers plus severe, dont des cancers resistants aux
traitements AE.
Mots cles: Receptor a l'cestrogene, transcription, chromatine, H2A.Z, modifications
d'histones
Vll
ACKNOWLEDGEMENTS
The process of acknowledging all of those who have contributed to my doctoral studies brings
about a great amount of nostalgia. As a result, it is almost impossible to mention everyone that
has contributed to my learning process. Notoriously known as an emotional and sensitive person
(in both the positive and negative realms of these terms), please bear with me, as this will be the
only intensely personal section of an otherwise scientific thesis.
First and foremost, I must thank Nicolas Gevry. His unrelenting support of me over the years is
second only to my family. Starting out as an annoying returning student with an immeasurable
number of questions, I can only hope to live up to the expectations he now has of me. I count
myself lucky to have worked so closely with him all these years, and have revelled in the everchanging relentless idea machine with his off-key singing, whistling, strange expressions and
sense of humour, as well as the many moments we have worked, discussed, and laughed together.
Thank you Nic for being such an incredible boss, mentor, and friend.
I cannot forget my co-director Luc Gaudreau, who originally believed in me and pushed me to
believe in myself when I didn't, and tried his best to get his "Calimero" to toughen up! Your
success in research is an inspiration, and thanks you for all that you have taught me.
Special thanks are reserved for the jury members of my thesis, who will be taking time to review
my work. The job of a researcher is a noble one, although rarely recognised and appreciated, so
much of their time dedicated to volunteer work. This is why I first thank Andre Tremblay, my
external evaluator. Viktor Steimle has been a non-stop source of knowledge and interesting
tidbits through the years, and I would never understand FACS (or many other things) without
him. Just for your own personal enjoyment Viktor, I have included a few well-placed "proper"s
in my thesis. I also appreciate the more recent yet significant contribution of Daniel Lafontaine
to my studies, always there for a good pep talk. Finally, Benoit Leblanc rivals Viktor in the
knowledge department, and his contribution to project-related and non-scientific silly discussions
will always be remembered.
My Gevry lab-mates need to be specially mentioned. Gabrielle lived through my pregnancy with
me, keeping the others in line and suffered through my slave-driver ways in the preparation of the
most recent article. Mylene was always there for scientific and non-scientific discussion, and I
vm
apologise for the incessant chatter that may have led to human error in your experiments... I hope
to have helped Anne-Marie, Lydia, Guylaine, and Ma'fka in their learning processes, since I have
sincerely enjoyed their company during the past few years and they have been the subject of my
constant teasing and silliness. I only hope the newcomers, Stephanie and Alexei, will become as
used to this as you all have! My colleagues in Luc's lab, Alain, Maud, Liette, Sylvain, Marc,
Annie, Sebas, Joelle and yes, even my nemesis Ben, have all contributed in their own unique way
to my progression through the years. I especially thank the overworked and underappreciated
Manon, who is the best Mommy to my cells I could ask for. Impossible to forget, although not
lab-mates, my department colleagues Gabi, Jean-Phillipe, Simon, Jean-Francois, Jerome and
Benoft played an important role in my psychological wellness over the years. Thanks as well to
Andree-Anne, who renewed my faith in the youngun's...
Last, but most definitely not least, I thank my family with all my heart. My husband, Francis
Jacques, was the essential in my re-entry into research in 2005 and has suffered through countless
moments of tardiness, existential and professional questioning, and the long hours spent at the
lab. If it was not for his help during my studies, my pregnancy and the birth of our child, Noah, I
would have quit many times. As I sit writing this on a wintery Saturday afternoon alone in the
lab, he is at home, taking care of our little Noah. Saying this, I also have to thank Noah, who was
such a good fetus and baby once he came into this world, letting Mommy finish her Ph.D.! The
support of my mother will stay with me my whole life, my number one fan. She is always backed
up by the cheerleaders, my sisters. Finally, I hope I have made my inspiration, my father, proud.
"No! Try not. Do or do not. There is no try."
- Yoda, a long time ago in a galaxy far, far away
IX
LIST OF ABBREVIATIONS
3C
3D
ACF
AD
AE
AF-1
AF-2
ATP
ATPase
bp
BRD
CAF
CBP
CENP
CHD
ChlA-PET
ChIP
ChlP-PET
ChlP-seq
CRC
C-terminal
DBD
DNA
DSB
E2
EGFR
ER
ERE
EZH
FISH
GNAT
H2A
H2B
H3
H4
HAT
HDAC
HER2
HMT
HP1
HRE
HZAD
chromosome conformation capture
three-dimensional
ATP-utilizing chromatin-assembly and -modifying factor
activation domain
anti-estrogen
activation function 1
activation function 2
adenosine-5'-phosphate
ATP hydrolysis
base pairs
bromodomain
chromatin assembly factor
CREB-binding protein
centromere protein
chromodomain
chromatin interaction analysis with paired-end tag sequencing
chromatin immunoprecipitation
ChIP analysis with paired-end tag sequencing
ChIP analysis with deep sequencing
chromatin remodelling complexes
carboxy terminal
DNA-binding domain
deoxyribonucleic acid
double strand break
estrogen
epidermal growth factor receptor
estrogen receptor
estrogen response element
enhancer of zeste
fluorescence in situ hybridization
Gcn5-related acetyltransferase
histone 2 A
histone 2 B
histone 3
histone 4
histone acetyltransferase
histone deacetylase
human epidermal growth factor receptor 2
histone methy transferase
heterchromatic protein 1
hormone response element
^/-activated domain
ISWI
Jmj
kb
KDM
LBD
LSD
MAPK
MLL
MYST
NAP
N-terminal
NR
PcG
PCR
pEZH2
PI3K
PIC
PRC
PRMT
pTEF-b
RCAF
RE
RNA
RNAi
RNAPII
SET
SWI/SNF
TFII
trxG
TSS
Ub
imitation switch
jumonji
kilobases
lysine demethylase
ligand-binding domain
lysine-specific demethylase
Mitogen activated protein kinase
Mixed Lineage Leukaemia
MOZ, Ybf2/Sas3, Sas2 and TIP60
nucleosome assembly protein
amino terminal
nuclear receptor
polycomb group
polymerase chain reaction
phosphorylated EZH2
phosphotidylinositol-3 kinase
pre-initiation complex
polycomb respressive complex
peptidylarginine methyltransferases
positive transcription elongation factor b
replication coupling assembly factor
response elements
ribonucleic acid
RNA interference
RNA polymerase II
su(var)3-9, enhancer of zeste, trithorax
SWItch/Sucrose NonFermentable
transcription factor II
trithorax group
transcription start site
ubiquitin
LIST OF TABLES
CHAPTER I : INTRODUCTION
TABLE 1-1: CHROMATIN CONFORMATIONS AT DIFFERENT PROMOTER TYPES
CHAPTER
III : H2A.Z
25
OVEREXPRESSION PROMOTES CELLULAR PROLIFERATION OF
BREAST CANCER CELLS
TABLE 3-1: HIGH GRADE BREAST CANCER CORRELATES WITH HIGH LEVELS OF H2A.Z
89
TABLE 3-2: HIGH LEVELS OF H2A.Z CORRELATE WITH HIGH LEVELS OF IMPORTANT CELL CYCLE
REGULATORS
89
CHAPTER IV : T H E CONTROL OF H3K27 METHYLATION STATUS AFFECTS THE APOPTOTIC
PROGRAM IN HORMONE-DEPENDENT BREAST CANCER AND ANTI-ESTROGEN RESISTANCE
TABLE 4-S1: E2-REGULATED GENES NEGATIVELY AFFECTED BY THE KNOCKDOWN OF JMJD3
139
TABLE 4-S2 : POTENTIAL ANTI-APOPTOTIC GENES NEGATIVELY REGULATED BY THE KNOCKDOWN OF JMJD3
140
TABLE 4-S3 : LIST OF PRIMERS USED IN THIS STUDY
141
XII
LIST OF FIGURES
CHAPTER I : INTRODUCTION
Figure 1-1 : The 3 main mechanisms of site exposure on DNA through chromatin remodelling....5
Figure 1-2 : Phytogeny of H2A variants
9
Figure 1-3 : Epigenetic tools
15
Figure 1-4 : Gene promoter structure in inducible gene expression
22
Figure 1-5 : Chromatin conformations at different promoter types
25
Figure 1-6 : Polycomb-mediated repression and model of cell fate decision on poised promoters
33
Figure 1-7 : The different pathways of gene regulation by ERa
36
CHAPTER II : REGULATION OF GENE EXPRESSION AND CELLULAR PROLIFERATION BY
HISTONE H2A.Z
Figure 2-1 : Proposed model for the control of cellular proliferation by H2A.Z in mammalian
cells
CHAPTER
69
III: H2A.Z OVEREXPRESSION PROMOTES CELLULAR PROLIFERATION OF BREAST
CANCER CELLS
Figure 3-1 : The overexpression of H2A.Z promotes E2-independent cell growth
85
Figure 3-2 : H2A.Z is overexpressed in several different cancerous cell lines and tissues and
correlates with ERa levels
86
Figure 3-3 : High grade breast cancer correlates with high levels of H2A.Z
88
Figure 3- 4 : ERa regulates the expression of H2A.Z in breast cancer cells
91
CHAPTER
IV : THE CONTROL OF H3K27 METHYLATION STATUS AFFECTS THE APOPTOTIC
PROGRAM IN HORMONE-DEPENDENT BREAST CANCER AND ANTI-ESTROGEN RESISTANCE
Figure 4-1: JMJD3 causes apoptosis in ERa-positive breast cancer cells
109
Figure 4-2: JMJD3 regulates BCL2 gene transcription in ERa-positive cells
112
Figure 4-3 : JMJD3 colocalizes with ERa at the BCL2 promoter
114
Figure 4-4 : Presence of ERa and JMJD3 at BCL2 are interdependent
116
Figure 4-5 : AE-resistant cells have a modified H3K27me3 chromatin signature that alters BCL2
transcriptional activity
121
Figure 4-6 : Inactivation of the EZH2 methyltransferase activity by the HER2/AKT pathway bypasses the
Xlll
need for JMJD3 at the BCL2 enhancer region in AE-resistant cells
125
Figure 4-7: Summary model of the role of JMJD3 and H3K27 methylation in the control of BCL2 gene
expression in tamoxifen sensitive and resistant breast cancer cells
130
Supplementary figures
Figure 4-S1 : The shRNA-mediated knockdown of JMJD3 affects apoptosis in MCF7 cells
134
Figure 4-S2 : The effect of JMJD3 knockdown is specific to ERa-positive cells
135
Figure 4-S3 : The H3K27me3 demethylase UTX does not affect BCL2 expression
135
Figure 4-S4 : H3K27me3 status does not affect chromatin remodelling at the BCL2 enhancer region
136
Figure 4-S5: Anti-estrogen resistant cells exhibit an altered epigenetic pattern and regulation of BCL2.. 136
Figure 4-S6 : Depletion of PRC complex member SUZ12 induces expression of BCL2
137
Figure 4-S7 : Inhibition of pEZH2 in AE resistant cells decreases BCL2 expression
137
Figure 4-S8 : A decrease in H3K27me3 due to EZH2 phosphorylation leads to resistance to tamoxifeninduced apoptosis
138
xiv
CHAPTER I
I.
INTRODUCTION
1.1. The eukaryotic genome
The world we live in is teeming with diverse forms of life, all based on the same simple
structure: a series of nucleotides (A, T, C, G) which are arranged into base pairs (bp) in a
double helix called DNA. The specific arrangement, or sequence, of these nucleotides
into genes will determine the different characteristics of an organism, from a simple-cell
prokaryotic or eukaryotic organism such as a bacteria or yeast, to complex multicellular
eukaryotic organisms that are composed of multiple organs or tissues, such as plants and
animals. The entirety of genes in an organism is called its genome, and generally the
more complex the organism, the larger the genome. However, the size of each cell does
not necessarily vary accordingly to accommodate the increasing amount of DNA. For
example, the yeast Saccharomyces cerevisiae genome is 12.1 million bp, approximately
6 300 genes, would measure if placed end to end almost 1 centimetre (cm) and fits in a
cell of 5-10 micrometers (um) in diameter (Alberts et al., 2002). The human genome is
composed of 3.2 billion bp that code for approximately 30 000 genes, and would measure
if placed end to end 2 metres long, but fits into cells that measure on average 10 urn
(almost 200 times smaller than the size of a pinhead) (Alberts et al., 2002).
To package a genome this size into such a small space is one of the greatest organising
feats ever achieved, using the sorting of sequences into different sections, or
1
chromosomes, and the folding of these DNA sections by proteins into a structure called
chromatin. In addition, multicellular organisms are composed of a number of different
cell types, but the expression of every single gene simultaneously would create chaos. At
the same time, the expression of the wrong genes at the wrong time leads to a number of
pathophysiologies, such as cancer. Therefore, the establishment of cell identity depends
largely on the timely differential expression of genes that are present in each cell. The
effect of chromatin structure on gene expression decisions in normal and cancerous cells
has been the subject of my doctoral studies.
1.1.1. Structure of the eukaryotic genome
Chromatin is a complex of DNA and proteins that is separated into several levels,
achieved via the use of several different proteins and complexes. The first level of
chromatin organisation is defined by the nucleosome, 146 base pairs (bp) of DNA
wrapped around an octamer of canonical histones (2 of each H2A, H2B, H3 and H4),
with generally 50-80 bp of linker DNA between nucleosomes (Kornberg and Thomas,
1974). Histones are proteins with a high proportion of positively charged amino acids,
and the central domain consists of three a-helixes separated by loop domains, known as
the "histone fold" domain (Arents et al., 1991).
It is believed that these two
characteristics permit the histones to tightly bind the DNA via the sugar phosphate
backbone, mostly in the minor groove of DNA (Luger et al., 1997). The main variations
between the histones occur in the N-terminal tails, which are known to be subject to
specific post-translational modifications (Strahl and Allis, 2000). The protruding Nterminal tails interact with DNA, neighbouring nucleosomes, and non-chromatin proteins
(Schwarz et al., 1996).
2
Chromatin is basically separated into two forms in the cells: heterochromatin and
euchromatin.
Heterochromatin is known as the most highly condensed form and
generally remains always condensed (Craig, 2005).
For example, regions of
heterochromatin present at the end of chromosomes, the telomeres, and at the interaction
point between chromosomes, the centromere, rarely contain genes and are known as
constitutive heterochromatin (Craig, 2005). However, some regions of chromatin present
in different areas of the chromosome have the capacity to condense in the response of
cellular signals, known as facultative heterochromatin (Craig, 2005). The histone protein
HI, larger than the core histones, can bind to the DNA-nucleosomal axis and change the
path of the linker DNA to help in further compaction of chromatin (Bustin et al., 2005).
Additional levels of DNA packaging exist in order to organise the genetic information
into a more efficiently compacted structure and to preserve the DNA during cell division,
where the condensation of chromatin into the chromosomes occurs (Felsenfeld and
McGhee, 1986).
Euchromatin makes up the majority of chromatin in eukaryotic cells, of which 10% is
actively being transcribed at any moment, giving it the designation of "active chromatin"
(Cairns, 2009).
Euchromatin is defined by its less condensed structure than
heterochromatin (Cairns, 2009). However, the simple presence of nucleosomes provides
an important barrier to gene expression and DNA replication mechanisms that must be
overcome (Knezetic and Luse, 1986; Lorch et al., 1987). Thus, gene expression is
dependent on complexes and mechanisms that modify nucleosomal positions and
structure. Therefore, there exist several factors that determine nucleosomal assembly on
a DNA template, and genome-wide studies in different organisms have revealed the
requirements for nucleosome positioning in vivo (Albert et al., 2007; Field et al., 2009;
Field et al., 2008; Kaplan et al., 2009; Lee et al., 2007b; Mavrich et al., 2008a; Mavrich et
al., 2008b; Ozsolak et al., 2007; Peckham et al., 2007; Schones et al., 2008; Shivaswamy
et al., 2008; Valouev et al., 2008; Yuan et al., 2005). First, the DNA sequence in itself
encodes preferential locations for nucleosome assembly. Considering that a mechanical
3
stress is created when DNA must be wrapped around the nucleosome, sequences with the
least resistance to the sharp bending, such as periodic stretches of AA/TT dinucleotides,
are preferred nucleosome locations, whereas long tracts of rigid sequences are often
devoid of nucleosomes (Segal and Widom, 2009).
The original positioning of
nucleosomes on DNA can then be forcibly modified by complexes that affect the histoneDNA interaction in different ways.
Chromatin remodelling complexes (CRC) are large complexes composed of a variable
number of proteins that direct nucleosome dynamics in the cell by regulating DNA
accessibility. There are three main ways that the eukaryotic cell remodels chromatin:
ATP-dependent site exposure, the incorporation of histone variants into the nucleosome,
and post-translational modification of the histones (Figure 1-1; (Saha et al., 2006)). A
common feature of CRC is the presence of protein domains that are required for
nucleosome
interaction:
bromodomains
(BRD)
bind
to
acetylated
residues;
chromodomains (CHD) recognise methylated residues; and plant homeodomain (PHD)
fingers and Tudor domains are known to bind methylated histones (Saha et al., 2006;
Zhang, 2006). These complexes also contain subunits with catalytic activity, such as
ATPase, acetylase and/or methylase activities, which are essential in executing the
chromatin remodelling mechanisms.
Each of these mechanisms is crucial for cell
viability and the equilibrium between these mechanisms is central in proper gene
regulation.
4
Positioning
ATP-de pendent
CRC
Composition
ATP-dependent
CRC
Canonical
nucleosome
Variant
nucleosome
Modification
CRC with histone
modifying enzymes
•
Figure 1-1 : The 3 main mechanisms of site exposure on DNA through chromatin
remodelling
The action of chromatin remodelling complexes can modify nucleosomal positions on
DNA or the composition of nucleosomes by incorporating histone variants. Nucleosomes
can also be modified by the actions of chromatin remodelling complexes that contain
proteins with histone modifying enzymatic capacity. Adapted from (Saha et al., 2006).
1.1.2. Chromatin remodelling via ATP-dependent complexes
In general, ATP-dependent CRC will affect chromatin structure via intrinsic ATPase
activity contained in the main subunit of the complex. The ATPase activity will permit
the disruption of histone-DNA contacts while the remodelling factor subunits will either
reposition the nucleosome along DNA, eject the nucleosome, or unwrap the DNA from
5
the nucleosome surface (Figure 1-1) (Clapier and Cairns, 2009; Saha et al., 2006). To
date, there exist four known main families of ATP-dependent CRC with different ATPase
activities in eukaryotic organisms, whose composition and function varies in each
organism: SWI2/SNF2 (Switching/Sucrose Non-Fermenting), ISWI (Imitation Switch),
CHD (chromodomain), and INO80 families (Clapier and Cairns, 2009; Eberharter and
Becker, 2004).
Assembly of the nucleosome during replication occurs through the concerted action of
the CAF-1 (Chromatin Assembly Factor 1), RCAF (Replication-Coupling Assembly
Factor), ACF (ATP-utilizing Chromatin assembly and remodelling Factor), and NAP-1 or
NAP-2 (Nuclesome Assembly Protein 1 or 2) complexes (Ito et al., 1999; Loyola et al.,
2001; Rodriguez et al., 1997; Tyler et al., 1999). CAF-1 and RCAF aid in the formation
of an H3-H4 tetramer and its deposition onto DNA (Smith and Stillman, 1989, 1991)
while Nap-1 or Nap-2 can bind H2A-H2B dimers and act as histone chaperone proteins
to deposit the dimer onto the H3-H4 tetramer, aided by the ACF complex, which contains
the ISWI ATPase (Ito et al., 1999; Rodriguez et al., 1997). Studies in human cells have
demonstrated that assembly is dependent on the ATP-dependent RSF (human
Remodelling and Spacing Factor) complex, also an ISWI-containing complex, and can
take place without the use of a histone chaperone (Loyola et al., 2001).
The ATPase activity of CRCs increases the accessibility to DNA and aids in the regular
spacing of nucleosomes along DNA (Ito et al., 1999). Both the ISWI and human INO80
complexes can displace nucleosomes in cis by "sliding" the nucleosomes along DNA (Jin
et al., 2005b; Langst and Becker, 2001). Members of the SWI2/SNF2 families of
chromatin remodelling complexes can displace nucleosomes in cis and trans, completely
disrupting chromatin structure in order to move a nucleosome to a different position on
DNA (Fan et al., 2003a; Imbalzano et al., 1994; Mizuguchi et al., 2004). The members of
the CHD family are characterised by the presence of a chromodomain-containing subunit,
used to bind methylated lysine residues on proteins, and often have a histone deacetylase
6
associated with the complex (Delmas et al., 1993; Feng and Zhang, 2003; Kelley et al.,
1999).
The actions of each of these complexes are also implicated directly in the regulation of
gene expression, often by the intrinsic activity of the complexes or by the association
with other histone modifiers. For example, the actions of ISWI in the modification of
translational positions of nucleosomes along DNA can uncover regulatory regions,
thereby modifying gene expression and DNA replication (Fazzio and Tsukiyama, 2003;
Langst et al., 1999; Xella et al., 2006). ISWI complexes have also been associated with
histone modifying activity (Kal et al., 2000; Wysocka et al., 2006). Of the INO80
members, the ATPase chromatin remodelling activity of the yeast SWRl, and human
SRCAP and p400 complexes have a special ability to specifically target H2A/H2B
dimers to exchange them with a dimer containing H2A.Z, an H2A variant strongly
associated with gene regulation (Gevry et al., 2009; Jin et al., 2005b; Kobor et al., 2004;
Krogan et al., 2004; Krogan et al., 2003; Mizuguchi et al., 2004; Ruhl et al., 2006; Wu et
al., 2005). CHD family CRC have been associated with active histone modifications and
demonstrates a role in relieving torsional stress on DNA during transcriptional and
replication processes (Hall and Georgel, 2007; Srinivasan et al., 2008; Zhang et al.,
2005b). Taken together, the increasing knowledge of the functions and subunits of CRC
have revealed that the three chromatin remodelling mechanisms are strongly inter-related,
and have crucial effects on DNA-related activity.
1.1.3. Incorporation of histone variants into the nucleosome
Histone variants are paralogues of the canonical histones, differing from the latter by
slight to major changes in sequence (Malik and Henikoff, 2003). Recent studies on these
variants have shown that they tend to be conserved across species, delineating their
7
importance (Talbert and Henikoff, 2010). Histone variants are generally expressed
throughout the cell cycle but are specifically deposited into chromatin at specialized
instances via a replication-independent mechanism, contributing to epigenetic control in
the cell (Henikoff et al., 2004; Jin et al., 2005a). Both histones H3 and H2A are known to
have several variants in mammalian cells: CENP-A, H3.lt, H3.1, H3.2 and H3.3 for H3;
and macroH2A, H2A.Bbd, H2A.X, H2A.Z1 (H2A.Z) and H2A.Z2 (H2A.F/Z) for H2A
(Hake and Allis, 2006; Pusarla and Bhargava, 2005; Talbert and Henikoff, 2010). Each
of the histone variants conveys a special characteristic to the chromatin fiber once they
are incorporated. CENP-A (or CenH3) is associated with the formation of the highly
compacted centromeric chromatin (Bernad et al., 2009). In contrast, H3.3 is located at
gene regulatory regions and areas that are enriched with covalent modifications
associated with active chromatin, such as acetylation (Bulger et al., 2003; Elsaesser et al.,
2010; McKittrick et al., 2004).
H2A variants are numerous and provide a great variability in the nucleosomes they
inhabit by modifying nucleosome structure, stability and targeting by CRC, conferring
the nucleosome an important role in transcription, DNA repair and chromosome
compaction (Figure 1-2; (Talbert and Henikoff, 2010)). The existence of variants of H2A
was first observed in mammalian cells, in a study that demonstrated two as-yetunidentified forms of H2A via gel and peptide analysis (West and Bonner, 1980). H2A is
the major form of histone H2A proteins in eukaryotic cells, with the variants H2A.X and
H2A.Z constituting a minor fraction of total H2A in S phase (Wu and Bonner, 1981).
H2A.X, in its phosphorylated form of y-H2A.X, plays a pivotal role in the marking of
DNA damage in the form of double-strand breaks (DSB) and the recruitment of DNA
repair proteins to these sites (Dickey et al., 2009). H2A.Z has been shown to have an
increasingly complex role in several organisms, notably in mammalian cells, with varying
roles in transcriptional regulation and nucleosome stability (Svotelis et al., 2009;
Zlatanova and Thakar, 2008).
8
" — " * "*~
Trypanosoma bmca M2A Z
~ Texrahym&na ihermophia H2A I
"Cryptosporidium parvum H2A £
Toxoplasma gondii H2A Z
Ambtdopms thattana HTM
™
Arobktepslififw&JrtaH2A Z
™™— 0>!»5Btt« H2A 2
rffcmo sapient H2AZ1
u
Dontor«r«>M2A.Z
Homo K#wns H2A Z2
^O0flusgfl&«H2A.Z2
Dr)rMOWK>H2A.v
j Trichofjtax odhopntra H2A 7
-DresppMo nwlonogoster H2Av
5oc^*anpmyic«5 cenrvrstoe H2AZ
- SehteosoxfiOfDmyGK pcmbe H2A.Z
-—
™
-Dtetyosttitum dfceoMewn H2A.Z
~7r>p<jri050ox» hwm H2A
-<J&^iam6taH2A.X
-DfCtyoSfcSurr* <AscokfcwiH2A.X
Homo sapiens HMBbd
Bos taumt HM Sbd
'
MUJ muscv&tf H2A.BW
J
Mus rrmstiAjs H2AU
••
A* rt museums H2AL1
C&n*femtferfeH2AI
* AJwandnum romonwis* H2A X
, f ™ Homo saptem tv&<2A\.2
*" Go&ftgofc«mH2A12
j Homo septem mH2AU
"•• 0mto/*rfomH2AU
~ Homo *opfen mH2A2
GaSfus go«us mH2A2
Danio rerio mH2A2
" Ixodes scapufarts mH2A
" Nematoste&a wcwnss mH2A
- Hyvfre maigrwpap*lfota mHZA
- Strongyhcentrotls purpuratui mH2A
Trfchep&wt odrwewns mH2A
™" OypfosporwAtirri parvum H2A X
* rarqs&tsmo^o^f HiA X
*—
Temsfrymem thermoptvla HM X
ArobkbfHK thobano HMJftCK
- / * « * * * » & rMSJnaHM
— • O y m SoBvo H2A
AVafcitfwsisrtefeiMoHMX
O0tfastftfvaH2AJ(
—Si*cdl»aror»vc«iDewWsfe» H2A X
5cfir/OSOCt/)ctrOfr<yc»i port?t* H2A.X
'OstdagO moydH K2A.X
Hpmo sapwrrw H2AX
Monodefcfta domesriOJ H2A.X
Omtifcrfyrtc/tus onotinus H2A X
Li
cOewtor*noH2AX
Danto/*rfoH2A
*tomo wp«m H2A
Calks ga8usH2A
TWdwpta* «#x»rwu H2AJC
r Mus musctAs H2A
f*A#smrtefer3H2A
~Aps/rwJtffaraH2A.X
"AdSoew voga H2Abd2
AdrwttJ w^ga H2Afadl
——j^&aeta vaga H2Abd
0 01 differences per site
tf
1r
Kingdom
Excavate
Amoebo/oan
Alveolate
Plant
Fungt
Animal
Historic variant
H2AZ
— HTA4 »rtd H2AV
— H2AX
•—- Canc*itcal H2A
— &detto<i rotifer H2A
Plant taiter bmdmg HM
— Mammattian H2AJJbd
and sperm H2A
— AntmaimH2A
Figure 1-2 : Phylogeny of H2A variants
A phylogenetic tree of H2A variants, showing that H2A.Z and H2A.X diverged from
other H2A variants before the diversification of eukaryotes, and may have preceded
canonical H2A (Talbert and Henikoff, 2010).
9
1.1.3.1. The histone variant H2A.Z
The study of H2A.Z and H2A.Z-containing nucleosomes has been an exciting adventure
over the past few years, providing irrefutable evidence that H2A.Z is an essential variant
for normal eukaryotic cell function. Originally identified in several organisms, it was
found that H2A.Z is significantly more conserved across species (90% sequence identity)
than H2A (Iouzalen et al., 1996; Jiang et al., 1998), and it has been suggested that either
H2A.Z or H2A.X evolved before the canonical H2A (Figure 1-2; (Talbert and Henikoff,
2010)). It has recently been shown that there are two distinct genes in vertebrates that
produce H2A.Z proteins, H2A.Z1 and H2A.Z2 (Eirin-Lopez et al., 2009). H2A.Z2
differs from H2A.Z1 by only three amino acids, but does not seem to be completely
functionally redundant with H2A.Z1, shown by the lethality of the murine simple
knockout of H2A.Z1 (Eirin-Lopez et al., 2009; Faast et al., 2001). For simplicity, all
future references to H2A.Z in this thesis apply to H2A.Z1, unless specifically stated. The
crucial differences between H2A and H2A.Z seem to lie within the C-terminal region of
the protein.
Although its deletion conferred roles in transcription and chromosome stability in
Saccharomyces cerevisiae and Schizosaccharomyces pombe, H2A.Z (htzl in yeast) is not
essential for survival (Adam et al., 2001; Carr et al., 1994; Jackson and Gorovsky, 2000;
Krogan et al., 2004; Larochelle and Gaudreau, 2003; Santisteban et al., 2000). However,
the overexpression of H2A.Z in H2A yeast gene knockout strains (Ahtal/Ahta2) could
not rescue the lethal phenotype associated with this strain, and the overexpression of
either of the H2A genes could not rescue the bhtzl phenotypes (Jackson and Gorovsky,
2000; Santisteban et al., 2000). Also, replacement of the C-terminus of H2A.Z with the
equivalent region in H2A could not rescue the Ahtzl phenotype, while a fusion of the
H2A.Z C-terminus with H2A lacking its C-terminus restored wild-type function (Adam
etal.,2001).
10
The importance of H2A.Z is more evident in metazoan models, such as Tetrahemena
thermophila, Xenopus laevis, Drosophila melanogaster, and Mus musculus, where
deletion of the gene is lethal (Faast et al., 2001; Iouzalen et al., 1996; Liu et al., 1996a;
van Daal et al., 1988). Complementation assays in Drosophila embryos via the injection
of H2A.Z in early larval stages rescues this lethality (van Daal et al., 1988). More
recently, RNA interference (RNAi) has now permitted us to explore the cellular pathways
affected by a decrease in the expression of H2A.Z while escaping the knockout lethal
phenotype in metazoan cells. Taken together, these results suggest that H2A.Z has a role
in the development of multi-cellular organisms, notably in the regulation of gene
expression, which will be discussed in the section 1.2.4.
The differences between H2A and H2A.Z function may stem from the differences in the
H2A- or H2A.Z-containing nucleosome structures. Despite a homology of only 60%
between the primary protein structures of H2A.Z and H2A, crystal structure analysis of
reconstituted nucleosomes containing mouse H2A.Z demonstrated only a few major
differences from H2A (Suto et al., 2000). A chimeric construct of H2A.Z with the Cterminal region of H2A introduced into Drosophila embryos lacking the wild-type
histone variant leads to lethality or major developmental defects, while other areas appear
to be interchangeable (Clarkson et al., 1999). Although subtle, these changes lead to a
possible steric hindrance between H2A and H2A.Z, which was suggested to lead to
homotypic nucleosomes, containing either H2A.Z or H2A in metazoan cells (Suto et al.,
2000). However, the existence of heterotypic "ZA" nucleosomes (one H2A/H2B dimer
coupled to a H2A.Z/H2B dimer) has been observed in reconstituted vertebrate
nucleosomes in vitro and confirmed in vivo by immunoprecipitation in S. cerevisiae and
Drosophila melanogaster (Ishibashi et al., 2009; Luk et al., 2010; Weber et al., 2010).
The heterotypic nucleosome tends to be less stable than homotypic H2A.Z nucleosomes
(Ishibashi et al., 2009). Many unresolved issues remain concerning the particularities of
the stability of the H2A.Z-containing nucleosome particle, which seems to depend on
11
nucleosome composition and H2A.Z acetylation (Jin et al., 2009; Le et al., 2010;
Zlatanova and Thakar, 2008).
The specificity of H2A.Z-related responses is due in part by it targeting to chromatin in
response to cellular signals independent of nucleosome formation during replication.
There has been speculation on the specific sequence characteristics that may determine
H2A.Z nucleosome positioning.
Large-scale analysis of the DNA sequences that
immunoprecipitate with H2A.Z by ChlP-chip, or by a massive DNA sequencing analysis
of ChIP DNA fragments (ChlP-seq) (Venters and Pugh, 2009) have provided a multitude
of information on H2A.Z in chromatin. Using previously obtained data from ChlP-chip
and Chip-seq experiments, bioinformatics analyses have shown that H2A.Z-containing
nucleosomes protect a smaller region of DNA in both yeast an humans (120bp as
compared to 147 in H2A-containing nucleosomes), and that the underlying sequence is
more GC-rich and more rigid (Fu et al., 2008; Gervais and Gaudreau, 2009; Tolstorukov
et al., 2009). However, a recent genome-wide analyses of sequences from purified
nuclesomes in human HeLa cells has further determined that nucleosomes containing
only H2A.Z are rich in more flexible AT motifs, while "double-variant" nucleosomes
(H2A.Z and H3.3), the nucleosomes that are most present at gene regulatory areas, are
more GC-rich (Jin et al., 2009; Le et al., 2010). Also, it appears that DNA methylation
will also affect the deposition of H2A.Z into chromatin, as they are anti-correlated in
plant, mouse and human genomes (Conerly et al., 2010; Edwards et al., 2010; Kobor and
Lorincz, 2009; Zemach et al., 2010; Zilberman et al., 2008).
The main determining factor of H2A.Z presence in chromatin remains is its deposition as
an H2A.Z/H2B dimer by the ATP-dependent remodelling CRC Swrl.com in yeast, and
SRCAP or p400/Tip60 complexes in metazoans (Cai et al., 2005; Gevry et al., 2007;
Kobor et al., 2004; Krogan et al., 2003; Mizuguchi et al., 2004; Ruhl et al., 2006). In
yeast, in addition to the copurification of H2A.Z, Swrl, and Swrl.com components, ChIP
assays in strains lacking swrl or other components of the complex showed a decrease in
12
the presence of H2A.Z in euchromatin that borders silenced areas of chromatin (Kobor et
al., 2004; Krogan et al., 2003). The role of Swrl.com in the catalysis of the exchange of
H2A/H2B dimers for H2A.Z/H2B dimers was confirmed in vitro, using an exchange
assay with reconstituted nucleosomes in the presence of ATP (Mizuguchi et al., 2004).
This activity appears to be genome-wide, as shown by the Swrl-dependent localization of
H2A.Z in chromatin (Li et al., 2005; Zhang et al., 2005a). The existence of heterotypic
"ZA" nucleosomes in S. cerevisiae and Drosophila melanogaster suggests a mechanism
by which the exchange occurs in a stepwise manner, replacing one dimer at a time
(Ishibashi et al., 2009; Luk et al., 2010; Weber et al., 2010). Orthologs of the catalytic
subunit Swrl in metazoan cells were suggested to be SRCAP and p400 (Cai et al., 2005;
Wu et al., 2005). The H2A.Z protein was present in an SRCAP immunoprecipitated
complex, and the ATP-dependent exchange of H2A/H2B dimers for H2A.Z/H2B by the
SRCAP complex was demonstrated in vitro (Cai et al., 2005; Ruhl et al., 2006).
Although not present in the p400/Tip60 immunoprecipitated complex (Fuchs et al.,
2001), H2A/H2B dimers can be exchanged for H2A.Z/H2B dimers by p400/Tip60 in
vitro (Gevry et al., 2007).
Once deposited into chromatin, the H2A.Z-containing nucleosome confers distinct
properties to the chromatin environment. Genome expression and ChIP analysis of an
htzl knockout strain suggested that H2A.Z was important in close proximity to telomeres
in yeast (Guillemette et al., 2005; Kobor et al., 2004; Krogan et al., 2004; Krogan et al.,
2003; Meneghini et al., 2003). These clusters are referred to as Htzl-activated domains,
serving to protect the spread of the Sir-dependent repressive effect (Meneghini et al.,
2003). Immunofluorescence and ChIP studies in mouse and human cells showed an
association between H2A.Z and HP la in constitutive and facultative heterochromatin, as
well as in important staining at the silent X chromosome (Fan et al., 2004; Rangasamy et
al., 2003; Sarcinella et al., 2007). However, H2A.Z is also present in a punctuate manner
throughout the chromosomes (Sarcinella et al., 2007). Accordingly, H2A.Z was found to
have a role in the prevention of heterochromatic spreading at insulator regions of the
13
chicken P-globin locus, regions of highly compacted chromatin that define chromatin
domains within the euchromatic regions of DNA (Bruce et al., 2005). The role of H2A.Z
in insulator definition is supported by the correlation between H2A.Z and the insulator
protein CTCF in human cells (Barski et al., 2007; Fu et al., 2008; van de Nobelen et al.,
2010). Along the same lines, the genome-wide ChlP-seq profiling of Plasmodium
falciparum showed that H2A.Z was found to demarcate intergenic regions and correlated
with H3K4me3 and H3K9ac (Bartfai et al., 2010). However, this localisation could not
be associated with a specific activity since it was stably present throughout the
developmental stages and no deletion analyses were performed (Bartfai et al., 2010). So,
early studies on H2A.Z positioning in the metazoan system corroborated yeast studies
that claimed H2A.Z was most important in heterochromatic areas of chromatin. However,
the majority of studies on H2A.Z confer a crucial role of this histone variant in the
control of gene expression in all model organisms, which will be discussed in more detail
in the section 1.2. Also, nucleosomes containing H2A.Z can be modified by the posttranslational modificaiton of this histone, as is the case for the canonical histone,
discussed in the following section.
1.1.4. Post-translational histone modifications
The post-translational modification of histones in the nucleosome has shown to be one of
the most important epigenetic marks, affecting chromatin compaction, gene regulation,
and lineage determination in multi-cellular organisms (Kouzarides, 2007).
The
association of nucleosomes with chromatin remodeling complexes and complexes
involved in gene expression is often affected by markers created by the post-translational
modification of histone proteins (Tarakhovsky, 2010). This results in major effects on
protein function and structure of the nucleosome by affecting the ability to fold or by
creating a new surface for protein interaction (Figure 1-3) (Tarakhovsky, 2010). The
14
main types of modifications that histones are subjected to are: acetylation, methylation,
phosphorylation and ubiquitinylation (Kouzarides, 2007). The abbreviated nomenclature
used for identifying histone marks begins with the histone that is modified, followed by
the residue, the modification and the number of marks placed on the residue (Kouzarides,
2007). For example, the tri-methylation of histone H3 on lysine 27 is identified as
H3K27me3.
The integration of acetyl, methyl and phosphorylation marks on the
canonical histone as well as their variants creates what can be known as an "epigenetic
signature" of different transcriptional states and cell lines (Lee et al., 2010). The crosstalk between these modifications can affect the establishment of these different signatures
in the process of differentiation or the development of different cancers, an area of great
interest in recent research.
Writing
Erasing
Acetylases,
methylases
Deacetylases,
demethylases.
Reading
Bromodomain,
chromodomain
Figure 1-3 : Epigenetic tools
The post-translational modification of histones in the nucleosome starts with the
"writing" of these marks by enzymes, such as acetylases and methylases. Following
these modifications, they can be removed by "erasers" (deacetylases or demethylases) or
serve as signals for the binding of proteins to the chromatin template through the
presence of domains such as bromo- and chromodomains. Adapted from (Tarakhovsky,
2010)
15
The acetylation of histones was one of the first studied histone modifications, due to the
observation that the acetylation of chromatin led to a more relaxed, therefore accessible,
structure (Mellor, 2005). The acetylation of lysine residues on histone tails neutralises
the positive charge and releases possible interactions with DNA and neighbouring
nucleosomes, "opening" the chromatin structure in the area of histone acetylation
(Mellor, 2005). However, the change in charge is not the only purpose of histone
acetylation, as this modification can also lead to the recruitment of regulatory proteins (or
complexes containing regulatory proteins) that possess a bromodomain (Mellor, 2005;
Sanchez and Zhou, 2009) (Figure 1-3). Histone acetylation is performed by complexes
that contain HAT (Histone Acetyl-Transferase) activity of which there are three main
families in mammalian cells, each with various substrates: GNAT (Gcn5-related
acteyltransferase); MYST (MOZ, Ybf2p/Sas3p, Sas2p, Tip60) and p300/CBP (CREBbinding protein) (Kouzarides, 2007; Marmorstein, 2001; Sterner and Berger, 2000). All
four canonical histones can be multiply acetylated in their N-terminal tails (Kouzarides,
2007). The most common acetyl marks that have been studied to date are H3K9ac,
H3K14ac, H3K27ac, and H4K16ac (Lee et al., 2010). In addition to the canonical
histones, histone variants can also be modified, adding another dimension to the variantcontaining nucleosome. For example, H2A.Z was shown to be acetylated in yeast and
chicken in areas of transcriptional activation and in regions required for the maintenance
of genome integrity and heterochromatin boundaries (Babiarz et al., 2006; Bruce et al.,
2005; Fan et al., 2002; Keogh et al., 2006; Millar et al., 2006). Histone acetylation is not
a permanent modification, and the removal of histone acetylation is associated with
decreased gene expression. The action of class I and II HDAC (Histone Deacetylase) and
class III Sir-family NAD-dependent enzyme complexes will remove the acetyl marks on
histone tails (Boffa et al., 1978; Kouzarides, 2007; Workman and Kingston, 1998). The
deacetylation of regions of chromatin can also lead to the susceptibility to the methylation
of lysine residues or to the methylation of DNA (Dobosy and Selker, 2001; Rice and
Allis, 2001). Both the actions of HATs and HDACs are considered to have multiple
substrate specificity, leading to a global effect on chromatin structure.
16
Histone methylation has varied effects on the chromatin state without altering the charge
of the histone tail. The effect of the methylation of histone tails varies depending on
which residue is modified, how many methyl groups are added, cellular context, other
modifications present in the nucleosome and the protein complexes that are recruited to
the modified nucleosome. The action of HMT (Histone Methyltransferase) complexes
adds methyl groups to lysine and arginine residues, with the mono-, di- or tri-methylation
of lysines on H3 and H4 becoming the subject of recent interest: H3K4, H3K9, H3K27,
H3K36, H3K79, and H4K20 (Sawan and Herceg, 2010). The three main classes of
HMTs are: the SET (Su(var)3-9, Enhancer-of-zeste, Trithorax)-domain family; the nonSET domain enzyme family, and the PRMT family (protein arginine methyltransferase)
(Wu and Zhang, 2009). The SET family contains members, of the MLL (Mixed Lineage
Leukaemia) group, which are important in the mono-, di-, and tri-methylation of H3K4,
an important mark in gene regulation (Ansari and Mandal, 2010). Other members of the
SET family, Polycomb (PcG) Repressive complex (PRC) and Trithorax group (trxG), are
important in heterochromatin formation by the trimethylation of H3K9me3 and
H3K27me3 (Ng et al., 2009; Wu and Zhang, 2009). The heterochromatic protein HPla
binds to both H3K9me3 and H3K27me3 via its chromodomain, leading to further DNA
compaction (Zeng et al., 2010). Of interest, the PRC and trxG complexes were also
identified as important regulators of homeotic (hox) gene expression in Drosophila, and
have been shown to be very important in mammalian development and cell identity
(Richly et al., 2010; Soshnikova and Duboule, 2009). The interplay between the two
complexes on related loci occurs due to the capacity of PRC to bind H3K27me3 and trxG
to bind H3K4me3 in the balance between repression and activation of developmental
genes, discussed in section 1.2.5 (Cao and Zhang, 2004; Czermin et al., 2002; Egli et al.,
2008; Kuzmichev et al., 2002; Muller et al., 2002; Niessen et al., 2009; Richly et al.,
2010; Soshnikova and Duboule, 2009).
17
Once considered a non-reversible chromatin mark associated with heterochromatic or
repressed regions, the discovery of lysine demethylases (KDM) has shown that this mark
is dynamically regulated.
To date, there are two main families of KDMs: the
KDM1/LSD1 (Lysine specific demethylase) and JmjC (Jumonji C) domain families
(Pedersen and Helin, 2010). The JmjC domain family is composed of five different
subfamilies: KDM2, KDM3, KDM4, KDM5, KDM6, PHF and JMJD6 (Pedersen and
Helin, 2010). The actions of KDMs have been shown to be pivotal in the regulation of
differentiation, by altering the balance of histone modification in key gene regulatory
areas, resulting in important cell fate decisions. For example, the depletion of members
KDM6A (UTX) and KDM6B (JMJD3) of the KDM6 subfamily led to developmental
defects in several systems in human and porcine cells, due to the loss of H3K27me3
demethylation on specific genes during the developmental process (Agger et al., 2007;
Dai et al., 2010; Gao et al., 2010; Lan et al., 2007; Seenundun et al., 2010). Taken
together, studies have shown that although a very important modification, histone
methylation has a more specific rather than generalised effect on chromatin architecture
within euchromatin.
The phosphorylation and ubiquitinylation of histone tails has been noted to some extent,
yet remains less characterised when compared to acetylation or methylation.
The
addition of a phosphate group to serine or threonine residues on histone tails is aided by
the action of kinases and can render the histone more sensitive to acetylation (Barratt et
al., 1994).
All of the core histones are found to be phosphorylated, yet the
phosphorylation of H3 at residues S10, S28, and Tl 1 have been the most studied seeing
as they are important in cell cycle progression (Clayton and Mahadevan, 2003; Goto et
al., 1999; Gurley et al., 1978; Preuss et al., 2003). In addition, the histone variant H2A.X
is subject to phosphorylation in response to DNA damage in several model organisms and
serves to mark the sites of DNA double-strand breaks (DSB) (Dickey et al., 2009).
Ubiquitinylation is a post-translational modification that adds one to several ubiquitin
(Ub) proteins to the target protein, which may lead to the degradation of the target protein
18
via the proteasome (Pickart, 2004). Histones H2A and H2B are known to be modified by
the addition of Ub in their C-terminal tails (Margueron et al., 2005). There have been
some indications in the mammalian system that H2A.Z can be Ub (Chen et al., 2006;
Sarcinella et al., 2007). Furthermore, immunoflourescence analysis of H2A.Z and mutant
forms localized mono-Ub H2A.Z to the inactive X chromosome in female cells,
suggesting that this modification could direct H2A.Z to specific chromatin environments
(Sarcinella et al., 2007). In summary, histone phosphorylation and ubiquitinylation serve
important roles in affecting histone function and may define different chromatin domains.
1.2. Chromatin architecture and regulatabie gene expression
The architecture of chromatin is such that it is generally not conducive to gene
expression, or the transcription of genes. It is obvious that not all genes in the eukaryotic
genome are expressed at all times, and a large majority of genes are regulatabie in
response to the presence (or absence) of extra- and intracellular stimuli (Weake and
Workman, 2010). Transcription requires the fine-tuned orchestration of several different
players that ultimately all modify the binding or activity of the basal transcription
apparatus, known as regulatabie gene expression (Weake and Workman, 2010). The
study of chromatin structure genome-wide by ChlP, ChlP-chip, ChlP-seq, and ChlP-PET
(ChlP-paired end diTag) has clarified the functioning of regulated gene expression in vivo
(Venters and Pugh, 2009). Most importantly, these techniques have permitted us to
elucidate the role of regulatory sequences that either activate or repress transcription via
their interaction with regulatory factors. In addition to the regulation of the initiation of
transcription, the underlying architecture of the structure of the eukaryotic genome,
chromatin, plays one of the most important roles in the regulation of expression.
19
1.2.1. RNA Polymerase II transcription of genes
If one were to imagine DNA as the simple double helix structure devoid of nucleosomes,
the transcription process would be fairly simple. Transcription begins in the crucial 5'
region of a gene, the core promoter which consists of the transcription start site, known as
+ 1 or TSS; the initiator region (Inr), the area that will open to permit transcription of the
gene; and occasionally a TATA box, at approximately -25 bp in metazoans, serving as a
recognition site for the basal transcription apparatus (Figure 1-4) (Juven-Gershon et al.,
2008; Levine and Tjian, 2003; Sandelin et al., 2007). However, for transcription to
occuer, genes require the use of up/downstream elements that are controlled by the
binding of different regulators, including chromatin remodelling complexes, transcription
factors and coactivators and repressors (Figure 1-4) (Juven-Gershon et al., 2008; Levine
and Tjian, 2003; Sandelin et al., 2007).
Basal transcription in eukaryotes of protein-encoding genes is performed by the preinitiation complex (PIC), composed of the RNA polymerase II holoenzyme complex
(RNAPII), general transcription factors and coactivator complexes (Buratowski, 2009;
Conaway et al., 2005; Malik and Roeder, 2010). RNAPII is composed of: catalytic
subunits that catalyze the addition of ribonucleotides (Rpbl and Rpb2) which also form a
channel through which the DNA-RNA hybrid moves during the transcription process
(Cramer, 2004a, b; Zhang et al., 1999); proteins with endonuclease activity that are
important for "proofreading" activity; and proteins required for the interaction with
transcription initiation and elongation coregulators (Malik and Roeder, 2000). The largest
subunit of RNAPII, Rpbl, is generally responsible for the initiation of elongation via the
phosphorylation of its C-terminal tail (Buratowski, 2009; Reese, 2003).
The general transcription factors are major components of the holoenzyme and have roles
in recognition of the promoter, initiation and elongation of transcription (Figure 1-4;
20
(Koleske and Young, 1994)). They are designated TFII, for transcription factor for
RNAPII, and have multiple roles in promoter recognition (Reese, 2003). The most
characterised to date are the TFIID and TFIIH complexes. The general transcription
factor complex TFIID is composed of several subunits: TBP (TATA-Binding Protein)
which binds to the TATA region distorting the DNA, and the TAFs (TBP-Associated
Proteins) which have multiple roles in promoter selectivity in TATA and TATA-less
promoters (Chen and Hampsey, 2002). The multiple subunits of TFIIH (Cdk7/cyclin H
in humans) contain ATP-dependent helicase activity needed to unwind the DNA template
and the kinase activity to phosphorylate RNAPII at serine 2 in the C-terminal domain
during transcriptional elongation. Transcription continues following the phosphorylation
of RNAPII at serine 5 by the factor positive transcription elongation factor b (p-TEFb)
(Dvir et al., 2001; Garriga and Grana, 2004).
Although transcription generally does
involve these simple steps, the specific regulation of gene expression is a very important
process in order to control cellular proliferation, differentiation and response to stimuli in
multicellular organisms. So, to this process we add the concerted action of several
complexes that bind to multiple regulatory regions of genes and to the core promoter,
which serve as modifiers of chromatin and activators or repressors of transcription
(Levine and Tjian, 2003). Although basal transcription may occur through the core
promoter, the key elements of gene regulation lie in areas surrounding the TSS (proximal
regulatory elements), and sometimes several kilobases (kb) from the core promoter (distal
regulatory elements) (Levine and Tjian, 2003).
21
Figure 1-4 : Gene promoter structure in regulatable gene expression
The representation of a gene promoter and the multiple possible regulatory elements,
including proximal (response elements (RE), TATA, INR, +1) and distal elements
(enhancers, insulators). Adapted from (Levine and Tjian, 2003)
1.2.2. Transcription factor mediated gene regulation
There are numerous fundamental mechanisms in the control of regulatable gene
expression.
First, within the DNA sequence itself, there are c/s-acting regulatory
sequences in areas surrounding the gene: response elements (RE) that permit the binding
of specific proteins (transcription factors, or activators); and enhancers that are bound by
positive transcriptional regulators and/or negative transcriptional regulators (Figure 1-4;
(Villard, 2004; Weake and Workman, 2010)). Both of these regulatory elements can be
found proximal or distal to the TSS.
The binding of activators to their RE is an essential step in transcription activation
(Weake and Workman, 2010). These factors generally have two main domains: a DNAbinding domain (DBD) that includes usually a dimerisation domain that permits the
22
formation of homo- or heterodimers; and an activating domain (AD) that binds to the
proteins of the transcriptional machinery (Kumar and Thompson, 1999; Weake and
Workman, 2010) Some activators have ligand-binding domains (LBD) that respond to
cellular signals such as hormone presence (Kumar and Thompson, 1999). The ensemble
of regions bound by one transcription factor in the genome has been recently come to be
known as its "cistrome" (Lupien et al., 2008). Activator binding to a RE generally
activates transcription by interacting directly or indirectly with the transcription machine
(Ptashne, 2005; Weake and Workman, 2010). For example, presence of the hormone
estrogen (E2) in mammalian cells will bind the estrogen receptor (ER) transcription
factor, permitting their dimerisation, nuclear transport and subsequent interaction with
estrogen response elements (ERE) on DNA, resulting in the transcriptional activation of
target genes (further detailed in section 1.3) (Beekman et al., 1993; Welboren et al.,
2009). Also, regulatory factors often do not act alone, utilizing different types of coregulatory proteins to respond to specific cell signals. Repressors can bind regulatory
sequences and prevent the binding of the transcriptional machinery or can also act
indirectly by interfering with the action of activators (Beekman et al., 1993; Kumar and
Thompson, 1999; Weake and Workman, 2010; Welboren et al., 2009). The activators
ERa and p53 notably recruit the help of histone modifiers CBP/p300, PRMT and
CARM1 during induction of their target genes (An et al., 2004; Gu et al., 1997; Lill et al.,
1997; Metivier et al., 2004; Shang et al., 2000). The action of these regulatory proteins is
not restricted to promoter proximal elements, but can also be observed at numerous distal
elements.
Distal response elements that influence transcription once bound by a trans-acting factor
and coregulatory proteins are known as enhancers. These areas are often large in size,
from 100 bp up to several kb, and can be located up- or downstream of the TSS in
variable positions and orientations with regard to the core promoter (Mitchell and Tjian,
1989; Weake and Workman, 2010). Some coregulator complexes prepare the regulatory
areas for the binding of different factors, and help form the bridge between activators and
23
RNAPII, aiding in the formation of the PIC (Malik and Roeder, 2010). These bridges can
result in the creation of specific 3-dimensional (3-D) structures, chromatin loops, that
affect the accessibility of the transcriptional machinery to the TSS and other promoter
elements (Bondarenko et al., 2003). This phenomenon is an area of much interest in
recent studies, and in part explains how distal elements will influence transcription of a
gene (Bondarenko et al., 2003; Hou et al., 2008; Ling et al., 2006; Splinter et al., 2006).
Similar structures are created at insulator regions, which define gene regions and limit the
interactions of enhancers with other promoters (Hou et al., 2008). The protein CTCF has
been shown by ChIP and chromosome conformation capture (3C) assays to be a master
regulator in the creation of insulator regions, of which H2A.Z is an important component
(Barski et al., 2007; Fu et al., 2008; Hou et al., 2008; Ling et al., 2006; Splinter et al.,
2006).
Enhancer function and chromatin looping demonstrates the importance of
chromatin structure in the gene regulation process.
1.2.3. Chromatin architecture at regulatory elements
It has become widely accepted that main criteria in controlling regulatable gene
expression is the modification of the chromatin structure that surrounds the promoter
region of a gene. The architecture of a promoter is known as the composition of the
DNA-protein complex that surrounds the TSS and regulatory elements (Cairns, 2009).
The application of high-resolution genome-wide analyses performed targeting histone
modifications and histone variants has provided a "chromatin signature" of enhancers and
promoters in human cells (Barski et al., 2007; Fu et al., 2008; Guenther et al., 2007; Jin et
al., 2009; Lupien et al., 2008; Mikkelsen et al., 2007; Schones et al., 2008; Sharov and
Ko, 2007; Zhou et al., 2010). Generally, there exist three different transcriptional states
for a promoter: active, in which the chromatin is organised and modified to be permissive
to transcription; repressed, where repressive chromatin marks dominate; and poised, a
24
state in which the promoter can be activated or repressed (Table 1-1; (Sakabe and
Nobrega, 2010; Zhou et al., 2010)). Numerous different chromatin modifications will
define these states, but this section will explore in more detail the effects on the fate of
transcription of one of the most influential histone variants, H2A.Z (1.2.4), and the
modification of H3K4 and H3K27 methylation (1.2.5).
Table 1-1: Chromatin conformations at different promoter types
Different histone modifications define inactive, poised or active promoters, and inactive
or active enhancers. Adapted from (Sakabe and Nobrega, 2010).
Genomic Element
Enrichment of Methylated Histories
Active genes (around TSS)
H3K4me1 H3K4me2 H3K4me3 (me1, me2, me3 H2AK9ac, H2BK5ac. H3K9ac, H3K18ac,
increase from 3' to 5')
H3K27ac, H3K36ac H4K91ac
Enrichment of Acetylated Histories
H3K9me1
H2A.Z
H2BK12ac. H2BK20ac, H2BK120ac, H3K4ac.
H4K5ac, H4K8ac, H4K12ac and H4K16ac
Active genes (transcribed regions)
H2BK5me1 (5' end) H3K27me1 (5'end)
H4K20Mel (5' end) H3K36me3 (3" end)
H2BK12ac, H2BK203C, H2BK120ac, H3K4ac,
H4K5ac, H4K8ac, H4K12ac and H4K16ac
Enhancers
H3K4me1 (H3K4me3)* H2A.Z
H3K27ac
Repressed genes
H3K27me2, H3K27me3 H3K79me3 H3K9me2,
H3K9me3 (weak correlation)
Bivalent domains'1
H3K4me3 'activating' H3K27me3 'repressive'
1.2.4. Mechanisms of transcriptional activation and roles of H2A.Z in gene
expression
Active promoters are generally defined as having an open promoter conformation,
defined by "available" regulatory sites (TSS, RE, or enhancers). This availability is
achieved by the epigenetic signature that is present at these promoters: highly acetylated
histone tails, and the presence of H3K4me3, H3.3 and H2A.Z in nucleosomes
surrounding the TSS (Azuara et al., 2006; Barski et al., 2007; Dreijerink et al., 2006; Fu
25
et al., 2008; Guenther et al., 2007; Jin et al., 2009; Lupien et al., 2008; Mikkelsen et al.,
2007; Schones et al., 2008; Sharov and Ko, 2007; Zhang et al., 2005b; Zhou et al., 2010).
First, transcriptionally active areas of chromatin are generally known to be
hyperacetylated and enriched in H3K4 methylation (Mellor, 2005; Zhou et al., 2010).
Interestingly, several coactivators of transcription are actually HAT-containing
complexes that effect transcription, and transcriptional activators have been shown to
interact with and recruit chromatin remodelling complexes to promoters, inducing either
the displacement or modification of nucleosomes (Szutorisz et al., 2005). For example,
the p300/CBP complex is a coactivator of transcription that interacts with the basal
transcriptional machinery and several known transcription factors (Kalkhoven, 2004), yet
also contains HAT activity that targets K12 and K15 of H2B, K14 and K18 of H3 and K5
and K8 of H4 (Schiltz et al., 1999). Notably, the p300/CBP complex colocalises with
H3K4 methylation, and specific methylation of H3K4 has rapidly become one of the
most recognised determinants of gene activity (Azuara et al., 2006; Barski et al., 2007;
Dreijerink et al., 2006; Fu et al., 2008; Guenther et al., 2007; Jin et al., 2009; Lupien et
al., 2008; Mikkelsen et al., 2007; Schones et al., 2008; Sharov and Ko, 2007; Zhang et al.,
2005b; Zhou et al., 2010). More specifically, active promoters are defined by H3K4me3
in mammalian cells, where enhancers exhibit H3K4mel/2, H3K27ac and p300/CBP
(Azuara et al., 2006; Barski et al., 2007; Dreijerink et al., 2006; Fu et al., 2008; Guenther
et al., 2007; Jin et al., 2009; Lupien et al., 2008; Mikkelsen et al., 2007; Schones et al.,
2008; Sharov and Ko, 2007; Zhang et al., 2005b; Zhou et al., 2010). In addition to these
histone modifications, the histone variant H2A.Z has generally been shown to be very
important in transcriptional regulation, and several lines of evidence suggest its
incorporation in chromatin promotes an active state.
Genome-wide analyses in yeast shed new light on the positioning of H2A.Z and its role
in gene activation in this model system. H2A.Z was mainly present at the 5' ends of
genes genome-wide, in the promoter regions in the nucleosomes that border the
26
nucleosome-free region around the TSS (Guillemette et al., 2005; Li et al., 2005; Millar
et al., 2006; Raisner et al., 2005; Segal et al., 2006; Zhang et al., 2005a), as well as
several replication origins (Dhillon et al., 2006; Guillemette et al., 2005). Early studies in
yeast aimed to clarify the role of H2A.Z in promoting transcriptional activity, showing
that H2A.Z is present in chromatin at the PH05, GAL1, and PUR5 promoters in
uninduced conditions, and its presence negatively correlates with the activation state of
these genes (Adam et al., 2001; Larochelle and Gaudreau, 2003; Santisteban et al., 2000).
Although seemingly counterintuitive, the theory that arose from these studies was that
H2A.Z is important in the poising of promoters for gene activation, because the htzl
knockout strain exhibits defects in the transcriptional activation of these genes (Adam et
al., 2001; Larochelle and Gaudreau, 2003; Santisteban et al., 2000), as well as the cellcycle-regulated genes CLN5 and CLB2 (Dhillon et al., 2006). An inverse correlation
between H2A.Z presence and gene transcription was found in the majority of these
studies (Guillemette et al., 2005; Li et al., 2005; Millar et al., 2006; Zhang et al., 2005a)
and in follow-up studies that verified H2A.Z presence during specific gene induction
(Zanton and Pugh, 2006), drawing a parallel with results previously seen in model gene
expression analyses. The prevailing inference of these studies is that H2A.Z presence at
the specific locations in promoters could create a transcriptionally poised state in yeast
cells.
The majority of the genomic analyses of H2A.Z in metazoan cells have shown the
association of H2A.Z with active or poised promoters. H2A.Z was first associated with
transcriptionally active areas of the nuclei in T. thermophila and Drosophila (Allis et al.,
1980; Leach et al., 2000; Stargell et al., 1993). H2A.Z is associated genome-wide in
Caenorhabditis elegans, Drosophila, and human cells with promoters that have wellpositioned nucleosomes that exhibit low occupancy close to the TSS and a wellestablished "nucleosome-free region", shown by ChlP-chip and ChlP-seq (Mavrich et al.,
2008b; Schones et al., 2008; Tirosh and Barkai, 2008; Whittle et al., 2008). The
"nucleosome-free region" of active promoters originally proposed in yeast suggests that
27
two well-positioned nucleosomes around the TSS in genes are occupied by H2A.Z
(Guillemette et al., 2005; Raisner et al., 2005; Yuan et al., 2005). This model has
recently been contested in metazoan cells by the discovery of highly unstable
H2A.Z/H3.3 nucleosomes (Jin et al., 2009; Le et al., 2010). It seems that the transient
presence of this type of nucleosome at the TSS renders serves to inhibit the occupation of
these areas by more stable nucleosomes (Jin et al., 2009; Le et al., 2010). Thus, the
promoter is available for transcription due to the increased capacity of activators to
remove these types of nucleosomes (Jin et al., 2009; Le et al., 2010). So, it would seem
that although the TSS may appear to be nucleosome-free, it may just be a technical
difficulty in the detection of such transient nucleosomes.
Therefore, it is possible that H2A.Z positions nucleosomes around the TSS and RE,
which are rapidly evicted upon activation. In mammalian euchromatin areas genomewide, H2A.Z can be randomly deposited in transcribed gene areas in the absence of gene
activity, but RNAPII transcriptional activation and elongation results in the preferential
localization of H2A.Z to promoter areas and its depletion within the transcribed gene
(Barski et al., 2007; Hardy et al., 2009). High resolution mononucleosome positioning
assays show that the presence of H2A.Z in the ERa target gene TFF1 stabilizes the
positions of proximal promoter nucleosomes, allowing ideal placement of nucleosomes
for the binding of the transcriptional machinery (Gevry et al., 2009), an idea that was first
brought forward in yeast (Guillemette et al., 2005). Another interesting study has
observed that H2A.Z positioning changes during the progression of mitosis, present at
TSS-proximal nucleosomes when genes are active prior to mitosis and shifting to cover
the TSS to correlate with gene silencing during the mitotic process (Kelly et al., 2010).
The importance of H2A.Z in the development of multicellular organisms could depend on
its role in establishing a specific promoter structure for tissue-specific gene regulation by
defining insulator and enhancer regions. In support of this, a high-resolution analysis of
nucleosome occupancy and composition at a model gene of the class I major
28
histocompatibility complex family in kidney, spleen, and brain tissue from the mouse
revealed that H2A.Z is present at TSS-associated nucleosomes, at different levels in each
tissue (Kotekar et al., 2008). In addition, H2A.Z has been located at distal DNase I
hypersensitive regulatory areas, a characteristic indicative of enhancer regions, and its
presence at these areas correlates with transcriptional activity (Barski et al., 2007; Gevry
et al., 2009; John et al., 2008). ChIP analysis of several glucocorticoid receptor (GR)responsive promoters revealed that H2A.Z was present at GR-responsive sites including
enhancers, with a dramatic exchange occurring following activation of GR by ligand
binding (John et al., 2008). John and colleagues (2008) propose an intriguing model in
which cell-specific positioning of H2A.Z would determine the gene expression program,
a model first introduced by work performed on the p53-dependent positioning of H2A.Z
at the p21WAFl/C!Pl promoter (Gevry et al., 2007). In mammalian cells the regulation
of several gene promoters by context-specific activators p53 and ERa depends on the
p400/Tip60 complex and the deposition of H2A.Z (Chan, 2005; Gevry et al., 2007; Gevry
et al., 2009; Legube et al., 2004). Also, H2A.Z is present at ERa-responsive promoters
and enhancers, and is required for ERa gene regulation in breast cancer cells (Gevry et
al., 2009). Finally, a systematic annotation of different gene regulation states has recently
clarified the specific localization of numerous histone modifications in the human
genome by analyzing the largest data set obtained by ChlP-seq, and associated H2A.Z
with active intergenic regions, which include enhancers (Barski et al., 2007; Ernst and
Kellis, 2010; Wang et al., 2008). Taken together, H2A.Z positioning in proximal and
distal regulatory elements can contribute to the positive regulation of transcriptional
activity, depending on the cellular context.
1.2.5. Gene silencing and the resolution of poised chromatin states
Repressive mechanisms implicate the higher order folding of DNA achieved by a high
nucleosome density, H3K9me3 and H3K27me3 (Zhou et al., 2010). In addition, the
29
binding of HPl (heterochromatic protein 1) to H3K9me3 encourages the compaction of
the chromatin fibre (Bannister et al., 2001; Lachner et al., 2001). Also, the incorporation
of the histone variant macroH2A into chromatin will often lead to repression of
transcription (Angelov et al., 2003).
The establishment of the H3K27me3 repressive mark occurs through polycomb-mediated
repression. The polycomb repressive complex-2 (PRC2) binds nucleosomes and trimethylates H3K27 through the enzymatic activity of HMT enhancer of zeste 2 (EZH2),
leads to the recruitment of PRC1 and silencing of target genes (Figure 1-5; (Cao and
Zhang, 2004; Czermin et al., 2002; Egli et al., 2008; Kuzmichev et al., 2002; Muller et
al., 2002; Niessen et al., 2009)). Interestingly, the binding of PRC1 alone inhibits ATPdependent nucleosome remodelling on chromatin templates in vitro (Shao et al., 1999).
The activity of PRC2 is defined by EZH2, whose activity and affinity for its substrate is
dependent on the PRC2 subunit Su(z)-12 (Niessen et al., 2009). However, the activity
and affinity of EZH2 for its substrate can be inhibited by the post-translational
phosphorylation of serine 21 by the PI3K/Akt (phosphatidyl-inositol 3 kinase/Akt)
pathway (Figure 1-5) (Niessen et al., 2009).
Originally associated only with heterochromatin, it is now known that H3K27me3 also
maps to the poised but silent promoters of many developmentally important genes in
euchromatic regions (Agger et al., 2007; Cao and Zhang, 2004; Lan et al., 2007; Muegge
et al., 2008). In particular, the tri-methylation of H3K27 is implicated in mammalian X
chromosome inactivation, germline development, cell-cycle regulation and cancer (Agger
et al., 2007; Cao and Zhang, 2004; Lan et al., 2007) and is a marker of repressed or
inactive chromatin (Craig, 2005; Sims et al., 2003). PRC-mediated repression leads to
the formation of a repressive 3D chromatin structure at the GATA4 gene (Tiwari et al.,
2008). Also, EZH2-dependent chromatin looping controls the transcription of the INK4a
and INK4b loci during human progenitor cell differentiation and cellular senescence
(Kheradmand Kia et al., 2009). Of note, recent studies have closely linked the increase in
30
the expression of JMJD3 with the removal of H3K27me3 and subsequent activation of
INK4a (Agger et al., 2009; Barradas et al., 2009). The KDMs JMJD3 and UTX of the
KDM6 family contain a well-conserved JmjC domain in their C-terminal regions which
catalyzes the transition of H3K27me3 and H3K27me2 to H3K27mel, changing the
chromatin state from a repressive to an active conformation during developmental
processes (Agger et al., 2007; De Santa et al., 2007; Swigut and Wysocka, 2007; Xiang et
al., 2007). In summary, repressive chromatin structure at promoters is defined by the
presence of certain histone modifications, namely H3K27me3, but can be altered to
permit transcriptional activation by the loss of H3K27me3 (Tiwari et al., 2008).
Interestingly, H3K27me3 colocalises with H3K4me3 at the promoters and H3K4mel at
the enhancers of silent developmental^ related genes in mouse embryos (Figure 1-5)
(Azuara et al., 2006; Bernstein et al., 2006; Ku et al., 2008; Mikkelsen et al., 2007;
Muegge et al., 2008).
These so-called "bivalent", or poised, genes may vary in
composition but are generally characterised by the concomitant presence of H3K27me3,
H3K4me3 and RNAPII at promoters, which is anchored to the promoter region by PRC1mediated ubiquitination of H2A by subunits RING 1A and RING IB (H2AK119ubl)
(Figure 1-5) (Stock et al., 2007). The resolution of promoter bivalency rests in the
decision between the H3K27me3 and H3K4me3 epigenetic marks and the recent
identification of KDMs clarified the gene regulation patterns in determining cell identity
and gene regulatory decisions. The trithorax group proteins MLL1-3 maintain gene
activity by methylating H3K4, and this complex interacts with UTX (Lee et al., 2007a;
Smith et al., 2008). Conversely, PRC2 interacts with KDM5A (RBP2), a H3K4me2/3
demethylase (Christensen et al., 2007; Pasini et al., 2008).
The interplay between these histone-modifying complexes demonstrates the precise
control of gene regulation by the balance of epigenetic modifications on gene promoters.
The specificity of the recruitment of these complexes remains in the hands of lineagedeterminant transcription factors and coactivators. During the developmental process, the
31
T-box family activator T-bet interacts with an H3K4 methyltransferase complex and
JMJD3, regulating T-bet-dependent target gene expression (Lewis et al., 2007; Miller et
al., 2010; Miller and Weinmann, 2009, 2010).
However, this phenomenon is not
necessarily reserved for developmental processes. For example, the hormone-dependent
nuclear receptor ERa physically interacts with MLL2 during E2-mediated gene
activation, and MLL2 is required for the activation of certain ERa target genes
(Dreijerink et al., 2006; Mo et al., 2006). It is also possible that the role of the MLL
complex at poised promoters is not only to methylate H3K4me3, but to recruit HATs
(Pasini et al., 2008; Pasini et al., 2010; Tie et al., 2009).
Recently a lot of attention has been placed on H3K27ac, which has been shown to define
enhancer regions (Creyghton et al., 2010; Gatta and Mantovani, 2010; Pasini et al., 2010;
Rada-Iglesias et al., 2010; Schwartz et al., 2010; Tie et al., 2009). In human embryonic
stem cells (hESCs), H3K27me3 and H3K27ac are inversely correlated at enhancer
regions, where H3K27me3 defines poised enhancers, and H3K27ac are predictive of
active enhancers (Creyghton et al., 2010; Rada-Iglesias et al., 2010). The loss of PRC2
and H3K27me3 in Drosophila and mouse cells increases p300/CBP-mediated H3K27
acetylation genome-wide, suggesting that while H3K27me3 antagonises this acetylation,
H3K27ac replaces the methyl mark during gene activation (Pasini et al., 2010; Tie et al.,
2009). These studies also put forward that these two histone modifications present a
greater predictive potential for gene activity than H3K4 methylation status. Therefore,
the coordinated control of antagonising epigenetic marks H3K4mel/H3K27ac and
H3K27me3 via the recruitment of histone modifying complexes by transcription factors
significantly affects gene expression in processes such as development, cell cycle
regulation and other hormone stimulated gene activities.
32
Poised promoters
PRC2
PRC1
PHC
„
H3K27m.2 -«. H3IC27lT»3
+
_ | ^ ^
H3K27m.3
w
repression
HMKmUM
Derepression
AKT
H3K27me2 - * H3K27me3 H3K27me2 - X » H3K27me3
OR
41 Mettiyfgroups
•
Ac«y< groups
Figure 1-5 : Polycomb-mediated repression and model of cell fate decision on poised
promoters
Poised promoters are defined by the concomitant presence of H3K4me3, H3K27me3,
RNAPII and H2AK119Ubl. Derepression can occur through the phosphorylation of
EZH2 by the PI3K/Akt pathway or by the demethylation of H3K27me3 by JmjC-domain
containing KDMs (JMJD3 or UTX). Adapted from (Pasini et al., 2008) and (Niessen et
al., 2009).
33
1.3.
Nuclear receptor mediated transcription
Hormone-dependent transcription is one of the most commonly used types of gene
regulation systems in multicellular organisms, dependent on the activity of nuclear
receptors (NR), a super family of ligand-dependent transcription factors. NR structure is
generalised across the large family, each domain having a specific function (Figure
1-6A). The A/B domain, or the N-terminal regulatory domain, contains the ligandindependent activation function 1 (AF-1), responsible for basal transcriptional activation.
The C domain contains the DNA-binding domain (DBD). The D domain is defined by
the hinge region, a flexible region that connects the DBD and LBD of the E/F domain.
The E/F also contains dimerisation region and the ligand-dependent activation function 2
(AF-2), which synergises with AF-1 for hormone-dependent gene activation (Kumar and
Thompson, 1999).
NRs are defined as transcription factors that bind to regulatory elements on DNA to act as
activators of transcription by recruiting coregulatory complexes to the promoter and
enhancer elements of hormone-responsive genes (Mangelsdorf et al., 1995). There are
different subfamilies of NR, often associated with a different mechanism of action: Type
I (steroid receptors), which dimerise and translocate to the nucleus upon ligand binding to
bind hormone response elements (HRE) and induce transcription; Type II (retinoid X
receptor (RXR) heterodimers), which are located in the nucleus and complexed with
corepressors prior to ligand binding; Type III (dimeric orphan receptors), the orphan
receptors whom have unknown ligands and bind inverted repeat HREs, but otherwise act
similarly to Type I; and Type IV (monomeric orphan receptors), which are known to bind
DNA as either monomers or dimers (Mangelsdorf et al., 1995). In general, once bound
by their ligand, NR undergo a conformational change that leads to either DNA binding
(Type I) or release of corepressors (Type II) (Biddie et al., 2010). The different types of
NR can be further divided into 6 subfamilies according to their sequence homologies:
34
Thyroid hormone receptor-1 ike; RXR-like; ER-like; Nerve Growth Factor IB-like;
Steroidogenic Factor-like; Germ Cell Nuclear Factor-like; and miscellaneous (Nuclear
Receptor Nomenclature Committee, 1999; Germain et al., 2006).
Of the NR subfamilies, the ER-like NR are of particular interest since estrogen (E2)dependent physiological processes regulate many key pathways in growth and
development of the reproductive tract, cardiovascular system and central nervous system
in females (Katzenellenbogen, 1996). As a result, modulation of E2 signaling has
varying effects in females, possibly leading to pathophysiologies such as breast cancer
(Anderson, 2002). Although all of the NR in the ER-like subfamily respond to E2
stimulation, the most studied actions of E2 are those accomplished through its diffusion
through the cell membrane and binding to its receptors ERa and ERp (Green et al., 1986;
Greene et al., 1986; Kumar et al., 1987). ERa and ERp are structurally very similar and
bind with comparable affinity to their ligands, leading to the formation of homodimers,
and less frequently ERa/ERp heterodimers (Cowley et al., 1997; Kuiper et al., 1997).
The greatest differences between the two receptors lie in the resulting physiological
responses of their actions, illustrated by the opposing phenotypes in mouse knockout
studies (Krege et al., 1998). ERa is responsable for the E2-dependent proliferative
effects in the development of the reproductive tract and mammary gland. However, ERp
knockout mice demonstrate hyperplasia, and the overexpression of ERp in breast and
colon cancer cells inhibits cancer cell proliferation and tumor formation in mouse
xenograft models, suggesting that ERp inhibits cellular proliferation (Hartman et al.,
2006; Hartman et al., 2009; Paruthiyil et al., 2004; Strom et al., 2004). These opposing
physiological responses in certain tissues suggest different gene targets of the receptors in
response to E2 stimulation, and the tissue-specific response may depend on the balance of
ERa/ERP in the cell (Fox et al., 2008; Pearce and Jordan, 2004). Thus, an increase in the
ERa response and/or expression of its target genes leads to the uncontrolled proliferation
observed in many different types of breast cancer cell lines.
35
A)
FUNCTIONS
A
D
NH2'
B)
Ligand binding
Dimerisation
Activation domain AF2
Activation DNA binding
domain AF1 Dimerisation
ERE:
E/F
-COOH
- * spacer •*-
AGGTCA (N)3 TGACCT
C)
Figure 1-6 : NR structure and different pathways of gene regulation by ERa
A) Nuclear receptor structure is conserved throughout the whole superfamily, defined by
the A/B N-terminal domain, the DBD domain in C, the hinge domain in D, and the LBD,
dimerisation and AF-2 domain present in E/F. (B) The consensus sequence upon which
ERs bind. (C) E2 stimulation leads to 3 different ERa-related outcomes: (1) the classical
genomic pathway where ERa binds to ERE; (2) the non-classical pathways genomic
pathway where ERa interacts with other transcription factors (TF) bound to their binding
site (TFBS); or (3) the non-classical non-genomic pathway in which membrane-bound
ERa activates protein kinase signaling cascades. Adapted from (Bjornstrom and Sjoberg,
2005; Kumar and Thompson, 1999, Ruff et al., 2000).
36
1.3.1. ERa-regulated gene expression
The exposure of an ERa-positive cell to E2 results in the modification of ERa-dependent
gene regulation. ERa is an activator that affects many different pathways in mammalian
cells in ways that are typical of a ligand-dependent activator by the classical genomic
pathway. However, ERa can act on gene expression by various indirect mechanisms
through what is known as the non-classical pathway (both genomic and non-genomic;
Figure 1-6) (Welboren et al., 2009).
1.3.1.1. The ERa genomic pathway
In the classical genomic pathway, E2 binding to the LBD leads to dimerisation and
association of the receptor to the palindromic ERE (Figure 1-6; (Ruff et al., 2000;
Welboren et al., 2009)). More specifically, to promote transcriptional activity, ligand
binding leads to a conformational change in the ERa E/F region allowing the association
with EREs in promoter or enhancer regions and the formation of an AF-2 coactivator
binding site (Bjornstrom and Sjoberg, 2005). The binding of an antagonist (for example,
tamoxifen or fulvestrant) to ERa disrupts the AF-2 region and does not permit coactivator
recruitment, although DNA-binding is not necessarily compromised (Brzozowski et al.,
1997; Pike et al., 2000a; Pike et al., 2000b). Coactivator recruitment occurs through
direct interaction of the receptor with an LXXLL motif present in the coactivator, and
known coactivors include the steroid receptor coactivator 1 (SRC-1), SRC-2 and SRC-3
(also known as amplified in breast cancer 1 (AIB-1)) (Pearce and Jordan, 2004).
Coactivator function is essential in ERa-mediated gene regulation at proximal and distal
regulatory elements. Recuitment dynamics at ERa model gene trefoil factor 1 (TFF1)
revealed the timely deposition of cofactors in cycles, such as CRCs (CBP/p300,
37
p400/Tip60, Swi/Snf), and members of the PIC, RNAPII, TBP, and TFI1B (Gevry et al.,
2009; Metivier et al., 2003; Shang et al., 2000) during the activation cycle.
The
activation cycle of this gene was notably controlled in part by the p400-dependent
deposition of H2A.Z in promoter-proximal areas and the subsequent stabilization of
proximal nucleosomes (Gevry et al., 2009). Genome-wide, H2A.Z colocalizes to ERabinding sites, supporting the observations at TFF1 (Gevry et al., 2009).
The
transcriptional regulation of an important majority of ERa-regulated genes is dependent
on the binding of the transcription factor FoxAl, thought to be a pioneer factor by
contributing to the recruitment of ERa and gene regulation (Carroll et al., 2005; Joseph et
al., 2010).
However, the p400-dependent deposition of H2A.Z is essential in the
recruitment of FoxAl to ERa-responsive enhancers, whereas the depletion of FoxAl did
not affect the targeting of H2A.Z to chromatin (Gevry et al., 2009).
The creation of a more permissive chromatin structure at ERa target genes is also
achieved by the interaction of ERa with multiple histone modifying complexes during
gene activation. Components of the SWI/SNF complex Brahma (BRM) and Brahma
related gene-1 (BRG-1) are also recruited to ERa target genes upon hormone stimulation,
and serve to create a more open chromatin conformation (Belandia et al., 2002; DiRenzo
et al., 2000; John et al., 2008). Contributing to this open conformation is the acetylation
of histones by the p300/CBP complex, enhancing ERa activity when coupled with pi60
(SRC-3) family binding (Smith et al., 1996). In addition to histone acetylation, ERa
interacts physically with MLL2, a H3K4 methyltransferase, and this interaction is
required for the activation of TFF1, HOXC13 and CTSD (Ansari et al., 2009; Ansari and
Mandal, 2010; Dreijerink et al., 2006; Mo et al., 2006). Interestingly, although ChlP-seq
analysis did not reveal any global decrease in H3K9me3 and H3K27me3 repressive
marks following E2 exposure (Joseph et al., 2010), it is known that the repressive
H3K9me mark is removed by LSD1 at certain loci during ERa-regulated gene expression
(Garcia-Bassets et al., 2007; Perillo et al., 2008). This suggests that ERa-mediated gene
38
expression also requires the activity of KDMs to remove repressive marks, in addition to
its role in promoting an active chromatin marks.
In order to define the genome-wide effects of ERa, binding sites were analyzed genomewide by ChlP-chip, ChlP-seq, and ChlP-PET, revealing that, in addition to it role at
promoter-proximal elements, a large percentage of ERa binding sites are at distal
enhancer regions (Carroll et al., 2005; Carroll et al., 2006; Hurtado et al., 2008; Krum et
al., 2008; Lin et al., 2007a; Lin et al., 2007b; Lupien et al., 2008). Notably, many
predicted EREs are not occupied by ERa in vivo, which suggests the requirement of
external influences on ERa association to DNA (Carroll et al., 2006; Hurtado et al., 2008;
Lin et al., 2007a; Welboren et al., 2009). Recent genome-wide analyses have defined that
the optimum prediction of ER binding at any specific site in MCF7 cells is the pre-ligand
occupancy of H3K4mel/2 and the factor FoxAl, and an open chromatin configuration
defined by activation-related histone marks and RNAPII at the future stie of ER binding
(Joseph et al., 2010; Lupien et al., 2008).
Taken together, large-scale analysis of ERa binding sites have answered many questions,
but may not provide all of the answers on ERa-dependent gene regulation during specific
cellular processes. For example, gene regulation by enhancer elements can include the
formation of chromatin loops, and distal enhancer EREs associate with proximal
promoter regions to enhance gene expression ERa-regulated model genes TFF1 and
GREB1, as well as proliferation-associated genes CCND1 and BCL2 (Engel and
Tanimoto, 2000; Pan et al., 2008; Perillo et al., 2008; Theo Sijtse Palstra, 2009). RNAPII
was also important in the formation of such loops, given that they interact with the
transcription start sites (TSSs) (Fullwood et al., 2009; Pan et al., 2008). However, many
questions remain on what is required to create these loops, and how ERa may participate
in the destruction of repressive loops.
Overall, in the presence of it ligand, ERa
associates genome-wide with EREs present in enhancer and promoter areas, creating a
modified 3D chromatin structure that is permissive to transcription.
39
1.3.1.2. Non-classical ERa pathways
Interestingly, genome-wide expression profiling and binding site analyses have shown
that many ERa-regulated genes do not contain ERE-like sequences (O'Lone et al., 2004).
This can be explained by the use of two non-classical pathways: ERa binding gene
regulatory regions indirectly through its interaction with other transcription factors
(genomic); or membrane-bound ERa can rapidly affect cellular response by activating
protein kinase signaling cascades (non-genomic) (Bjornstrom and Sjoberg, 2005). In the
genomic non-classical pathways, E2 stimulation of genes that do not contain EREs, by
interaction with other transcription factors such as AP-1 and SP1 (Levin, 2005).
Membrane-associated ERa can participate in rapid cellular responses via the activation of
cytoplasmic signaling cascades (Figure 1-6) (Kelly and Levin, 2001; Razandi et al.,
1999).
E2 stimulation rapidly activates the Src-mitogen-activated protein kinase
(MAPK) signaling cascade in breast cancer cells, contributing to proliferation (Song et
al., 2002). In addition, adapter proteins have been shown to link membrane-bound ERa
with Src and stimulate Src-dependent responses (Edwards and Boonyaratanakornkit,
2003). Also, membrane-associated ERa has been associated with phosphotidylinositol-3
kinase (PI3K)/Akt during gene activation (Ahmad et al., 1999; Campbell et al., 2001;
Klotz et al., 2002; Marquez and Pietras, 2001; Martin et al., 2000). The PI3K/Akt
pathway is responsible for the mediation of gene regulation through the eventual
phosphorylation of transcription factors (Castaneda et al., 2010). ERa is known to be
subject to Akt-mediated phosphorylation, which decreases its transcriptional activity,
possibly the result of a negative feedback loop to control E2-dependent responses,
possibly explaining the decrease in binding of ERa genome-wide in the presence of Akt
overexpression (Bhat-Nakshatri et al., 2008; Park et al., 2008; Sun et al., 2001).
Interestingly, the action of PI3K/Akt can increase ERa transcriptional activity in the
absence of E2, suggesting a role in breast cancer development and resistance to therapy
40
(Campbell et al., 2001; Pietras and Marquez-Garban, 2007). The PI3K/Akt pathway is
also closely linked to breast cancer in that it is activated by the epithelial growth factor
receptor (EGFR) family member HER2, whose overexpression in breast cancers leads to
constitutive activation of these pathways (Lehnes et al., 2007; Stoica et al., 2005).
1.3.2. ERa-dependent breast cancer and anti-estrogen resistance
The general definition of a cancerous cell is a cell that has become insensitive to various
signals in cell cycle causing continued, uncontrolled proliferation due to an accumulation
of multiple mutagenic events (Hanahan and Weinberg, 2000). The majority of cancers
are caused by the overexpression or mutation of genes that affect the regulation of the cell
cycle, known as oncogenes or tumour suppressors respectively (Hanahan and Weinberg,
2000). E2 and ERa play a well characterized role in cellular proliferation, so naturally
activation of ERa-regulated pathways in conjunction with other mutations of tumor
suppressors or oncogenes will lead to breast cancer progression. ERa regulates genes
that are important in proliferation and cancer progression: cell cycle entry genes
(CCNDl, E2F target genes), anti-apoptotic genes (BCL2, FasL), and genes involved in
cell migration (TFF1) (Cooper and Foster, 2009; Ding et al., 2006; Ding and Kleer, 2006;
Jones, 2007; Seligson et al., 2005). Also, the modification of ERa coactivators are
typical in breast cancer cells and have shown to be important prognostic factors in the
severity of breast cancers. SRC-3 is a known ERa coactivator that is amplified in breast
cancer, leading to cancer progression and poor prognosis when co-expressed with HER2
(Gojis et al., 2010; Kuang et al., 2004; Osborne et al., 2003). Also, the expression of
histone variant H2A.Z, associated genome-wide with ERa binding, is upregulated by the
E2-mediated binding of the transcription factor Myc in its promoter region, and correlates
with decreased survival in breast cancer patients (Hua et al., 2008).
41
Despite being an important inducer of cellular proliferation, ERa presence in breast
cancers is often prognostic of an increased survival rate (Badve and Nakshatri, 2009), in
part due to the development of antiestrogens (AE), synthetic molecules that compete with
E2 for binding to its ERa, that have proved to be a successful treatment in ERa-positive
breast cancers (Doisneau-Sixou et al., 2003; Normanno et al., 2005). While AE (for
example, tamoxifen (TAM) or fulvestrant (ICI182780) have proven to be beneficial to a
large number of patients, resistance to these drugs is a major problem in the treatment of
breast cancer (Normanno et al., 2005; Riggins et al., 2007). Interestingly, patients can
exhibit resistance in response to the initial treatment, or can develop resistance after
prolonged exposure to AE (Badia et al., 2007). Both types of AE-resistant breast cancers
show a deregulation in their ERa gene expression program, resulting in E2-independent
proliferation (Badia et al., 2007; Naughton et al., 2007; Normanno et al., 2005; Riggins et
al., 2007; Sommer and Fuqua, 2001).
EGFR and HER2 are overexpressed in a wide variety of tumors, leading to the
uncontrolled activation of these receptors (Kumar et al., 1996). In addition, ERft status
and HER2 expression levels are inversely correlated in breast cancer aggressivity, with
HER2 overexpression observed in approximately 30% of breast cancers, mainly those
with poor prognosis and overall survival (Shou et al., 2004). In particular, it has been
found associated with increased metastatic potential and resistance to chemotherapeutic
agents (Shou et al., 2004). Activated HER2 will activate the PI3K/Akt pathway, known
to promote non-classical non-genomic ERa regulated cellular responses (Ahmad et al.,
1999; Lehnes et al., 2007; Stoica et al., 2003a; Stoica et al., 2003b; Stoica et al., 2005).
Of note, the PI3K/Akt pathway is linked to H3K27 methylation by the post-translational
modification of EZH2 (section 1.2.5). Several studies suggest that EZH2 is a promising
prognostic biomarker in breast cancer (Collect et al. 2006; Raaphorst et al. 2003;
Buchmann et al. 2006), showing a strong correlation with a more aggressive ER-negative
breast cancer subtype and breast cancer invasion (Cao et al., 2008; Gonzalez et al., 2009).
However, breast cancer patients with low expression of H3K27me3 had significantly
42
shorter overall survival time when compared with those with high H3K27me3 expression
(Wei et al., 2008).
Also, the H3K27 demethylase JMJD3 has been shown to be
upregulated in hormone-dependent breast cancer (Xiang et al., 2007). The specificity in
the recruitment of HMT and KDM to certain genes and the precise regulation of
transcriptional programs in different cell types may provide an explanation for these
seemingly contradictory findings. All in all, the link between ERa gene regulation,
chromatin remodelling and the development of breast cancer is strong.
Taken together, the deregulation of E2-responsive pathways in ERa-dependent breast
cancer and the acquisition of AE resistance may be due to the accumulation of errors in
ERa classical and non-classical pathways, altering the epigenetic signature of target
genes.
43
1.4.
Research project and objectives
The chromatin environment surrounding gene regulatory areas will significantly
influence target gene expression, and this so-called "epigenetic signature" is orchestrated
by the interplay between cellular response specific transcription factors and coactivators.
It is now widely accepted that the epigenetic state of a cell will significantly influence the
cellular outcome, as well as its transformation potential. ERa is a key regulator of
normal breast development and its pathways are drastically affected in breast cancer. In
addition, many studies have shown the E2-independent activation of these pathways in
the development of AE resistance.
An essential chromatin modification in ERa target gene expression is H2A.Z deposition
(Gevry et al., 2009). Interestingly, several studies have provided evidence that H2A.Z
may be implicated in carcinogenesis. Studies in yeast have shown that the double
mutation of H2A.Z and genes involved in replication and S phase checkpoint control
confers severe growth defects in these strains and the simple deletion of H2A.Z renders
yeast cells hypersensitive to cell cycle arrest, leading to a delay in the start of the cell
cycle (Dhillon et al., 2006). In addition, specific knockdown of H2A.Z expression in
p53-dependent breast cancer cells promotes an increase in p21WAFl/CIPl expression,
thus the controlled cell cycle arrest by cellular senescence, suggesting an inhibitory role
of H2A.Z in cell-cycle arrest (Gevry et al., 2007). The p21 and pl6 proteins are cell-cycle
inhibitors that, through their capacity to bind and inactivate several cyclin-CdK
complexes, will stop progression through to the next phase of the cell cycle, typically in
Gl (Zhang, 2007). Chan et al. (2005) revealed that the p400 subunit of the p400/Tip60
complex negatively affects the induction of the senescence pathway by decreasing
p21WAFl/CIPl expression via its localization at p53 binding sites in the p21WAFl/CIPl
promoter (Chan, 2005). The precise deposition of H2A.Z at the distal p53-binding site by
the p400 complex accounts for the adverse effects of p400 on the senescence response
44
explained by Chan et al. (Chan, 2005; Gevry et al., 2007). This repressive characteristic
of H2A.Z presence in chromatin is contrary to many findings concerning the histone
variant, yet demonstrates that the specific location of H2A.Z in gene regulatory regions
yields different effects. Of note, the overexpression of H2A.Z has been observed in
colorectal cancers, undifferentiated cancers, and breast metastatic cancer cells, but not in
normal cells (Dunican et al., 2002; Hua et al., 2008; Rhodes et al., 2004; Zucchi et al.,
2004).
We thus hypothesized that the histone variant H2A.Z interacts with proteins at the
chromatin level in order to promote cellular proliferation and transcriptional
activation in mammalian cells, and the deregulation of the expression of H2A.Z
could lead to possible oncogenic effects in the cell. Our hypotheses are outlined in the
second chapter of this thesis, in a published review manuscript entitled "Regulation of
gene expression and cellular proliferation by histone H2A.Z" (Svotelis et al., 2009).
We aimed to verify if the exogenous overexpression of H2A.Z in breast cancer ceils
would promote increased proliferation. The second manuscript presented in this thesis in
Chapter III is entitled "H2A.Z overexpression promotes cellular proliferation of
breast cancer cells". This published manuscript presents our observations on the link
between ERa and H2A.Z, as well as the possible role of H2A.Z in promoting E2independent proliferation (Svotelis et al., 2010).
We first show by ChIP that E2-
dependent increased expression of H2A.Z is partly due to the binding of ERa to the
H2A.Z promoter. In addition, we observe by immunohistochemistry a correlation between
H2A.Z and ERa levels in low grade breast cancer. Using proliferation assays we also
show that the exogenous overexpression of H2A.Z in the MCF7 breast cancer cell line
leads to increased proliferation in low levels of E2 and in the presence of TAM.
E2-independent proliferation is a phenomenon also observed in AE resistant cells.
Considering the interesting link between ERa, PRC and trxG-related chromatin
modifiers, and the influence of HER2/PI3K/Akt on PRC-mediated repression, we
45
hypothesized that ERa-mcdiated transcription in normal and AE-resistant breast
cancer implicates the modification of H3K27 methylation status. The results of our
investigation into the role of chromatin modifications on ERa target gene expression in
breast cancer progression are presented in Chapter IV, entitled "The control of H3K27
methylation status affects the apoptotic program in hormone-dependent breast
cancer and anti-estrogen resistance". This manuscript is under revision in EMBO
Journal. Using cell cycle analysis, RT-qPCR, and ChIP techniques, we present results
that support a model in which a repressive chromatin state following stimulation by E2 in
ERa-dependent cancerous cells caused by H3K27 methylation is permissive for the
regulation of BCL2 transcription by a mechanism that comprises the interdependent
recruitment of ERa and JMJD3. However, the phosphorylation of EZH2 caused by the
overexpression of HER2 in AE-resistant breast cancer cells prevents the methylation of
H3K27 surrounding the enhancer region of BCL2, allowing the formation of an active
chromatin conformation and constitutive activation of BCL2.
46
CHAPTER II
II. REGULATION OF GENE EXPRESSION AND CELLULAR PROLIFERATION BY HISTONE
H2A.Z
II.1.
Preamble
In early H2A.Z research, several avenues were explored concerning its role in the yeast
model system.
These studies shed light on its role in transcriptional activation,
heterchromatin formation, and genome stability, and also determined that the Swrl
complex regulated the specific deposition of H2A.Z in chromatin. First, it was important
to identify the complex that deposited H2A.Z in chromatin. The p400/Tip60 complex
was the most likely candidate in mammalian cells. The p400/Tip60 complex has been
associated with several important transcription factors involved the control of cell
proliferation, such as E2F1, p53, and Myc (Chan, 2005; Kim et al., 2005; Nagl et al.,
2007; Samuelson et al., 2005; Taubert et al., 2004). Tip60 has been shown to participate
in the activation of pHWAFl/CIPl expression (Berns et al., 2004; Legube et al., 2004;
Tyteca et al., 2006a). The p21 WAF1/CIP1 gene is known to be silenced in several types
of cancer by the adoption of a generally repressive chromatin state of the promoter region
(Fang and Lu, 2002; Shin et al., 2000). An intriguing study had shown that the depletion
of p400 leads to the p53-dependent senescence response by increasing p21 WAF1/CIP1
expression in primary human fibroblasts (Chan, 2005).
47
The connection between p400, H2A.Z, and cellular senescence was clarified (Gevry et
al., 2007), but questions remained on the interplay between Tip60 and p400 and the role
of H2A.Z in cellular proliferation and carcinogenesis. In light of the role of H2A.Z in the
development and proliferation of cells in many mammalian systems, a review of the
literature along with related hypotheses is presented in this manuscript, published in
Biochemistry and Cell Biology in January 2009. I wrote the review and contributed to
the conception of the figure presented, aided by discussions and corrections from Drs.
Nicolas Gevry and Luc Gaudreau, and Dr. Benoit Leblanc for the creation of the artwork.
48
11.2.
Manuscript
Regulation of gene expression and cellular proliferation by histone H2A.Z
Amy Svotelis, Nicolas Gevry, and Luc Gaudreau
Departement de biologie, Faculte des Sciences, Universite de Sherbrooke, Sherbrooke,
Quebec, Canada
Address correspondence to: Luc Gaudreau, Departement de biologie, Faculte des
Sciences, Universite de Sherbrooke, Sherbrooke, Quebec, Canada, JIK 2R1 Tel: 819821-8000 ext. 62081; Fax: 819-821-8049; E-Mail: [email protected]
Svotelis, A., Gevry, N., and Gaudreau, L. (2009). Regulation of gene expression and
cellular proliferation by histone H2A.Z. Biochem Cell Biol 87, 179-188.
49
Abstract
The mammalian genome is organized into a structure of DNA and proteins known
as chromatin.
In general, chromatin presents a barrier to gene expression which is
regulated by several pathways, namely by the incorporation of histone variants into the
nucleosome.
In yeast, H2A.Z is a H2A histone variant that is incorporated into
nucleosomes as a H2A.Z/H2B dimer by the Swrl complex and by the SRCAP and
p400/Tip60 complexes in mammalian cells. H2A.Z has been associated with the poising
of genes for transcriptional activation in the yeast model system, and is essential for
development in higher eukaryotes. Recent studies in our laboratory have demonstrated a
p400-dependent deposition of H2A.Z at the promoter of p21mFI/CIPi',
a consequence that
prevents the activation of the gene by p53, therefore inhibiting p53-dependent replicative
senescence, a form of cell cycle arrest crucial in the prevention of carcinogenic
transformation of cells. Moreover, H2A.Z is overexpressed in several different types of
cancers and its overexpression has been associated functionally with the proliferation
state of cells. Therefore, we suggest that H2A.Z is an important regulator of gene
expression, and its deregulation may lead to the increased proliferation of mammalian
cells.
Key words: Chromatin, histone variant H2A.Z, transcription, gene expression, cancer
50
Resume
L'ensemble des genes du genome est organise dans une structure d'ADN et de proteines
nomme la chromatine. La chromatine presente une barriere a I'acces aux genes pendant
l'expression genique.
L'incorporation des variants d'histone dans les nucleosomes,
notamment le variant H2A.Z, joue un role important dans l'activation et la repression des
genes. H2A.Z est incorpore a la chromatine via le complexe Swrl chez la levure et via les
complexes SRCAP et p400/Tip60 chez les mammiferes. Ce variant a ete associe avec la
preparation des promoteurs pour l'activation des genes et la proliferation cellulaire chez
la levure. De plus, il est essentiel dans le developpement des eukaryotes superieurs. Des
etudes dans notre laboratoire ont demontre que 1'incorporation de H2A.Z au promoteur
de p21WAFI/cwl
est effectuee par le complexe p400/Tip60, et que cette incorporation est
importante dans la regulation de la transcription d e / ^ / ^ ' ^ ^ d e p e n d a n t e de p53. Cette
regulation de p21WAF,/apl
par la presence de H2A.Z interfere avec la senescence
replicative induit par p53. De plus, la surexpression de H2A.Z est observee dans
plusieurs types de cancer. Le variant d'histone H2A.Z aurait done un role important non
seulement dans l'expression genique, mais aussi dans la progression du cycle cellulaire.
51
Introduction
The organization of DNA into chromatin is separated into several levels and the
first level of chromatin organization is defined by the nucleosome. Additional levels of
DNA packaging exist in order to organize the genetic information more efficiently and to
preserve the DNA during cell division (Polo and Almouzni, 2006).
Changes in
nucleosomal structure, composition and positioning are critical in facilitating DNA
replication and transcription control (Lusser and Kadonaga, 2003). There are three
known ways in which the eukaryotic cell overcomes the chromatin barrier: chromatin
remodeling by ATP-dependent "chromatin remodeling complexes", post-translational
modification of the histones, and incorporation of histone variants into the nucleosome.
Each of these mechanisms is crucial for proper cellular function and the equilibrium
between these mechanisms is essential for proper gene regulation. The
specific
incorporation of histone variants into nucleosomes conveys a special characteristic to the
chromatin fiber, and one of the most characterized histone variants to date is the H2A
variant H2A.Z.
Histone H2A.Z biology
The existence of variants of H2A was determined in mammalian cells first in a
study that demonstrated two as yet unidentified forms of H2A via gel and peptide
analysis (West and Bonner, 1980). H2A is the major form of histone H2A proteins in
cells, with the variants H2A.X and H2A.Z constituting a minor fraction of total H2A in S
phase(Wu and Bonner, 1981). Following its identification in several organisms, it was
found that H2A.Z is significantly more conserved across species (90% sequence identity)
than H2A (Iouzalen et al., 1996; Jiang et al., 1998). A noteworthy analysis of H2A.Zcontaining nucleosomes by Suto and colleagues demonstrated the subtle yet important
changes of between H2A and H2A.Z chromatin (Suto et al., 2000). Despite a homology
of only 60% between the primary protein structures of H2A.Z and H2A, crystal structure
analysis of reconstituted nucleosomes containing mouse H2A.Z demonstrated only a few
major differences from those of H2A. The LI loop, the region responsible for interaction
52
between H2A proteins in the nucleosome, differs slightly between H2A and H2A.Z,
creating a steric hindrance between H2A/H2B and H2A.Z/H2B dimers, which would
seemingly lead to nucleosomes that contain either H2A.Z or H2A in metazoan cells (Suto
et al., 2000). However, the yeast nucleosome core particle differs from its metazoan
counterpart, notably in the LI loop region of H2A where significant amino acid
differences in Saccharomyces cerevisiae H2A lead to a decreased interaction between the
two H2A-H2B dimers (White et al., 2001), creating therefore less possibility of a clash
between H2A-H2B and H2A.Z-H2B dimers in the same nucleosome. Also of important
note, the C-terminus of H2A.Z creates an extended uninterrupted acidic patch with its
interaction with H2B on the surface of the nucleosome as compared to the H2Acontaining nucleosomes (Suto et al., 2000). This extended acidic patch is important in
the highly folded nucleosomal arrays created by the cooperation of H2A.Z and HPla, a
heterochromatic protein, seeing as a mutant H2A.Z carrying equivalent H2A residues that
disrupt the patch are similar to H2A arrays (Fan et al., 2004). The extension of the acidic
patch in the C-terminal region could also suggest the possibility of an essential area of
protein interaction by which H2A.Z could recruit factors important in gene transcription,
explaining its unique role as compared to H2A.
Many unresolved issues remain
concerning the particularities of the stability of the H2A.Z-containing nucleosome
particle, which is eloquently discussed elsewhere (Zlatanova and Thakar, 2008).
H2A.Z is an essential gene that provides a function distinct from that of H2A in
several model organisms. In Saccharomyces cerevisiae and Saccharomyces pombe, the
deletion of htzl, the yeast H2A.Z-encoding gene, is not lethal but leads to multiple
phenotypes including transcriptional defects and increased chromosome loss (Adam et
al., 2001; Carr et al., 1994; Jackson and Gorovsky, 2000; Krogan et al., 2004; Larochelle
and Gaudreau, 2003; Santisteban et al., 2000). H2A.Z is essential for viability in
metazoan models, such as Tetrahemena thermophila, Xenopus laevis, Drosophila
melanogaster and Mus musculus (Faast et al., 2001; Iouzalen et al., 1996; Liu et al.,
1996b; van Daal et al., 1988). Early complementation assays in both yeast and metazoan
cells illustrate the importance of H2A.Z and its distinct role in the cell. The lethal
53
phenotype of H2A.Z knockout embryos can be rescued in Drosophila by the injection of
H2A.Z in early larval stages (van Daal et al., 1988). However, the overexpression of
H2A.Z in the H2A yeast gene knockout strains (Ahtal/Ahta2) could not rescue the lethal
phenotype associated with this strain, and the overexpression of either H2A genes could
not rescue the Ahtzl phenotypes (Jackson and Gorovsky, 2000; Santisteban et al., 2000).
Moreover, a chimeric construct of H2A.Z with the C-terminal region of H2A introduced
into Drosophila embryos lacking the wild-type histone variant leads to lethality, or major
developmental defects (Clarkson et al., 1999).
Other areas of H2A.Z seem
interchangeable with those in H2A, which suggests that crucial differences between these
two histones lies within the C-terminal region (Clarkson et al., 1999). Also, replacement
of the C-terminus of H2A.Z with the equivalent region in H2A could not rescue the Ahtzl
phenotype while a fusion of the H2A.Z C-terminus with H2A lacking its C-terminus
restored wild type function (Adam et al., 2001). David Tremethick's group was the first
to employ the now widely used RNAi technology to decrease H2A.Z expression,
showing that H2A.Z is important for chromosome segregation and mitosis (Rangasamy et
al., 2003). Taken together, it has become increasingly clear that H2A.Z possesses unique
functions distinct from canonical H2A, and that is involved in important cellular
functions.
Post-translational modifications ofH2A.Z
Another major way to modify chromatin is the post-translational modification of histones
in the nucleosome core particle.
Many histone modifications have now become
"classical", such as the methylation of H3K4, a proven mark of active promoters, and the
methylation of H3K9, a marker for transcriptionally silent genes (Kouzarides, 2007). The
integration of acetate and phosphate in peptides derived from H2A.Z and the importance
of the lysine residues of the N-terminus in the model organism T. thermophila provided
early indications of acetylation and phosphorylation (Allis et al., 1980; Ren and
Gorovsky, 2001). Recently it has been demonstrated that H2A.Z is multiply acetylated
on its N-terminal tail in yeast by the NuA4 and SAGA histone acetyltransferase
54
complexes (Babiarz et al., 2006; Keogh et al., 2006; Millar et al., 2006). Mutation of the
residues that were found to be acetylated resulted in defects in growth, chromosome
transmission and H2A.Z deposition in chromatin.
Also, studies in chicken cells
demonstrated by ChIP that the acetylated form of H2A.Z was present at the 5' end of
active gene loci as compared to the non-acetylated form (Bruce et al., 2005). Previous
studies demonstrated the inability of H2A.Z nucleosomes to participate in
internucleosomal interactions due to a decrease in the oligomerisation of N-terminal tails,
characteristic of acetylated N-terminal tails, impeding the formation of highly condensed
chromatin (Fan et al., 2002). Taken together, these studies show that the acetylation of
H2A.Z is necessary in the maintenance of genome integrity and heterochromatin
boundaries, possibly playing a role in gene activation.
There have been some indications in the mammalian system that H2A.Z can be
ubiquitylated, a modification that can both be involved in cell signalling and in
degradation of the protein marked by this modification (Mukhopadhyay and Riezman,
2007). The first indication appeared when the study of cardiac myocytes in the mouse
showed that Sir2-dependent deacetylation of H2A.Z led to the degradation of H2A.Z via
the ubiquitin-proteasome pathway (Chen et al., 2006). This effect was lost when the
lysines 15, 115 and 121 were mutated into non-acetable, non-ubiquitylable residues. This
study did not demonstrate the direct ubiquitylation of H2A.Z, while a more recent study
using mouse and human cell lines identified a slower migrating form of H2A.Z on gel
electrophoresis and immuno-blotting assay, which corresponds to the weight of a monoubiquitylated H2A.Z protein (Sarcinella et al., 2007). This theory was confirmed when
the authors cotransfected HA-tagged ubiquitin into cells and detected the presence of the
tag in the slower migrating H2A.Z band, and mutation analysis showed that both K120
and K121 are ubiquitylated. Furthermore, immunoflourescence analysis of H2A.Z and
mutant forms localised monoubiquitylated H2A.Z to the inactive X chromosome in
female cells (Sarcinella et al., 2007), suggesting that this modification could direct
H2A.Z to specific chromatin environments.
55
Deposition ofH2A.Z within chromatin
A very unique feature of H2A.Z is that it is incorporated within chromatin as an
H2A.Z-H2B dimer by the Swrl .com complex in yeast, named after the catalytic subunit
Swrl, a member of the Swi2/Snf2 family of ATPases. Unlike H2A, H2A.Z is deposited
into chromatin in a replication-independent manner. In yeast cells, in addition to the
copurification
of
H2A.Z
and
Swrl
and
Swrl.com
components,
chromatin
immunoprecipitation assays in yeast strains lacking swrl or other components of the
complex showed a decrease in the presence of H2A.Z in euchromatin that borders
silenced areas of chromatin (Kobor et al., 2004; Krogan et al., 2003). The role of
Swrl .com in the catalysis of the transfer of H2A/H2B dimers for H2A.Z/H2B dimers was
confirmed in vitro using an exchange assay with reconstituted nucleosomes in the
presence of ATP (Mizuguchi et al., 2004). This activity appears to be genome-wide, as
shown by the Swrl-dependent localization of H2A.Z in chromatin (Li et al., 2005; Zhang
et al., 2005a).
Orthologs of the catalytic subunit Swrl in metazoan cells are suggested to be
SRCAP and p400 (Cai et al., 2005; Wu et al., 2005). During identification of the SRCAP
complex by immunoprecipitation, the H2A.Z protein was identified among the peptides
analyzed by mass spectrometry (Cai et al., 2005), although this is not the case for p400
immunoprecipitated complex (Fuchs et al., 2001). Furthermore, the ATP-dependent
exchange of H2A/H2B dimers for H2A.Z/H2B by the SRCAP complex was
demonstrated in vitro (Ruhl et al., 2006). Of note, it has recently been suggested that the
Swrl-dependent deposition of H2A.Z requires a prior acetylation of chromatin by the
NuA4 complex (Auger et al., 2008). Seeing as there is no known histone acetyltransferase (HAT) associated with the SRCAP complex, it is possible that this complex
would be responsible for acetylation-independent H2A.Z deposition (Auger et al., 2008).
The human p400/Tip60 complex appears to be a fusion of the yeast NuA4 and Swrl
complexes and would be a more likely candidate to deposit H2A.Z into chromatin in an
acetylation-dependent fashion (Auger et al., 2008).
To date, we know that the
Drosophila p400/Tip60 complex is responsible for the exchange of phosphorylated H2Av
56
with unphosphorylated H2Av by first acetylating the histone, then catalyzing the
exchange (Kusch et al., 2004). The role of the human p400/Tip60 complex remained
elusive until a recent study in our laboratory determined that H2A/H2B dimers can be
exchanged for H2A.Z/H2B dimers by p400 in vitro (Gevry et al., 2007), in line with
findings concerning the Saccharomyces cerevisiae Swrl complex. In addition, it has
been suggested that H2A.Z may be involved in a Brg-1 containing Swi/Snf complex
chromatin remodeling activity, with or without the contribution of the p400/Tip60 or
SRCAP complexes, yet this speculation remains to be verified (John et al., 2008). The
question that remains then is, why incorporate this histone variant into chromatin and
how is this incorporation directed?
Localization of H2A.Z and gene expression
Several lines of evidence suggest that the incorporation of the histone variant
H2A.Z within chromosomes promotes an active chromatin state.
H2A.Z was first
isolated in the model organism T. thermophila in association with the transcriptionally
active macronucleus, namely during peak transcriptional activity, but not the inactive
micronucleus, providing an indication that H2A.Z correlates with active chromatin (Allis
et al., 1980; Stargell et al., 1993). Immunostaining of cells demonstrated that H2A.Z
localized to active areas of polytene chromosomes in Drosophila (Leach et al., 2000).
Early studies in yeast aimed to clarify the role of H2A.Z in promoting transcriptional
activity, showing that H2A.Z is present in chromatin at the PH05, GAL1 and PURS
promoters in uninduced conditions, and its presence negatively correlates with the
activation state of these genes (Adam et al., 2001; Larochelle and Gaudreau, 2003;
Santisteban et al., 2000). Although seemingly counter-intuitive, the theory that arose
from these studies was that H2A.Z is important in the poising of promoters for gene
activation, seeing as the htzl knockout strain exhibits defects in the transcriptional
activation of these genes (Adam et al., 2001; Larochelle and Gaudreau, 2003; Santisteban
et al., 2000), as well as cell-cycle regulated genes CLN5 and CLB2 (Dhillon et al., 2006).
However, genome expression and ChIP analysis of a H2A.Z knockout strain suggested
57
that H2A.Z was important mainly as a barrier to the Sir-dependent repressive effect in
areas in close proximity to telomeres where H2A.Z is present in clusters in yeast cells,
referred to as Htzl-activated domains (HZADs), undermining its importance in the rest of
the genome (Meneghini et al., 2003). This phenomenon was also addressed during the
characterization of the Swrl-dependent deposition of H2A.Z into chromatin (Kobor et al.,
2004; Krogan et al., 2003; Zhang et al., 2005a). In addition, a similar role for H2A.Z in
the prevention of heterochromatic spreading was proposed following the finding of its
presence in insulator regions of the chicken P-globin locus (Bruce et al., 2005) and the
correlation between H2A.Z and the insulator protein CTCF in human cells (Barski et al.,
2007; Fu et al., 2008).
Further genome-wide analyses in yeast shed new light on the positioning of
H2A.Z, confirming its presence in telomere-proximal areas (Guillemette et al., 2005), yet
showing that H2A.Z was mainly present at the 5' ends of genes genome-wide, in the
promoter regions in the nucleosomes that border the nucleosome-free region (NFR)
around the transcription start site (TSS) (Guillemette et al., 2005; Li et al., 2005; Millar et
al., 2006; Raisner et al., 2005; Segal et al., 2006; Zhang et al., 2005a), as well as several
replication origins (Dhillon et al., 2006; Guillemette et al., 2005). In some studies, no
obvious correlations between H2A.Z presence and gene expression were found, possibly
due to the scale of the study performed, as only the yeast chromosome III was tiled by
microarray (Liu et al., 2005; Raisner et al., 2005; Yuan et al., 2005). However, an inverse
correlation between H2A.Z presence and gene transcription was found in the majority of
these studies (Guillemette et al., 2005; Li et al., 2005; Millar et al., 2006; Zhang et al.,
2005a) and in follow-up studies that verified H2A.Z presence during specific gene
induction (Zanton and Pugh, 2006), drawing a parallel with results previously seen in
model gene expression analyses. Intriguingly, later detailed analyses of the yeast genome
confirmed that positioning of H2A.Z at yeast promoters is more defined at TATA-less
promoters, while its positioning is more variable at TATA-containing promoters (Albert
et al., 2007). In addition, H2A.Z has recently been shown to be associated with both
yeast and human promoters that have Depleted Proximal-Nucleosomes (DPN), which are
58
well-positioned nucieosomes that exhibit low occupancy close to the TSS and greater
occupancy at distal regions creating a well-established NFR, yet it is not shown in this
study if H2A.Z could be responsible for the creation of such a promoter architecture
(Tirosh and Barkai, 2008). The proposed "promoter poising" activity of H2A.Z could
also be related to the structure of H2A.Z nucieosomes and their ability to prevent
internucleosomal interactions (Fan et al., 2002), promoting a more open chromatin
conformation that is characteristic of transcriptionally poised genes. It remains that the
prevailing inference of these studies is that H2A.Z presence at the specific regions in
yeast promoters could create a transcriptionally poised state in yeast cells, leading to a
more in-depth analysis of the role of H2A.Z positioning in the regulation of expression of
mammalian genes.
Similar positioning of H2A.Z rings true in the genomes of higher eukaryotes, yet
correlation with gene activity is seemingly more complex. The early studies of H2A.Z
positioning in the metazoan system corroborated yeast studies that claimed H2A.Z was
most important in heterochromatic areas of chromatin. Immunofluorescence and ChIP
studies in the mouse embryo showed an association between H2A.Z and HP la, a known
heterochromatic protein, in constitutive heterochromatin (Fan et al., 2004; Rangasamy et
al., 2003). However, these studies did not observe H2A.Z at facultative heterochromatin
such as the silent X chromosome, while a recent publication localized H2A.Z to the silent
X chromosome and clearly showed the counter-staining of H2A.Z with HP la in
constitutive heterochromatin, with H2A.Z staining in a punctuate manner throughout the
chromosomes (Sarcinella et al., 2007). The important nuance here is that the early
studies were performed in the developing mouse embryo, while Cheung's group used
differentiated mouse and human cells (Sarcinella et al., 2007).
Furthermore,
immunofluorescence staining of H2A.Z and different histone modifications during the
epigenetic reprogramming of mouse progenitor germ cells during development showed
that the strong but diffuse staining of H2A.Z is lost during the reprogramming process,
and this loss correlates with the critical erasure of epigenetic memory (Hajkova et al.,
2008). This transition of H2A.Z localization could explain many phenomena observed in
59
the literature to date. The importance of H2A.Z in the development of multicellular
organisms could depend on its role in the formation of heterochromatic areas, while more
differentiated cells require the use of H2A.Z in establishing a specific promoter structure
for tissue-specific gene regulation. For example, a thorough ChlP-chip analysis in the
developing Caenorhabditis elegans embryo associated H2A.Z with TSS, Pol II (read
transcriptional activity), and transcript levels, namely at growth and developmentallyrelated genes (Whittle et al., 2008).
The majority of the genomic analyses of H2A.Z in metazoan cells have shown the
association of H2A.Z with active or poised promoters. The analysis of mononucleosomelength fragments from resting and T-cell receptor signaling activated human CD4+ T
cells by ChlP-sequencing provided a high-resolution profile of nucleosomes across the
genome of these cells (Schones et al., 2008). Genome-wide, H2A.Z was shown to be
present at several nucleosomes surrounding the TSS, nucleosomes that are very wellpositioned relative to other regions of the genome, yet preferentially lost at the -1
nucleosomes upon gene induction (Schones et al., 2008), providing more evidence of the
role of H2A.Z in promoter poising first shown in yeast.
Also, global nucleosome
positioning of H2A.Z-containing nucleosomes in the Drosophila genome revealed similar
results as in yeast, with H2A.Z mapping to the TSS at the majority of promoters (Mavrich
et al., 2008b). Of note, this presence was most detected at the +1 nucleosome situated at
approximately position +62, the area at which RNA Polymerase II (RNA PolII) pauses
during the transcription cycle (Mavrich et al., 2008b). H2A.Z had also previously been
found to bind the promoter region of Myc, but is lost during induction of the gene by 11-2
(Farris et al., 2005). Interestingly, the presence of H2A.Z in the coding region of Myc
can inhibit transcriptional activity (Farris et al., 2005), raising an important issue on the
influence of the specific positioning of H2A.Z on its role in gene regulation. For
example, H2A.Z has been located at distal DNasel hypersensitive regulatory areas, often
indicating enhancer areas important in gene regulation, and its presence at these areas
correlates with transcriptional activity (Barski et al., 2007; John et al., 2008). A recent
high-resolution analysis of nucleosome occupancy and composition at model gene of the
60
class I major histocompatibility complex (MHC) family in kidney, spleen and brain tissue
from the mouse revealed that H2A.Z is present at TSS-associated nucleosomes, at
different levels in each tissue (Kotekar et al., 2008). The most interesting example in this
study is the gene activation in the kidney, where the gene is weakly active. H2A.Z
occupancy is highest here, and although the authors claim that tissue-specific presence of
H2A.Z at this specific locus does not correlate with or change upon gene activation, one
can observe a slight decrease in H2A.Z presence once the gene is activated tissue
(Kotekar et al., 2008). Moreover, ChIP analysis of several GR-responsive promoters
revealed that H2A.Z was present at GR-responsive sites, with a dramatic exchange
occurring following activation of GR by ligand binding (John et al., 2008). The authors
propose an intriguing model in which cell-specific positioning of H2A.Z would
determine the gene expression program (John et al., 2008), a model first introduced by
the work performed in our laboratory on the p53-dependent positioning of H2A.Z at the
p2jWAFi/ciPi p r o m o t e r
(Qevry et al., 2007). So, it is evident that the positioning of H2A.Z
in chromatin and its specific location within gene regulatory areas can contribute both to
the positive or negative regulation of transcriptional activity.
One can also easily hypothesize on the role of transcriptional activators in the
deposition of this histone variant into chromatin.
Transcriptional activators readily
interact with and recruit chromatin remodeling complexes to promoters, inducing either
the displacement or modification of nucleosomes (Szutorisz et al., 2005). It is known that
several coactivators of transcription are actually complexes that contain histone
modifying enzymes which affect transcription (Brownell et al., 1996). Our laboratory
and others have determined that the yeast transcriptional co-activators Spt-Ada-Gcn5Acetyl transferase (SAGA), Mediator, Swi/Snf complex and RNA PolII subunits are
recruited to the GALI promoter, and that H2A.Z is required for the recruitment of these
factors (Adam et al., 2001; Gligoris et al., 2007; Lemieux and Gaudreau, 2004; Lemieux
et al., 2008). In addition, genome-wide studies have shown the correlation between
H2A.Z presence and certain histone modifications. High-resolution ChlP-sequencing of
histone methylations and H2A.Z in human T cells associated enhancers and promoters of
61
active genes with H3K4 methylation, H2A.Z, and mono-methylated H3K9, with binding
levels correlating with gene activity (Barski et al., 2007). Interestingly, in yeast, Setl, a
H3K.4 methytransferase, and H2A.Z were shown to have redundant roles in the
establishment of a chromatin barrier to Sir-mediated silencing, as shown by an increased
repression of genes genome-wide in the double mutant strain of Ahtzl/Asetl
(Venkatasubrahmanyam et al., 2007). This suggests that these two mechanisms are
overlapping, in that the presence of either H2A.Z or the H3K4 methyl mark are not
dependent on the presence of one another, yet H2A.Z occupancy was significantly
decreased at certain genes in strains that were mutated for Setl and certain key histone
modifications (Venkatasubrahmanyam et al., 2007; Zhang et al., 2005a). Of importance
to our studies, the interplay between chromatin remodeling complexes and histone
modifying enzymes is illustrated by the interaction in mammalian cells at the p21WAFI/CIPI
promoter between p53 and the p400/Tip60 complex, a complex that contains both HAT
activity (Tip60 subunit) and ATPase subunits (p400) (Erkine, 2004; Gevry et al., 2007;
Legube et al., 2004). This same complex is now known to be responsible for the loading
of H2A.Z into nucleosomes, showing a dynamic interplay between the ATPase subunit
p400 and the HAT subunit Tip60, and has been the subject of recent research performed
in our laboratory (Gevry et al., 2007).
Taken together, these studies lead to a question similar to the chicken and the egg
scenario: it is a causal relationship in which we should ask which comes first, the histone
modifications or H2A.Z? Or do these "epigenetic marks" exist in the same regions of
chromatin without influencing the presence of one another? Is it possible that the
complex or complexes that are involved in the remodeling of H2A.Z within chromatin
also are involved in the establishment of histone modifications? Although many
bioinformatics analyses have calculated correlations and determined signatures of
H2A.Z-containing nucleosomes ((Fu et al., 2008); A. Gervais and L.G., unpublished
data), we are unable as of yet to determine the importance of H2A.Z in the establishment
of such marks, or the significance of the marks in the targeting of H2A.Z to chromatin.
62
H2A.Z and the p53/p21 senescence pathway
The link between replicative senescence, transcriptional control and chromatin
remodeling complexes was explored by Chan et al. (2005) where they focused on the role
of p400 in the p53/p21 senescence response. Replicative senescence occurs when the cell
encounters severe stresses, such as the overexpression of oncogenes or DNA damage,
provoking the activation of p53 and the pl6 pathways, causing a cell cycle arrest that is
irreversible (Campisi, 2005; Narita and Lowe, 2005). The maintenance of cell cycle
arrest leads to replicative senescence and important morphological changes in the cell,
changes in chromatin structure, and the maintenance of simple basal metabolic levels
(Cristofalo et al., 2004; Zhang, 2007). The effect of p53 on the cell cycle is somewhat
indirect, binding to the regulatory region of the p2]WAFI/CIP1 gene, activating its
transcription (Dulic et al., 1994; el-Deiry et al., 1994). The p21 and pl6 proteins are cell
cycle inhibitors which, through their capacity to bind and inactivate several cyclin-CdK
complexes, will stop the progression through to the next phase of the cell cycle, typically
in Gl (reviewed in (Zhang, 2007)). Chan et al. (2005) revealed that the p400 subunit of
the p400/Tip60 complex effects negatively the induction of the senescence pathway
(Chan et al. 2005) by decreasing p21WAF1/CIPl expression via its localization at p53
binding sites in the p21WAFI/ap' promoter (Chan et al. 2005).
We have recently demonstrated the importance of the presence of H2A.Z in
chromatin on cell cycle progression via the p53/p21 pathway (Gevry et al., 2007). Our
group demonstrated that deposition of H2A.Z at the distal p53-binding site by the p400
complex accounts for the adverse effects of p400 on the senescence response explained
by Chan et al. (2005). Specific knockdown of H2A.Z expression promotes cellular
senescence and an increase in p21
WAFl/CIP
' expression, suggesting an inhibitory role of
H2A.Z in cell cycle arrest (Gevry et al., 2007). Moreover, the decrease in the expression
of both H2A.Z and p400 in human fibroblasts caused the formation of senescenceassociated heterochromatic foci (SAHF), the p-galactosidase staining of nuclei and
change in morphology that are characteristic of senescent cells (Gevry et al., 2007). This
repressive characteristic of H2A.Z presence in chromatin is contrary to many findings
63
concerning the histone variant, yet demonstrates that the specific location of H2A.Z in
gene regulatory regions yields different effects.
The effects on cellular senescence demonstrated in these experiments were then
attributed to the p53-dependent deposition of H2A.Z by the p400/Tip60 complex on the
promoter of p21WAF,/apI.
ChIP analysis revealed the colocalisation of H2A.Z and p400
to the promoter of p21WAFI/apl
at the distal and proximal p53-binding sites in human
breast cancer cell lines, a localisation which is lost in the p53"" cell line SaOS2 (Gevry et
al., 2007).
This localisation of H2A.Z definitely linked to the repressive state of
p21WAF1/CIPI, seeing as induction of the gene via the p53 pathway led to the eviction of
H2A.Z from the chromatin of the promoter (Gevry et al., 2007). In addition, this loading
of H2A.Z by p400 is independent of its association with Tip60, seeing as they show
inversely proportional occupation of the promoter, at opposing times in the expression
pattern (Gevry et al., 2007). This result explains the opposing effects of p400 and Tip60
on p53-dependent p2lWAFl/CIPI expression, and suggests the existence of two separate
complexes, as is seen in yeast. Interestingly, following the "clearing" of the promoter
from all pre-bound RNA PolII by a-amanitin, and p53"A cells in which RNA PolII is not
pre-bound (Espinosa et al., 2003), H2A.Z is detected at the initiator region (Gevry et al.,
2007). The oncogene Myc is known to repress p21WAF1/apl
expression when present at
the initiator region of the gene (Seoane et al., 2002), and the presence of H2A.Z at the
same region leads us to study the association of H2A.Z with the oncogene Myc.
H2A.Z and the oncogene Myc
There is much evidence linking the oncogene Myc and the overall state of
chromatin in the cell. The overexpression of Myc influences global chromatin structure
by both widespread binding of Myc to chromatin and a possible recruitment of various
chromatin remodelling complexes (Knoepfler et al., 2006). Myc is known to bind and
recruit the p400/Tip60 complex to chromatin (Frank et al., 2003; Fuchs et al., 2001;
Samuelson et al., 2005). We show in our most recent study that the overexpression of
Myc not only represses p21WA
/apl
expression, but increases the loading of H2A.Z at the
64
initiator region of p21
expression, concordant with an increase in the binding of
Myc and p400 at the same region in the absence of p53 (Gevry et al., 2007). Most
recently another link has been made between Myc and H2A.Z, in that Myc stimulates
H2A.Z expression in breast cancer cells by binding the promoter of H2A.Z (Hua et al.,
2008). Taken together, these studies suggest a mechanism in which, in a type of
feedback loop, the proliferative effect of Myc would begin with an increase in the amount
of H2A.Z, leading to the repression of p21WAF1/api expression by the incorporation of this
variant into the chromatin environment of thep21WAF1/c,pl promoter.
H2A.Z and carcinogenesis
The p400/Tip60 complex has been associated with the control of expression of
several important transcription factors involved in the control of cell proliferation, such as
E2F1, p53, KAIl and Myc (Chan, 2005; Kim et al., 2005; Nagl et al., 2007; Samuelson et
al., 2005; Taubert et al., 2004). Tip60 has been shown to participate in the activation of
p2lwAFi/cwi e x p r e s s i o n
(Berns et
al;
2004; Legube et al., 2004; Tyteca et al., 2006b). In
line with this, Tip60 acts as a haplo-insufficient tumour suppressor, wherein Tip60
heterozygous mice are more sensitive to Myc-induced lymphomas (Gorrini et al., 2007).
These mice show defects in the DNA-damage response, yet the defects are not due to a
deregulation of p53- or Myc-induced transcription (Gorrini et al., 2007), which suggests
an additional unknown function of Tip60 in the cell cycle. The interplay between Tip60
and p400 remains to be determined, seeing as they appear to have opposing roles in cell
cycle arrest and carcinogenesis.
The connection between p400, H2A.Z and cellular senescence is clear, yet
questions remain concerning the role of H2A.Z in cellular proliferation and
carcinogenesis. In addition, the importance of Tip60 in the deposition of H2A.Z and the
possibility of two separate complexes must be addressed. In light of the role of H2A.Z in
the development and proliferation of cells in many mammalian systems, could it be that
the overexpression of this histone variant presents an alteration that will contribute to the
cancerous transformation of mammalian cells, as is the case for many oncogenes? The
65
overexpression of H2A.Z has been observed in colorectal cancers, undifferentiated
cancers and breast metastatic cancer cells as compared to normal cells ((Dunican et al.,
2002; Hua et al., 2008; Rhodes et al., 2004; Zucchi et al., 2004), N.G. and L.G.,
unpublished data).
The double knockout of H2A.Z and certain genes involved in
replication and S phase checkpoint control in yeast confers severe growth defects in these
strains (Dhillon et al., 2006). Of note, the simple deletion of H2A.Z renders yeast cells
hypersensitive to checkpoints, leading to a delay in the start of the cell cycle. One can
hypothesize that H2A.Z plays a role in pushing the cell through its checkpoints,
promoting proliferation.
Following our demonstration of the importance of H2A.Z in the control of the
senescence response, we have recently hypothesized upon its correlation with
carcinogenesis and the malignancy of tumors, as well as its role in the establishment of
these cancers.
In support of this hypothesis, we have recently demonstrated the
importance of H2A.Z in the estrogen receptor a (ERa) signaling pathway and in ERdependent breast cancer proliferation.
These intriguing results demonstrate that the
cyclic incorporation of H2A.Z at ERa-dependent genes stabilizes chromatin architecture
and allows the activation of the gene (N. Gevry, S. Hardy, P.-E. Jacques, L. Laflamme,
G. Grondin, F. Robert and Gaudreau, submitted for publication).
The specific
knockdown of H2A.Z in synchronized cells results in a Gl block which cannot be rescued
by serum stimulation, as compared to control cells. To further support the supposition
that H2A.Z aids in the establishment of cellular transformation, we observe that the
overexpression of H2A.Z causes increased proliferation, and the pro-proliferative effects
of H2A.Z seem to be caused by a deregulation in the cell cycle, most apparent in a P16"'"
background. Interestingly, E2F1 can recruit the p400/Tip60 complex to chromatin at the
promoters of cell-cycle related genes during the Gl/S transition (Kramps et al., 2004;
Nagl et al., 2007; Taubert et al., 2004). One can imagine a model similar to the one
illustrated in Figure 1, in which the incorporation of H2A.Z into the chromatin of
promoters will provoke a decrease mp21WAFI/apl
expression, in addition to an increase in
the expression of certain genes that are important in the promotion of cell cycle
66
progression through the Gl/S transition, such as E2F1- regulated genes, in a chromatin
remodeling response that is context-specific. Therefore, based on these studies, we can
conclude that H2A.Z could have a direct role in the control of cellular proliferation, and
potentially in cancer progression.
The direct and decisional role of H2A.Z in the
establishment of the transformed state requires further investigation and is a fascinating
aspect of H2A.Z function.
67
Acknowledgements
The authors would like to thank Marc Larochelle, Liette Laflamme and Julie Carrier for
their comments on this manuscript, and a special thanks to Benoit Leblanc for the
production of Figure 1 and many significant discussions. A.S. is a recipient of a doctoral
studentship from the Natural Sciences and Engineering Research Council of Canada
(NSERC). L.G. holds a Canada Research Chair on Mechanisms of gene transcription.
CIHR and the Canadian Cancer Society provided funding for the unpublished work cited
in this review.
68
Figure 2-1 : Proposed model for the control of cellular proliferation by H2A.Z in
mammalian cells.
The incorporation of H2A.Z into promoter chromatin of p21WAFI/apl inhibits p53dependent replicative senescence. In addition, we propose that H2A.Z regulates both
cellular proliferation through the Gl/S transition and ER-dependent cellular proliferation.
We surmise that the deposition of H2A.Z at the promoters of certain genes that are
important in the promotion of cell cycle progression through Gl/S transition, such as
E2F1- regulated genes, will regulate their expression by poising the genes for activation,
leading to increased proliferation.
69
References
Adam, M., Robert, F., Larochelle, M, and Gaudreau, L. 2001. H2A.Z is required for
global chromatin integrity and for recruitment of RNA polymerase II under
specific conditions. Mol Cell Biol 21(18): 6270-6279.
Albert, I., Mavrich, T.N., Tomsho, L.P., Qi, J., Zanton, S.J., Schuster, S.C., and Pugh,
B.F. 2007. Translational and rotational settings of H2A.Z nucleosomes across the
Saccharomyces cerevisiae genome. Nature 446(7135): 572-576.
Allis, CD., Glover, C.V., Bowen, J.K., and Gorovsky, M.A. 1980. Histone variants
specific to the transcriptionally active, amitotically dividing macronucleus of the
unicellular eucaryote, Tetrahymena thermophila. Cell 20(3): 609-617.
Auger, A., Galarneau, L., Altaf, M., Nourani, A., Doyon, Y., Utley, R.T., Cronier, D.,
Allard, S., and Cote, J. 2008. Eafl is the platform for NuA4 molecular assembly
that evolutionarily links chromatin acetylation to ATP-dependent exchange of
histone H2A variants. Mol Cell Biol 28(7): 2257-2270.
Babiarz, J.E., Halley, J.E., and Rine, J. 2006. Telomeric heterochromatin boundaries
require NuA4-dependent acetylation of histone variant H2A.Z in Saccharomy
cescerevisiae. Genes Dev 20(6): 700-710.
Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G.,
Chepelev, I., and Zhao, K. 2007. High-resolution profiling of histone
methylations in the human genome. Cell 129(4): 823-837.
Berns, K., Hijmans, E.M., Mullenders, J., Brummelkamp, T.R., Velds, A., Heimerikx,
M., Kerkhoven, R.M., Madiredjo, M., Nijkamp, W., Weigelt, B., Agami, R., Ge,
W., Cavet, G., Linsley, P.S., Beijersbergen, R.L., and Bernards, R. 2004. A largescale RNAi screen in human cells identifies new components of the p53 pathway.
Nature 428(6981): 431-437.
Brownell, J.E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D.G., Roth, S.Y., and
Allis, CD. 1996. Tetrahymena histone acetyltransferase A: a homolog to yeast
Gcn5p linking histone acetylation to gene activation. Cell 84(6): 843-851.
Bruce, K.., Myers, F.A., Mantouvalou, E., Lefevre, P., Greaves, I., Bonifer, C,
Tremethick, D.J., Thorne, A.W., and Crane-Robinson, C. 2005. The replacement
histone H2A.Z in a hyperacetylated form is a feature of active genes in the
chicken. Nucleic Acids Res 33(17): 5633-5639.
Cai, Y., Jin, J., Florens, L., Swanson, S.K., Kusch, T., Li, B., Workman, J.L., Washburn,
M.P., Conaway, R.C, and Conaway, J.W. 2005. The mammalian YL1 protein is a
shared subunit of the TRRAP/TIP60 histone acetyltransferase and SRCAP
complexes. J Biol Chem 280(14): 13665-13670.
Campisi, J. 2005. Suppressing cancer: the importance of being senescent. Science
309(5736): 886-887.
Carr, A.M., Dorrington, S.M., Hindley, J., Phear, G.A., Aves, S.J., and Nurse, P. 1994.
Analysis of a histone H2A variant from fission yeast: evidence for a role in
chromosome stability. Mol Gen Genet 245(5): 628-635.
70
Chan, H.M., M. Narita, S. W. Lowe, and D. M. Livingston. . 2005. The p400 E1Aassociated protein is a novel component of the p53 --> p21 senescence pathway. .
Genes Dev 19.
Chen, I.Y., Lypowy, J., Pain, J., Sayed, D., Grinberg, S., Alcendor, R.R., Sadoshima, J.,
and Abdellatif, M. 2006. Histone H2A.z is essential for cardiac myocyte
hypertrophy but opposed by silent information regulator 2alpha. J Biol Chem
281(28): 19369-19377.
Clarkson, M.J., Wells, J.R., Gibson, F., Saint, R., and Tremethick, D.J. 1999. Regions of
variant histone His2AvD required for Drosophila development. Nature
399(6737): 694-697.
Cristofalo, V.J., Lorenzini, A., Allen, R.G., Torres, C, and Tresini, M. 2004. Replicative
senescence: a critical review. Mech Ageing Dev 125(10-11): 827-848.
Dhillon, N., Oki, M., Szyjka, S.J., Aparicio, O.M., and Kamakaka, R.T. 2006. H2A.Z
functions to regulate progression through the cell cycle. Mol Cell Biol 26(2): 489501.
Dulic, V., Kaufmann, W.K., Wilson, S.J., Tlsty, T.D., Lees, E., Harper, J.W., Elledge,
S.J., and Reed, S.I. 1994. p53-dependent inhibition of cyclin-dependent kinase
activities in human fibroblasts during radiation-induced Gl arrest. Cell 76(6):
1013-1023.
Dunican, D.S., McWilliam, P., Tighe, O., Parle-McDermott, A., and Croke, D.T. 2002.
Gene expression differences between the microsatellite instability (MIN) and
chromosomal instability (CIN) phenotypes in colorectal cancer revealed by highdensity cDNA array hybridization. Oncogene 21(20): 3253-3257.
el-Deiry, W.S., Harper, J.W., O'Connor, P.M., Velculescu, V.E., Canman, C.E., Jackman,
J., Pietenpol, J.A., Burrell, M., Hill, D.E., Wang, Y., and et al. 1994. WAF1/CIP1
is induced in p53-mediated Gl arrest and apoptosis. Cancer Res 54(5): 11691174.
Erkine, A.M. 2004. Activation domains of gene-specific transcription factors: are
histones among their targets? Biochem Cell Biol 82(4): 453-459.
Espinosa, J.M., Verdun, R.E., and Emerson, B.M. 2003. p53 functions through stressand promoter-specific recruitment of transcription initiation components before
and after DNA damage. Mol Cell 12(4): 1015-1027.
Faast, R., Thonglairoam, V., Schulz, T.C., Beall, J., Wells, J.R., Taylor, H., Matthaei, K.,
Rathjen, P.D., Tremethick, D.J., and Lyons, I. 2001. Histone variant H2A.Z is
required for early mammalian development. Curr Biol 11(15): 1183-1187.
Fan, J.Y., Gordon, F., Luger, K., Hansen, J.C., and Tremethick, D.J. 2002. The essential
histone variant H2A.Z regulates the equilibrium between different chromatin
conformational states. Nat Struct Biol 9(3): 172-176.
Fan, J.Y., Rangasamy, D., Luger, K.., and Tremethick, D.J. 2004. H2A.Z alters the
nucleosome surface to promote HP 1 alpha-mediated chromatin fiber folding. Mol
Cell 16(4): 655-661.
Farris, S.D., Rubio, E.D., Moon, J.J., Gombert, W.M., Nelson, B.H., and Krumm, A.
2005. Transcription-induced chromatin remodeling at the c-myc gene involves the
local exchange of histone H2A.Z. J Biol Chem 280(26): 25298-25303.
71
Frank, S.R., Parisi, T., Taubert, S., Fernandez, P., Fuchs, M., Chan, H.M., Livingston,
D.M., and Amati, B. 2003. MYC recruits the TIP60 histone acetyltransferase
complex to chromatin. EMBO Rep 4(6): 575-580.
Fu, Y., Sinha, M, Peterson, C.L., and Weng, Z. 2008. The insulator binding protein
CTCF positions 20 nucleosomes around its binding sites across the human
genome. PLoSgenetics 4(7): el000138.
Fuchs, M., Gerber, J., Drapkin, R., Sif, S., Ikura, T., Ogryzko, V., Lane, W.S., Nakatani,
Y., and Livingston, D.M. 2001. The p400 complex is an essential E1A
transformation target. Cell 106(3): 297-307.
Gevry, N., Chan, H.M., Laflamme, L., Livingston, D.M., and Gaudreau, L. 2007. p21
transcription is regulated by differential localization of histone H2A.Z. Genes Dev
21(15): 1869-1881.
Gligoris, T., Thireos, G., and Tzamarias, D. 2007. The Tupl corepressor directs Htzl
deposition at a specific promoter nucleosome marking the GAL1 gene for rapid
activation. Mol Cell Biol 27(11): 4198-4205.
Gorrini, C, Squatrito, M., Luise, C, Syed, N., Perna, D., Wark, L., Martinato, F.,
Sardella, D., Verrecchia, A., Bennett, S., Confalonieri, S., Cesaroni, M.,
Marchesi, F., Gasco, M., Scanziani, E., Capra, M., Mai, S., Nuciforo, P., Crook,
T., Lough, J., and Amati, B. 2007. Tip60 is a haplo-insufficient tumour suppressor
required for an oncogene-induced DNA damage response. Nature 448(7157):
1063-1067.
Guillemette, B., Bataille, A.R., Gevry, N., Adam, M., Blanchette, M., Robert, F., and
Gaudreau, L. 2005. Variant histone H2A.Z is globally localized to the promoters
of inactive yeast genes and regulates nucleosome positioning. PLoS Biol 3(12):
e384.
Hajkova, P., Ancelin, K., Waldmann, T., Lacoste, N., Lange, U.C., Cesari, F., Lee, C,
Almouzni, G., Schneider, R., and Surani, M.A. 2008. Chromatin dynamics during
epigenetic reprogramming in the mouse germ line. Nature 452(7189): 877-881.
Hua, S., Kallen, C.B., Dhar, R., Baquero, M.T., Mason, C.E., Russell, B.A., Shah, P.K.,
Liu, J., Khramtsov, A., Tretiakova, M.S., Krausz, T.N., Olopade, O.I., Rimm,
D.L., and White, K.P. 2008. Genomic analysis of estrogen cascade reveals histone
variant H2A.Z associated with breast cancer progression. Molecular systems
biology A: 188.
Iouzalen, N., Moreau, J., and Mechali, M. 1996. H2A.ZI, a new variant histone expressed
during Xenopus early development exhibits several distinct features from the core
histone H2A. Nucleic Acids Res 24(20): 3947-3952.
Jackson, J.D. and Gorovsky, M.A. 2000. Histone H2A.Z has a conserved function that is
distinct from that of the major H2A sequence variants. Nucleic Acids Res 28(19):
3811-3816.
Jiang, W., Guo, X., and Bhavanandan, V.P. 1998. Histone H2A.F/Z subfamily: the
smallest member and the signature sequence. Biochem Biophys Res Commun
245(2): 613-617.
John, S., Sabo, P.J., Johnson, T.A., Sung, M.H., Biddie, S.C., Lightman, S.L., Voss, T.C.,
Davis, S.R., Meltzer, P.S., Stamatoyannopoulos, J.A., and Hager, G.L. 2008.
72
Interaction of the glucocorticoid receptor with the chromatin landscape. Mol Cell
29(5): 611-624.
Keogh, M.C., Mennella, T.A., Sawa, C, Berthelet, S., Krogan, N.J., Wolek, A., Podolny,
V., Carpenter, L.R., Greenblatt, J.F., Baetz, K., and Buratowski, S. 2006. The
Saccharomyces cerevisiae histone H2A variant Htzl is acetylated by NuA4.
Genes Dev 20(6): 660-665.
Kim, J.H., Kim, B., Cai, L., Choi, H.J., Ohgi, K.A., Tran, C, Chen, C, Chung, C.H.,
Huber, O., Rose, D.W., Sawyers, C.L., Rosenfeld, M.G., and Baek, S.H. 2005.
Transcriptional regulation of a metastasis suppressor gene by Tip60 and betacatenin complexes. Nature 434(7035): 921-926.
Knoepfler, P.S., Zhang, X.Y., Cheng, P.F., Gafken, P.R., McMahon, S.B., and Eisenman,
R.N. 2006. Myc influences global chromatin structure. Embo J 25(12): 27232734.
Kobor, M.S., Venkatasubrahmanyam, S., Meneghini, M.D., Gin, J.W., Jennings, J.L.,
Link, A.J., Madhani, H.D., and Rine, J. 2004. A protein complex containing the
conserved Swi2/Snf2-related ATPase Swrlp deposits histone variant H2A.Z into
euchromatin. PLoS Biol 2(5): El31.
Kotekar, A.S., Weissman, J.D., Gegonne, A., Cohen, H., and Singer, D.S. 2008. Histone
Modifications, But Not Nucleosomal Positioning, Correlate With MHC Class I
Promoter Activity In Different Tissues In Vivo. Mol Cell Biol.
Kouzarides, T. 2007. Chromatin modifications and their function. Cell 128(4): 693-705.
Kramps, C, Strieder, V., Sapetschnig, A., Suske, G., and Lutz, W. 2004. E2F and
Spl/Sp3 Synergize but are not sufficient to activate the MYCN gene in
neuroblastomas. J Biol Chem 279(7): 5110-5117.
Krogan, N.J., Baetz, K., Keogh, M.C., Datta, N., Sawa, C, Kwok, T.C., Thompson, N.J.,
Davey, M.G., Pootoolal, J., Hughes, T.R., Emili, A., Buratowski, S., Hieter, P.,
and Greenblatt, J.F. 2004. Regulation of chromosome stability by the histone H2A
variant Htzl, the Swrl chromatin remodeling complex, and the histone
acetyltransferaseNuA4.ProcAta/A™r&/ USA 101(37): 13513-13518.
Krogan, N.J., Keogh, M.C., Datta, N., Sawa, C, Ryan, O.W., Ding, H., Haw, R.A.,
Pootoolal, J., Tong, A., Canadien, V., Richards, D.P., Wu, X., Emili, A., Hughes,
T.R., Buratowski, S., and Greenblatt, J.F. 2003. A Snf2 family ATPase complex
required for recruitment of the histone H2A variant Htzl. Mol Cell 12(6): 15651576.
Kusch, T., Florens, L., Macdonald, W.H., Swanson, S.K., Glaser, R.L., Yates, J.R., 3rd,
Abmayr, S.M., Washburn, M.P., and Workman, J.L. 2004. Acetylation by Tip60
is required for selective histone variant exchange at DNA lesions. Science
306(5704): 2084-2087.
Larochelle, M. and Gaudreau, L. 2003. H2A.Z has a function reminiscent of an activator
required for preferential binding to intergenic DNA. Embo J 22(17): 4512-4522.
Leach, T.J., Mazzeo, M., Chotkowski, H.L., Madigan, J.P., Wotring, M.G., and Glaser,
R.L. 2000. Histone H2A.Z is widely but nonrandomly distributed in
chromosomes of Drosophila melanogaster. J Biol Chem 275(30): 23267-23272.
73
Legube, G., Linares, L.K., Tyteca, S., Caron, C, Scheffner, M., Chevillard-Briet, M., and
Trouche, D. 2004. Role of the histone acetyl transferase Tip60 in the p53
pathway. J Biol Chem 279(43): 44825-44833.
Lemieux, K. and Gaudreau, L. 2004. Targeting of Swi/Snf to the yeast GAL1 UAS G
requires the Mediator, TAF lis, and RNA polymerase II. Embo J 23(20): 40404050.
Lemieux, K., Larochelle, M., and Gaudreau, L. 2008. Variant histone H2A.Z, but not the
HMG proteins Nhp6a/b, is essential for the recruitment of Swi/Snf, Mediator, and
SAGA to the yeast GAL1 UAS(G). Biochem Biophys Res Commun 369(4): 11031107.
Li, B., Pattenden, S.G., Lee, D., Gutierrez, J., Chen, J., Seidel, C, Gerton, J., and
Workman, J.L. 2005. Preferential occupancy of histone variant H2AZ at inactive
promoters influences local histone modifications and chromatin remodeling. Proc
NatlAcadSci USA 102(51): 18385-18390.
Liu, C.L., Kaplan, T., Kim, M., Buratowski, S., Schreiber, S.L., Friedman, N., and
Rando, O.J. 2005. Single-nucleosome mapping of histone modifications in S.
cerevisiae. PLoS Biol 3(10): e328.
Liu, X., Li, B., and GorovskyMa. 1996. Essential and nonessential histone H2A variants
in Tetrahymena thermophila. Mol Cell Biol 16(8): 4305-4311.
Lusser, A. and Kadonaga, J.T. 2003. Chromatin remodeling by ATP-dependent
molecular machines. Bioessays 25(12): 1192-1200.
Mavrich, T.N., Jiang, C, Ioshikhes, LP., Li, X., Venters, B.J., Zanton, S.J., Tomsho, L.P.,
Qi, J., Glaser, R.L., Schuster, S.C., Gilmour, D.S., Albert, I., and Pugh, B.F. 2008.
Nucleosome organization in the Drosophila genome. Nature 453(7193): 358-362.
Meneghini, M.D., Wu, M., and Madhani, H.D. 2003. Conserved histone variant H2A.Z
protects euchromatin from the ectopic spread of silent heterochromatin. Cell
112(5): 725-736.
Millar, C.B., Xu, F., Zhang, K., and Grunstein, M. 2006. Acetylation of H2AZ Lys 14 is
associated with genome-wide gene activity in yeast. Genes Dev 20(6): 711-722.
Mizuguchi, G., Shen, X., Landry, J., Wu, W.H., Sen, S., and Wu, C. 2004. ATP-driven
exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling
complex. Science 303(5656): 343-348.
Mukhopadhyay, D. and Riezman, H. 2007. Proteasotne-independent functions of
ubiquitin in endocytosis and signaling. Science 315(5809): 201-205.
Nagl, N.G., Jr., Wang, X., Patsialou, A., Van Scoy, M., and Moran, E. 2007. Distinct
mammalian SWI/SNF chromatin remodeling complexes with opposing roles in
cell-cycle control. EmboJ26(3): 752-763.
Narita, M. and Lowe, S.W. 2005. Senescence comes of age. Nat Med 11(9): 920-922.
Polo, S.E. and Almouzni, G. 2006. Chromatin assembly: a basic recipe with various
flavours. Curr Opin Genet Dev 16(2): 104-111.
Raisner, R.M., Hartley, P.D., Meneghini, M.D., Bao, M.Z., Liu, C.L., Schreiber, S.L.,
Rando, O.J., and Madhani, H.D. 2005. Histone variant H2A.Z marks the 5' ends
of both active and inactive genes in euchromatin. Cell 123(2): 233-248.
74
Rangasamy, D., Berven, L., Ridgway, P., and Tremethick, D.J. 2003. Pericentric
heterochromatin becomes enriched with H2A.Z during early mammalian
development. Embo J 22(7): 1599-1607.
Ren, Q. and Gorovsky, M.A. 2001. Histone H2A.Z acetylation modulates an essential
charge patch. Mol Cell 7(6): 1329-1335.
Rhodes, D.R., Yu, J., Shanker, K., Deshpande, N., Varambally, R., Ghosh, D., Barrette,
T., Pandey, A., and Chinnaiyan, A.M. 2004. Large-scale meta-analysis of cancer
microarray data identifies common transcriptional profiles of neoplastic
transformation and progression. Proc Natl Acad Sci USA 101(25): 9309-9314.
Ruhl, D.D., Jin, J., Cai, Y., Swanson, S., Florens, L., Washburn, M.P., Conaway, R.C.,
Conaway, J.W., and Chrivia, J.C. 2006. Purification of a Human SRCAP
Complex That Remodels Chromatin by Incorporating the Histone Variant H2A.Z
into Nucleosomes. Biochemistry 45(17): 5671-5677.
Samuelson, A.V., Narita, M., Chan, H.M., Jin, J., de Stanchina, E., McCurrach, M.E.,
Narita, M., Fuchs, M., Livingston, D.M., and Lowe, S.W. 2005. p400 is required
for El A to promote apoptosis. J Biol Chem 280(23): 21915-21923.
Santisteban, M.S., Kalashnikova, T., and Smith, M.M. 2000. Histone H2A.Z regulats
transcription and is partially redundant with nucleosome remodeling complexes.
Cell 103(3): 411-422.
Sarcinella, E., Zuzarte, P.C., Lau, P.N., Draker, R., and Cheung, P. 2007.
Monoubiquitylation of H2A.Z distinguishes its association with euchromatin or
facultative heterochromatin. Mol Cell Biol 27(18): 6457-6468.
Schones, D.E., Cui, K., Cuddapah, S., Roh, T.Y., Barski, A., Wang, Z., Wei, G., and
Zhao, K. 2008. Dynamic regulation of nucleosome positioning in the human
genome. Cell 132(5): 887-898.
Segal, E., Fondufe-Mittendorf, Y., Chen, L., Thastrom, A., Field, Y., Moore, I.K., Wang,
J.P., and Widom, J. 2006. A genomic code for nucleosome positioning. Nature
442(7104): 772-778.
Seoane, J., Le, H.V., and Massague, J. 2002. Myc suppression of the p21(Cipl) Cdk
inhibitor influences the outcome of the p53 response to DNA damage. Nature
419(6908): 729-734.
Stargell, L.A., Bowen, J., Dadd, C.A., Dedon, P.C., Davis, M., Cook, R.G., Allis, CD.,
and Gorovsky, M.A. 1993. Temporal and spatial association of histone H2A
variant hvl with transcriptionally competent chromatin during nuclear
development in Tetrahymena thermophila. Genes Dev 7(12B): 2641-2651.
Suto, R.K., Clarkson, M.J., Tremethick, D.J., and Luger, K. 2000. Crystal structure of a
nucleosome core particle containing the variant histone H2A.Z. Nat Struct Biol
7(12): 1121-1124.
Szutorisz, H., Dillon, N., and Tora, L. 2005. The role of enhancers as centres for general
transcription factor recruitment. Trends Biochem Sci 30(11): 593-599.
Taubert, S., Gorrini, C, Frank, S.R., Parisi, T., Fuchs, M., Chan, H.M., Livingston, D.M.,
and Amati, B. 2004. E2F-dependent histone acetylation and recruitment of the
Tip60 acetyltransferase complex to chromatin in late Gl. Mol Cell Biol 24(10):
4546-4556.
75
Tirosh, I. and Barkai, N. 2008. Two strategies for gene regulation by promoter
nucleosomes. Genome research 18(7): 1084-1091.
Tyteca, S., Vandromme, M., Legube, G., Chevillard-Briet, M., and Trouche, D. 2006.
Tip60 and p400 are both required for UV-induced apoptosis but play antagonistic
roles in cell cycle progression. EmboJ25(8): 1680-1689.
van Daal, A., White, E.M., Gorovsky, M.A., and Elgin, S.C. 1988. Drosophila has a
single copy of the gene encoding a highly conserved histone H2A variant of the
H2A.F/Z type. Nucleic Acids Res 16(15): 7487-7497.
Venkatasubrahmanyam, S., Hwang, W.W., Meneghini, M.D., Tong, A.H., and Madhani,
H.D. 2007. Genome-wide, as opposed to local, antisilencing is mediated
redundantly by the euchromatic factors Setl and H2A.Z. Proc Natl Acad Sci US
A 104(42): 16609-16614.
West, M.H. and Bonner, W.M. 1980. Histone 2B can be modified by the attachment of
ubiquitin. Nucleic Acids Res 8(20): 4671-4680.
White, C.L., Suto, R.K., and Luger, K. 2001. Structure of the yeast nucleosome core
particle reveals fundamental changes in internucleosome interactions. Embo J
20(18): 5207-5218.
Whittle, CM., McClinic, K.N., Ercan, S., Zhang, X., Green, R.D., Kelly, W.G., and Lieb,
J.D. 2008. The genomic distribution and function of histone variant HTZ-1 during
C. elegans embryogenesis. PLoSgenetics 4(9): el000187.
Wu, R.S. and Bonner, W.M. 1981. Separation of basal histone synthesis from S-phase
histone synthesis in dividing cells. Cell 27(2 Pt 1): 321-330.
Wu, W.H., Alami, S., Luk, E., Wu, C.H., Sen, S., Mizuguchi, G., Wei, D., and Wu, C.
2005. Swc2 is a widely conserved H2AZ-binding module essential for ATPdependent histone exchange. Nat Struct Mol Biol 12(12): 1064-1071.
Yuan, G.C., Liu, Y.J., Dion, M.F., Slack, M.D., Wu, L.F., Altschuler, S.J., and Rando,
O.J. 2005. Genome-scale identification of nucleosome positions in S. cerevisiae.
Science 309(5734): 626-630.
Zanton, S.J. and Pugh, B.F. 2006. Full and partial genome-wide assembly and
disassembly of the yeast transcription machinery in response to heat shock. Genes
Dev 20(16): 2250-2265.
Zhang, H. 2007. Molecular signaling and genetic pathways of senescence: Its role in
tumorigenesis and aging. Journal of cellular physiology 210(3): 567-574.
Zhang, H., Roberts, D.N., and Cairns, B.R. 2005. Genome-wide dynamics of Htzl, a
histone H2A variant that poises repressed/basal promoters for activation through
histone loss. Cell 123(2): 219-231.
Zlatanova, J. and Thakar, A. 2008. H2A.Z: view from the top. Structure 16(2): 166-179.
Zucchi, I., Mento, E., Kuznetsov, V.A., Scotti, M., Valsecchi, V., Simionati, B.,
Vicinanza, E., Valle, G., Pilotti, S., Reinbold, R., Vezzoni, P., Albertini, A., and
Dulbecco, R. 2004. Gene expression profiles of epithelial cells microscopically
isolated from a breast-invasive ductal carcinoma and a nodal metastasis. Proc
Natl Acad Sci USA 101(52): 18147-18152.
76
77
CHAPTER III
III.H2A.Z
OVEREXPRESSION
PROMOTES CELLULAR
PROLIFERATION
OF BREAST
CANCER CELLS
III.1.
Preamble
H2A.Z is expressed at high levels in colorectal cancers, undifferentiated cancers, and
breast metastatic cancer cells, but not in normal cells (Dunican et al., 2002; Hua et al.,
2008; Rhodes et al., 2004; Zucchi et al., 2004). A study by Hua et al. observed that
increased H2A.Z expression is significantly associated with lymph node metastasis and
decreased breast cancer survival using tissue microarray screening (TMA), and H2A.Z
expression is stimulated by E2-dependent binding of Myc (Hua et al., 2008). In addition
to the importance of H2A.Z in the control of the senescence response (Gevry et al.,
2007), we shortly thereafter observed that H2A.Z is crucial in E2-dependent
transcriptional regulation by the cyclic p400-dependent incorporation of H2A.Z which
stabilizes chromatin architecture at ERa target genes (Gevry et al., 2009). In this study,
we also observed that the depletion of H2A.Z decreases E2-dependent cellular
proliferation in the breast cancer cell line MCF7 (Gevry et al., 2009).
The manuscript in this chapter presents the results obtained following our questioning on
the correlation of H2A.Z with ERa-dependent breast cancer and hormone-dependent
cellular proliferation. We first show that E2-dependent increased expression of H2A.Z is
78
partly due to the binding of ERa to the H2A.Z promoter. In addition, we observe a
correlation between H2A.Z and ERa levels in low grade breast cancer, and that the
exogenous overexpression of H2A.Z in the MCF7 breast cancer cell line leads to
increased proliferation in low levels of E2 and in the presence of TAM.
This manuscript was published in the peer-reviewed journal Cell Cycle in January 2010,
and the artwork from the article was featured on the cover of the journal (Svotelis, A.,
Gevry, N., Grondin, G., and Gaudreau, L. (2010). H2A.Z overexpression promotes
cellular proliferation of breast cancer cells. Cell Cycle 9, 364-370.). The contribution to
the conception and execution of the experiments were equally shared between Dr.
Nicolas Gevry and myself, with the help of Gilles Grondin in the execution of the
immunohistochemistry presented in Figure 3.2 and 3.3. I wrote the manuscript, aided by
discussions and corrections from Drs. Nicolas Gevry and Luc Gaudreau, cocorresponding authors for the manuscript.
79
III.2.
Manuscript
H2A.Z overexpression promotes cellular proliferation of breast
cancer cells
Amy Svotelis*, Nicolas Gevry* °°, Gilles Grondin, and Luc Gaudreau00
Departement de biologie, Faculte des Sciences, Universite de Sherbrooke, Sherbrooke,
Quebec, Canada
* These authors contributed equally to this work.
00
Address correspondence to: Nicolas Gevry or Luc Gaudreau, Departement de biologie,
Faculte des Sciences, Universite de Sherbrooke, Sherbrooke, Quebec, Canada, JIK 2R1
Tel:
819-821-8000
ext.
62081;
Fax:
819-821-8049;
E-Mail:
Nicolas.Gevrv(2),USherbrooke.ca. or [email protected]
Key words: Estrogen receptor, breast cancer, chromatin, histone variant H2A.Z,
transcription, proliferation
Svotelis, A., Gevry, N., Grondin, G., and Gaudreau, L. (2010). H2A.Z overexpression
promotes cellular proliferation of breast cancer cells. Cell Cycle 9, 364-370.
80
Abstract
We recently showed that histone H2A.Z, as well as members of the ATP-dependent p400
chromatin remodeling complex (p400.com), are essential components of estrogen
receptor a (ERa) signaling. More specifically, we showed that H2A.Z and p400.com are
incorporated into the promoter regions of ERa target genes only upon gene induction, and
also in a cyclic fashion. RNAi-mediated cellular depletion of H2A.Z and p400.com
strongly impedes estrogen-dependent growth of breast cancer cells as well as strongly
affects ERa-target gene expression. Two mechanisms emerged from our studies of how
H2A.Z incorporation within ERa-target regulatory regions can actually regulate
estrogen-mediated signaling: 1) by stabilizing nucleosomes within the translational DNA
axis, a process that allows general transcription factors to be efficiently recruited to
promoter regions; 2) by allowing estrogen-responsive enhancer function. In the current
study, we now show that in MCF7 cells, ectopic overexpression of H2A.Z increases
proliferation, and such in conditions where estrogen levels are low.
Also,
immunohistochemical studies of breast cancer biopsies show that the presence of H2A.Z
correlates highly with that of ERa, but is associated with high-grade ER-negative
cancers. Finally we show that ERa directly associates to the H2A.Z promoter, and
consequently modulates its expression. Our study provides a possible link between
H2A.Z and endocrine resistance by showing that H2A.Z overexpression leads to
increased growth, particularly when estrogen levels are very low.
81
Introduction
Breast cancer is the one of the leading causes of death in females, second only to lung
Cancer ("Canadian Cancer Society/National Cancer Institute of Canada: Canadian Cancer Statistics 2008, Toronto,
Canada, 2008."April 2008, ISSN 0835-2976). Although treatment of the disease is increasingly
possible, the incidence of breast cancer continues to grow and resistance to common
chemotherapy is common. Breast cancer is generally categorized by either estrogen
receptor (ER)-positive or ER-negative cancers. The ER is a nuclear receptor that is
activated by its ligand estrogen (E2) which, once activated, promotes transcriptional
activation of gene targets that contain estrogen response elements (ERE) '. There exists
both ERa and ERp, and many of ERa target genes are involved in cellular proliferation .
Notably, recent studies have suggested that ERa receptors can stimulate transcription of
RNA polymerase II target genes by promoting modification of chromatin, creating
favorable promoter architecture for the establishment of stable initiation complexes 3.
Chromatin is now considered an extremely dynamic structure that changes to control
gene expression 4. H2A.Z is a histone variant that has been implicated principally in
inducing local changes in chromatin structure and subsequently the regulation of gene
expression 5"7.
H2A.Z is an essential gene in metazoan models, such as Tetrahemena
Q
1 I
thermophila, Xenopus laevis, Drosophila melanogaster and Mus musculus ' , and is
required for the proper regulation of many cellular processes. The deposition of H2A.Z
into chromatin genome-wide has been shown to be associated with and regulated by the
SRCAP and p400/Tip60 complexes in mammalian cells
12 14 7 15
"
. The positioning of
H2A.Z in chromatin and its specific location in gene regulatory areas and promoters can
contribute both to the positive or negative regulation of transcriptional activity ' . We
have recently shown that H2A.Z is important in the regulation of ERa-dependant
transcription and estrogen-specific cell proliferation
. The incorporation of H2A.Z
within the chromatin positions nucleosomes in the promoter area of TFF1, an ERadependant model gene. In addition, H2A.Z is essential in estrogen-responsive enhancer
function by allowing the recruitment of the factor FoxAl.
82
In addition to the recent insights on the mechanistic function of H2A.Z, it has
been observed that increased expression of H2A.Z has been observed in colorectal
cancers, undifferentiated cancers and breast metastatic cancer cells as compared to
normal cells ,7"20. Recent studies published by our group not only showed that the
depletion of H2A.Z expression causes cellular senescence, but that H2A.Z is required for
E2-dependent cellular proliferation '
. Taken together, these studies suggest that
H2A.Z is important in promoting proliferation. We thus hypothesized on the correlation
of H2A.Z with carcinogenesis and the malignancy of tumors, namely in ERa-positive
and ERa-negative cancers, as well as its role in the establishment of these cancers. In
this report we show that H2A.Z promotes growth in breast cancer cells, and such, in an
estrogen-independent manner. Also, H2A.Z correlates with ERa in low grade breast
cancers, but is preferentially expressed in high grade cancers, in which we no longer
observe an association with ERa. Finally, we show that the ERa directly regulates H2A.Z
expression.
83
Results
The overexpression of H2A.Z promotes the proliferation of breast cancer cells
To determine whether H2A.Z expression levels influence breast cancer progression, we
overexpressed H2A.Z in the ERcc-positive MCF7 breast cancer cell line using a lentiviral
vector, using the overexpression of canonical histone H2A as a control. The protein and
mRNA overexpression levels were verified by Western blot and quantitative PCR
(qPCR) (Figure 1A and 4B). The in vitro growth potential of the different cell lines in the
absence and presence of E2 or tamoxifen (TAM) was verified.
Cell counts were
performed at different time intervals (day 0, 2, 4, 6 and 8). Interestingly, H2A.Z
overexpression promotes significantly proliferation in the absence of E2 (Figure 1C) and
in the presence of TAM (Figure IE) when compared to the empty vector control (WPI) or
H2A overexpression, whereas E2-dependent cell population growth is similar for all cell
lines (Figure ID). To determine if the presence of ERa is required for H2A.Z to affect
proliferation, we performed similar experiments in the MCF10A mammary epithelial cell
line, which are ER-negative. As seen in Figure IF, the overexpression of H2A.Z has no
effect on the proliferative capacity of these cells. Similar results were obtained in the
MDA-MB-231 ER-negative breast cancer cells (data not shown). Taken together, these
results suggest that increased H2A.Z expression leads to increased cellular proliferation
and this effect is better visualized when estrogen levels are very low.
Increased expression ofH2A.Z is observed in breast cancer
To determine a link between increased H2A.Z expression and transformed cells, we
verified the expression of H2A.Z and its correlation with breast cancer in several
different manners. First, the expression of H2A.Z mRNA was verified using a cDNA
panel generated using tissue from normal and breast cancer biopsy tissue. The relative
expression of H2A.Z mRNA was calculated using H2A, and correlated to the reported
expression of ERa. As seen in Figure 2A, increased H2A.Z expression correlates with
high ERa expression in cancerous breast tissue and common breast cancer cell lines
84
MCF7, T47D, and MDA-MB-231. Basal levels of H2A.Z expression are observed in
A
B
Expression of H2A.Z in MCF7 cell lines (n=4)
20'
Q 18& 16'
g o 14
1 § 12£
Overexpression: CTL
_
IB: anti-H2A.Z
H2A
H2A.Z
_ „
« —
IB: arrti-FLAG
«—H2A Z-FLAG
•-endogenous
H2A2
—
— •
U*
- » 8
6 4& 20
WPI-
D
-E2
WPI-H2A
WPI-H2A.Z
(cellli
•E2(1<J 8 M)
400
1 ^
§, 300
I 25°
/
1 200
/ '
/W,/'
&
150
I
50
— , — , — , ,-r,-m-f--,—
6
-•-WPI
*H2A
»H2AZ
/
6
8 (days)
8
(rj a ys)
Growth of MCF10A cells
Growth in presence of Tamoxifen (10 " M)
300
250
~WP|
»H2A
*H2AZ
200
150
100
50
i>^
•
.
• • i
K—,-
6
8 (days)
6
8 (days)
Figure 3-1 : The overexpression of H2A.Z promotes E2-independent cell growth.
Overexpressed H2A.Z was scored by immunoblotting H2A.Z and FLAG in histone
extracts of MCF7 cell lines (A) and by RT-qPCR using oligonucleotide primers specific
for H2A.Z (B; normalized using GAPDH as a control). The overexpression of H2A.Z
increases proliferation of MCF7 cells in the absence of E2 (C) and in the presence of
TAM (E), but does not affect E2-dependent growth (D). The overexpression of H2A.Z in
ERa-negative MCF10A cells does not affect proliferation (F).
85
%N &$>+** $ **%sv%s*
Normal Breast
B
MW#^>VW
Breast Cancer
Hoechst
/>°/
^
^
Merge
ER+
Tumor
ERTumor
Figure 3-2 : H2A.Z is overexpressed in several different cancerous cell lines and
tissues and correlates with ERa levels.
(A) A cDNA panel created from normal and cancerous breast tissues (Origene) was
quantified for H2A.Z RNA levels in as well as in different invasive cell lines (T47D,
MCF7, and MD-AMB-231), normalized using GAPDH as a control. (B) Coimmunolocalisation of both H2A.Z and ERa by immunochemistry in tissues obtained
from biopsies of ERa-positive and ERa-negative breast cancers shows a strong
colocalisation pattern exists between H2A.Z and ERa.
86
normal breast tissue. The correlation observed between H2A.Z and ERa increased
expression led us to investigate protein levels and co-immunolocalisation of both H2A.Z
and ERa by immunochemistry in tissues obtained from biopsies of ERa-positive and
ERa-negative breast cancers. Figure 2B shows that strong protein levels of H2A.Z are
observed in ERa-positive tumors with lower levels present in ERa-negative tumors, and a
strong colocalisation pattern exists between H2A.Z and ERa.
Increased expression of H2A.Z correlates with ERa levels in low grade breast tumors
whereas high grade breast cancer shows only high levels ofH2A.Z
To further investigate correlative patterns between H2A.Z and ERa, we obtained
a tissue array that contained 208 spots of normal and cancerous biopsy tissue, from which
pathology reports are provided containing information on location and tumor grade.
Antibodies specific for H2A.Z and ERa were hybridized to the array in order to
determine correlations between H2A.Z, ERa and severity of breast cancer. As seen in
table 1, in low grade cancers we observe a strong correlation (72%) between the
expression of H2A.Z and ERa. This correlation diminishes drastically with increased
tumor grade, and we observe that 70% of grade 3 tumors (50%) that are only positive for
H2A.Z expression and 5 % for ERa. Furthermore, none of the biopsy tissues investigated
showed co-expression of H2A.Z and ERa for the grade 3 tumors. Representative images
of each grade are shown in Figure 3. These results indicate that, although we observe
strong correlations between H2A.Z and ERa in low grade carcinoma (Fig. 2B, Table 1),
the highest proportion of high grade tumor tissues are positive for H2A.Z and negative
for ERa (Table 1). Relating back to the observations in figure 1, we can suggest that
increased H2A.Z expression could lead to independence of E2-controlled cellular
proliferation. In addition, a bioinformatics analysis of available microarray data from the
literature shows that H2A.Z expression in breast cancer is highly correlated with
increased expression of several cell-cycle related genes such as cyclin B2, cyclin A2,
cyclin Bl and PCNA (see table 2). These results point toward a link between ERa and
87
H2A.Z in cancerous tissues, as well as a strong correlation between increased H2A.Z
expression and the proliferative capacity of cells.
Hoechst
Merge
Figure 3-3 : High grade breast cancer correlates with high levels of H2A.Z.
A tissue array containing 208 spots of normal and cancerous biopsy tissue was analysed
for H2A.Z and ERa protein levels. Here we present representative examples of biopsies
of grade 1, 2 and 3 tissues. The analysis showed that the highest proportion of high grade
tumor tissues is positive for H2A.Z and negative for ERa.
Table 3-2 : High grade breast cancer correlates with high levels of H2A.Z.
The results from the immunocolocalisation analysis of H2A.Z and ERa from a tissue
array containing 208 spots of normal and cancerous biopsy tissue are illustrated below.
We observe strong correlations between H2A.Z and ERa in low grade carcinoma the
highest proportion of high grade tumor tissues are positive for H2A.Z and negative for
ERa.
T u m o r grade
Grade 1
Grade 1-2
Grade 2
Grade 2-3
Grad*3
H2A.Zand
ERalpha
72
14
5
20
0
50
HMZ
14
28
19
20
ERalpha
0
14
6
0
6
Undetectable
14
44
70
60
44
Total
100
100
100
100
100
Percentage of
>osittve samples
Table 3-3 : High levels of H2A.Z correlate with high levels of important cell cycle
regulators.
A bioinformatics analysis of available microarray data from the literature shows that
H2A.Z expression in breast cancer is highly correlated with increased expression of
several cell-cycle related genes such as cyclin B2, cyclin A2, cyclin Bl and PCNA.
Gene
No.
studies
% studies
Gene name
H2AFZ
20
100%
H2A hittone family, member Z
CDC2
13
65%
cell division cycle 2, G, to S and
GjtoM
CCNB2
13
65%
cyclin B2
CCNA2
12
60%
cyclin A2
AURKA
12
60%
aurora kinase A
PCNA
it
55%
proliferating cell nuclear antigen
CCNBI
n
55%
cyclin Bl
89
ERa regulates the expression ofH2A.Z in breast cancer cells
Considering that H2A.Z levels are high in ERa-positive breast cancers (Hua et al., 2008,
Fig. 2A), we set out to determine whether ERa could directly regulate the expression of
H2A.Z in breast cancer cells. First, we verified if E2 could induce H2A.Z expression in
MCF7 cells. Figure 4B shows that after 4 h of E2 treatment, H2A.Z expression increases
more than 2.5 fold. Figure 4A shows a graphical representation of the H2A.Z promoter
that includes the localization of putative regulatory elements described by Hatch and
Bonner (Hatch and Bonner 1995; Hatch and Bonner 1996), as well as regulatory elements
scored by a bioinformatics analysis using the TransFac database. Our in silico approach
did not detect the presence of an ERE, but has nevertheless revealed two Spl sites and
one AP-1 site, two factors that have been shown to be able to recruit ERa to promoters
by a non-classical pathway (Figure 4A) 2 . To further characterize the implication of the
E2 signaling pathway, we investigated the recruitment of ERa at the H2A.Z promoter in
MCF7 cells by ChIP assay. Figure 4C shows a ChIP experiment performed with an antiERa antibody in which we observe that the receptor begins to accumulate at the H2A.Z
promoter after 15 minutes of E2 treatment, reaching a peak at 30 minutes (Figure 4C),
and proportionally decreasing thereafter. This interesting result suggests that ERa can
also engage in coordinated cycles at H2A.Z. In Figure 4C, amplicon "O" was used as a
negative control, and indeed shows no significant enrichment in ERa binding. Taken
together, our results show that ERa and H2A.Z are involved in a positive feedback loop
that appears important for ERa signaling under normal and pathological conditions.
90
+1^
Q.O<CLUDLO
-2.2 kb
1//u
5
woowotoo P
TnnoMnnr
-0.2 kb
B
Figure 3- 4 : ERa regulates the expression of H2A.Z in breast cancer cells.
(A) Representation of the H2A.Z promoter with the putative cis-acting elements and
primers used for qPCR. (B) H2A.Z mRNA expression levels after 4 h of E2 treatment in
MCF7 cells. (C) ChIP assay showing the binding of ERa at the H2A.Z promoter at
different time after E2 activation.
Discussion
Our data supports a strong link between H2A.Z and ERa-dependent breast
tumor proliferation. Several lines of evidence argue for such a possibility: 1) H2A.Z is
essential component of E2-dependent breast cancer cell growth l6; 2) H2A.Z and ERa
levels have been shown to correlate in several breast cancer samples tested; and 3) ERa
directly regulates H2A.Z gene expression. Although the link between H2A.Z and breast
cancer has recently been addressed l7, many questions remained following this study. A
recent study demonstrated the link between H2A.Z and breast cancer more concretely,
and that H2A.Z expression is stimulated by E2-dependent binding of Myc l7. First of all,
91
we show here for the first time that E2-dependent increased expression of H2A.Z is partly
due to the binding of ERa to the H2A.Z promoter. It has never before been shown which
factors directly bind to the H2A.Z promoter area and regulate its expression. ERa is
known to stimulate expression of cell-cycle related genes and promote proliferation. The
expression of H2A.Z has often been considered not regulated throughout the cell cycle,
yet we know that there is a peak of H2A.Z expression at the Gl/S transition during the
cell cycle (data not shown, ). In addition, the increased expression observed of H2A.Z
in breast cancers is associated with increased expression of several cell-cycle related
genes (see Table 2). The association between ERa and H2A.Z is also evident with the
high levels of correlation between ERa and H2A.Z protein levels in low-grade breast
cancers (Table 1 and Fig. 3). Interestingly, although the incidence of ERa-related breast
cancers decrease with increased grade, the levels of H2A.Z expression increases, in line
with a previous study
. Furthermore, the p400/Tip60 complex, who incorporate H2A.Z
into chromatin, has been associated with the control of expression of several important
transcription factors involved in the control of cell proliferation, such as E2F1, p53, KAI1
and Myc
" . Tip60 has been shown to participate in the activation of p21
expression 27"29. In line with this, Tip60 acts as a haplo-insufficient tumour suppressor,
in
wherein Tip60 heterozygous mice are more sensitive to Myc-induced lymphomas
.
These mice show defects in the DNA-damage response, yet the defects are not due to a
deregulation of p53- or Myc-induced transcription
, which suggests an additional
unknown function of Tip60 in the cell cycle. The interplay between Tip60 and p400 has
recently been investigated, showing that the balance between the two proteins affects
carcinogenesis 31.
Of most importance in this study is our demonstration that increased H2A.Z
expression promotes cellular proliferation, namely when E2 levels are low and during
tamoxifen treatment. Although several studies have shown increased levels of H2A.Z in
breast cancer 17'32'33, no group has yet modified the expression of H2A.Z to determine its
role in the regulation of cellular proliferation besides ours (Fig. 4, 7 ' l 6 ). In this study we
92
provide evidence that not only does H2A.Z correlate with increased cellular proliferation,
but may be a causal factor. Interestingly, the effects of increased H2A.Z expression in
MCF7 cells leads to increased growth notably in the absence of E2 and in the presence of
tamoxifen. Tamoxifen is widely used to treat breast cancer due to its capacity to bind
ERa and inhibit the activation potential of the nuclear receptor. Our study shows that, as
expected, MCF7 cells do not proliferate well in the presence of tamoxifen, but the
overexpression of H2A.Z overrides the toxic potential of tamoxifen.
This result, in
combination with the observation that H2A.Z is highly associated with high grade ERnegative breast cancers (Table 1 and Fig. 3) indicates that H2A.Z could possibly be a
factor important in the transformation of breast cancer cells and the establishment of
endocrine resistance. This is a concern that is of major clinical importance in the
treatment of breast cancers, and the control of H2A.Z expression could be at the heart of
the issue.
93
Experimental procedures
Cell culture and lentiviral infection.
MCF7 cells were maintained in DMEM (Invitrogen, Carlsbad, CA, USA) containing
10% fetal bovine serum (FBS) and antibiotics.
MCF10A cells were maintained in
DMEM-F12 (Invitrogen) with 5% horse serum (Invitrogen), containing a growth factor
mix (human epithelial growth factor at 20 ng/ml, hydrocortisone at 0.5 ug/ml, and insulin
at 10 ug/ml, SIGMA-ALDRICH, St. Louis, MO, USA) and antibiotics. 17n-estradiol
(SIGMA-ALDRICH) and tamoxifen (SIGMA-ALDRICH) were used at concentrations of
lOOnM and luM, respectively. Constructs overexpressing H2A or H2A.Z were inserted
into MCF7 and MCF10A cells using lentiviral infections as described previously (in7,2fi).
Efficiency of lentiviral infection was verified by detection of GFP by fluorescence
microscopy and immunoblotting using antibodies specific for the overexpressed proteins,
or FLAG M2 monoclonal antibody (SIGMA).
Cell proliferation assay
The cell proliferation assay has been described previously, with slight modifications 7.
Briefly, 1 x 104 cells were seeded in a 48-well plate. Twelve hours after plating, one plate
was trypsinized for counting. At the indicated time points, other assay plates were also
trypsinized and counted. The values were normalized to those of the time zero plate.
Each data point presented is the average value of triplicate samples.
RNA extraction and RT-qPCR
Total RNA was isolated using the GenElute Mammalian Total RNA kit (SIGMA). RNA
was reverse-transcribed into first-strand cDNA using MMLV reverse transcriptase
(Promega, Madison, WI, USA). Samples were subjected to Q-PCR using MX3000P
(Stratagene, Cedar Creek, TX, USA). The cDNA panel created from normal and
cancerous breast tissues originates from Origene (Rockville, MD, USA). Q-PCR for
36B4 (which encodes a ribosomal protein subunit) and GAPDH mRNA were used as
94
internal controls. The relative abundance of target mRNA (or other test genes) was
calculated following normalization using 36B4 mRNA, where relative expression levels
were calculated as 2"01", where CT = (CT test gene -CT 36B4).
ChIP assays
MCF7 cells were deprived of hormonal stimulation for at least 3 days and then treated
with 100 nM of 17p-estradiol for the indicated time. ChIP assays were performed
essentially as described previously (7'16,26 with a panel of specific polyclonal antibodies
generated in-house or from commercial sources, as well as preimmune and no antibody
controls. Samples were sonicated to generate DNA fragments <500 bp. PCR was
performed using a set of primers relevant to the promoter regions of the H2A.Z and
analyzed by Q-PCR.
Immunochemistry
Paraffin embedded tissue was cut at 4 urn thickness, deparaffinized and rehydrated.
Antigenicity lost during fixation and embedding process was retrieved by heat treatment
in a pressure cooker for 9 min in ImM EDTA, 10 mM Tris-HCl ph 8.0. Tissue sections
were permeabilized with 50% methanol at - 20° C for 5 min and in PBSP (PBS with 2%
normal goat serum, 2% BSA and 0.45 % of fish gelatin) for 10 min. Tissue sections were
incubated for overnight at 4°C with primary antibodies, ER mouse monoclonal and
H2A.Z at dilutions 1:100 in PBSB. Control tissue sections were incubated similarly with
a nonspecific immune serum. Primary antibodies were detected by incubation with Alexa
Fluor 488 goat anti-mouse IgG (Invitrogen) and Alexa Fluor 546 goat anti-rabbit IgG
(Invitrogen) at a dilution of 1:200 in PBSB for 2 h at room temperature. After several
washes, the nuclei were stained 10 min with Hoechst 33342 (Invitrogen) at 1:5000
dilution for epifluorescence or with To-Pro-3 iodine (Invitrogen) at 1:1000 dilution for
confocal microscopy. Finally, sections were mounted in Prolong Gold anti-fade reagent
(Invitrogen). Pictures were taken with using an inverted Olympus IX 70 microscope with
a Cool SNAP-Pro cf monochrome camera and Image-Pro Plus software or with Olympus
95
Fluoview FV 300 confocal system. For the cell and tissue array labeling, the same
protocol was used, omitting the deparaffinisation, hydration and heat retrieval steps. The
tissue array used in this study was the BR2085a array obtained from US Biomax, Inc.,
Rockville, MD, USA.
Antibodies
The ERD polyclonal (HC20), ERp monoclonal (N20), and RNA pol II antibodies (N20)
were purchased from Santa Cruz Biotechnology, Santa Cruz, CA, USA. Polyclonal
antibodies to H2A.Z (07-594) were from Upstate Biotechnology (Millipore, Billerica,
MA, USA). Histone H3 (ab 1791) and H2A.Z (ab4174) were purchased from Abeam
(Cambridge, MA, USA).
Lentiviral constructions
A FLAG-peptide was cloned to the 3'-end of the coding regions of H2A and H2A.Z, and
the constructs were inserted into the multiple cloning site of pcDNA4-TO (Invitrogen)
using BamHI and EcoRI. The resulting constructs were then digested using Pmel in
order to sub-clone into the pWPI vector. 293T cells were transfected with our pWPI
constructs and the packaging vectors MD2G and PAX2 (gift from Dr. Didier Trono) and
viruses contained in the cell medium were collected 48h following transfection.
96
Acknowledgements:
We thank Brian Wilson for biostatistical insight on our study. The authors acknowledge
support from the Canadian Cancer Society and from the Canadian Institutes of Health
Research. L.G. holds a Canada Research Chairs on Mechanisms of Gene Transcription.
A.S. was a recipient of a doctoral studentship from the Natural Sciences and Engineering
Research Council of Canada.
97
References:
1.
Bjornstrom L, Sjoberg M. Mechanisms of estrogen receptor signaling:
convergence of genomic and nongenomic actions on target genes. Mol Endocrinol 2005;
19:833-42.
2.
Matthews J, Gustafsson JA. Estrogen signaling: a subtle balance between ER
alpha and ER beta. Mol Interv 2003; 3:281-92.
3.
Metivier R, Huet G, Gallais R, Finot L, Petit F, Tiffoche C, Merot Y, LePeron C,
Reid G, Penot G, Demay F, Gannon F, Flouriot G, Salbert G. Dynamics of estrogen
receptor-mediated transcriptional activation of responsive genes in vivo: apprehending
transcription in four dimensions. Advances in experimental medicine and biology 2008;
617:129-38.
4.
Li B, Carey M, Workman JL. The role of chromatin during transcription. Cell
2007; 128:707-19.
5.
Guillemette B, Bataille AR, Gevry N, Adam M, Blanchette M, Robert F,
Gaudreau L. Variant histone H2A.Z is globally localized to the promoters of inactive
yeast genes and regulates nucleosome positioning. PLoS Biol 2005; 3:e384.
6.
Svotelis A, Gevry N, Gaudreau L. Regulation of gene expression and cellular
proliferation by histone H2A.Z. Biochem Cell Biol 2009; 87:179-88.
7.
Gevry N, Chan HM, Laflamme L, Livingston DM, Gaudreau L. p21 transcription
is regulated by differential localization of histone H2A.Z. Genes Dev 2007; 21:1869-81.
8.
van Daal A, White EM, Gorovsky MA, Elgin SC. Drosophila has a single copy of
the gene encoding a highly conserved histone H2A variant of the H2A.F/Z type. Nucleic
Acids Res 1988; 16:7487-97.
9.
Liu X, Li B, GorovskyMa. Essential and nonessential histone H2A variants in
Tetrahymena thermophila. Mol Cell Biol 1996; 16:4305-11.
10.
Iouzalen N, Moreau J, Mechali M. H2A.ZI, a new variant histone expressed
during Xenopus early development exhibits several distinct features from the core histone
H2A. Nucleic Acids Res 1996; 24:3947-52.
11.
Faast R, Thonglairoam V, Schulz TC, Beall J, Wells JR, Taylor H, Matthaei K,
Rathjen PD, Tremethick DJ, Lyons I. Histone variant H2A.Z is required for early
mammalian development. CurrBiol 2001; 11:1183-7.
12.
Cai Y, Jin J, Florens L, Swanson SK, Kusch T, Li B, Workman JL, Washburn
MP, Conaway RC, Conaway JW. The mammalian YL1 protein is a shared subunit of the
TRRAP/TIP60 histone acetyltransferase and SRCAP complexes. J Biol Chem 2005;
280:13665-70.
13.
Wu WH, Alami S, Luk E, Wu CH, Sen S, Mizuguchi G, Wei D, Wu C. Swc2 is a
widely conserved H2AZ-binding module essential for ATP-dependent histone exchange.
Nat Struct Mol Biol 2005; 12:1064-71.
14.
Ruhl DD, Jin J, Cai Y, Swanson S, Florens L, Washburn MP, Conaway RC,
Conaway JW, Chrivia JC. Purification of a Human SRCAP Complex That Remodels
Chromatin by Incorporating the Histone Variant H2A.Z into Nucleosomes. Biochemistry
2006;45:5671-7.
98
15.
John S, Sabo PJ, Johnson TA, Sung MH, Biddie SC, Lightman SL, Voss TC,
Davis SR, Meltzer PS, Stamatoyannopoulos JA, Hager GL. Interaction of the
glucocorticoid receptor with the chromatin landscape. Mol Cell 2008; 29:611-24.
16.
Gevry N, Hardy S, Jacques PE, Laflamme L, Svotelis A, Robert F, Gaudreau L.
Histone H2A.Z is essential for estrogen receptor signaling. Genes & development 2009;
23:1522-33.
17.
Hua S, Kallen CB, Dhar R, Baquero MT, Mason CE, Russell BA, Shah PK, Liu J,
Khramtsov A, Tretiakova MS, Krausz TN, Olopade 01, Rimm DL, White KP. Genomic
analysis of estrogen cascade reveals histone variant H2A.Z associated with breast cancer
progression. Molecular systems biology 2008; 4:188.
18.
Zucchi I, Mento E, Kuznetsov VA, Scotti M, Valsecchi V, Simionati B,
Vicinanza E, Valle G, Pilotti S, Reinbold R, Vezzoni P, Albertini A, Dulbecco R. Gene
expression profiles of epithelial cells microscopically isolated from a breast-invasive
ductal carcinoma and a nodal metastasis. Proc Natl Acad Sci U S A 2004; 101:18147-52.
19.
Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T,
Pandey A, Chinnaiyan AM. Large-scale meta-analysis of cancer microarray data
identifies common transcriptional profiles of neoplastic transformation and progression.
Proc Natl Acad Sci U S A 2004; 101:9309-14.
20.
Dunican DS, McWilliam P, Tighe O, Parle-McDermott A, Croke DT. Gene
expression differences between the microsatellite instability (MIN) and chromosomal
instability (CIN) phenotypes in colorectal cancer revealed by high-density cDNA array
hybridization. Oncogene 2002; 21:3253-7.
21.
Hatch CL, Bonner WM. Sequence of cDNAs for mammalian H2A.Z, an
evolutionarily diverged but highly conserved basal histone H2A isoprotein species.
Nucleic Acids Res 1988; 16:1113-24.
22.
Nagl NG, Jr., Wang X, Patsialou A, Van Scoy M, Moran E. Distinct mammalian
SWI/SNF chromatin remodeling complexes with opposing roles in cell-cycle control.
Embo J 2007; 26:752-63.
23.
Taubert S, Gorrini C, Frank SR, Parisi T, Fuchs M, Chan HM, Livingston DM,
Amati B. E2F-dependent histone acetylation and recruitment of the Tip60
acetyltransferase complex to chromatin in late Gl. Molecular and cellular biology 2004;
24:4546-56.
24.
Samuelson AV, Narita M, Chan HM, Jin J, de Stanchina E, McCurrach ME,
Narita M, Fuchs M, Livingston DM, Lowe SW. p400 is required for El A to promote
apoptosis. J Biol Chem 2005; 280:21915-23.
25.
Kim JH, Kim B, Cai L, Choi HJ, Ohgi KA, Tran C, Chen C, Chung CH, Huber O,
Rose DW, Sawyers CL, Rosenfeld MG, Baek SH. Transcriptional regulation of a
metastasis suppressor gene by Tip60 and beta-catenin complexes. Nature 2005; 434:9216.
26.
Chan HM, M. Narita, S. W. Lowe, and D. M. Livingston. . The p400 E1Aassociated protein is a novel component of the p53 --> p21 senescence pathway. . Genes
& development 2005; 19.
99
27.
Legube G, Linares LK, Tyteca S, Caron C, Scheffner M, Chevillard-Briet M,
Trouche D. Role of the histone acetyl transferase Tip60 in the p53 pathway. J Biol Chem
2004; 279:44825-33.
28.
Tyteca S, Vandromme M, Legube G, Chevillard-Briet M, Trouche D. Tip60 and
p400 are both required for UV-induced apoptosis but play antagonistic roles in cell cycle
progression. Embo J 2006; 25:1680-9.
29.
Berns K, Hijmans EM, Mullenders J, Brummelkamp TR, Velds A, Heimerikx M,
Kerkhoven RM, Madiredjo M, Nijkamp W, Weigelt B, Agami R, Ge W, Cavet G,
Linsley PS, Beijersbergen RL, Bernards R. A large-scale RNAi screen in human cells
identifies new components of the p53 pathway. Nature 2004; 428:431-7.
30.
Gorrini C, Squatrito M, Luise C, Syed N, Perna D, Wark L, Martinato F, Sardella
D, Verrecchia A, Bennett S, Confalonieri S, Cesaroni M, Marchesi F, Gasco M,
Scanziani E, Capra M, Mai S, Nuciforo P, Crook T, Lough J, Amati B. Tip60 is a haploinsufficient tumour suppressor required for an oncogene-induced DNA damage response.
Nature 2007; 448:1063-7.
31.
Mattera L, Escaffit F, Pillaire MJ, Selves J, Tyteca S, Hoffmann JS, Gourraud PA,
Chevillard-Briet M, Cazaux C, Trouche D. The p400/Tip60 ratio is critical for colorectal
cancer cell proliferation through DNA damage response pathways. Oncogene 2009;
28:1506-17.
32.
Camp RL, Chung GG, Rimm DL. Automated subcellular localization and
quantification of protein expression in tissue microarrays. Nat Med 2002; 8:1323-7.
33.
van de Vijver MJ, He YD, van't Veer LJ, Dai H, Hart AA, Voskuil DW, Schreiber
GJ, Peterse JL, Roberts C, Marton MJ, Parrish M, Atsma D, Witteveen A, Glas A,
Delahaye L, van der Velde T, Bartelink H, Rodenhuis S, Rutgers ET, Friend SH,
Bernards R. A gene-expression signature as a predictor of survival in breast cancer. The
New England journal of medicine 2002; 347:1999-2009.
100
CHAPTER IV
IV. H3K27 DEMETHYLATION BY JMJD3 AT A POISED ENHANCER OF ANTI-APOPTOTIC
GENE BCL2 DETERMINES E R a LIGAND-DEPENDENCY
IV. 1.
Preamble
Our observations on the role of H2A.Z in ERa-positive breast cancer cells (MCF7) and
their estrogen-independent growth (Gevry et al., 2009; Svotelis et al., 2009; Svotelis et
al., 2010) led us to hypothesize on other important chromatin modifications in ERadependent transcriptional response in breast cancer. E2 cellular stimulation results in an
ERa-mediated genomic response in which ERa interacts with several coactivators at
target genes, as well as a rapid non-genomic response where ERa associates with protein
kinase signalling pathways such as that of PI3K/Akt (Ordonez-Moran and Munoz, 2009).
One known coactivator of ERa is MLL2, present in a complex that may also contain the
H3K27me3 KDM UTX and JMJD3 (Issaeva et al., 2007). We thus put forward the
theory that H3K27 demethylation may have a role in the expression of ERa target genes.
In this manuscript we present results that show the importance of H3K27me3 dynamics
in the essential process of apoptosis control in E2-positive breast cancer. We propose a
model in which a repressive chromatin state following stimulation by E2 in ERadependent cancerous cells caused by H3K27 methylation is permissive for the regulation
of BCL2 transcription by a mechanism that comprises the interdependent recruitment of
ERa and JMJD3. However, the phosphorylation of EZH2 caused by the overexpression
101
of HER2 in AE-resistant breast cancer cells prevents the methylation of H3K27
surrounding the enhancer region of BCL2, allowing the formation of an active chromatin
conformation and constitutive activation of BCL2. We believe these findings are of great
significance since we show that fundamental epigenetic mechanisms and the signature of
epigenetic marks on chromatin can provide important clues on AE-resistance and breast
cancer.
This manuscript is under revision in EMBO Journal. I performed the majority of the
experiments presented in the manuscript.
Dr. Stephanie Bianco contributed to the
execution and analysis of the microarray in Figure 4.2. Gabrielle Huppe provided an
important contribution to the execution of certain Western blot, RT-qPCR and FACS
analyses. Jason Madore and Dr. Anne-Marie Mes-Masson performed the breast cancer
TMA analysis and Alexei Nordell Markovits contributed to the clustering analysis of the
TMA. I wrote the manuscript in collaboration with Dr. Gevry, aided by discussions and
corrections from co-authors.
102
IV.2.
Manuscript
H3K27 demethylation by JMJD3 at a poised enhancer of antiapoptotic gene BCL2 determines ERa ligand-dependency
Amy Svotelis , Stephanie Bianco , Jason Madore Gabrielle Huppe , Alexei NordellMarkovits1, Anne-Marie Mes-Masson2 and Nicolas Gevry1'3
'Departement de biologie, Faculte des sciences, Universite de Sherbrooke, 2500
boulevard de PUniversite, Sherbrooke, Quebec J1K 2R1, Canada
2
Institut du cancer de Montreal, 1560 Sherbrooke Est, Montreal, Quebec, H2L 4M1,
Canada
Correspondence: [email protected]; Tel. (819) 821-8000 ext. 66013; Fax:
(819)821-8049
Submitted to EMBO Journal March 15th, 2011, under revision since April 8th, 2011
103
Abstract
Chromatin represents a repressive barrier to the process of ligand-dependent
transcriptional activity of nuclear receptors. Here we show that H3K27 methylation
imposes ligand dependent regulation of the estrogen receptor a (ERa)-dependent
apoptotic response via Bcl-2 in breast cancer cells. The activation of BCL2 transcription
is dependent on the simultaneous inactivation of the H3K27 methyltransferase, EZH2,
and the demethylation of H3K27 at the poised enhancer by the ERa-dependent
recruitment of JMJD3 in hormone-dependent breast cancer cells. Interestingly, we also
provide evidence that this pathway is modified in cells resistant to anti-estrogen (AE),
which constitutively express BCL2. We show that the lack of H3K27 methylation at
BCL2 regulatory elements due to the inactivation of EZH2 by the HER2 pathway leads to
this constitutive activation of BCL2 in these AE-resistant cells. Our results describe a
novel mechanism in which the epigenetic state of chromatin affects ligand dependency
during ERa-regulated gene expression.
104
Introduction
Estrogens (E2) are physiologically important steroid hormones that influence
proliferation, differentiation, and apoptosis in hormone-dependent breast cancer (Pearce
and Jordan, 2004). The functions of E2 are mainly mediated by ERa, a ligand-dependent
transcription factor that functions in conjunction with coregulator proteins to control gene
expression by binding to gene regulatory regions that contain an estrogen response
element (ERE) (Pearce and Jordan, 2004). Despite being an important inducer of cellular
proliferation, ERa presence in breast cancers is often prognostic of an increased survival
rate (Badve and Nakshatri, 2009). This is in part due to the development of antiestrogens
(AE), synthetic molecules that compete with E2 for binding to ERa, which have shown to
be a successful treatment in ERa-positive breast cancers (Doisneau-Sixou et al., 2003;
Normanno et al., 2005).
While AE (for example, tamoxifen (TAM) or fulvestrant
(ICI182780)) can be beneficial to a large number of patients, resistance to these drugs is a
major problem in the treatment of breast cancer (Normanno et al., 2005; Riggins et al.,
2007). Interestingly, patients can exhibit resistance in response to the initial treatment, or
can develop resistance after prolonged exposure to AE (Badia et al., 2007). Both types of
AE-resistant breast cancers show a deregulation in their ERa gene expression program
resulting in E2-independent proliferation (Badia et al., 2007; Naughton et al., 2007;
Normanno et al., 2005; Riggins et al., 2007; Sommer and Fuqua, 2001). However, the
genomic events involved in the development of AE resistance in breast cancer are not
clearly defined.
ERa regulates target gene transcription by recruiting coactivator proteins to favor
the recruitment of the basal transcriptional machinery (Pearce and Jordan, 2004). More
specifically, current models of ERa action suggest that this receptor stimulates
transcription of RNA polymerase II (RNAPII) target genes by promoting favourable
alterations in promoter structure and the formation of stable transcriptional pre-initiation
complexes on hormone-responsive promoters embedded in chromatin (Mellor, 2005).
The majority of EREs are present in enhancers that are distal from the transcription start
105
site (TSS), and lead to the formation of chromatin loops by associating with proximal
promoter regions to enhance gene expression of ERa-regulated genes (Fullwood et al.,
2009). E2 stimulation in cells can also lead to a non-genomic response, in which ERa
target gene expression is modified by actions outside the nucleus implicating the
association of ERa with membrane proteins or cytoplasmic signalling proteins, such as
AKT (Ordonez-Moran and Munoz, 2009; Razandi et al., 2002; Russell et al., 2000).
These effects are known to stimulate cell-cycle progression and inhibit apoptosis in
MCF7 cells (Arold et al., 2001; Castoria et al., 2001). Interestingly, recent research
alludes to the crossover between the genomic and non-genomic pathways of estrogen
action in the control of chromatin remodelling (Bredfeldt et al., 2010). The dynamic
nature of chromatin has been brought to light in the last decade, showing that the once
believed static nature of regularly spaced nucleosomes along DNA is actually constantly
changing in response to the cellular environment. The modifications of histones affects
nucleosome structure and determine the state of gene regulatory areas such as promoters
and enhancers (Kouzarides, 2007; Luger, 2003; Zhou et al., 2010).
In particular, several studies have highlighted the importance of histone
methylation on specific lysine residues in maintaining transcriptional programs and
determining cell fate and identity (Benevolenskaya, 2007; Cloos et al., 2008; Pasini et al.,
2004). For example, methylation of histone H3 lysine 27 (H3K.27) is an important
epigenetic modification found at the promoters of many developmentally important genes
and is involved in mammalian X chromosome inactivation, germline development, cellcycle regulation and cancer (Agger et al., 2007; Cao and Zhang, 2004; Lan et al., 2007).
Histone H3 tri-methylated lysine 27 (H3K27me3) contributes to the recruitment of the
Polycomb repressive complexes (PRCI and PRC2) on chromatin, which in turn mediate
gene silencing (Lund and van Lohuizen, 2004; Simon and Kingston, 2009). In the
protein complex PRC2, EZH2 is the mammalian methylase that adds a methyl group to
H3K27, which leads to the recruitment of other Polycomb-group proteins and silencing of
target genes (Cao and Zhang, 2004; Czermin et al., 2002; Kuzmichev et al., 2002; Muller
106
et al., 2002). However, the demethylases JMJD3 and UTX of the KDM6 family contain
a weII-conserved JmjC domain in their C-terminal regions which catalyzes the transition
of H3K27me3 and H3K27me2 to H3K27mel, therefore from a repressive to an active
chromatin conformation (Agger et al., 2007; De Santa et al., 2007; Swigut and Wysocka,
2007; Xiang et al., 2007). This histone demethylase activity can antagonize the
recruitment of the PRC complex, playing a decisive role between cellular proliferation
and differentiation in the establishment of cell fate during development (Agger et al.,
2007; De Santa et al., 2007; Jones, 2007). Genes important in the developmental process
are often considered poised, or bivalent, in that both silencing (H3K27me3) and
activating (mono and trimethylation of histone H3 lysine 4; H3K4mel/me3) marks are
present at promoter and enhancer regions (Azuara et al., 2006; Bernstein et al., 2006;
Mikkelsen et al., 2007; Rada-lglesias et al., 2011). The simultaneous presence of
H3K4me3 and H3K27me3 is characteristic of poised promoters (Azuara et al., 2006;
Bernstein et al., 2006; Mikkelsen et al., 2007) while the combination of H3K4mel and
H3K27me3 marks poised enhancers (Rada-lglesias et al., 2011). Moreover, it has also
been suggested that the perturbation of both EZH2 and JMJD3 expression and activity,
hence potentially H3K27 methylation, is implicated in carcinogenesis (Cooper and
Foster, 2009; Ding et al., 2006; Ding and Kleer, 2006; Jones, 2007; Seligson et al., 2005).
Despite the growing evidence for a prominent role of H3K27 methylation status in
transcriptional regulation and cellular function, the understanding of their contribution in
establishment of hormone-dependent cancer, is still limited.
In this study we show that the anti-apoptotic ERa target gene, BCL2, is
differentially regulated in different breast cancer cell types, due to a modification in the
chromatin template at a poised enhancer element. In hormone-responsive breast cancer
cells (MCF7), JMJD3 and ERa work in concert to remove the repressive H3K27me3
mark from the poised (yet silent) enhancer region to permit appropriate gene activation
and anti-apoptotic effects following E2 stimulation. However, in cells that are no longer
responsive to hormones, resistant to AE and overexpress HER2, the balance shifts
107
towards a non-genomic constitutive activation of BCL2 by the prolonged HER2/AKT
mediated inactivation of the methyltransferase EZH2. In this case the structure of the
enhancer region is no longer poised but active due to a lack of H3K.27 methylation, and
the participation of JMJD3 is no longer required. Therefore, we propose a model in
which the modification of the chromatin environment of the BCL2 enhancer region
imposes ligand dependency in hormone-responsive cells, and this epigenetic mark is
deregulated in the acquisition of AE resistance in breast cancer.
Results
Depletion of JMJD3 induces apoptosis in ERa-dependent breast cancer.
To investigate the role of JMJD3 and its H3K27 demethylase activity in E2-dependent
cell proliferation, we first proceeded with short hairpin-RNA (shRNA)-mediated
knockdown of JMJD3 and analysed cell cycle distribution using fluorescent activated cell
sorting (FACS) in the ERa-positive breast cancer cell line, MCF7. The shJMJD3-l and
shJMJD3-2 constructions efficiently depleted both mRNA and protein levels of JMJD3 as
compared to the scrambled shRNA (shCTL) and the non-functional construction
shJMJD3-nf controls (Figure 1A-B). Following depletion of JMJD3 expression in MCF7
cells in complete media, we observed by fluorescent activated cell sorting (FACS)
analysis the presence of sub-Gl fluorescence (21% as compared to 0,4 % in the shCTL
and 0.6% in shJMJD3-nf cells), characteristic of DNA degradation and indicative of cell
death.
A representative FACS analysis and the overall analysis are depicted in
Supplemental Figure 1A and B. Considering that E2 has been shown to inhibit apoptosis
in the mammary gland during menstrual cycle and in breast cancer MCF7 cells (Ferguson
and Anderson, 1981; Kyprianou et al., 1991; Teixeira et al., 1995), we investigated
whether the degraded DNA content seen in the FACS analysis was due to apoptosis. As
described previously, staining for annexin-V/PI followed by FACS analysis showed the
inhibitory effect of E2 on this marker of apoptosis in MCF7 cells (approximately 19.8%
of apoptotic cells to 1.4% in E2-treated cells; Figure 1C-D). However, cellular depletion
of JMJD3 using the shJMJD3-l and shJMJD3-2 constructs dramatically increased
108
JMJD3
mm~~mm>m»>
ER«
. « * « » w
Actin
s<?
SWMJ03-1
»hJMJD3-2
+E2
100
10'
102
io 5
IOMO 0
10*
ib 2
ib 3
ibMb 0
ib*
1b2
io 3
ib4 Vo°
io 1
10* ~io*
- Annextn-V
io 4
•
Figure 4- 1: JMJD3 causes apoptosis in ERa-positive breast cancer cells.
The shRNA construct shJMJD3-l and shJMJD3-2 efficiently reduce both RNA (A)
(shown by qPCR) and protein (B) (shown by Western blotting) levels of JMJD3 in MCF7
cells. ERa and Actin have been used to show the specificity of the JMJD3 knockdown
and as a loading control. (C) Representative apoptosis analysis using annexin-V/PI
staining and flow cytometry of MCF7 cells depleted with shCTL, shJMJD3-l, shJMJD32 or shJMJD3-nf treated with vehicle (-E2) or 17p-estradiol (+E2) for 24h. Flow
cytometry profile represents annexin-V staining in x axis and PI in y axis. (D) The
graphical representation annexin-V/PI staining and flow cytometry of MCF7 cells (data
shown are the mean ± S.E. of three independent experiments).
109
apoptosis in E2-treated cells (33.9% and 24.7 respectively) compared to the shCTL
(1.4%) and shJMJD3-nf (0.9%)(Figure 1C-D). Moreover, ERa-negative MDA-MB-231
cells did not undergo apoptosis following JMJD3 depletion (Figure S2A), suggesting that
the effect of JMJD3 is specific to E2 responsive cells. Taken together, these observations
suggest that JMJD3 plays an important role in the control of apoptosis in ERa-dependent
breast cancer cells.
JMJD3 controls the apoptotic program through the transcriptional regulation of the
anti-apoptotic gene BCL2.
In order to discern the E2-dependent transcription program associated with the observed
apoptotic response, we investigated global gene expression in MCF7 cells depleted or not
of JMJD3. Surprisingly, 151 of 274 E2-upregulated genes (55%) are negatively affected
by the loss of JMJD3 (Figure 2A and Table SI). As shown in Figure 2B, cellular
depletion of JMJD3 was found to significantly reduce the E2-dependent induction of
well-known ERa-regulated genes, such as PR, TFF1, GREB1, IGFBP4 and CCND1,
while the GAPDH housekeeping gene remains unaffected. We next classified the mRNA
enriched in each subclass on the basis of gene ontology (GO) annotation using the
PANTHER classification system and searched for a functional enrichment in the
apoptosis related genes. Notably, the GO analysis revealed functions related to cellular
(19.8%) and metabolic process (23.3%), as well as the cell cycle (11%) and
communication (9.1%) (Figure 2C). More specifically, we observed an enrichment in a
small subset of genes implicated in apoptosis (2.6%). Since JMJD3 mostly plays a
positive role in gene activation and its depletion causes apoptosis, we then considered
genes implicated in the inhibition of apoptosis (Table S2). Interestingly, in this subset of
genes, we observed the presence of BCL2, one of the most important anti-apoptotic genes
regulated by ERa in MCF7 breast cancer cells (Perillo et al., 2008). Consistent with the
previous observation on the positive role of JMJD3 on the regulation of ERa-regulated
genes, specific depletion of JMJD3 by shRNA-mediated knockdown blocked the ERa-
110
E2-upregulated
genes
shJMJD3-repressed
genes
OshCTL-E2
• shCTL +E2
BshJMJD3-1 -E2
• shJMJD3-1 +E2
TFF1
GREB1 IGFBP4 CCND1 GAPDH
• Apoptosls
• Cell communication
• Cellular process
D Localization
D Transport
• Cellular component organization
• System process
M Reproduction
• Response to stimulus
• Regulation of biological process
D Homeostatic process
B Developmental process
• Generation of precursor metabolites
m Metabolic process
• Cell cycle
• Immune system process and energy
-E2
+E2
Q-E2
Bcl-2
• +E2
GAPDH
¥ ^
ShCTL
¥¥ #>
<?
shJMJD3-1 shJMJD3-nf
D shCTL
• shJMJD3-1
Bcl-2
GAPDH
vector
Bd-2
111
Figure 4- 2: JMJD3 regulates BCL2 gene transcription in ERa-positive cells.
(A) Venn diagram showing the number of E2 upregulated genes significantly affected by
the knockdown of JMJD3 in MCF7 cells. (B) Expression levels of PR, TFF1, GREB1,
IGFBP4, CCND1 and GAPDH in MCF7 cells depleted or not of JMJD3, and in absence
or presence of E2 for 4h. mRNA expression levels were determined by qPCR and
normalized against expression levels of the 36B4 ribosomal gene. (C) Pie chart showing
gene ontology composition of genes affected by the knockdown of JMJD3 after E2
treatment in MCF7 cells. (D) Relative expression of BCL2 in MCF7 cells treated with
vehicle or E2 and depleted or not in JMJD3 using specific shRNA constructs. (E)
Immunoblot assay showing the effect of JMJD3 and UTX depletion on BCL2 protein
expression in MCF7 cells (GAPDH used as loading control). (F) Immunoblot assay
showing the overexpression of the Bcl-2 protein MCF7 cells as compared to the empty
vector control (GAPDH used as loading control). (G) The graphical representation
annexin-V/PI staining and flow cytometry of MCF7 cells that overexpress Bcl-2
following the depletion of JMJD3 (data shown are the mean ± S.E. of three independent
experiments).
dependent activation of BCL2 expression in MCF7 cells in an ERa-specific manner
(Figure 2D-E), while no effect was observed on BCL2 by depletion of JMJD3 in MDAMB-231 cells (Figure S2B). Importantly, this effect was specific to the knockdown of
JMJD3, as the shRNA-mediated depletion of UTX, another H3K27me3 demethylase of
the same family, did not have the same effect (Figure S3 and 2E). To confirm that the
apoptotic program affected by JMJD3 depletion is due to the anti-apoptotic effects of
Bcl-2, we over-expressed Bcl-2 in JMJD3-depleted MCF7 cells (Figure 2F). We show
by FACS analysis following annexin-V/PI staining that the addition of Bcl-2 renders the
cells resistant to apoptosis observed in JMJD3-depleted cells (Figure 2G). Collectively,
these results suggest that JMJD3 prevents ERa-positive breast cancer cells from entering
apoptosis via its control of E2-dependent BCL2 gene expression.
112
JMJD3 is recruited to the surrounding binding region of ERa in the BCL2 enhancer
region upon E2 signalling.
To
gain
insight
into
how
JMJD3
regulates
BCL2 expression,
chromatin
immunoprecipitation (ChIP) assays were used to identify the preferential localization of
JMJD3 within or near the BCL2 promoter region. Based on the report indicating that
BCL2 is regulated by 2 different promoters, PI (the principal promoter) and P2 and has
two estrogen response elements (ERE) in the enhancer present in the coding region of the
gene (Perillo et al., 2008) (Figure 3A), we surveyed these BCL2 regulatory regions by
ChIP. To determine the transcriptional program of BCL2 following ERa-dependent
activation, ChIP assays were performed at 0 and 30 minutes after E2-stimulation in
MCF7 cells. As expected, ERa was recruited to the ERE sites in the coding region of
BCL2 as well as at the PI promoter area (Figure 3B). JMJD3 colocalised with ERa at
both the active PI promoter and the ERE enhancer regions (Figure 3C). Moreover, this
recruitment of JMJD3 upon E2 treatment was associated with a decrease in H3K27me3
(Figure 3D) in proximity of the ERE enhancer region of BCL2. Since H3K27me3 is a
transcriptionally repressive chromatin mark that has been associated with poised
promoters and enhancers at important developmental genes (Bernstein et al., 2006;
Burgold et al., 2008; Jorgensen et al., 2006; Sharov and Ko, 2007), we verified the
presence of active transcriptional marks such as RNAPII, H3K4me3, H3K4mel, and
histone variant H2A.Z, using histone H3 to control nucleosome density. The results
demonstrate that RNAPII (Figure 3E), H3K4me3 (Figure 3F) and H2A.Z (Figure 3G)
were present before E2 treatment at the PI promoter and increased at the ERE after
induction. The simultaneous presence of ERa, JMJD3, RNAPII, H3K4me3 and H2A.Z
at the PI promoter and the ERE enhancer region after E2 treatment may be at least partly
a consequence of the formation of an active DNA loop, an event that has been previously
shown to be an important step in BCL2 gene activation in response to E2 (Perillo et al.,
113
TSS
-1599
-1599
TSS
ERE2
ERE2
-1599
TSS
ERE2
-1599
TSS
ERE2
-1599
TSS
ERE2
0 8n
D-E2
• +E2
£•06o
04.
2
0 2-
5& 3
a
0£
00.
-1599
TSS
ERE2
• -E2
• +E2
N
a
-1599
TSS
ERE2
2-
Figure 4-3 : JMJD3 colocalizes with ERa at the BCL2 promoter.
(A) Diagram of the BCL2 promoter regions (PI and P2), its regulatory elements (ERE),
and segments used for qPCR. (B-G) ChIP analysis showing the location of ERa (B),
JMJD3 (C), H3K27me3 (D), RNAPII (E), H3K4me3 (F), and H2A.Z (G) at the BCL2
promoter treated with vehicle or E2 for 30 minutes in MCF7 cells.
114
2008). Furthermore, H3K4mel, indicative of a poised enhancer, colocalized with
H3K27me3 at the BCL2 enhancer region (Figure 3H).
Another characteristic of
enhancers is their relative nucleosomal depletion compared to surrounding regions (He et
al.). Using formaldehyde-assisted isolation of regulatory elements (FAIRE), we observed
that the BCL2 enhancer region is nucleosome-depleted both before and after E2
activation, as well as both before and after H3K27me3 removal by JMJD3 (Figure S4).
Taken together, these results show that JMJD3 is recruited to the surrounding binding
region of ERa in the BCL2 enhancer region, and that the repressive H3K27me3 mark is
actively removed upon E2 treatment.
The presence of ERa and JMJD3 at the BCL2 enhancer region are interdependent.
Many studies have shown that ERa can target the recruitment of histone modifying
enzymes such as p400, CBP/p300, Tip60, CARM-1, and RNAPII to gene promoters
(Gevry et al., 2009; Metivier et ai., 2003). To establish the order in which ERa and
JMJD3 are recruited to the BCL2 enhancer region, we performed ChIP analyses at 0, 15,
30, 45 minutes after E2 stimulation. The results show that ERa, RNAPII, and JMJD3
were concomitantly recruited, with maximal recruitment after 15 minutes, followed by
reduction to pre-treatment levels after 45 minutes (Figure 4A).
Furthermore, the
recruitment of JMJD3 corresponded to an increase in H3K27mel after 15 minutes of
induction and a decrease in H3K27me3, suggesting that JMJD3 could be responsible for
the transformation of the repressive H3K27me3 mark into transcriptionally-permissive
H3K27mel (Figure 4A). Surprisingly, H3K27mel and H3K27me3 were depleted after
45 minutes of induction (Figure 4A). Considering that the ERE binding sites are located
in exon 2 of the BCL2 gene (Perillo et al., 2008), our observation might be explained by
the dynamics of H3K27mel replacement by an unmodified histone H3 during
transcriptional elongation by RNAPII. Because these results did not permit us to clearly
determine the active recruitment hierarchy of JMJD3 and ERa to the BCL2 enhancer
region, we examined the recruitment of JMJD3, ERa and H3K27me3 at the ERE
following treatment with the estrogen receptor antagonists, ICI182780 (ICI) or tamoxifen
115
(TAM).
Mechanistically,
ICI
causes
rapid
degradation
of
ERa
by
the
ubiquitin/proteasome pathway(Fan et al., 2003; McClelland et al., 1996). TAM acts by
competing with E2 as a ligand for ERa thus inducing a conformational change in the AF2 domain of ERa, which then blocks its interaction with coactivators such as SRC-1,
D ICI+E2
shCTL
shJMJD3-1
shCTL
shJMJD3-1
Figure 4-4 : Presence of ERa and JMJD3 at BCL2 are interdependent.
(A) Recruitment kinetics of ERa, RNAPII, JMJD3, H3K27me3 and H3K27mel after E2
treatment in MCF7 cells. (B) ChIP analysis of ERa, H3K27me3 and JMJD3 recruitment
before and after treatment with E2 or tamoxifen (TAM) for 30 minutes, or ICI 180,782
for 24hr followed by E2 for 30 minutes. (C-F) ChIP assay showing the effect of JMJD3
depletion on the recruitment of JMJD3 (C), H3K27me3 (D), ERa (E), and RNAPII (F).
The primers used in these experiments correspond to the ERE (ERE2) of the BCL2 gene.
116
GRIP1 and CBP/p300 (Shang et al., 2000). As expected, TAM treatment induced
recruitment of ERa to the enhancer region of BCL2, while the pre-incubation of MCF7
cells with ICI following E2 treatment abolished its recruitment (Figure 4B). JMJD3
recruitment was affected by TAM or ICI treatments, and H3K27 methylation status
remained unchanged (Figure 4B). These results suggest that JMJD3 recruitment and
H3K27me3 demethylation at the BCL2 enhancer region are regulated in an ERa liganddependent manner. Since H3K27me3 is a repressive mark in transcriptional processes,
we investigated the role of JMJD3 and H3K27me3 demethylation in the transcriptional
regulation of BCL2 in response to E2 by ChIP experiments in cells depleted in JMJD3.
Using antibodies directed against JMJD3 (as a control), H3K27me3, ERa and RNAPII,
we observed that depletion of JMJD3 specifically abolished the recruitment of JMJD3
and the demethylation of H3K27me3 at the enhancer region upon E2 treatment (Figure
4C-D). Notably, JMJD3 depletion in MCF7 cells reduced the recruitment of both ERa
(Figure 4E) and RNAPII (Figure 4F) in presence of E2. Together, these results suggest
that localization of JMJD3 and ERa at the enhancer region of BCL2 are co-dependent,
and that both are simultaneously required for proper E2-dependent BCL2 transcriptional
activation.
Inactivation of EZH2 methy transferase activity by non-genomic pathways controls
BCL2 transcription and apoptosis in AE-sensitive and AE-resistant breast cancer
cells.
The removal of H3K27me3 on chromatin is not entirely dependent on the activity
of demethylases, as the phosphorylation of serine 21 of EZH2 (pEZH2) via the AKT
pathway impedes EZH2 binding to histone H3, resulting in a global decrease in
H3K27me3 (Cha et al., 2005). Of note, the AKT pathway is involved in the non-genomic
effects associated with ERa target gene expression (Bredfeldt et al., 2010; Castaneda et
al., 2010; Sun et al., 2001). In AE-resistant breast cancer cells the overexpression of
HER2 is sufficient to activate the AKT pathway (Jones, 2007; Kumar et al., 1996; Schiff
et al., 2004). To observe the possibility of a negative relationship between HER2 levels
117
(thus, implicating the AKT pathway) and H3K27me3 in different types of breast cancer,
we performed immunohistochemistry analysis on a breast cancer tissue microarray
(TMA) composed of surgical breast samples. Using a scale from 0-3, we scored the
intensity of immunostaining for H3K27me3 and HER2 and categorised the samples into
two main groups, low (0-1) or high (2-3). Hierarchical clustering using Euclidian
distance was performed on the data segregating the tumors into four groups based on
these two markers. Heatmap visualisation reveals the largest cluster to present a high
presence of H3K27me3 versus a low presence of HER2 with 67/118 samples, or 56.8%
(Figure 5A). Representative immunostaining examples of each group are shown in Figure
5B. Furthermore, a Chi-Square test of independence on the expression levels show the
presence of equivalent levels does not follow a random distribution (X2 (1, N = 118) =
7.627, p = 0.006), suggesting a relationship between H3K27me3 and HER2 levels.
Considering the link between HER2, AKT pathway, pEZH2 and H3K27
methylation and the importance of HER2 in the development of AE resistance, we next
aimed to investigate the effects of the deregulation of H3K27me3 in the ERa-dependent
apoptotic response in AE-resistant cells that overexpress HER2. Since no data on AE
resistance is available in the TMA, we used three different MCF7-derived AE-resistant
cell lines: MCF7/LCC2 (LCC2), which were developed by the selection of MCF7 cells
resistant to TAM (Brunner et al., 1993), MCF7/LCC9 (LCC9) cells that are resistant to
TAM and ICI (Brunner et al., 1997) and MCF7/HER2-18 (HER2), which artificially
overexpress HER2 (Benz et al., 1992). All of these cell lines show a high level of AKT
activation and have an E2-independent phenotype, despite that they express ERa (Wang
et al., 2006). Interestingly, we observed that JMJD3 knockdown in the AE-resistant cell
lines LCC2, LCC9 and HER2 did not affect cell survival, as determined by annexin-V/PI
and FACS analysis (Figure 5C). To link these observations with those from our TMA,
we sought to use cell lines representative of the high-low and low-high clusters. MCF7
are known to exhibit low levels of HER2 (Wang et al., 2006), so these cells may
correspond to the high-low cluster from the TMA. The non-genomic E2 response leads
118
to the rapid AKT-mediated pEZH2 in MCF7 cells, which we confirmed by analysis of
pEZH2 following E2 treatment of 30 minutes (Figure 5D). This correlated with a global
decrease in H3K27me3 after 16h treatment with E2 (longer E2 treatment was necessary
to observe a change in H3K27me3 status due to the stability of this chromatin mark
(Jones, 2007)), which was inhibited by the pre-treatment of MCF7 with the AKT
inhibitor LY294002 (Figure 5D). We monitored the levels of pEZH2 in LCC2 cells
under basal media conditions and found that they were much higher in LCC2 than in
MCF7 cells, accompanied by a general decrease in H3K27me3 levels in LCC2 cells
(Figure 5D). Therefore, MCF7 cells mimic the high-low cluster from the TMA, while
MCF7/LCC2 cells represent the low-high category.
119
HWJTroeS
H«J
4(h
D
•
•
D
MCF7
E2
LY
HER2
LCC2
MCF7
+
+
+
•m* —
i
H3K27me3
1pEZH2
EZH2
LCC2
- LY
• - jH3K27me3
^IWPP" ^Wff!^ ^^^^^^ ^^^^^
B
LCC9
LCC2
+
i^WMBSfci milMCF7
- E2
shCTL
shCTL+E2
shJMJD3-1
SWMJD3-1+E2
H3
Her-2
D shCTL
• shCTL+E2
• shJMJD3-1
D shJMJD3-1+E2
MCF7
LCC2
120
Figure 4-5 : AE-resistant cells have a modified H3K27me3 chromatin signature that
alters BCL2 transcriptional activity.
(A) Heat map representing the hierarchical cluster analysis performed on the breast
cancer TMA, separated into four different clusters based on H3K27me3 and Her2
immunoreactivity scores from 0-3: low-low, high-low, low-high, and high-high.
Percentages were calculated from the number of patients in a category divided by the
total number of patients. Representative immunostaining of each cluster is shown in (B).
(C) Representative plots of annexin-V/PI staining and flow cytometry analysis of AE
resistant cells MCF7/LCC2, MCF7/Herl8, and MCF7/LCC9 depleted with shCTL or
shJMJD3-l and treated with vehicle or E2 for 24h. (D) Immunoblot assay showing the
levels of phospho-EZH2 (pEZH2) as compared to total EZH2 and H3K27me3 (H3 as a
loading control) in MCF7 cells treated with vehicle or E2 for 30 min (pEZH2) or 16h
(H3K27me3) and LCC2 treated with Akt inhibitor LY294002 for 72h. (E) Comparison
of BCL2 mRNA expression levels in MCF7 and LCC2 cells depleted or not of JMJD3,
and in absence or presence of E2 for 4h.
In order to further investigate the influence of HER2/AK.T and H3K27
methylation status on the development of AE resistance, we employed LY294002 to
inhibit EZH2 phosphorylation in LCC2 cells. The levels of pEZH2 greatly decreased to
an almost undetectable level in the presence of LY294002 in LCC2 cells, which resulted
in a corresponding increase in global H3K27me3 (Figure 5D). We then asked whether
JMJD3 depletion has an effect on BCL2 expression in AE-resistant LCC2 cells. We
found that AE-resistant cells constitutively express high levels of BCL2 that are not
altered by E2 or TAM treatments (Figure 5E and S4). Moreover, when JMJD3 was
depleted in MCF7/LCC2, we did not observe downregulation of BCL2 compared to
MCF7 cells (Figure 5E), suggesting that the JMJD3-mediated transcriptional regulation
of BCL2 does not occur in the AE-resistant cell line. Overall, these results suggest the
simultaneous implication of the non-genomic and genomic pathways in the control of
121
H3K27me status and perturbation of one of these pathways may affect BCL2 expression
and the apoptosis response.
Inactivation of the EZH2 methyltransferase activity bypasses the need for JMJD3 in
the transcriptional regulation of BCL2 in breast cancer cells.
In light of our observations in the LCC2 cell line, we hypothesized that the
H3K27me3 repressive mark is absent at the BCL2 promoter in these cells, leading to
uncontrolled constitutive activation of BCL2. In support of this hypothesis, by interfering
with the activity of EZH2 by the depletion of its essential partner SUZ12 (Pasini et al.,
2004), we observed an increase the basal expression levels of BCL2 in MCF7 cells
(Figure S6). Furthermore, a ChIP assay comparing the enhancer region of BCL2 in
MCF7 and LCC2 cells (Figure 6A) showed not only that ERa and RNAPII are present
without E2 stimulation, but also that the repressive H3K27me3 mark is clearly absent, a
result consistent with the lower levels of EZH2 binding to the BCL2 enhancer observed in
our ChIP assays in LCC2 (Figure 6B). These findings indicate that the absence of the
repressive H3K27me3 mark renders the presence of JMJD3 obsolete. We then blocked
EZH2 phosphorylation with LY294002 treatment and observed by ChIP assays that we
were able to restore a repressive state to the BCL2 enhancer region (Figure 6C) and
decrease gene expression (Figure S7). When AKT activity was inhibited in absence of E2
stimulation, we observed that the binding of ERa and RNAPII were decreased to basal
levels in LCC2 (Figure 6C). More importantly, the level of H3K27me3 increased and the
binding of EZH2 was restored (Figure 6C and 6D).
To confirm the importance of EZH2 phosphorylation status on the Bcl-2 regulated
apoptotic program in breast cancer cells and AE resistance, we investigated the effects of
EZH2 mutants in MCF7 cells. The mutants were created by converting serine 21 either
into alanine to block any potential phosphorylation (EZH2-S21A), or into aspartic acid to
imitate the phosphorylated state (EZH2-S21D) (Cha et al., 2005). The overexpression of
EZH2-S21D in JMJD3-depleted MCF7 cells did not lead to apoptosis, while the
122
overexpression of wild type EZH2 or EZH2-S21A still showed the typical apoptotic
pattern of JMJD3-depleted MCF7 cells (Figure 6E-F). This result is corroborated by a
restoration of induced levels of BCL2 in JMJD3-depleted MCF7 cells that overexpress
EZH2-S21D (Figure 6G). So, a decrease in H3K27me3 due to EZH2 phosphorylation is,
at least in part, responsible for the increased expression of Bcl-2, resulting cell survival.
To further link these observations to AE resistance, we performed these tests in MCF7
cells in the presence of increasing concentrations of tamoxifen (0, 5, 10, 15, 20 and 25
uM) for 48h.
Concentration-dependent apoptosis was observed in the presence of
tamoxifen (Figure S8). Due to the high levels of cell death in increased concentrations
FACS analysis following annexinV/PI staining was measured in the cell lines exposed to
0, 5 and 10 uM tamoxifen,. Of note, the overexpression of EZH2-21D and Bcl-2 led to a
resistance to tamoxifen-induced apoptosis (Figure 6H). Taken together, these results
show that perturbation of H3K27 methylation by the phosphorylation of EZH2 affects
BCL2 gene expression and the regulation of the apoptotic pathway, thus contributing to
the acquisition of AE resistance in breast cancer.
123
CD
Relative BCL2 mRNA levels
tow
MM
m
ERa,H3K27me3
(% Input)
O
ERa. JMJD3, H3K27me3
(% Input)
Figure 4-6 : Inactivation of the EZH2 methyltransferase activity by the HER2/AKT
pathway bypasses the need for JMJD3 at the BCL2 enhancer region in AE-resistant
cells.
(A) ChIP analysis comparing the levels of ERa, JMJD3, RNAPII and H3K27me3 in
MCF7 and LCC2 cells in the absence of E2. The qPCR analysis was performed using
primers corresponding to the ERE (ERE2) of the BCL2 gene. (B) ChIP assays showing
the levels EZH2 in MCF7 and LCC2 cells at ERE binding site in absence of E2. (C-D)
ChIP experiments showing the effects of AKT inhibitor (LY294002) on the recruitment
of ERa, RNAPII, H3K27me3 (C), and EZH2 (D) at the ERE2 BCL2 binding site in
LCC2 cells. (E) Immunoblot assay showing the overexpression of myc-tagged wild type
EZH-2 (EZH2) and mutants EZH2-21A and EZH2-21D proteins in MCF7 cells as
compared to the empty vector control using the antibody against the Myc tag (GAPDH
used as loading control). The graphical representation of annexin-V/PI staining and flow
cytometry (F) and qPCR analysis of mRNA expression of BCL2 (G) in MCF7 cells that
overexpress EZH2 and mutants following the depletion of JMJD3 (data shown are the
mean ± S.E. of three independent experiments). (H) Annexin-V/PI staining and flow
cytometry analyses of EZH2 and EZH2 mutant MCF7 cell lines following treatment with
0, 5, and lOuM TAM for 48h (data shown are the mean ± S.E. of three independent
experiments).
Discussion
In breast cancer, E2 both promotes proliferation of abnormal cells by regulating
the expression of cell cycle-related genes, and prevents apoptosis in these cells by
increasing the expression of the anti-apoptotic gene BCL2 (Perillo et al., 2008; Teixeira et
al., 1995). Bcl-2, a key player in the regulation of cell cycle and development of
carcinogenesis, is often highly expressed in cancer and is associated with ERa status and
more malignant breast cancers (Perillo et al., 2008; Teixeira et al., 1995). In this study,
we show that the importance of the modification of an epigenetic mark, H3K27me3, to
allow proper ligand-dependent regulation of BCL2 in breast cancer cells. We observed
125
that during the E2-mediated apoptotic response in MCF7 cells, the co-recruitment of ERa
and JMJD3 to the enhancer of the anti-apoptotic gene BCL2 results in H3K27me3
demethylation and subsequent gene activation. Therefore, we propose that the repressive
chromatin state caused by H3K27 methylation in ERcc-dependent cancerous cells is
permissive for the regulation of BCL2 following stimulation by E2 transcription by a
mechanism that comprises the interdependent recruitment of ERa and JMJD3. The
knockdown of JMJD3 in this context causes apoptosis, since the cells are rendered more
sensitive to apoptotic demise in the absence of expression of the anti-apoptotic gene
BCL2.
It is of interest that the enhancer region of BCL2 in unstimulated MCF7 cells
mirrors a poised enhancer signature (H3K4mel/H3K27me3) similar to what is observed
in a subset of key developmental regulatory genes (Rada-Iglesias et al., 2011). Studies
into the control of poised promoters in developmental genes (H3K4me3/H3K27me3)
show that their activation requires the actions of cell signals to recruit transcription
factors which can bind to and recruit JMJD3 to chromatin (Bernstein et al., 2006;
Jorgensen et al., 2006; Sharov and Ko, 2007). Our results are in agreement with research
on developmentally regulated genes, yet provide an interesting novel role of the
demethylation of H3K27me3 outside this subset of genes. We show here for the first
time the involvement of a demethylase, JMJD3, in the resolution of a poised enhancer
region by its association with a hormone-dependent transcription factor, ERa, on the
chromatin template to regulate a gene that is critical in cell survival. Our finding that
H3K27me3 acts as a barrier to the binding of ERa in the ERE enhancer region suggests a
twofold role of JMJD3 in the proper regulation of BCL2 and apoptosis in E2-dependent
breast cancer cells. JMJD3 could first act by tightly regulating the accessibility to DNA
in important distal control regions, and second by altering chromatin structure to permit
communication between distal regulatory elements and the proximal promoter region
(Figure 7).
126
We also observed that the binding of H2A.Z was pre-bound at BCL2 and
colocalised with ERa and JMJD3 binding following E2 stimulation (Figure 4). It is
possible that, in addition to JMJD3, H2A.Z is required for the activation of BCL2 in
response to E2 in breast cancer cells, contributing to the anti-apoptotic characteristic of
these cells. Interestingly, H2A.Z binds SUZ12 target genes in mouse embryonic stem
cells, and the specific depletion in this context leads to the derepression of PcG targets
(Creyghton et al., 2008). H2A.Z has been highly associated with gene activity in
mammalian cells, so this result was surprising. However, it is possible that H2A.Z
colocalisation to these areas promotes the bivalency of such genes, poising the promoter
for activation. One avenue that remains to be explored is the role of H2A.Z in preventing
apoptosis. The depletion of p400, catalytic protein responsible of the H2A.Z
incorporation into chromatin, has been shown to lead to apoptosis in several cancer cell
lines (Mattera et al., 2010; Mattera et al., 2009), and we observed in increase in TAMinduced apoptosis in MCF7 cells in the absence of H2A.Z (A. Svotelis, unpublished
results).
The role of H2A.Z in pro- and anti-apoptotic gene regulation would be
interesting to pursue, especially considering the known association of H2A.Z with p53
and ERa, two known regulators of apoptotic genes (Gevry et al., 2007; Gevry et al.,
2009; Svotelis etal., 2010).
Our studies also demonstrate that the perturbation of the H3K27 methylation
pathway considerably affects the apoptosis program in breast cancer cells. Polycomb
group proteins have been associated with carcinogenesis, namely by the control of
senescence via the repression of the INK4/ARF locus (Agger et al., 2009; Barradas et al.,
2009). In this case, JMJD3 derepresses this locus, leading to cell cycle arrest and
suggesting a tumor-suppressive role for JMJD3. Conversely, our results suggest that in
the context of ERa-dependent breast cancer, JMJD3 promotes cellular growth by
promoting the expression of the anti-apoptotic gene BCL2. Our results with JMJD3 are
supported by the increase in the basal expression levels of BCL2 shown by depletion of
SUZ12 in MCF7 cells (Figure S5). Recently, overexpression of JMJD3 and demethylase
127
activity has been shown to contribute to the pathogenesis of Hodgkin's Lymphoma
(Anderton et al.).
In addition, several studies suggest that EZH2 is a promising
prognostic biomarker in breast cancer (Collett et al. 2006; Raaphorst et al. 2003;
Buchmann et al. 2006). Moreover, decreased survival is observed in patients with low
H3K27me3 levels (Wei et al., 2008). In fact, EZH2 overexpression is related more with
the aggressive ER-negative breast cancer subtype and breast cancer invasion (Cao et al.,
2008; Gonzalez et al., 2009; Wei et al., 2008). However, we (and others (Bredfeldt et al.,
2010)) have shown that the overexpression of HER2 leads to Akt-mediated
phosphorylation of EZH2 in more severe, AE-resistant breast cancer, decreasing global
H3K27me3 levels. The levels of pEZH2 and global H3K27me3 in the aggressive breast
cancers that exhibit increased EZH2 were not verified in previous studies, so it is possible
that EZH2 overexpression in conjunction with HER2 overexpression does not lead to
increased H3K27me3. Interestingly, we also observe a negative relationship in breast
biopsy samples between H3K27me3 and HER2, a marker of AE-resistant breast cancer
(Figure 5A and B).
These results suggest a context-dependent role for JMJD3 and H3K27me3 in
different cell types, and led us to speculate on the role of the HER2/AKT inactivation of
EZH2 by phosphorylation in AE-resistant cells. The HER2/Akt dependent modification
of EZH2 decreases H3K27 methylation (Cha et al., 2005) which has been strongly
implicated in the development of AE resistance in breast cancer cells (Schiff et al., 2004;
Shou et al., 2004). The phosphorylation of EZH2 caused by the overexpression of HER2
in AE-resistant breast cancer cells prevents the methylation of H3K27 surrounding the
enhancer region of BCL2, allowing the formation of an active chromatin conformation
and constitutive activation of BCL2. The overall consequence is a bypass of the need for
JMJD3 for transcriptional activation (Figure 5E). It is of particular interest that the
constitutive expression of the proto-oncogene BCL2 has been shown to prevent apoptosis
after AE treatment in breast cancer cells (Figure 5H). Taken together, our results
strongly suggest that the regulation of BCL2 expression in AE-sensitive breast cancer
128
cells requires the simultaneous and coordinated implication of the genomic and nongenomic pathway in the regulation of BCL2 by the implication of the effectors of H3K27
methylation, EZH2 and JMJD3. In AE-sensitive cells, upon E2 induction, both pathways
converge rapidly to activate the BCL2 gene transcription by suppressing the
methyltransferase activity of EZH2 and by recruiting JMJD3 through ERa to remove the
H3K27 mark at the enhancer region of BCL2. This regulation is sensitive to AE, as
observed by a lack in BCL2 activation in presence of tamoxifen.
However, in the
acquisition of AE resistance, BCL2 becomes constitutively activated due to the
overactivation of the HER2/AKT pathway which results in a global decrease in
H3K27me3 that circumvents the requirement of JMJD3 at the BCL2 enhancer region.
To summarise, we propose that there exists a balance between the genomic and
the non-genomic pathways in the epigenetic regulation of transcription of ERa target
genes during cellular stimulation with E2, as is the case for BCL2 in our E2-responsive
MCF7 cell line (Figure 7). MCF7 cells remain responsive to external stimuli, such as E2,
which results in the rapid regulation of BCL2 expression. First, the induction of AKT
activity by the ERa non-genomic pathway results in the phosphorylation of EZH2 and its
subsequent removal from the chromatin template, preventing further H3K27 methylation
(Figure 7). Secondly, the ERa genomic response leads to the concomitant binding of
ERa and JMJD3 at the BCL2 enhancer region and the demethylation of H3K27me3,
favoring a transcriptionally active state. The contribution of HER2 remains negligible in
E2-responsive cells, seeing as HER2 levels are low and the activation of AKT by the ERa
non-genomic response is favored. However, the disruption of the balance between ERa
and HER2 signalling by the overexpression of HER2 often observed in AE-resistant
cancer cells results in the superactivation of the end result of the ERa non-genomic
pathway (pEZH2 by AKT) in the absence of extracellular stimuli. Thus, the continual
phosphorylation of EZH2 leads to a global decrease in H3K27me3, affecting the ERa
transcriptional program.
Our findings show that not only modifications in cellular
signalling pathways are required to transform cancerous cells into AE-resistant cells, but
129
that an important key to understand this phenomenon lie in the fundamental epigenetic
mechanisms and the signature of epigenetic marks on chromatin. This study may also
provide JMJD3 and H3K27me3 as alternatives to current detection methods and
chemotherapy treatments in breast cancer.
Tamoxifen-sensitive breast cancer cells
Tamoxifen-resistant breast cancer cells
Figure 4- 7: Summary model of the role of JMJD3 and H3K27 methylation in the
control of BCL2 gene expression in tamoxifen sensitive and resistant breast cancer
cells.
Materials and methods
Cell culture and shRNA lentiviral transduction
MCF7, MDA-MB-231, 293T and MCF7/HER2-18 (gift from Mien-Chie Hung,
University of Texas, USA) cell lines were maintained in DMEM (Wisent) containing
10% fetal bovine serum (FBS) and antibiotics.
Prior to their use in E2 treatment
experiments, MCF7 cells were grown in DMEM without phenol red (Wisent) and
supplemented with 5% charcoal-dextran treated FBS for at least 3 days. The LCC2 cells
(gift from Robert Clarke, Georgetown University Medical Center, USA) were cultured in
130
DMEM without phenol red containing 5% charcoal-dextran-treated FBS. All cells were
mycoplasma-free and were kept in a humidified chamber at 37°C in 5% CO2. 17(3estradiol, tamoxifen and ICI 182,780 (Sigma) were used at concentrations of 100 nM, 1
u.M and 100 nM respectively, unless otherwise stated. The shRNA sequences designed
to
inhibit
JMJD3
(#1,
GAGACCTCGTGTGGATTAA;
#2,
GCGCTCGTGTATGTACATT) were cloned into the pLVTHM backbone (gift from
Didier Trono, University of Geneva, Switzerland). The shRNA against UTX were
purchased from Open Biosystems in the pLKO.l vector and shRNA lentiviruses were
obtained by cotransfection of pLVTHM or pLKO.l vectors, pMDVSV-G, and psPAX2
into human 293T cell line. The pcDNA3 constructs overexpressing Bcl-2, EZH2, EZH221 A, EZH2-21D were transfected in MCF7 cells as described previously(Gevry et al.,
2009).
Apoptosis analysis
For sub-Gl analysis, cells were harvested and fixed in 70% ethanol. Fixed cells were
stained with propidium iodide (PI, 50 ug/mL) after treatment with RNase (100 ng/mL).
Stained cells were analyzed for DNA content by FACS in a FACS Calibur (BD
Biosciences). For annexin-V/PI analysis, cells were stained with annexin-V coupled to
the fluorophore Cy5 according to the manufacturer's instructions (Abeam) and cells
positive for annexin-V detection were measured using the CellQuest software (BD
Biosciences).
ChIP and FAIRE assays
MCF7 cells were hormone-deprived for at least 3 days and then treated with 100 nM of
E2 for the indicated time.
ChIP assays were performed essentially as described
previously (Gevry et al., 2007) with a panel of specific polyclonal antibodies generated
in-house or from commercial sources, as well as pre-immune, and controls without
antibodies. FAIRE experiments were performed as previously described (Eeckhoute et
al., 2009). Samples were sonicated to generate DNA fragments <400 bp. qPCR was
131
performed using a set of primers relevant to the promoter regions of the BCL2 gene. The
primers used in qPCR are listed in Table S3.
RNA and microarray analysis
Total RNA was isolated from MCF7 cells grown in E2-free medium using the GenElute
mammalian total RNA miniprep kit (Sigma). RNA was reverse-transcribed into firststrand cDNA using MMLV reverse transcriptase (Promega). Samples were subjected to
qPCR using CFX-96 (BioRad) and qPCR for 36B4 and GAPDH mRNA were used as an
internal controls. The relative abundance of BCL2 mRNA (or other test genes) was
calculated after normalization using 36B4 mRNA, where relative expression levels were
calculated as 2~ACT where ACT = CT test gene - CT 36B4. Primers used are listed in
Supplementary Table S3.
Microarray analysis using BeadChip Human Genome
(Illumina, HT-12) was performed at the Centre d'innovation at Genome Quebec (McGill
University, Montreal, QC, Canada). Data were analyzed using the FlexArray 1.5 software
and as described previously(Blazejczyk et al., 2007).
Analysis of the breast cancer TMA
141 cases were selected from consented patients who had undergone surgical resectioning
with auxiliary lymph node dissection for breast cancer, at the Centre hospitalier de
TUniversite
de
Montreal
-
Hotel
Dieu
(CHUM-HD),
between
2003
and
2007. Formalin-fixed, paraffin-embedded archival tissue blocks were obtained from the
surgical archives at CHUM-HD. Immunohistochemistry for HER2 and H3K27me3 were
performed on representative tumor areas, annotated by a pathologist and two single core
tissue-microarrays were constructed in parallel. Hierarchical clustering was done using
the Cluster 3.0 program, Euclidian distance and complete centroid linkage. The original
dataset was filtered to eliminate individuals with incomplete staining (16 of 142). Data
visualization was done using the Java TreeView program(Saldanha, 2004). To test the
distribution of the equivalent levels of expression, data was first transformed into high (2,
3) or low values (0, 1). Where expression values where equivalent (high-high or low-
132
low), we attributed a value of 1 to the sample, 0 otherwise. A Chi-Square test of
independence with this sample was then run using a random distribution as our
hypotheses.
Antibodies
A complete list of antibodies used in the present study in ChIP and Western blot analysis
are shown in Supplemental Table S4.
Acknowledgments
We thank Alain Lavigueur, Viktor Steimle, Bruce Murphy and Mylene Brunelle for
critical comments on the manuscript and Benoit Leblanc for the artwork included in
Figure 7. We are also grateful to Robert Clark, Mien-Chie Hung and Didier Trono for
providing reagents. We would also like to thank Viktor Steimle for the use of the FACS
and important advice concerning the analysis, and Luc Paquette for advice on statistical
analysis of the breast TMA. This work was supported with funds from the Cancer
Research Society Inc. to N.G. N.G. holds a holds a Chercheur boursier (junior 1) award
from the FRSQ. A.S. was the recipient of a doctoral fellowship from NSERC and Reseau
Quebecois en reproduction.
133
shCTL
SWMJD3-1
160-
If
1?(V
soio
shJMJD3-nf
sub-G1
20.9%
M4
1
Ml 1
f~m
IJ " ' 26J 400 8 0 0 8 0 0
- Propidium Iodide -
1 H
Figure 4-S1: The shRNA-mediated knockdown of JMJD3 affects apoptosis in
MCF7 cells.
(A) Graphical representation of FACS analysis of the percentage of cells in sub-Gl,
indicative of MCF7 cell death in complete media, following knockdown of JMJD3.
Percent of cells in sub-Gl is shown in the upper left corner of each fluorogram. (B) Bar
graph of cell cycle patterns of MCF7 cells depleted for JMJD3. Fluorograms and bar
graphs are representative of three experiments. (C) Summary graph of annexin-V/PI
analysis from panel A. The data shown are the mean ± S.E. of three independent
experiments.
134
shCTL
f 1<rt
shJMJD3-1
0 78%
|iaa
101
10? ~£££^. 2 0 355%
10°' 10' lb 10 W I O 0 10'
-Annexln-V-
_ua%J
102 103 104
Figure 4-S2 : The effect of JMJD3 knockdown is specific to ERa-positive ceils.
(A) Representative analysis of annexin-V/PI analysis in ERa-negative MDA-MB-231
cells showing lack of effect of JMJD3 knockdown on cell survival. (B) The shRNA
construct shJMJD3-l is shown to have no effect on the expression BCL2 (shown by
qPCR) in MDA-MB-231 cells.
250-
« 6
D-E2
•+E2
-200-
: 150-
(E
0-
on
shCTL
-E2
shUTX-1
shUTX-2
+E2
Figure 4-S3 : The H3K27me3 demethylase UTX does not affect BCL2 expression.
The shRNA constructs shUTX-1 and shUTX-2 both efficiently reduce RNA levels of
UTX (A) but do not affect induced expression levels of BCL2 (B), as shown by qPCR.
135
60-
- » - -E2
- * • + E2
«\
\\
«S-<40E
*
c
\ <\
\
>\
A
91
UJ
OC 20-J
A
<f
u.
0-
!
-1599
T
i
TSS
ERE2
Figure 4-S4 : H3K27me3 status does not affect chromatin remodelling at the BCL2
enhancer region.
FAIRE-qPCR experiments were performed in MCF7 cells to monitor nucleosome
depletion before and after E2 treatment at the indicated BCL2 promoter regions. Relative
enrichment are normalized on a control region (+13 000 relative to the TSS). The primers
used in these experiments correspond to the -1599, TSS and the ERE2 regions as shown
in Figure 3A of the BCL2 gene. This graph is representative of three independent
experiments.
a
M
•
0
MCF7
-E2/-TAM
+E2/-TAM
-E2/+TAM
+E2/+TAM
LCC2
Figure 4-S5: Anti-estrogen resistant cells exhibit an altered epigenetic pattern and
regulation of BCL2.
As shown by qPCR, induced BCL2 expression levels are restored to baseline levels in
MCF7 cells with the addition of tamoxifen. MCF7/LCC2 cells demonstrate induced
levels of BCL2 in the absence of E2 stimulation which is not affected by the addition of
E2 or tamoxifen.
136
D -E2
• + E2
shCTL shSUZ12
shCTL
shSUZ12
Figure 4-S6 : Depletion of PRC complex member SUZ12 induces expression of
BCL2.
RT-qPCR analysis showing the effect of SUZ12 depletion (A) on the expression levels of
BCL2 in MCF7 cells treated or not with E2 (B), normalised using 36B4.
>
< 08|
06.
0
I "2
X
.1 ° *oo.
4^
^
•
&
Figure 4-S7 : Inhibition of pEZH2 in AE resistant cells decreases BCL2 expression.
The addition of the AKT inhibitor LY294002 in MCF7/LCC2 cells decreases RNA
expression levels ofBCL2, shown by qPCR analysis normalised using 36B4.
137
0
5
10
15
20
25
EZH2
EZH221A
EZH221D
Figure 4-S8 : A decrease in H3K27me3 due to EZH2 phosphorylation leads to
resistance to tamoxifen-induced apoptosis.
MCF7 cells overexpressing EZH2, mutant EZH2 (EZH2-21A and EZH2-21D), or BcI-2
were exposed to increasing concentrations of tamoxifen (0, 5, 10, 15, 20, and 25 uM) for
48h. Concentration-dependent apoptosis was observed in the presence of tamoxifen for
control, EZH2 and EZH2-21A, but not in the cell lines overexpressing EZH2-21D and
Bcl-2.
138
(uM)
Table 4-Sl : E2-regulated genes negatively affected by the knockdown of JMJD3
Global gene expression in MCF7 cells depleted of JMJD3 following vehicle or E2
treatment shows 151 of 274 E2-upregulated genes (55%) are negatively affected by the
loss of JMJD3.
EPDRl
ADAMTSL5
TUBB2B
FGFRIOP
SLC22A5
LOCI 00134266
EGR3
COQ4
LOC727941
MIR574
FABP5
GADD45GIP1
SLC6A6
GAL
POLR3G
UNCI 19
KCNF1
ACOX2
LOC643161
ELOVL2
MYBL1
LOC643479
C90RF95
TFF2
IL24
IGFBP4
C60RF221
ALDOC
PDLIM3
PKIB
SFXN2
LRG1
LOC643150
DPYSL4
ZNF185
SDK2
FAM25A
FGFBP2
CCDC110
GPRIN1
LOC730167
GPR68
HS.537742
MAPT
LHX4
TFF1
LOC730274
C10ORF119
CYP4F11
PPP2R2C
AP1B1
GPR77
SERP1NE2
DEGS2
MGC16121
DCAF16
NR5A2
ARL3
SLC25A25
SGK1
LOC647993
AFF3
LOC100131727
CDC25A
MPPED2
KIF12
LOC647987
SNX24
CXCL12
RERG
C40RF43
CELSR2
MSMB
PRKCE
HS.151692
SGK
RAPGEFL1
B4GALT1
TOE1
RET
SGK3
TIMM10
SUSD3
LRP8
GREB1
APOA1
NP
BCL2
LOCI 54860
SSR3
SIAH2
CDCA7
ADORA1
WAPAL
HS.224678
IFIH1
PLAC1
REEP1
ZNF533
PDZK1P1
PODXL
PTGES
SLITRK4
TH
NBL1
TIFA
HPDL
PDZK1
ANKRD37
RBM24
RBBP8
GALE
KCTD6
LOC493869
LOCI 00134009
TUBA3D
UST
LOC100134073
HS.562504
SPOCD1
HERC5
OLFML3
JAK2
VWF
SCNN1G
LOC727831
TMEM229B
RAB31
LOC441484
LOC731954
SPINK4
NRIP1
TUBA3E
KIAA1881
DEPDC6
IL20
PGLYRP2
PCP4
CHAF1A
DTL
SMTNL2
GALNT4
CEP135
RPRML
OSTF1
FSIP1
RASGRP1
ZNF385B
C20ORF160
TGFA
THBS1
FARP1
139
Table 4-S2 : Potential anti-apoptotic genes negatively regulated by the knockdown
ofJMJD3
The subset of genes implicated in the inhibition of apoptosis in the group of E2-regulated
genes negatively affected by the knockdown of JMJD3. In this subset of genes, we
observed the presence of BCL2, one of the most important anti-apoptotic genes.
BCL2
Apoptosis regulator Bcl-2
TK1
Fibroblast growth factor receptor homolog 1
FGFR3
Fibroblast growth factor receptor 3
FGFR5
Fibroblast growth factor receptor 5
FKBP11
FK506-binding protein 11
LHX4
LIM/homeobox protein Lhx4
IL20
lnterleukin-20
1L24
lnterleukin-24
MYBL1
Myb-related protein A
MYB
Myb proto-oncogene protein
RLN2
Relaxin A chain
TTC9C
Tetratricopeptide repeat protein 9C
SGK1
Serine/threonine-protein kinase Sgk1
SGK3
Serine/threonine-protein kinase Sgk3
RET
Proto-oncogene tyrosine-protein kinase receptor ret
MLKL
Mixed lineage kinase domain-like protein
MYB
Telomere length regulator tazl
FGFR5
Fibroblast growth factor receptor 4
140
Table 4-S3 : List of primers used in this study.
Primer name
GAPDH-FWD
Application Sequence
RT-qPCR
CTCTGCTCCTCCTGTTCGAC
GAPDH REV
RT-qPCR
TGACTCCGACCTTCACCTTC
36B4 FWD
36B4 REV
JMJD3 FWD
RT-qPCR
GCGACCTGGAAGTCCAACTA
ATCTGCTGCATCTGCTTGG
CACCCACTGTGGTCTGTTGT
GTCTCCGCCTCAGTAACAGC
GTGTTCCGCGTGATTGAAGAC
CCCCAGAGAAAGAAGAGGAGTTATAA
JMJD3 REV
BCL2 FWD
BCL2 REV
GREB1-FWD
RT-qPCR
RT-qPCR
RT-qPCR
RT-qPCR
RT-qPCR
RT-qPCR
CTCTGCCTGAAGGATGCTGT
GREB1-REV
TFF1-FWD
TFF1-REV
PR-FWD
PR-REV
RT-qPCR
RT-qPCR
RT-qPCR
RT-qPCR
RT-qPCR
GCAGATCCCTGCAGAAGTGT
CGCGCTCTACCCTGCACTC
TGAATCCGGCCTCAGGTAGTT
IGFBP4-FWD
IGFBP4-REV
CCND1-FWD
CCND1-REV
UTX Fwd
UTX Rev
SUZ12 Fwd
SUZ12Rev
BCL2-1599 Fwd
BCL2-1599 Rev
BCL2 -698(TSS) Fwd
RT-qPCR
RT-qPCR
RT-qPCR
RT-qPCR
CCCACGAGGACCTCTACATC
ATCCAGAGCTGGGTGACACT
GCTGTGCATCTACACCGACA
CCACTTGAGCTTGTTCACCA
RT-qPCR
RT-qPCR
RT-qPCR
AATTCCCGCAGAGCTTACCT
GGATGTGACACAGCATGTCC
GGATATTCATCGCCAACCTG
RT-qPCR
ChIP
ChIP
ChIP
ChIP
ChIP
ChIP
GACATGCTTGCTTTTGTTCG
GCTCAGAGGAGGGCTCTTT
TGCCTGTCCTCTTACTTCATTCT
GTCTGGGAATCGATCTGGAA
GCAACGATCCCATCAATCTT
CACCTGTGGTCCACCTGAC
CTGAAGAGCTCCTCCACCAC
BCL2 -698(TSS) Rev
BCL2 ERE2 Fwd
BCL2 ERE2 Rev
CGTTGGAAATGGAGACAAGG
GTGCAAATAAGGGCTGCTGT
141
References
Agger, K., Cloos, P.A., Christensen, J., Pasini, D., Rose, S., Rappsilber, J., Issaeva, I.,
Canaani, E., Salcini, A.E. and Helin, K. (2007) UTX and JMJD3 are histone
H3K27 demethylases involved in HOX gene regulation and development. Nature,
449,731-734.
Agger, K., Cloos, P.A., Rudkjaer, L., Williams, K., Andersen, G., Christensen, J. and
Helin, K. (2009) The H3K27me3 demethylase JMJD3 contributes to the
activation of the INK4A-ARF locus in response to oncogene- and stress-induced
senescence. Genes Dev, 23, 1171-1176.
Anderton, J.A., Bose, S., Vockerodt, M., Vrzalikova, K., Wei, W., Kuo, M., Helin, K.,
Christensen, J., Rowe, M., Murray, P.G. and Woodman, C.B. The H3K27me3
demethylase, KDM6B, is induced by Epstein-Barr virus and over-expressed in
Hodgkin's Lymphoma. Oncogene.
Arold, S.T., Ulmer, T.S., Mulhern, T.D., Werner, J.M., Ladbuty, J.E., Campbell, I.D. and
Noble, M.E. (2001) The role of the Src homology 3-Src homology 2 interface in
the regulation of Src kinases. J Biol Chem, 276, 17199-17205.
Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jorgensen, H.F., John, R.M., Gouti, M.,
Casanova, M., Warnes, G., Merkenschlager, M. and Fisher, A.G. (2006)
Chromatin signatures of pluripotent cell lines. Nat Cell Biol, 8, 532-538.
Badia, E., Oliva, J., Balaguer, P. and Cavailles, V. (2007) Tamoxifen resistance and
epigenetic modifications in breast cancer cell lines. Curr Med Chem, 14, 30353045.
Badve, S. and Nakshatri, H. (2009) Oestrogen-receptor-positive breast cancer: towards
bridging histopathological and molecular classifications. J Clin Pathol, 62, 6-12.
Barradas, M., Anderton, E., Acosta, J.C., Li, S., Banito, A., Rodriguez-Niedenfuhr, M.,
Maertens, G., Banck, M., Zhou, M.M., Walsh, M.J., Peters, G. and Gil, J. (2009)
Histone demethylase JMJD3 contributes to epigenetic control of INK4a/ARF by
oncogenic RAS. Genes Dev, 23, 1177-1182.
Benevolenskaya, E.V. (2007) Histone H3K4 demethylases are essential in development
and differentiation. Biochem Cell Biol, 85, 435-443.
Benz, C.C, Scott, G.K., Sarup, J.C., Johnson, R.M., Tripathy, D., Coronado, E., Shepard,
H.M. and Osborne, C.K. (1992) Estrogen-dependent, tamoxifen-resistant
tumorigenic growth of MCF-7 cells transfected with HER2/neu. Breast Cancer
Res Treat, 24, 85-95.
Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B.,
Meissner, A., Wernig, M., Plath, K., Jaenisch, R., Wagschal, A., Feil, R.,
Schreiber, S.L. and Lander, E.S. (2006) A bivalent chromatin structure marks key
developmental genes in embryonic stem cells. Cell, 125, 315-326.
Blazejczyk, M., Miron, M. and Nadon, R. (2007) FlexArray: A statistical data analysis
software
for
gene
expression
microarrays.,
http://genomequebec.mcgiIl.ca/FIexArray
142
Bredfeldt, T.G., Greathouse, K.L., Safe, S.H., Hung, M.C., Bedford, M.T. and Walker,
C.L. (2010) Xenoestrogen-induced regulation of EZH2 and histone methylation
via estrogen receptor signaling to PI3K/AKT. Mol Endocrinol, 24, 993-1006.
Brunner, N., Boysen, B., Jirus, S., Skaar, T.C., Holst-Hansen, C, Lippman, J., Frandsen,
T., Spang-Thomsen, M., Fuqua, S.A. and Clarke, R. (1997) MCF7/LCC9: an
antiestrogen-resistant MCF-7 variant in which acquired resistance to the steroidal
antiestrogen ICI 182,780 confers an early cross-resistance to the nonsteroidal
antiestrogen tamoxifen. Cancer Res, 57, 3486-3493.
Brunner, N., Frandsen, T.L., Holst-Hansen, C, Bei, M., Thompson, E.W., Wakeling,
A.E., Lippman, M.E. and Clarke, R. (1993) MCF7/LCC2: a 4-hydroxytamoxifen
resistant human breast cancer variant that retains sensitivity to the steroidal
antiestrogen ICI 182,780. Cancer Res, 53, 3229-3232.
Burgold, T., Spreafico, F., De Santa, F., Totaro, M.G., Prosperini, E., Natoli, G. and
Testa, G. (2008) The histone H3 lysine 27-specific demethylase Jmjd3 is required
for neural commitment. PLoS One, 3, e3034.
Cao, Q., Yu, J., Dhanasekaran, S.M., Kim, J.H., Mani, R.S., Tomlins, S.A., Mehra, R.,
Laxman, B., Cao, X., Yu, J., Kleer, C.G., Varambally, S. and Chinnaiyan, A.M.
(2008) Repression of E-cadherin by the polycomb group protein EZH2 in cancer.
Oncogene, 27, 7274-7284.
Cao, R. and Zhang, Y. (2004) The functions of E(Z)/EZH2-mediated methylation of
lysine 27 in histone H3. Curr Opin Genet Dev, 14, 155-164.
Castaneda, C.A., Cortes-Funes, H., Gomez, H.L. and Ciruelos, E.M. (2010) The
phosphatidyl inositol 3-kinase/AKT signaling pathway in breast cancer. Cancer
Metastasis Rev, 29, 751-759.
Castoria, G., Migliaccio, A., Bilancio, A., Di Domenico, M., de Falco, A., Lombardi, M.,
Fiorentino, R., Varricchio, L., Barone, M.V. and Auricchio, F. (2001) PI3-kinase
in concert with Src promotes the S-phase entry of oestradiol-stimulated MCF-7
cells. Embo J, 20, 6050-6059.
Cha, T.L., Zhou, B.P., Xia, W., Wu, Y., Yang, C.C, Chen, C.T., Ping, B., Otte, A.P. and
Hung, M.C. (2005) Akt-mediated phosphorylation of EZH2 suppresses
methylation of lysine 27 in histone H3. Science, 310, 306-310.
Cloos, P.A., Christensen, J., Agger, K. and Helin, K. (2008) Erasing the methyl mark:
histone demethylases at the center of cellular differentiation and disease. Genes
Dev, 22, 1115-1140.
Cooper, C.S. and Foster, C.S. (2009) Concepts of epigenetics in prostate cancer
development. Br J Cancer, 100, 240-245.
Creyghton, M.P., Markoulaki, S., Levine, S.S., Hanna, J., Lodato, M.A., Sha, K., Young,
R.A., Jaenisch, R. and Boyer, L.A. (2008) H2AZ is enriched at polycomb
complex target genes in ES cells and is necessary for lineage commitment. Cell,
135,649-661.
Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A. and Pirrotta, V. (2002)
Drosophila enhancer of Zeste/ESC complexes have a histone H3
methyltransferase activity that marks chromosomal Polycomb sites. Cell, 111,
185-196.
143
De Santa, F., Totaro, M.G., Prosperini, E., Notarbartolo, S., Testa, G. and Natoli, G.
(2007) The histone H3 lysine-27 demethylase Jmjd3 links inflammation to
inhibition of polycomb-mediated gene silencing. Cell, 130, 1083-1094.
Ding, L., Erdmann, C, Chinnaiyan, A.M., Merajver, S.D. and Kleer, C.G. (2006)
Identification of EZH2 as a molecular marker for a precancerous state in
morphologically normal breast tissues. Cancer Res, 66, 4095-4099.
Ding, L. and Kleer, C.G. (2006) Enhancer of Zeste 2 as a marker of preneoplastic
progression in the breast. Cancer Res, 66, 9352-9355.
Doisneau-Sixou, S.F., Sergio, CM., Carroll, J.S., Hui, R., Musgrove, E.A. and
Sutherland, R.L. (2003) Estrogen and antiestrogen regulation of cell cycle
progression in breast cancer cells. Endocr Relat Cancer, 10, 179-186.
Eeckhoute, J., Lupien, M., Meyer, C.A., Verzi, M.P., Shivdasani, R.A., Liu, X.S. and
Brown, M. (2009) Cell-type selective chromatin remodeling defines the active
subset of FOXA1-bound enhancers. Genome Res, 19, 372-380.
Fan, M., Bigsby, R.M. and Nephew, K.P. (2003) The NEDD8 pathway is required for
proteasome-mediated degradation of human estrogen receptor (ER)-alpha and
essential for the antiproliferative activity of ICI 182,780 in ERalpha-positive
breast cancer cells. Mol Endocrinol, 17, 356-365.
Ferguson, D.J. and Anderson, T.J. (1981) Morphological evaluation of cell turnover in
relation to the menstrual cycle in the "resting" human breast. Br J Cancer, 44,
177-181.
Fullwood, M.J., Liu, M.H., Pan, Y.F., Liu, J., Xu, H., Mohamed, Y.B., Orlov, Y.L.,
Velkov, S., Ho, A., Mei, P.H., Chew, E.G., Huang, P.Y., Welboren, W.J., Han,
Y., Ooi, H.S., Ariyaratne, P.N., Vega, V.B., Luo, Y., Tan, P.Y., Choy, P.Y.,
Wansa, K.D., Zhao, B., Lim, K.S., Leow, S.C, Yow, J.S., Joseph, R., Li, H.,
Desai, K.V., Thomsen, J.S., Lee, Y.K., Karuturi, R.K., Herve, T., Bourque, G.,
Stunnenberg, H.G., Ruan, X., Cacheux-Rataboul, V., Sung, W.K., Liu, E.T., Wei,
C.L., Cheung, E. and Ruan, Y. (2009) An oestrogen-receptor-alpha-bound human
chromatin interactome. Nature, 462, 58-64.
Gevry, N., Chan, H.M., Lafiamme, L., Livingston, D.M. and Gaudreau, L. (2007) p21
transcription is regulated by differential localization of histone H2A.Z. Genes
Dev, 21, 1869-1881.
Gevry, N., Hardy, S., Jacques, P.E., Lafiamme, L., Svotelis, A., Robert, F. and Gaudreau,
L. (2009) Histone H2A.Z is essential for estrogen receptor signaling. Genes Dev,
23, 1522-1533.
Gonzalez, M.E., Li, X., Toy, K., DuPrie, M., Ventura, A.C., Banerjee, M., Ljungman, M.,
Merajver, S.D. and Kleer, C.G. (2009) Downregulation of EZH2 decreases
growth of estrogen receptor-negative invasive breast carcinoma and requires
BRCA1. Oncogene, 28, 843-853.
He, H.H., Meyer, C.A., Shin, H., Bailey, ST., Wei, G., Wang, Q., Zhang, Y., Xu, K., Ni,
M., Lupien, M., Mieczkowski, P., Lieb, J.D., Zhao, K., Brown, M. and Liu, X.S.
Nucleosome dynamics define transcriptional enhancers. Nat Genet, 42, 343-347.
Jones, R.S. (2007) Epigenetics: reversing the 'irreversible'. Nature, 450, 357-359.
144
Jorgensen, H.F., Giadrossi, S., Casanova, M, Endoh, M, Koseki, H., Brockdorff, N. and
Fisher, A.G. (2006) Stem cells primed for action: polycomb repressive complexes
restrain the expression of lineage-specific regulators in embryonic stem cells. Cell
Cycle, 5, 1411-1414.
Kouzarides, T. (2007) Chromatin modifications and their function. Cell, 128, 693-705.
Kumar, R., Mandal, M., Lipton, A., Harvey, H. and Thompson, C.B. (1996)
Overexpression of HER2 modulates bcl-2, bcl-XL, and tamoxifen-induced
apoptosis in human MCF-7 breast cancer cells. Clin Cancer Res, 2, 1215-1219.
Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst, P. and Reinberg, D.
(2002) Histone methyltransferase activity associated with a human multiprotein
complex containing the Enhancer of Zeste protein. Genes Dev, 16, 2893-2905.
Kyprianou, N., English, H.F., Davidson, N.E. and Isaacs, J.T. (1991) Programmed cell
death during regression of the MCF-7 human breast cancer following estrogen
ablation. Cancer Res, 51, 162-166.
Lan, F., Bayliss, P.E., Rinn, J.L., Whetstine, J.R., Wang, J.K., Chen, S., Iwase, S.,
Alpatov, R., Issaeva, I., Canaani, E., Roberts, T.M., Chang, H.Y. and Shi, Y.
(2007) A histone H3 lysine 27 demethylase regulates animal posterior
development. Nature, 449, 689-694.
Luger, K. (2003) Structure and dynamic behavior of nucleosomes. Curr Opin Genet Dev,
13,127-135.
Lund, A.H. and van Lohuizen, M. (2004) Epigenetics and cancer. Genes Dev, 18, 23152335.
Mattera, L., Courilleau, C, Legube, G., Ueda, T., Fukunaga, R., Chevillard-Briet, M.,
Canitrot, Y., Escaffit, F. and Trouche, D. (2010) The ElA-associated p400 protein
modulates cell fate decisions by the regulation of ROS homeostasis. PLoS Genet,
6,el 000983.
Mattera, L., Escaffit, F., Pillaire, M.J., Selves, J., Tyteca, S., Hoffmann, J.S., Gourraud,
P.A., Chevillard-Briet, M., Cazaux, C. and Trouche, D. (2009) The p400/Tip60
ratio is critical for colorectal cancer cell proliferation through DNA damage
response pathways. Oncogene, 28, 1506-1517.
McClelland, R.A., Manning, D.L., Gee, J.M., Anderson, E., Clarke, R., Howell, A.,
Dowsett, M., Robertson, J.F., Blarney, R.W., Wakeling, A.E. and Nicholson, R.I.
(1996) Effects of short-term antiestrogen treatment of primary breast cancer on
estrogen receptor mRNA and protein expression and on estrogen-regulated genes.
Breast Cancer Res Treat, 41,31-41.
Mellor, J. (2005) The dynamics of chromatin remodeling at promoters. Mol Cell, 19, 147157.
Metivier, R., Penot, G., Hubner, M.R., Reid, G., Brand, H., Kos, M. and Gannon, F.
(2003) Estrogen receptor-alpha directs ordered, cyclical, and combinatorial
recruitment of cofactors on a natural target promoter. Cell, 115, 751-763.
Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez,
P., Brockman, W., Kim, T.K., Koche, R.P., Lee, W., Mendenhall, E., O'Donovan,
A., Presser, A., Russ, C, Xie, X., Meissner, A., Wernig, M., Jaenisch, R.,
145
Nusbaum, C, Lander, E.S. and Bernstein, B.E. (2007) Genome-wide maps of
chromatin state in pluripotent and lineage-committed cells. Nature, 448, 553-560.
Muller, J., Hart, CM., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L.,
O'Connor, M.B., Kingston, R.E. and Simon, J.A. (2002) Histone
methyltransferase activity of a Drosophila Polycomb group repressor complex.
Cell, 111, 197-208.
Naughton, C, MacLeod, K., Kuske, B., Clarke, R., Cameron, D.A. and Langdon, S.P.
(2007) Progressive loss of estrogen receptor alpha cofactor recruitment in
endocrine resistance. Mol Endocrinol, 21, 2615-2626.
Normanno, N., Di Maio, M., De Maio, E., De Luca, A., de Matteis, A., Giordano, A. and
Perrone, F. (2005) Mechanisms of endocrine resistance and novel therapeutic
strategies in breast cancer. Endocr Relat Cancer, 12, 721-747.
Ordonez-Moran, P. and Munoz, A. (2009) Nuclear receptors: genomic and non-genomic
effects converge. Cell Cycle, 8, 1675-1680.
Pasini, D., Bracken, A.P., Jensen, M.R., Lazzerini Denchi, E. and Helin, K. (2004) Suzl2
is essential for mouse development and for EZH2 histone methyltransferase
activity. Embo J, 23, 4061 -4071.
Pearce, S.T. and Jordan, V.C. (2004) The biological role of estrogen receptors alpha and
beta in cancer. Crit Rev Oncol Hematol, 50, 3-22.
Perillo, B., Ombra, M.N., Bertoni, A., Cuozzo, C, Sacchetti, S., Sasso, A., Chiariotti, L.,
Malorni, A., Abbondanza, C. and Avvedimento, E.V. (2008) DNA oxidation as
triggered by H3K9me2 demethylation drives estrogen-induced gene expression.
Science, 319, 202-206.
Rada-Iglesias, A., Bajpai, R., Swigut, T., Brugmann, S.A., Flynn, R.A. and Wysocka, J.
(2011) A unique chromatin signature uncovers early developmental enhancers in
humans. Nature, 470, 279-283.
Razandi, M., Oh, P., Pedram, A., Schnitzer, J. and Levin, E.R. (2002) ERs associate with
and regulate the production of caveolin: implications for signaling and cellular
actions. Mol Endocrinol, 16, 100-115.
Riggins, R.B., Schrecengost, R.S., Guerrero, M.S. and Bouton, A.H. (2007) Pathways to
tamoxifen resistance. Cancer Lett, 256, 1-24.
Russell, K.S., Haynes, M.P., Sinha, D., Clerisme, E. and Bender, J.R. (2000) Human
vascular endothelial cells contain membrane binding sites for estradiol, which
mediate rapid intracellular signaling. Proc Natl Acad Sci USA, 97, 5930-5935.
Saldanha, A.J. (2004) Java Treeview—extensible visualization of microarray data.
Bioinformatics, 20, 3246-3248.
Schiff, R., Massarweh, S.A., Shou, J., Bharwani, L., Mohsin, S.K. and Osborne, C.K.
(2004) Cross-talk between estrogen receptor and growth factor pathways as a
molecular target for overcoming endocrine resistance. Clin Cancer Res, 10, 331S336S.
Seligson, D.B., Horvath, S., Shi, T., Yu, H., Tze, S., Grunstein, M. and Kurdistani, S.K.
(2005) Global histone modification patterns predict risk of prostate cancer
recurrence. Nature, 435, 1262-1266.
146
Shang, Y., Hu, X., DiRenzo, J., Lazar, M.A. and Brown, M. (2000) Cofactor dynamics
and sufficiency in estrogen receptor-regulated transcription. Cell, 103, 843-852.
Sharov, A.A. and Ko, M.S. (2007) Human ES cell profiling broadens the reach of
bivalent domains. Cell Stem Cell, 1, 237-238.
Shou, J., Massarweh, S., Osborne, C.K., Wakeling, A.E., Ali, S., Weiss, H. and Schiff, R.
(2004) Mechanisms of tamoxifen resistance: increased estrogen receptorHER2/neu cross-talk in ER/HER2-positive breast cancer. J Natl Cancer Inst, 96,
926-935.
Simon, J.A. and Kingston, R.E. (2009) Mechanisms of polycomb gene silencing: knovvns
and unknowns. Nat Rev Mol Cell Biol, 10, 697-708.
Sommer, S. and Fuqua, S.A. (2001) Estrogen receptor and breast cancer. Semin Cancer
Biol, 11, 339-352.
Sun, M., Paciga, J.E., Feldman, R.I., Yuan, Z., Coppola, D., Lu, Y.Y., Shelley, S.A.,
Nicosia, S.V. and Cheng, J.Q. (2001) PhosphatidyIinositol-3-OH Kinase
(PI3K)/AKT2, activated in breast cancer, regulates and is induced by estrogen
receptor alpha (ERalpha) via interaction between ERalpha and PI3K. Cancer Res,
61,5985-5991.
Svotelis, A., Gevry, N., Grondin, G. and Gaudreau, L. (2010) H2A.Z overexpression
promotes cellular proliferation of breast cancer cells. Cell Cycle, 9, 364-370.
Swigut, T. and Wysocka, J. (2007) H3K27 demethylases, at long last. Cell, 131, 29-32.
Teixeira, C, Reed, J.C. and Pratt, M.A. (1995) Estrogen promotes chemotherapeutic drug
resistance by a mechanism involving Bcl-2 proto-oncogene expression in human
breast cancer cells. Cancer Res, 55, 3902-3907.
Wang, L.H., Yang, X.Y., Zhang, X., An, P., Kim, H.J., Huang, J., Clarke, R., Osborne,
C.K., Inman, J.K., Appella, E. and Farrar, W.L. (2006) Disruption of estrogen
receptor DNA-binding domain and related intramolecular communication restores
tamoxifen sensitivity in resistant breast cancer. Cancer Cell, 10,487-499.
Wei, Y., Xia, W., Zhang, Z., Liu, J., Wang, H., Adsay, N.V., Albarracin, C, Yu, D.,
Abbruzzese, J.L., Mills, G.B., Bast, R.C., Jr., Hortobagyi, G.N. and Hung, M.C.
(2008) Loss of trimethylation at lysine 27 of histone H3 is a predictor of poor
outcome in breast, ovarian, and pancreatic cancers. Mol Carcinog, 47, 701-706.
Xiang, Y., Zhu, Z., Han, G., Lin, H., Xu, L. and Chen, CD. (2007) JMJD3 is a histone
H3K27 demethylase. Cell Res, 17, 850-857.
Zhou, V.W., Goren, A. and Bernstein, B.E. (2010) Charting histone modifications and the
functional organization of mammalian genomes. Nat Rev Genet, 12, 7-18.
147
CHAPTER V
V. DISCUSSION
The general definition of a cancerous cell is a cell that has become insensitive to various
signals in cell cycle causing continued, uncontrolled proliferation, resulting from a
normal eukaryotic cell that has accumulated a number of mutations (Vogelstein and
Kinzler, 1993). There are numerous possible alterations made in a cancerous cell leading
the cell to continue throughout the cell cycle without being controlled at any point
(Hanahan and Weinberg, 2000; Boehm and Hahn, 2005). The presence of only one of
these alterations renders the cell pre-cancerous, yet multiple mutagenic events normally
occur in order for the cell to become cancerous. In breast cancer, ERa both promotes
proliferation of abnormal cells by regulating the expression of cell cycle-related genes
and apoptosis prevention in these cells (Doisneau-Sixou et al., 2003; Perillo et al., 2008;
Teixeira et al., 1995). The E2-stimulated ERa cellular response leads to the convergence
of transcriptional and protein signalling pathways involved in chromatin regulation.
Depending on the genetic context, the ERa response leads to multiple effects in breast
cancer cells. For example, numerous CRCs and histone modifications implicated in ERa
pathways have been shown to be affected in various tumour types, notably in breast
tissues. MLL2, an ERa coactivator that methylates H3K4 and interacts with H3K27
demethylase UTX and JMJD3, is aberrantly upregulated in breast cancer (Lan et al.,
2007; Natarajan et al., 2010).
Several studies suggest that EZH2 is a promising
prognostic biomarker in breast cancer (Collett et al. 2006; Raaphorst et al. 2003;
Buchmann et al. 2006). Overall, the totality of the observations made during my doctoral
thesis suggests that two important epigenetic marks with opposing roles in transcriptional
148
activation, H2A.Z and H3K27me3, are both linked to ERa during the typical E2
response, and these pathways are modified leading to proliferative effects and
progression towards AE resistance.
V.l.
ERa modulation of chromatin signatures affects the cell cycle
Our results suggest that in the context of ERa-dependent breast cancer, the removal of
H3K27me3 by JMJD3 promotes cellular proliferation by the activation of the antiapoptotic gene BCL2. This suggests a context-dependent role for JMJD3 and H3K27me3
in different cancer types. In normal cells, a subset of key developmental regulatory genes
contain both the active H3K4me3 at promoter and repressive H3K27me3 modifications
and are pre-bound by RNAPII (Bernstein et al., 2006; Jorgensen et al., 2006; Sharov and
Ko, 2007).
This poised transcriptional state requires the action of H3K27me3
demethylases such as JMJD3 to initiate gene expression (Agger et al., 2007; De Santa et
al., 2007; Hong et al., 2007; Lan et al., 2007; Xiang et al., 2007). Many of these
developmental genes require the actions of cell signals to recruit transcription factors
which bind to and recruit JMJD3 to chromatin. For example, JMJD3 association with
Smads2/3 is essential in the activation of Nodal-Smads2/3 target genes during
development (Dahle et al., 2010). Our results are in agreement with this research, yet
provide an interesting novel role of the demethylation of H3K27me3 outside this subset
of genes in which JMJD3 cooperates with ERa to regulate a gene that is critical in
carcinogenesis.
The unstimulated BCL2 promoter region in MCF7 cells shows a
chromatin conformation similar to bivalent genes, and H3K27me3 prevents ERa binding
to the ERE enhancer region of the BCL2 gene (Figure 4.3). Prior to activation of BCL2,
the promoter appears to be poised for activation, with pre-bound H3K4me3, RNAPII and
H2A.Z (Figure 4.3).
E2 stimulation leads to the JMJD3-mediated depletion of
H3K27me3 and the possible formation of an active loop between the distal and proximal
149
regulatory elements, exhibited by the increase in H3K4me3 and H2A.Z at the ERE
enhancer region. It is possible that in the case of oncogene-induced JMJD3-dependent
activation of the pl6INK4a locus, a similar same mechanism may be employed, but in
response to different cellular stimuli. So, in the context of breast cancer cells, JMJD3 is
important in establishing the activation of an anti-apoptotic response gene, therefore
contributing to the oncogenic properties of these cells.
We also observed the presence of H2A.Z at the poised enhancer of BCL2. We observed
that the binding of H2A.Z and H3K4me3 were pre-bound at BCL2 and colocalised with
ERa and JMJD3 binding following E2 stimulation (Figure 4.3). It is possible that, in
addition to JMJD3, H2A.Z is required for the activation of BCL2 in response to E2 in
breast cancer cells, contributing to the anti-apoptotic phenotype of these cells.
Interestingly, H2A.Z binds Su(z)12 target genes in mouse embryonic stem cells, and the
specific depletion in this context leads to the derepression of PcG targets (Creyghton et
al., 2008). H2A.Z has been highly associated with gene activity in mammalian cells, so
this result was surprising. However, it is possible that H2A.Z colocalisation to these
areas promotes the bivalency of such genes, poising the promoter for activation. Notably,
p400 binding is known to closely mirror H3K4me3, and when H3K4me3 is reduced by
depletion of Ash21, a subunit of SET 1-family methyltransferase complexes, p400 binding
to its target genes is also reduced (Fazzio et al., 2008). One avenue that remains to be
explored is the role of H2A.Z in preventing apoptosis. The depletion of p400 has been
shown to lead to apoptosis in several cancer cell lines (Mattera et al., 2010; Mattera et al.,
2009), and we observed an increase in TAM-induced apoptosis in MCF7 cells in the
absence of H2A.Z (A. Svotelis, unpublished results). The role of H2A.Z in pro- and antiapoptotic gene regulation would be interesting to pursue, especially considering the
known association of H2A.Z with p53 and ERa, two known regulators of apoptotic genes
(Gevry et al., 2007; Gevry et al., 2009; Svotelis et al., 2010). Therefore, our observations
at BCL2 in MCF7 cells suggest an important interplay between epigenetic marks that
leads to an oncogenic anti-apoptotic response.
150
In addition to the modulation of anti-apoptotic genes, an important requirement for
cellular proliferation is the expression of genes that promote the crucial transition in the
cell cycle from the resting phase (Gl) to the DNA replication phase (S). The p53/p21
and pi6 pathways are negative regulators of cell cycle progression, namely through the
Gl/S transition. The p400/Tip60 complex is known to regulate the expression of these
cell cycle inhibitors (pl6INK4a and p21WAFl/CIPl), acting primarily through the p53
pathway (Gevry et al., 2007; Legube et al., 2004; Park and Roeder, 2006; Tang et al.,
2006; Tyteca et al., 2006a). H2A.Z is required for the p400-induced repression of
p21WAFl/CIPl (Gevry et al., 2007). Our studies show that H2A.Z overexpression
promotes cellular proliferation in breast cancer cells (Svotelis et al., 2010), possibly
through the regulation of cell cycle arrest by repressing p21 WAF1/CIP1 (Gevry et al.,
2007). In addition, the kinetics of H3K27 methylation at the p21WAFl/CIPl promoter
would be interesting to observe following E2 stimulation. For the pl6INK4a locus, the
specific knockdown of p400 leads to increased transcription ofpl6INK4a (Mattera et al.,
2010), suggesting a similar role for the p400-mediated deposition of H2A.Z as observed
at p21WAFl/CIPl. A recent study has shown that the presence of H2A.Z and insulator
protein CTCF are lost at the silenced pl6INK4a in breast cancer cells (Witcher and
Emerson, 2009). Of note, this locus is also repressed by PcG proteins (Agger et al., 2009;
Barradas et al., 2009).
In this case, JMJD3 derepresses this locus in response to
oncogenic stress in fibroblasts, leading to cell cycle arrest and suggesting a tumorsuppressive role for JMJD3.
Considering that our studies concerning these two
epigenetic marks in breast cancer proliferation were performed in a pl6INK4a-lbackground (MCF7 cells), it would be interesting to observe the ERa-dependent kinetics
of H3K27 methylation and H2A.Z deposition during the regulation of this locus in breast
cancer cells. All in all, the interplay between epigenetic marks at cell-cycle inhibitors is
an important step in breast cancer progression.
151
Cancerous cells also generally demonstrate an increase in the expression of genes that are
important in the promotion of cell-cycle progression through the Gl/S transition, such as
E2F1-regulated genes (Svotelis et al., 2009). Although the expression of H2A.Z has not
been considered regulated throughout the cell cycle, we know that there is a peak of
H2A.Z expression at the Gl/S transition during the cell cycle (A. Svotelis, unpublished
results; (Hatch and Bonner, 1988)). In addition, we observed that the overexpression of
H2A.Z causes increased proliferation, and the pro-proliferative effects of H2A.Z seem to
be caused by a deregulation in the cell cycle, most apparent in the MCF7 breast cancer
cell line (Figure 3.1) (Svotelis et al., 2010).
The p400/Tip60 complex has been
associated with cell proliferation due to its association with activators such as p53, E2F1,
Myc, and ERa (Chan, 2005; Gevry et al., 2009; Kim et al., 2005; Nagl et al., 2007;
Samuelson et al., 2005; Taubert et al., 2004).
Interestingly, E2F1 can recruit the
p400/Tip60 complex to chromatin at the promoters of cell-cycle-related genes during the
Gl/S transition (Kramps et al., 2004; Nagl et al., 2007; Taubert et al., 2004). However,
the depletion of H2A.Z did not significantly affect E2F-1 dependent genes in human
fibroblasts and breast cancer cells in our investigations (A. Svotelis, unpublished results),
whereas H2A.Z depletion significantly affects ERa-regulated genes in MCF7 breast
cancer cells (Gevry et al., 2009). Although several studies have shown increased levels
of H2A.Z in breast cancer (Camp et al., 2002; Hua et al., 2008; van de Vijver et al.,
2002), no group has yet modified the expression of H2A.Z to determine its role in the
regulation of cellular proliferation besides ours (Gevry et al., 2007; Gevry et al., 2009).
Thus, it would be interesting to further pursue the modulation of gene expression patterns
by the exogenous overexpression of H2A.Z.
152
V.2.
The role of epigenetic signatures in anti-estrogen resistance
In our results the overexpression of H2A.Z overrides the toxic potential of the AE TAM,
and leads to increased cellular proliferation in the absence of E2 stimulation (Figure 3.1).
TAM is widely used to treat breast cancer due to its capacity to bind ERa and inhibit the
activation potential of the nuclear receptor, but some patients exhibit resistance to this
treatment, which has also been attributed to the constitutive activation of ERa target
genes (Badia et al., 2007; Shou et al., 2004). E2-independent growth is typical of more
severe breast cancers that have constitutively activated ERa target genes (Anderson,
2002). This suggests a possible activation of genes involved in cellular proliferation (or
repression of cell cycle arrest genes) that are normally controlled by E2-dependent
pathways.
Therefore, H2A.Z could serve as an important prognostic factor in
determining not only cancer severity, but could help guide clinical treatments as a marker
of possible resistance to AE therapy. Considering the important effect H2A.Z in ERapositive breast cancer cells (MCF7) and their estrogen-independent growth (Gevry et al.,
2009; Svotelis et al., 2009; Svotelis et al., 2010), it would be interesting to explore the
role of H2A.Z in AE-resistant cell lines.
We also observed increased levels of H2A.Z in breast cancers, with a notable correlation
between ERa and H2A.Z in low-grade breast cancers (Table 3.1 and Figure 3.3).
Expectedly, ERa levels decrease with increasing cancer severity (Pearce and Jordan,
2004), but we also observed that the highest levels of H2A.Z associate with more severe
cancers, in line with a previous study (Hua et al., 2008). What is the role of increased
levels of H2A.Z on its existing target genes? Does overexpression lead to constitutive
activation?
H2A.Z has been suggested to be important in cell-specific responses,
possibly due to activator-specific p400-deposition of H2A.Z at target genes (Gevry et al.,
2007; Gevry et al., 2009). We (and others (Bredfeldt et al., 2010)) have shown that the
overexpression of HER2 leads to Akt-mediated phosphorylation of EZH2 in more severe,
153
AE-resistant breast cancer, decreasing global H3K27me3 levels. However, decreased
survival is observed in patients with low H3K27me3 levels (Wei et al., 2008). In fact,
EZH2 overexpression is related more with the aggressive ER-negative breast cancer
subtype and breast cancer invasion (Cao et al., 2008; Gonzalez et al., 2009; Wei et al.,
2008). The levels of pEZH2 and global H3K27me3 in the aggressive breast cancers that
exhibit increased EZH2 were not verified, so it is possible that EZH2 overexpression in
conjunction with HER2 overexpression does not lead to increased H3K27me3. In
relation with our findings on a global H3K27 demethylation, the absence of this
repressive regulation and the "overloading" of H2A.Z in chromatin could lead to
activation in the absence of cellular stimuli such as E2. In this case, both the genomic
(H2A.Z presence) and non-genomic (H3K27 demethylation by pEZH2) pathways of ERa
regulation are active during conditions that should normally promote inactivation.
Our results also lead us to propose that AE resistant cells exhibit a chromatin signature
that is permissive for BCL2 transcription in the absence of stimulation. E2 cellular
stimulation results in an ERa-mediated genomic response in which ERa interacts with
several coactivators at target genes, as well as a rapid non-genomic response where ERa
associates with protein kinase signalling pathways such as that of PI3K/Akt (OrdonezMoran and Munoz, 2009). The use of AE will block E2 binding to ERa, preventing the
activation of either pathway. In AE-sensitive cells, the JMJD3/ERa-dependent regulation
of H3K27 methylation is required for BCL2 activation, but is blocked in the presence of
the AE TAM (Figure 4.4). The HER2/Akt dependent phosphorylation of EZH2 decreases
H3K27 methylation (Cha et al., 2005) which has been strongly implicated in the
development of AE resistance in breast cancer cells (Schiff et al., 2004; Shou et al.,
2004). We show that the pEZH2 caused by the overexpression of HER2 in AE-resistant
breast cancer cells specifically prevents the methylation of H3K27 surrounding the
enhancer region of BCL2, allowing the formation of an active chromatin conformation
and constitutive activation of BCL2. The overall consequence is a bypass of the need for
JMJD3 for transcriptional activation (Figure 4.5 and 4.6). It is of particular note that the
154
constitutive expression of BCL2, has been shown to prevent apoptosis after AE treatment
in breast cancer cells (Crawford et al., ; Kumar et al., 1996; Wang and Phang, 1995; Yde
et al., 2007), which we confirm by the introduction of exogenous BCL2 expression in the
MCF7 cell line (Figure 4.6). We believe these findings are of great significance since we
show that fundamental epigenetic mechanisms and the signature of epigenetic marks on
chromatin can provide important clues on AE-resistance and breast cancer.
In cells that overexpress H2A.Z, we observed an increased amount of H2A.Z protein
when extracting histone proteins from precipitated chromatin, suggesting that more
H2A.Z is deposited into chromatin when overexpressed (Figure 3.1) (Svotelis et al.,
2010). Notably, an increase in p400 levels has never been observed in cancer, but it has
been suggested that histone chaperones that are important in replication-dependent
nucleosome assembly NAP1 may deposit H2A.Z/H2B dimers into chromatin templates in
yeast (Luk et al., 2007; Mazurkiewicz et al., 2006). Random H2A.Z incorporation could
be a causal factor in chromosomal defects and translocation in breast cancer by the
creation of confusion between heterochromatic regions in euchromatic areas, resulting in
devastating effects during the transcriptional process. The random deposition of H2A.Z
at low levels in euchromatin has already been observed in genome-wide in human cells,
and is suggestive of silenced or heterochromatic areas in which genes are not transcribed,
and the removal of H2A.Z in gene bodies is required for gene activation (Hardy et al.,
2009). So, the overexpress ion of H2A.Z may also lead to a decreased capacity to
distinguish between heterochromatin and repressed or poised genes, leading to the
aberrant spreading of HP1 and H3K9me3 over normally expressed genes. Of importance
here is the fact that H2A.Z and CpG methylation are significantly anti-correlated in
certain mouse and human cell lines (Conerly et al., 2010; Kobor and Lorincz, 2009;
Zilberman et al., 2008). CpG methylation at promoter and regulatory areas is associated
with H3K27me3 and gene silencing (Kobor and Lorincz, 2009).
In addition,
hypomethylation of promoters regulating growth stimulatory pathways has been observed
in AE-resistant cell lines (Fan et al., 2006). Thus, our observations that demonstrate
155
increased H2A.Z incorporation associated with increased tamoxifen resistance (Chapter
III) and decreased global H3K27me3 in AE-resistant cell lines (Chapter IV) is suggestive
of an overall epigenetic signature in AE resistance. It would be interesting to correlate
these marks genome-wide in AE-resistant cell lines as well as in cases of AE resistance in
breast cancer patients.
V.3.
General conclusions and perspectives
My investigation into epigenetic mechanisms involved in breast cancer has lead me to the
following conclusions: (1) Epigenetic modifications, such as H2A.Z overexpression and
H3K27 methylation status, may be useful prognostic markers for breast cancer severity;
(2) Epigenetic modifications are pivotal in the regulation of cell cycle progression related
genes and the overactivation of pathways that affect this epigenetic marks in certain cells
leads to carcinogenesis; (3) Continued deregulation of multiple pathways that affect the
modulation of epigenetic marks can lead to more severe breast cancer and AE resistance.
However, with every answer, there comes a new question.
What type of genomic instability is caused by the modulation of epigenetic marks? First,
the analysis of H2A.Z-overexpressing cancer cells by immunohistochemistry or FISH
would provide us with information concerning any chromosomal abnormalities. Also,
comparing the ChlP-chip or ChlP-seq profiles of H2A.Z and heterochromatic markers
HP1 and H3K9me3 in non-transformed breast epithelial cells with those of several
different breast cancer cell lines in which H2A.Z is overexpressed would be of interest.
To more clearly determine the role of H2A.Z overexpression or global H3K27
demethylation in tumour formation and genomic instability it would be interesting to
develop transgenic mouse models that conditionally overexpress H2A.Z or JMJD3 in a
dose-dependent fashion specifically in breast tissue.
156
How do the expression profiles of normal cells compare to breast cancer cells? Increased
random H2A.Z incorporation may result in an increase in cryptic transcription by the
recruitment of RNAPII to alternate transcription initiation sites, or by the incapacity to reestablish closed chromatin conformation in gene bodies (Farris et al., 2005; Hardy et al.,
2009; Williams and Tyler, 2007). Comparing total RNA expression patterns by the
newly developed transcriptome sequencing (RNA-seq) in non-transformed breast
epithelial cells with those of several different breast cancer cell lines in which H2A.Z is
overexpressed would provide us with some indications of cryptic transcription (van Bakel
and Hughes, 2009; Wang et al., 2009). It would be interesting to compare mRNA
expression patterns in cell lines exhibiting different levels of H3K27me3. Together with
ChlP-seq analysis of H2A.Z and H3K27me3 binding, these results would provide us with
a map of the genomic effects of the modulation of these marks. It would be especially
interesting to determine the states of these marks by immunohistochemistry and ChlP-seq
in triple-negative breast cancers (ERa-/PR-/HER2-), a very severe breast cancer with low
survival rates. It has been suggested that ERa-negative breast cancer may evolve from
ERa-positive precursors (Allred et al., 2004), and our observations concerning the
development of E2 independence by an imbalance in the chromatin signature may
support this model.
How does the presence of H2A.Z or the demethylation of H3K27 affect long range
chromatin interactions between regulatory elements? JMJD3 and H2A.Z may both have
roles in the modification of chromatin structure to permit communication between distal
regulatory elements and the proximal promoter region. A recent analysis by ChlA-PET
of ERa long-range interactions during E2 stimulation in MCF7 cells, showing the
existence of several ERa-dependent loops at BCL2, in addition to those previously
described (Fullwood et al., 2009; Perillo et al., 2008). It would also be intriguing to
compare the chromatin landscape prior to and following E2 stimulation by ChlA-PET of
H2A.Z, JMJD3 and H3K27me3.
157
The studies presented in this thesis support a model in which epigenetic marks H2A.Z
and H3K27me3 will strongly affect the outcome of a breast cancer cell, and these marks
may present novel prognostic tools in the discrimination between different types of breast
cancer by affecting genomic instability, gene regulation and the development of AE
resistance.
158
VI. REFERENCES
Adam, M., Robert, F., Larochelle, M., and Gaudreau, L. (2001). H2A.Z is required for
global chromatin integrity and for recruitment of RNA polymerase II under specific
conditions. Mol Cell Biol 21, 6270-6279.
Agger, K., Cloos, P.A., Christensen, J., Pasini, D., Rose, S., Rappsilber, J., Issaeva, I.,
Canaani, E., Salcini, A.E., and Helin, K. (2007). UTX and JMJD3 are histone H3K27
demethylases involved in HOX gene regulation and development. Nature 449, 731-734.
Agger, K., Cloos, P.A., Rudkjaer, L., Williams, K., Andersen, G., Christensen, J., and
Helin, K. (2009). The H3K27me3 demethylase JMJD3 contributes to the activation of the
INK4A-ARF locus in response to oncogene- and stress-induced senescence. Genes Dev
23,1171-1176.
Ahmad, S., Singh, N., and Glazer, R.I. (1999). Role of AKT1 in 17beta-estradiol- and
insulin-like growth factor I (IGF-I)-dependent proliferation and prevention of apoptosis
in MCF-7 breast carcinoma cells. Biochem Pharmacol 58, 425-430.
Albert, I., Mavrich, T.N., Tomsho, L.P., Qi, J., Zanton, S.J., Schuster, S.C., and Pugh,
B.F. (2007). Translational and rotational settings of H2A.Z nucleosomes across the
Saccharomyces cerevisiae genome. Nature 446, 572-576.
Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002).
Molecular Biology of the Cell, 4th edn (New York, Garland Science).
Allis, CD., Glover, C.V., Bowen, J.K., and Gorovsky, M.A. (1980). Histone variants
specific to the transcriptionally active, amitotically dividing macronucleus of the
unicellular eucaryote, Tetrahymena thermophila. Cell 20, 609-617.
Allred, D.C., Brown, P., and Medina, D. (2004). The origins of estrogen receptor alphapositive and estrogen receptor alpha-negative human breast cancer. Breast Cancer Res 6,
240-245.
An, W., Kim, J., and Roeder, R.G. (2004). Ordered cooperative functions of PRMT1,
p300, and CARM1 in transcriptional activation by p53. Cell 117, 735-748.
Anderson, E. (2002). The role of oestrogen and progesterone receptors in human
mammary development and tumorigenesis. Breast Cancer Res 4, 197-201.
159
Angelov, D., Molla, A., Perche, P.Y., Hans, F., Cote, J., Khochbin, S., Bouvet, P., and
Dimitrov, S. (2003). The histone variant macroH2A interferes with transcription factor
binding and SWI/SNF nucleosome remodeling. Mol Cell 11, 1033-1041.
Ansari, K.I., Kasiri, S., Hussain, I., and Mandal, S.S. (2009). Mixed lineage leukemia
histone methylases play critical roles in estrogen-mediated regulation of HOXC13. FEBS
Journal 276, 7400-7411.
Ansari, K.I., and Mandal, S.S. (2010). Mixed lineage leukemia: roles in gene expression,
hormone signaling and mRNA processing. FEBS Journal 277, 1790-1804.
Arents, G., Burlingame, R.W., Wang, B.C., Love, W.E., and Moudrianakis, E.N. (1991).
The nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein assembly
and a left-handed superhelix. Proc Natl Acad Sci U S A 88, 10148-10152.
Auger, A., Galarneau, L., Altaf, M., Nourani, A., Doyon, Y., Utley, R.T., Cronier, D.,
Allard, S., and Cote, J. (2008). Eafl is the platform for NuA4 molecular assembly that
evolutionarily links chromatin acetylation to ATP-dependent exchange of histone H2A
variants. Mol Cell Biol 28, 2257-2270.
Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jorgensen, H.F., John, R.M., Gouti, M.,
Casanova, M., Warnes, G., Merkenschlager, M., et al. (2006). Chromatin signatures of
pluripotent cell lines. Nat Cell Biol 8, 532-538.
Babiarz, J.E., Halley, J.E., and Rine, J. (2006). Telomeric heterochromatin boundaries
require NuA4-dependent acetylation of histone variant H2A.Z in Saccharomy
cescerevisiae. Genes Dev 20, 700-710.
Badia, E., Oliva, J., Balaguer, P., and Cavailles, V. (2007). Tamoxifen resistance and
epigenetic modifications in breast cancer cell lines. Curr Med Chem 14, 3035-3045.
Badve, S., and Nakshatri, H. (2009). Oestrogen-receptor-positive breast cancer: towards
bridging histopathological and molecular classifications. J Clin Pathol 62, 6-12.
Bannister, A.J., Zegerman, P., Partridge, J.F., Miska, E.A., Thomas, J.O., Allshire, R.C.,
and Kouzarides, T. (2001). Selective recognition of methylated lysine 9 on histone H3 by
the HP1 chromo domain. Nature 410, 120-124.
Barradas, M., Anderton, E., Acosta, J.C., Li, S., Banito, A., Rodriguez-Niedenfuhr, M.,
Maertens, G., Banck, M., Zhou, M.M., Walsh, M.J., et al. (2009). Histone demethylase
160
JMJD3 contributes to epigenetic control of lNK4a/ARF by oncogenic RAS. Genes Dev
23, 1177-1182.
Barratt, M.J., Hazzalin, C.A., Cano, E., and Mahadevan, L.C. (1994). Mitogen-stimulated
phosphorylation of histone H3 is targeted to a small hyperacetylation-sensitive fraction.
ProcNatl Acad Sci U S A 91,4781-4785.
Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G.,
Chepelev, I., and Zhao, K. (2007). High-resolution profiling of histone methylations in
the human genome. Cell 129, 823-837.
Bartfai, R., Hoeijmakers, W.A., Salcedo-Amaya, A.M., Smits, A.H., Janssen-Megens, E.,
Kaan, A., Treeck, M., Gilberger, T.W., Francoijs, K.J., and Stunnenberg, H.G. (2010).
H2A.Z Demarcates Intergenic Regions of the Plasmodium falciparum Epigenome That
Are Dynamically Marked by H3K9ac and H3K4me3. PLoS Pathog 6, el001223.
Beekman, J.M., Allan, G.F., Tsai, S.Y., Tsai, M.J., and O'Malley, B.W. (1993).
Transcriptional activation by the estrogen receptor requires a conformational change in
the ligand binding domain. Mol Endocrinol 7, 1266-1274.
Belandia, B., Orford, R.L., Hurst, H.C., and Parker, M.G. (2002). Targeting of SWI/SNF
chromatin remodelling complexes to estrogen-responsive genes. Embo J 21, 4094-4103.
Benz, C.C., Scott, G.K., Sarup, J.C., Johnson, R.M., Tripathy, D., Coronado, E., Shepard,
H.M., and Osborne, C.K. (1992). Estrogen-dependent, tamoxifen-resistant tumorigenic
growth of MCF-7 cells transfected with HER2/neu. Breast Cancer Res Treat 24, 85-95.
Bernad, R., Sanchez, P., and Losada, A. (2009). Epigenetic specification of centromeres
by CENP-A. Exp Cell Res 315, 3233-3241.
Berns, K., Hijmans, E.M., Mullenders, J., Brummelkamp, T.R., Velds, A., Heimerikx,
M., Kerkhoven, R.M., Madiredjo, M., Nijkamp, W., Weigelt, B., et al. (2004). A largescale RNAi screen in human cells identifies new components of the p53 pathway. Nature
425,431-437.
Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B.,
Meissner, A., Wernig, M., Plath, K., et al. (2006). A bivalent chromatin structure marks
key developmental genes in embryonic stem cells. Cell 125, 315-326.
Bhat-Nakshatri, P., Wang, G., Appaiah, H., Luktuke, N., Carroll, J.S., Geistlinger, T.R.,
Brown, M., Badve, S., Liu, Y., and Nakshatri, H. (2008). AKT alters genome-wide
161
estrogen receptor alpha binding and impacts estrogen signaling in breast cancer. Mol Cell
Biol 28, 7487-7503.
Biddie, S.C, John, S., and Hager, G.L. (2010). Genome-wide mechanisms of nuclear
receptor action. Trends Endocrinol Metab 21, 3-9.
Bjornstrom, L., and Sjoberg, M. (2005). Mechanisms of estrogen receptor signaling:
convergence of genomic and nongenomic actions on target genes. Mol Endocrinol 19,
833-842.
Blazejczyk, M., Miron, M., and Nadon, R. (2007). FlexArray: A statistical data analysis
software for gene expression microarrays. http://genomequebec.mcgill.ca/FlexArray
Boffa, L.C, Vidali, G., Mann, R.S., and Allfrey, V.G. (1978). Suppression of histone
deacetylation in vivo and in vitro by sodium butyrate. J Biol Chem 253, 3364-3366.
Bondarenko, V.A., Liu, Y.V., Jiang, Y.I., and Studitsky, V.M. (2003). Communication
over a large distance: enhancers and insulators. Biochem Cell Biol 81, 241-251.
Bredfeldt, T.G., Greathouse, K.L., Safe, S.H., Hung, M.C, Bedford, M.T., and Walker,
C.L. (2010). Xenoestrogen-induced regulation of EZH2 and histone methylation via
estrogen receptor signaling to PI3K7AKT. Mol Endocrinol 24, 993-1006.
Brownell, J.E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D.G., Roth, S.Y., and
Allis, CD. (1996). Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p
linking histone acetylation to gene activation. Cell 84, 843-851.
Bruce, K., Myers, F.A., Mantouvalou, E., Lefevre, P., Greaves, I., Bonifer, C,
Tremethick, D.J., Thorne, A.W., and Crane-Robinson, C. (2005). The replacement
histone H2A.Z in a hyperacetylated form is a feature of active genes in the chicken.
Nucleic Acids Res 33, 5633-5639.
Brunner, N., Boysen, B., Jirus, S., Skaar, T.C, Holst-Hansen, C, Lippman, J., Frandsen,
T., Spang-Thomsen, M., Fuqua, S.A., and Clarke, R. (1997). MCF7/LCC9: an
antiestrogen-resistant MCF-7 variant in which acquired resistance to the steroidal
antiestrogen ICI 182,780 confers an early cross-resistance to the nonsteroidal antiestrogen
tamoxifen. Cancer Res 57, 3486-3493.
Brunner, N., Frandsen, T.L., Holst-Hansen, C, Bei, M., Thompson, E.W., Wakeling,
A.E., Lippman, M.E., and Clarke, R. (1993). MCF7/LCC2: a 4-hydroxytamoxifen
162
resistant human breast cancer variant that retains sensitivity to the steroidal antiestrogen
1CI 182,780. Cancer Res 53, 3229-3232.
Brzozowski, A.M., Pike, A.C., Dauter, Z., Hubbard, R.E., Bonn, T., Engstrom, O.,
Ohman, L., Greene, G.L., Gustafsson, J.A., and Carlquist, M. (1997). Molecular basis of
agonism and antagonism in the oestrogen receptor. Nature 389, 753-758.
Bulger, M., Schubeler, D., Bender, M.A., Hamilton, J., Farrell, CM., Hardison, R.C, and
Groudine, M. (2003). A complex chromatin landscape revealed by patterns of nuclease
sensitivity and histone modification within the mouse beta-globin locus. Mol Cell Biol
23, 5234-5244.
Buratowski, S. (2009). Progression through the RNA polymerase II CTD cycle. Mol Cell
36, 541-546.
Burgold, T., Spreafico, F., De Santa, F., Totaro, M.G., Prosperini, E., Natoli, G., and
Testa, G. (2008). The histone H3 lysine 27-specific demethylase Jmjd3 is required for
neural commitment. PLoS One 3, e3034.
Bustin, M., Catez, F., and Lim, J.H. (2005). The dynamics of histone HI function in
chromatin. Mol Cell 17, 617-620.
Cai, Y., Jin, J., Florens, L., Swanson, S.K., Kusch, T., Li, B., Workman, J.L., Washburn,
M.P., Conaway, R.C, and Conaway, J.W. (2005). The mammalian YL1 protein is a
shared subunit of the TRRAP/TIP60 histone acetyltransferase and SRCAP complexes. J
Biol Chem 280, 13665-13670.
Cairns, B.R. (2009). The logic of chromatin architecture and remodelling at promoters.
Nature 45/, 193-198.
Camp, R.L., Chung, G.G., and Rimm, D.L. (2002). Automated subcellular localization
and quantification of protein expression in tissue microarrays. Nat Med 8, 1323-1327.
Campbell, R.A., Bhat-Nakshatri, P., Patel, N.M., Constantinidou, D., Ali, S., and
Nakshatri, H. (2001). Phosphatidylinositol 3-kinase/AKT-mediated activation of estrogen
receptor alpha: a new model for anti-estrogen resistance. J Biol Chem 276, 9817-9824.
Campisi, J. (2005). Suppressing cancer: the importance of being senescent. Science 309,
886-887.
163
Cao, Q., Yu, J., Dhanasekaran, S.M., Kim, J.H., Mani, R.S., Tomlins, S.A., Mehra, R.,
Laxman, B., Cao, X., Yu, J., et al. (2008). Repression of E-cadherin by the polycomb
group protein EZH2 in cancer. Oncogene 27, 7274-7284.
Cao, R., and Zhang, Y. (2004). The functions of E(Z)/EZH2-mediated methylation of
lysine 27 in histone H3. Curr Opin Genet Dev 14, 155-164.
Carr, A.M., Dorrington, S.M., Hindley, J., Phear, G.A., Aves, S.J., and Nurse, P. (1994).
Analysis of a histone H2A variant from fission yeast: evidence for a role in chromosome
stability. Mol Gen Genet 245, 628-635.
Carroll, J.S., Liu, X.S., Brodsky, A.S., Li, W., Meyer, C.A., Szary, A.J., Eeckhoute, J.,
Shao, W., Hestermann, E.V., Geistlinger, T.R., et al. (2005). Chromosome-wide mapping
of estrogen receptor binding reveals long-range regulation requiring the forkhead protein
FoxAl. Cell 122, 33-43.
Carroll, J.S., Meyer, C.A., Song, J., Li, W., Geistlinger, T.R., Eeckhoute, J., Brodsky,
A.S., Keeton, E.K., Fertuck, K.C., Hall, G.F., et al. (2006). Genome-wide analysis of
estrogen receptor binding sites. Nat Genet 38, 1289-1297.
Castaneda, C.A., Cortes-Funes, H., Gomez, H.L., and Ciruelos, E.M. (2010). The
phosphatidyl inositol 3-kinase/AKT signaling pathway in breast cancer. Cancer
Metastasis Rev 29, 751-759.
Cha, T.L., Zhou, B.P., Xia, W., Wu, Y., Yang, C.C., Chen, C.T., Ping, B., Otte, A.P., and
Hung, M.C. (2005). Akt-mediated phosphorylation of EZH2 suppresses methylation of
lysine 27 in histone H3. Science 310, 306-310.
Chan, H.M., M. Narita, S. W. Lowe, and D. M. Livingston. (2005). The p400 E1Aassociated protein is a novel component of the p53 --> p21 senescence pathway. Genes
Dev 19.
Chen, B.S., and Hampsey, M. (2002). Transcription activation: unveiling the essential
nature of TFIID. Curr Biol 12, R620-622.
Chen, I.Y., Lypowy, J., Pain, J., Sayed, D., Grinberg, S., Alcendor, R.R., Sadoshima, J.,
and Abdellatif, M. (2006). Histone H2A.Z is essential for cardiac myocyte hypertrophy
but opposed by silent information regulator 2alpha. J Biol Chem 281, 19369-19377.
Christensen, J., Agger, K., Cloos, P.A., Pasini, D., Rose, S., Sennels, L., Rappsilber, J.,
Hansen, K.H., Salcini, A.E., and Helin, K. (2007). RBP2 belongs to a family of
164
demethylases, specific for tri-and dimethylated lysine 4 on histone 3. Cell 128, 10631076.
Clapier, C.R., and Cairns, B.R. (2009). The biology of chromatin remodeling complexes.
Annu Rev Biochem 78, 273-304.
Clarkson, M.J., Wells, J.R., Gibson, F., Saint, R., and Tremethick, D.J. (1999). Regions
of variant histone His2AvD required for Drosophila development. Nature 399, 694-697.
Clayton, A.L., and Mahadevan, L.C. (2003). MAP kinase-mediated phosphoacetylation
of histone H3 and inducible gene regulation. FEBS Lett 546, 51-58.
Nuclear Receptor Nomenclature Committee (1999). A unified nomenclature system for
the nuclear receptor superfamily. Cell 97,161-163.
Conaway, R.C., Sato, S., Tomomori-Sato, C, Yao, T., and Conaway, J.W. (2005). The
mammalian Mediator complex and its role in transcriptional regulation. Trends Biochem
Sci 30, 250-255.
Conerly, M.L., Teves, S.S., Diolaiti, D., Ulrich, M., Eisenman, R.N., and Henikoff, S.
(2010). Changes in H2A.Z occupancy and DNA methylation during B-cell
lymphomagenesis. Genome Res 20, 1383-1390.
Cooper, C.S., and Foster, C.S. (2009). Concepts of epigenetics in prostate cancer
development. Br J Cancer 100, 240-245.
Cowley, S.M., Hoare, S., Mosselman, S., and Parker, M.G. (1997). Estrogen receptors
alpha and beta form heterodimers on DNA. J Biol Chem 272, 19858-19862.
Craig, J.M. (2005). Heterochromatin—many flavours, common themes. Bioessays 27, 1728.
Cramer, P. (2004a). RNA polymerase II structure: from core to functional complexes.
Curr Opin Genet Dev 14, 218-226.
Cramer, P. (2004b). Structure and function of RNA polymerase II. Adv Protein Chem 67,
1-42.
165
Crawford, A.C., Riggins, R.B., Shajahan, A.N., Zwart, A., and Clarke, R. Co-inhibition
of BCL-W and BCL2 restores antiestrogen sensitivity through BECN1 and promotes an
autophagy-associated necrosis. PLoS One 5, e8604.
Creyghton, M.P., Cheng, A.W., Welstead, G.G., Kooistra, T., Carey, B.W., Steine, E.J.,
Hanna, J., Lodato, M.A., Frampton, G.M., Sharp, P.A., et al. (2010). Histone H3K27ac
separates active from poised enhancers and predicts developmental state. Proc Natl Acad
Sci USA.
Creyghton, M.P., Markoulaki, S., Levine, S.S., Hanna, J., Lodato, M.A., Sha, K., Young,
R.A., Jaenisch, R., and Boyer, L.A. (2008). H2AZ is enriched at polycomb complex
target genes in ES cells and is necessary for lineage commitment. Cell 135, 649-661.
Cristofalo, V.J., Lorenzini, A., Allen, R.G., Torres, C, and Tresini, M. (2004).
Replicative senescence: a critical review. Mech Ageing Dev 125, 827-848.
Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. (2002).
Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase
activity that marks chromosomal Polycomb sites. Cell 111, 185-196.
Dahle, O., Kumar, A., and Kuehn, M.R. (2010). Nodal signaling recruits the histone
demethylase Jmjd3 to counteract polycomb-mediated repression at target genes. Sci
Signal 3, ra48.
Dai, J.P., Lu, J.Y., Zhang, Y., and Shen, Y.F. (2010). Jmjd3 activates Mashl gene in RAinduced neuronal differentiation of P19 cells. J Cell Biochem 110, 1457-1463.
De Santa, F., Totaro, M.G.,-Prospering E., Notarbartolo, S., Testa, G., and Natoli, G.
(2007). The histone H3 lysine-27 demethylase Jmjd3 links inflammation to inhibition of
polycomb-mediated gene silencing. Cell 130,1083-1094.
Delmas, V., Stokes, D.G., and Perry, R.P. (1993). A mammalian DNA-binding protein
that contains a chromodomain and an SNF2/SWI2-like helicase domain. Proc Natl Acad
SciUSA90,2414-2418.
Dhillon, N., Oki, M., Szyjka, S.J., Aparicio, O.M., and Kamakaka, R.T. (2006). H2A.Z
functions to regulate progression through the cell cycle. Mol Cell Biol 26, 489-501.
Dickey, J.S., Redon, C.E., Nakamura, A.J., Baird, B.J., Sedelnikova, O.A., and Bonner,
W.M. (2009). H2AX: functional roles and potential applications. Chromosoma 118, 683692.
166
Ding, L., Erdmann, C, Chinnaiyan, A.M., Merajver, S.D., and Kleer, C.G. (2006).
Identification of EZH2 as a molecular marker for a precancerous state in morphologically
normal breast tissues. Cancer Res 66, 4095-4099.
Ding, L., and Kleer, C.G. (2006). Enhancer of Zeste 2 as a marker of preneoplastic
progression in the breast. Cancer Res 66, 9352-9355.
DiRenzo, J., Shang, Y., Phelan, M., Sif, S., Myers, M., Kingston, R., and Brown, M.
(2000). BRG-1 is recruited to estrogen-responsive promoters and cooperates with factors
involved in histone acetylation. Mol Cell Biol 20, 7541-7549.
Dobosy, J.R., and Selker, E.U. (2001). Emerging connections between DNA methylation
and histone acetylation. Cell Mol Life Sci 58, 721-727.
Doisneau-Sixou, S.F., Sergio, CM., Carroll, J.S., Hui, R., Musgrove, E.A., and
Sutherland, R.L. (2003). Estrogen and antiestrogen regulation of cell cycle progression in
breast cancer cells. Endocr Relat Cancer 10, 179-186.
Dreijerink, K.M., Mulder, K.W., Winkler, G.S., Hoppener, J.W., Lips, C.J., and
Timmers, H.T. (2006). Menin links estrogen receptor activation to histone H3K4
trimethylation. Cancer Res 66, 4929-4935.
Dulic, V., Kaufmann, W.K., Wilson, S.J., Tlsty, T.D., Lees, E., Harper, J.W., Elledge,
S.J., and Reed, S.I. (1994). p53-dependent inhibition of cyclin-dependent kinase activities
in human fibroblasts during radiation-induced Gl arrest. Cell 76, 1013-1023.
Dunican, D.S., McWilliam, P., Tighe, O., Parle-McDermott, A., and Croke, D.T. (2002).
Gene expression differences between the microsatellite instability (MIN) and
chromosomal instability (CIN) phenotypes in colorectal cancer revealed by high-density
cDNA array hybridization. Oncogene 21, 3253-3257.
Dvir, A., Conaway, J.W., and Conaway, R.C. (2001). Mechanism of transcription
initiation and promoter escape by RNA polymerase II. Curr Opin Genet Dev 11, 209-214.
Eberharter, A., and Becker, P.B. (2004). ATP-dependent nucleosome remodelling:
factors and functions. J Cell Sci 117, 3707-3711.
Edwards, D.P., and Boonyaratanakornkit, V. (2003). Rapid extranuclear signaling by the
estrogen receptor (ER): MNAR couples ER and Src to the MAP kinase signaling
pathway. Mol Interv 3, 12-15.
167
Edwards, J.R., O'Donnell, A.H., Rollins, R.A., Peckham, H.E., Lee, C, Milekic, M.H.,
Chanrion, B., Fu, Y., Su, T., Hibshoosh, H., et al. (2010). Chromatin and sequence
features that define the fine and gross structure of genomic methylation patterns. Genome
Res 20, 972-980.
Egli, D., Birkhoff, G., and Eggan, K. (2008). Mediators of reprogramming: transcription
factors and transitions through mitosis. Nat Rev Mol Cell Biol 9, 505-516.
Eirin-Lopez, J.M., Gonzalez-Romero, R., Dryhurst, D., Ishibashi, T., and Ausio, J.
(2009). The evolutionary differentiation of two histone H2A.Z variants in chordates
(H2A.Z-1 and H2A.Z-2) is mediated by a stepwise mutation process that affects three
amino acid residues. BMC Evol Biol 9, 31.
el-Deiry, W.S., Harper, J.W., O'Connor, P.M., Velculescu, V.E., Canman, C.E., Jackman,
J., Pietenpol, J.A., Burrell, M., Hill, D.E., Wang, Y., et al. (1994). WAF1/CIP1 is
induced in p53-mediated Gl arrest and apoptosis. Cancer Res 54, 1169-1174.
Elsaesser, S.J., Goldberg, A.D., and Allis, CD. (2010). New functions for an old variant:
no substitute for histone H3.3. Curr Opin Genet Dev 20, 110-117.
Engel, J.D., and Tanimoto, K. (2000). Looping, linking, and chromatin activity: new
insights into beta-globin locus regulation. Cell 100, 499-502.
Erkine, A.M. (2004). Activation domains of gene-specific transcription factors: are
histones among their targets? Biochem Cell Biol 82, 453-459.
Ernst, J., and Kellis, M. (2010). Discovery and characterization of chromatin states for
systematic annotation of the human genome. Nat Biotechnol 28, 817-825.
Espinosa, J.M., Verdun, R.E., and Emerson, B.M. (2003). p53 functions through stressand promoter-specific recruitment of transcription initiation components before and after
DNA damage. Mol Cell 12, 1015-1027.
Faast, R., Thonglairoam, V., Schulz, T.C., Beall, J., Wells, J.R., Taylor, H., Matthaei, K.,
Rathjen, P.D., Tremethick, D.J., and Lyons, I. (2001). Histone variant H2A.Z is required
for early mammalian development. Curr Biol //, 1183-1187.
Fan, H.Y., He, X., Kingston, R.E., and Narlikar, G.J. (2003a). Distinct strategies to make
nucleosomal DNA accessible. Mol Cell 11, 1311-1322.
168
Fan, J.Y., Gordon, F., Luger, K., Hansen, J.C., and Tremethick, D.J. (2002). The essential
histone variant H2A.Z regulates the equilibrium between different chromatin
conformational states. Nat Struct Biol 9, 172-176.
Fan, J.Y., Rangasamy, D., Luger, K., and Tremethick, D.J. (2004). H2A.Z alters the
nucleosome surface to promote HP 1 alpha-mediated chromatin fiber folding. Mol Cell 16,
655-661.
Fan, M., Bigsby, R.M., and Nephew, K.P. (2003b). The NEDD8 pathway is required for
proteasome-mediated degradation of human estrogen receptor (ER)-alpha and essential
for the antiproliferative activity of ICI 182,780 in ERalpha-positive breast cancer cells.
Mol Endocrinol 17, 356-365.
Fan, M, Yan, P.S., Hartman-Frey, C, Chen, L., Paik, H., Oyer, S.L., Salisbury, J.D.,
Cheng, A.S., Li, L., Abbosh, P.H., et al. (2006). Diverse gene expression and DNA
methylation profiles correlate with differential adaptation of breast cancer cells to the
antiestrogens tamoxifen and fulvestrant. Cancer Res 66, 11954-11966.
Fang, J.Y., and Lu, Y.Y. (2002). Effects of histone acetylation and DNA methylation on
p21( WAF1) regulation. World J Gastroenterol 8, 400-405.
Farris, S.D., Rubio, E.D., Moon, J.J., Gombert, W.M., Nelson, B.H., and Krumm, A.
(2005). Transcription-induced chromatin remodeling at the c-myc gene involves the local
exchange of histone H2A.Z. J Biol Chem 280, 25298-25303.
Fazzio, T.G., Huff, J.T., and Panning, B. (2008). An RNAi screen of chromatin proteins
identifies Tip60-p400 as a regulator of embryonic stem cell identity. Cell 134, 162-174.
Fazzio, T.G., and Tsukiyama, T. (2003). Chromatin remodeling in vivo: evidence for a
nucleosome sliding mechanism. Mol Cell 12, 1333-1340.
Felsenfeld, G., and McGhee, J.D. (1986). Structure of the 30 nm chromatin fiber. Cell 44,
375-377.
Feng, Q., and Zhang, Y. (2003). The NuRD complex: linking histone modification to
nucleosome remodeling. Curr Top Microbiol Immunol 274, 269-290.
Ferguson, D.J., and Anderson, T.J. (1981). Morphological evaluation of cell turnover in
relation to the menstrual cycle in the "resting" human breast. Br J Cancer 44, 177-181.
169
Field, Y., Fondufe-Mittendorf, Y., Moore, I.K., Mieczkowski, P., Kaplan, N., Lubling,
Y., Lieb, J.D., Widom, J., and Segal, E. (2009). Gene expression divergence in yeast is
coupled to evolution of DNA-encoded nucleosome organization. Nat Genet 41, 438-445.
Field, Y., Kaplan, N., Fondufe-Mittendorf, Y., Moore, I.K., Sharon, E., Lubling, Y.,
Widom, J., and Segal, E. (2008). Distinct modes of regulation by chromatin encoded
through nucleosome positioning signals. PLoS Comput Biol 4, el000216.
Fox, E.M., Davis, R.J., and Shupnik, M.A. (2008). ERbeta in breast cancer—onlooker,
passive player, or active protector? Steroids 73, 1039-1051.
Frank, S.R., Parisi, T., Taubert, S., Fernandez, P., Fuchs, M., Chan, H.M., Livingston,
D.M., and Amati, B. (2003). MYC recruits the TIP60 histone acetyltransferase complex
to chromatin. EMBO Rep 4, 575-580.
Fu, Y., Sinha, M., Peterson, C.L., and Weng, Z. (2008). The insulator binding protein
CTCF positions 20 nucleosomes around its binding sites across the human genome. PLoS
Genet ¥, el000138.
Fuchs, M., Gerber, J., Drapkin, R., Sif, S., Ikura, T., Ogryzko, V., Lane, W.S., Nakatani,
Y., and Livingston, D.M. (2001). The p400 complex is an essential E1A transformation
target. Cell 106, 297-307.
Fullwood, M.J., Liu, M.H., Pan, Y.F., Liu, J., Xu, H., Mohamed, Y.B., Orlov, Y.L.,
Velkov, S., Ho, A., Mei, P.H., et al. (2009). An oestrogen-receptor-alpha-bound human
chromatin interactome. Nature 462, 58-64.
Gao, Y., Hyttel, P., and Hall, V.J. (2010). Regulation of H3K27me3 and H3K4me3
during early porcine embryonic development. Mol Reprod Dev 77, 540-549.
Garcia-Bassets, I., Kwon, Y.S., Telese, F., Prefontaine, G.G., Hutt, K.R., Cheng, C.S., Ju,
B.G., Ohgi, K.A., Wang, J., Escoubet-Lozach, L., et al (2007). Histone methylationdependent mechanisms impose ligand dependency for gene activation by nuclear
receptors. Cell 128, 505-518.
Garriga, J., and Grana, X. (2004). Cellular control of gene expression by T-type
cyclin/CDK9 complexes. Gene 337, 15-23.
Gatta, R., and Mantovani, R. (2010). Single nucleosome ChlPs identify an extensive
switch of acetyl marks on cell cycle promoters. Cell Cycle 9.
170
Germain, P., Staels, B., Dacquet, C, Spedding, M., and Laudet, V. (2006). Overview of
nomenclature of nuclear receptors. Pharmacol Rev 58, 685-704.
Gervais, A.L., and Gaudreau, L. (2009). Discriminating nucleosomes containing histone
H2A.Z or H2A based on genetic and epigenetic information. BMC Mol Biol 10, 18.
Gevry, N., Chan, H.M., Laflamme, L., Livingston, D.M., and Gaudreau, L. (2007). p21
transcription is regulated by differential localization of histone H2A.Z. Genes Dev 21,
1869-1881.
Gevry, N., Hardy, S., Jacques, P.E., Laflamme, L., Svotelis, A., Robert, F., and
Gaudreau, L. (2009). Histone H2A.Z is essential for estrogen receptor signaling. Genes
Dev 23, 1522-1533.
Gligoris, T., Thireos, G., and Tzamarias, D. (2007). The Tupl corepressor directs Htzl
deposition at a specific promoter nucleosome marking the GALl gene for rapid
activation. Mol Cell Biol 27, 4198-4205.
Gojis, O., Rudraraju, B., Gudi, M., Hogben, K., Sousha, S., Coombes, R.C., Cleator, S.,
and Palmieri, C. (2010). The role of SRC-3 in human breast cancer. Nat Rev Clin Oncol
7, 83-89.
Gonzalez, M.E., Li, X., Toy, K., DuPrie, M., Ventura, A.C., Banerjee, M., Ljungman, M.,
Merajver, S.D., and Kleer, C.G. (2009). Downregulation of EZH2 decreases growth of
estrogen receptor-negative invasive breast carcinoma and requires BRCA1. Oncogene 28,
843-853.
Gorrini, C, Squatrito, M., Luise, C, Syed, N., Perna, D., Wark, L., Martinato, F.,
Sardella, D., Verrecchia, A., Bennett, S., et al. (2007). Tip60 is a haplo-insufficient
tumour suppressor required for an oncogene-induced DNA damage response. Nature 448,
1063-1067.
Goto, H., Tomono, Y., Ajiro, K., Kosako, H., Fujita, M., Sakurai, M., Okawa, K.,
Iwamatsu, A., Okigaki, T., Takahashi, T., et al. (1999). Identification of a novel
phosphorylation site on histone H3 coupled with mitotic chromosome condensation. J
Biol Chem 274, 25543-25549.
Green, S., Walter, P., Kumar, V., Krust, A., Bornert, J.M., Argos, P., and Chambon, P.
(1986). Human oestrogen receptor cDNA: sequence, expression and homology to v-erbA. Nature 320, 134-139.
171
Greene, G.L., Gilna, P., Waterfield, M., Baker, A., Hort, Y., and Shine, J. (1986).
Sequence and expression of human estrogen receptor complementary DNA. Science 231,
1150-1154.
Gu, W., Shi, X.L., and Roeder, R.G. (1997). Synergistic activation of transcription by
CBP and p53. Nature 387, 819-823.
Guenther, M.G., Levine, S.S., Boyer, L.A., Jaenisch, R., and Young, R.A. (2007). A
chromatin landmark and transcription initiation at most promoters in human cells. Cell
130, 77-88.
Guillemette, B., Bataille, A.R., Gevry, N., Adam, M, Blanchette, M., Robert, F., and
Gaudreau, L. (2005). Variant histone H2A.Z is globally localized to the promoters of
inactive yeast genes and regulates nucleosome positioning. PLoS Biol 3, e384.
Gurley, L.R., D'Anna, J.A., Barham, S.S., Deaven, L.L., and Tobey, R.A. (1978). Histone
phosphorylation and chromatin structure during mitosis in Chinese hamster cells. Eur J
Biochem<W, 1-15.
Hajkova, P., Ancelin, K., Waldmann, T., Lacoste, N., Lange, U.C., Cesari, F., Lee, C,
Almouzni, G., Schneider, R., and Surani, M.A. (2008). Chromatin dynamics during
epigenetic reprogramming in the mouse germ line. Nature 452, 877-881.
Hake, S.B., and Allis, CD. (2006). Histone H3 variants and their potential role in
indexing mammalian genomes: The "H3 barcode hypothesis". Proc Natl Acad Sci USA.
Hall, J.A., and Georgel, P.T. (2007). CHD proteins: a diverse family with strong ties.
Biochem Cell Biol 85, 463-476.
Hanahan, D., and Weinberg, R.A. (2000). The hallmarks of cancer. Cell 100, 57-70.
Hardy, S., Jacques, P.E., Gevry, N., Forest, A., Fortin, M.E., Laflamme, L., Gaudreau, L.,
and Robert, F. (2009). The euchromatic and heterochromatic landscapes are shaped by
antagonizing effects of transcription on H2A.Z deposition. PLoS Genet 5, el 000687.
Hartman, J., Lindberg, K., Morani, A., Inzunza, J., Strom, A., and Gustafsson, J.A.
(2006). Estrogen receptor beta inhibits angiogenesis and growth of T47D breast cancer
xenografts. Cancer Res 66, 11207-11213.
Hartman, J., Strom, A., and Gustafsson, J.A. (2009). Estrogen receptor beta in breast
cancer-diagnostic and therapeutic implications. Steroids 74, 635-641.
172
Hatch, C.L., and Bonner, W.M. (1988). Sequence of cDNAs for mammalian H2A.Z, an
evolutionarily diverged but highly conserved basal histone H2A isoprotein species.
Nucleic Acids Res 16, 1113-1124.
Henikoff, S., Furuyama, T., and Ahmad, K. (2004). Histone variants, nucleosome
assembly and epigenetic inheritance. Trends Genet 20, 320-326.
Hong, S., Cho, Y.W., Yu, L.R., Yu, H., Veenstra, T.D., and Ge, K. (2007). Identification
of JmjC domain-containing UTX and JMJD3 as histone H3 lysine 27 demethylases. Proc
Natl Acad Sci U S A 104, 18439-18444.
Hou, C, Zhao, H., Tanimoto, K., and Dean, A. (2008). CTCF-dependent enhancerblocking by alternative chromatin loop formation. Proc Natl Acad Sci U S A 705, 2039820403.
Hua, S., Kallen, C.B., Dhar, R., Baquero, M.T., Mason, C.E., Russell, B.A., Shah, P.K.,
Liu, J., Khramtsov, A., Tretiakova, M.S., et al. (2008). Genomic analysis of estrogen
cascade reveals histone variant H2A.Z associated with breast cancer progression. Mol
SystBioW, 188.
Hurtado, A., Holmes, K.A., Geistlinger, T.R., Hutcheson, I.R., Nicholson, R.I., Brown,
M., Jiang, J., Howat, W.J., Ali, S., and Carroll, J.S. (2008). Regulation of ERBB2 by
oestrogen receptor-PAX2 determines response to tamoxifen. Nature 456, 663-666.
Imbalzano, A.N., Kwon, H., Green, M.R., and Kingston, R.E. (1994). Facilitated binding
of TATA-binding protein to nucleosomal DNA. Nature 370, 481-485.
Iouzalen, N., Moreau, J., and Mechali, M. (1996). H2A.ZI, a new variant histone
expressed during Xenopus early development exhibits several distinct features from the
core histone H2A. Nucleic Acids Res 24, 3947-3952.
Ishibashi, T., Dryhurst, D., Rose, K.L., Shabanowitz, J., Hunt, D.F., and Ausio, J. (2009).
Acetylation of vertebrate H2A.Z and its effect on the structure of the nucleosome.
Biochemistry 48, 5007-5017.
Issaeva, I., Zonis, Y., Rozovskaia, T., Orlovsky, K., Croce, CM., Nakamura, T., Mazo,
A., Eisenbach, L., and Canaani, E. (2007). Knockdown of ALR (MLL2) reveals ALR
target genes and leads to alterations in cell adhesion and growth. Mol Cell Biol 27, 18891903.
173
Ito, T., Levenstein, M.E., Fyodorov, D.V., Kutach, A.K., Kobayashi, R., and Kadonaga,
J.T. (1999). ACF consists of two subunits, Acfl and ISWI, that function cooperatively in
the ATP-dependent catalysis of chromatin assembly. Genes Dev 13, 1529-1539.
Jackson, J.D., and Gorovsky, M.A. (2000). Histone H2A.Z has a conserved function that
is distinct from that of the major H2A sequence variants. Nucleic Acids Res 28, 38113816.
Jiang, W., Guo, X., and Bhavanandan, V.P. (1998). Histone H2A.F/Z subfamily: the
smallest member and the signature sequence. Biochem Biophys Res Commun 245, 613617.
Jin, C, Zang, C, Wei, G., Cui, K., Peng, W., Zhao, K., and Felsenfeld, G. (2009).
H3.3/H2A.Z double variant-containing nucleosomes mark 'nucleosome-free regions' of
active promoters and other regulatory regions. Nat Genet 41, 941-945.
Jin, J., Cai, Y., Li, B., Conaway, R.C., Workman, J.L., Conaway, J.W., and Kusch, T.
(2005a). In and out: histone variant exchange in chromatin. Trends Biochem Sci 30, 680687.
Jin, J., Cai, Y., Yao, T., Gottschalk, A.J., Florens, L., Swanson, S.K., Gutierrez, J.L.,
Coleman, M.K., Workman, J.L., Mushegian, A., et al. (2005b). A mammalian chromatin
remodeling complex with similarities to the yeast INO80 complex. J Biol Chem 280,
41207-41212.
John, S., Sabo, P.J., Johnson, T.A., Sung, M.H., Biddie, S.C., Lightman, S.L., Voss, T.C.,
Davis, S.R., Meltzer, P.S., Stamatoyannopoulos, J.A., et al. (2008). Interaction of the
glucocorticoid receptor with the chromatin landscape. Mol Cell 29, 611-624.
Jones, R.S. (2007). Epigenetics: reversing the 'irreversible'. Nature 450, 357-359.
Jorgensen, H.F., Giadrossi, S., Casanova, M., Endoh, M., Koseki, H., Brockdorff, N., and
Fisher, A.G. (2006). Stem cells primed for action: polycomb repressive complexes
restrain the expression of lineage-specific regulators in embryonic stem cells. Cell Cycle
5,1411-1414.
Joseph, R., Orlov, Y.L., Huss, M., Sun, W., Kong, S.L., Ukil, L., Pan, Y.F., Li, G., Lim,
ML, Thomsen, J.S., et al. (2010). Integrative model of genomic factors for determining
binding site selection by estrogen receptor-alpha. Mol Syst Biol 6, 456.
174
Juven-Gershon, T., Hsu, J.Y., Theisen, J.W., and Kadonaga, J.T. (2008). The RNA
polymerase II core promoter - the gateway to transcription. Curr Opin Cell Biol 20, 253259.
Kal, A.J., Mahmoudi, T., Zak, N.B., and Verrijzer, C.P. (2000). The Drosophila brahma
complex is an essential coactivator for the trithorax group protein zeste. Genes Dev 14,
1058-1071.
Kalkhoven, E. (2004). CBP and p300: HATs for different occasions. Biochem Pharmacol
65,1145-1155.
Kaplan, N., Moore, I.K., Fondufe-Mittendorf, Y., Gossett, A.J., Tillo, D., Field, Y.,
LeProust, E.M., Hughes, T.R., Lieb, J.D., Widom, J., et al. (2009). The DNA-encoded
nucleosome organization of a eukaryotic genome. Nature 458, 362-366.
Katzenellenbogen, B.S. (1996). Estrogen receptors: bioactivities and interactions with
cell signaling pathways. Biol Reprod 54, 287-293.
Kelley, D.E., Stokes, D.G., and Perry, R.P. (1999). CHDl interacts with SSRPl and
depends on both its chromodomain and its ATPase/helicase-like domain for proper
association with chromatin. Chromosoma 108, 10-25.
Kelly, M.J., and Levin, E.R. (2001). Rapid actions of plasma membrane estrogen
receptors. Trends Endocrinol Metab 12, 152-156.
Kelly, T.K., Miranda, T.B., Liang, G., Berman, B.P., Lin, J.C., Tanay, A., and Jones, P.A.
(2010). H2A.Z maintenance during mitosis reveals nucleosome shifting on mitotically
silenced genes. Mol Cell 39, 901-911.
Keogh, M.C., Mennella, T.A., Sawa, C, Berthelet, S., Krogan, N.J., Wolek, A., Podolny,
V., Carpenter, L.R., Greenblatt, J.F., Baetz, K., et al. (2006). The Saccharomyces
cerevisiae histone H2A variant Htzl is acetylated by NuA4. Genes Dev 20, 660-665.
Kheradmand Kia, S., Solaimani Kartalaei, P., Farahbakhshian, E., Pourfarzad, F., von
Lindern, M., and Verrijzer, C.P. (2009). EZH2-dependent chromatin looping controls
INK4a and INK4b, but not ARF, during human progenitor cell differentiation and
cellular senescence. Epigenetics Chromatin 2, 16.
Kim, J.H., Kim, B., Cai, L., Choi, H.J., Ohgi, K.A., Tran, C, Chen, C, Chung, C.H.,
Huber, O., Rose, D.W., et al. (2005). Transcriptional regulation of a metastasis
suppressor gene by Tip60 and beta-catenin complexes. Nature 434, 921-926.
175
Klotz, D.M., Hewitt, S.C., Ciana, P., Raviscioni, M., Lindzey, J.K., Foley, J., Maggi, A.,
DiAugustine, R.P., and Korach, K.S. (2002). Requirement of estrogen receptor-alpha in
insulin-like growth factor-1 (IGF-l)-induced uterine responses and in vivo evidence for
IGF-1/estrogen receptor cross-talk. J Biol Chem 277, 8531-8537.
Knezetic, J.A., and Luse, D.S. (1986). The presence of nucleosomes on a DNA template
prevents initiation by RNA polymerase II in vitro. Cell 45, 95-104.
Knoepfler, P.S., Zhang, X.Y., Cheng, P.F., Gafken, P.R., McMahon, S.B., and Eisenman,
R.N. (2006). Myc influences global chromatin structure. Embo J 25, 2723-2734.
Kobor, M.S., and Lorincz, M.C. (2009). H2A.Z and DNA methylation: irreconcilable
differences. Trends Biochem Sci 34, 158-161.
Kobor, M.S., Venkatasubrahmanyam, S., Meneghini, M.D., Gin, J.W., Jennings, J.L.,
Link, A.J., Madhani, H.D., and Rine, J. (2004). A pro*lein complex containing the
conserved Swi2/Snf2-related ATPase Swrlp deposits histone variant H2A.Z into
euchromatin. PLoS Biol 2, E131.
Koleske, A.J., and Young, R.A. (1994). An RNA polymerase II holoenzyme responsive
to activators. Nature 368, 466-469.
Kornberg, R.D., and Thomas, J.O. (1974). Chromatin structure; oligomers of the
histones. Science 184, 865-868.
Kotekar, A.S., Weissman, J.D., Gegonne, A., Cohen, H., and Singer, D.S. (2008).
Histone modifications, but not nucleosomal positioning, correlate with major
histocompatibility complex class I promoter activity in different tissues in vivo. Mol Cell
Biol 28, 7323-7336.
Kouzarides, T. (2007). Chromatin modifications and their function. Cell 128, 693-705.
Kramps, C, Strieder, V., Sapetschnig, A., Suske, G., and Lutz, W. (2004). E2F and
Spl/Sp3 Synergize but are not sufficient to activate the MYCN gene in neuroblastomas. J
Biol Chem 279,5110-5117.
Krege, J.H., Hodgin, J.B., Couse, J.F., Enmark, E., Warner, M., Mahler, J.F., Sar, M.,
Korach, K.S., Gustafsson, J.A., and Smithies, O. (1998). Generation and reproductive
phenotypes of mice lacking estrogen receptor beta. Proc Natl Acad Sci U S A 95, 1567715682.
176
Krogan, N.J., Baetz, K., Keogh, M.C., Datta, N., Sawa, C, Kwok, T.C., Thompson, N.J.,
Davey, M.G., Pootoolal, J., Hughes, T.R., et al. (2004). Regulation of chromosome
stability by the histone H2A variant Htzl, the Swrl chromatin remodeling complex, and
the histone acetyltransferase NuA4. Proc Natl Acad Sci U S A 101, 13513-13518.
Krogan, N.J., Keogh, M.C., Datta, N., Sawa, C, Ryan, O.W., Ding, H., Haw, R.A.,
Pootoolal, J., Tong, A., Canadien, V., et al. (2003). A Snf2 family ATPase complex
required for recruitment of the histone H2A variant Htzl. Mol Cell 12, 1565-1576.
Krum, S.A., Miranda-Carboni, G.A., Lupien, M., Eeckhoute, J., Carroll, J.S., and Brown,
M. (2008). Unique ERalpha cistromes control cell type-specific gene regulation. Mol
Endocrinol 22, 2393-2406.
Ku, M, Koche, R.P., Rheinbay, E., Mendenhall, E.M., Endoh, M., Mikkelsen, T.S.,
Presser, A., Nusbaum, C, Xie, X., Chi, A.S., et al. (2008). Genomewide analysis of
PRC1 and PRC2 occupancy identifies two classes of bivalent domains. PLoS Genet 4,
el000242.
Kuang, S.Q., Liao, L., Zhang, H., Lee, A.V., O'Malley, B.W., and Xu, J. (2004).
AIB1/SRC-3 deficiency affects insulin-like growth factor I signaling pathway and
suppresses v-Ha-ras-induced breast cancer initiation and progression in mice. Cancer Res
64, 1875-1885.
Kuiper, G.G., Carlsson, B., Grandien, K., Enmark, E., Haggblad, J., Nilsson, S., and
Gustafsson, J.A. (1997). Comparison of the ligand binding specificity and transcript
tissue distribution of estrogen receptors alpha and beta. Endocrinology 138, 863-870.
Kumar, R., Mandal, M, Lipton, A., Harvey, H., and Thompson, C.B. (1996).
Overexpression of HER2 modulates bcl-2, bcl-XL, and tamoxifen-induced apoptosis in
human MCF-7 breast cancer cells. Clin Cancer Res 2, 1215-1219.
Kumar, R., and Thompson, E.B. (1999). The structure of the nuclear hormone receptors.
Steroids 64, 310-319.
Kumar, V., Green, S., Stack, G., Berry, M., Jin, J.R., and Chambon, P. (1987). Functional
domains of the human estrogen receptor. Cell 57, 941-951.
Kusch, T., Florens, L., Macdonald, W.H., Swanson, S.K., Glaser, R.L., Yates, J.R., 3rd,
Abmayr, S.M., Washburn, M.P., and Workman, J.L. (2004). Acetylation by Tip60 is
required for selective histone variant exchange at DNA lesions. Science 306, 2084-2087.
177
Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst, P., and Reinberg, D.
(2002). Histone methyltransferase activity associated with a human multiprotein complex
containing the Enhancer of Zeste protein. Genes Dev 16, 2893-2905.
Kyprianou, N., English, H.F., Davidson, N.E., and Isaacs, J.T. (1991). Programmed cell
death during regression of the MCF-7 human breast cancer following estrogen ablation.
Cancer Res 57, 162-166.
Lachner, M., O'Carroll, D., Rea, S., Mechtler, K., and Jenuwein, T. (2001). Methylation
of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 410, 116-120.
Lan, F., Bayliss, P.E., Rinn, J.L., Whetstine, J.R., Wang, J.K., Chen, S., Iwase, S.,
Alpatov, R., Issaeva, I., Canaani, E., et al. (2007). A histone H3 lysine 27 demethylase
regulates animal posterior development. Nature 449, 689-694.
Langst, G., and Becker, P.B. (2001). ISWI induces nucleosome sliding on nicked DNA.
Mol Cell 8, 1085-1092.
Langst, G., Bonte, E.J., Corona, D.F., and Becker, P.B. (1999). Nucleosome movement
by CHRAC and ISWI without disruption or trans-displacement of the histone octamer.
Cell 97, 843-852.
Larochelle, M., and Gaudreau, L. (2003). H2A.Z has a function reminiscent of an
activator required for preferential binding to intergenic DNA. Embo J 22, 4512-4522.
Le, N.T., Ho, T.B., and Ho, B.H. (2010). Sequence-dependent histone variant positioning
signatures. BMC Genomics 11 Suppl 4, S3.
Leach, T.J., Mazzeo, M., Chotkowski, H.L., Madigan, J.P., Wotring, M.G., and Glaser,
R.L. (2000). Histone H2A.Z is widely but nonrandomiy distributed in chromosomes of
Drosophila melanogaster. J Biol Chem 275, 23267-23272.
Lee, J.S., Smith, E., and Shilatifard, A. (2010). The language of histone crosstalk. Cell
142, 682-685.
Lee, M.G., Villa, R., Trojer, P., Norman, J., Yan, K.P., Reinberg, D., Di Croce, L., and
Shiekhattar, R. (2007a). Demethylation of H3K27 regulates polycomb recruitment and
H2A ubiquitination. Science 318, 447-450.
178
Lee, W., Tillo, D., Bray, N., Morse, R.H., Davis, R.W., Hughes, T.R., and Nislow, C.
(2007b). A high-resolution atlas of nucleosome occupancy in yeast. Nat Genet 39, 12351244.
Legube, G., Linares, L.K., Tyteca, S., Caron, C, Scheffner, M., Chevillard-Briet, M., and
Trouche, D. (2004). Role of the histone acetyl transferase Tip60 in the p53 pathway. J
Biol Chem 279, 44825-44833.
Lehnes, K., Winder, A.D., Alfonso, C, Kasid, N., Simoneaux, M., Summe, H., Morgan,
E., Iann, M.C., Duncan, J., Eagan, M., et al. (2007). The effect of estradiol on in vivo
tumorigenesis is modulated by the human epidermal growth factor receptor
2/phosphatidylinositol 3-kinase/Aktl pathway. Endocrinology 148, 1171-1180.
Lemieux, K., and Gaudreau, L. (2004). Targeting of Swi/Snf to the yeast GAL1 UAS G
requires the Mediator, TAF lis, and RNA polymerase II. Embo J 23, 4040-4050.
Lemieux, K., Larochelle, M., and Gaudreau, L. (2008). Variant histone H2A.Z, but not
the HMG proteins Nhp6a/b, is essential for the recruitment of Swi/Snf, Mediator, and
SAGA to the yeast GAL1 UAS(G). Biochem Biophys Res Commun 369, 1103-1107.
Levin, E.R. (2005). Integration of the extranuclear and nuclear actions of estrogen. Mol
Endocrinol 19, 1951-1959.
Levine, M., and Tjian, R. (2003). Transcription regulation and animal diversity. Nature
424, 147-151.
Lewis, M.D., Miller, S.A., Miazgowicz, M.M., Beima, K.M., and Weinmann, A.S.
(2007). T-bet's ability to regulate individual target genes requires the conserved T-box
domain to recruit histone methytransferase activity and a separate family memberspecific transactivation domain. Mol Cell Biol 27, 8510-8521.
Li, B., Carey, M., and Workman, J.L. (2007). The role of chromatin during transcription.
Cell 128, 707-719.
Li, B., Pattenden, S.G., Lee, D., Gutierrez, J., Chen, J., Seidel, C, Gerton, J., and
Workman, J.L. (2005). Preferential occupancy of histone variant H2AZ at inactive
promoters influences local histone modifications and chromatin remodeling. Proc Natl
Acad Sci U S A 102, 18385-18390.
Lill, N.L., Grossman, S.R., Ginsberg, D., DeCaprio, J., and Livingston, D.M. (1997).
Binding and modulation of p53 by p300/CBP coactivators. Nature 387, 823-827.
179
Lin, C.Y., Vega, V.B., Thomsen, J.S., Zhang, T., Kong, S.L., Xie, M., Chiu, K.P.,
Lipovich, L., Barnett, D.H., Stossi, F., et al (2007a). Whole-genome cartography of
estrogen receptor alpha binding sites. PLoS Genet 3, e87.
Lin, Z., Reierstad, S., Huang, C.C., and Bulun, S.E. (2007b). Novel estrogen receptoralpha binding sites and estradiol target genes identified by chromatin
immunoprecipitation cloning in breast cancer. Cancer Res 67, 5017-5024.
Ling, J.Q., Li, T., Hu, J.F., Vu, T.H., Chen, H.L., Qiu, X.W., Cherry, A.M., and Hoffman,
A.R. (2006). CTCF mediates interchromosomal colocalization between Igf2/H19 and
Wsbl/Nfl. Science 312, 269-272.
Liu, C.L., Kaplan, T., Kim, M., Buratowski, S., Schreiber, S.L., Friedman, N., and
Rando, O.J. (2005). Single-nucleosome mapping of histone modifications in S.
cerevisiae. PLoS Biol 3, e328.
Liu, X., Bowen, J., and Gorovsky, M.A. (1996a). Either of the major H2A genes but not
an evolutionarily conserved H2A.F/Z variant of Tetrahymena thermophila can function as
the sole H2A gene in the yeast Saccharomyces cerevisiae. Mol Cell Biol 16,2878-2887.
Liu, X., Li, B., and GorovskyMa (1996b). Essential and nonessential histone H2A
variants in Tetrahymena thermophila. Mol Cell Biol 16, 4305-4311.
Lorch, Y., LaPointe, J.W., and Kornberg, R.D. (1987). Nucleosomes inhibit the initiation
of transcription but allow chain elongation with the displacement of histones. Cell 49,
203-210.
Loyola, A., LeRoy, G., Wang, Y.H., and Reinberg, D. (2001). Reconstitution of
recombinant chromatin establishes a requirement for histone-tail modifications during
chromatin assembly and transcription. Genes Dev 15, 2837-2851.
Luger, K. (2003). Structure and dynamic behavior of nucleosomes. Curr Opin Genet Dev
13, 127-135.
Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997).
Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389, 251260.
Luk, E., Ranjan, A., Fitzgerald, P.C., Mizuguchi, G., Huang, Y., Wei, D., and Wu, C.
(2010). Stepwise Histone Replacement by SWR1 Requires Dual Activation with Histone
H2A.Z and Canonical Nucleosome. Cell 143, 725-736.
180
Luk, E., Vu, N.D., Patteson, K., Mizuguchi, G., Wu, W.H., Ranjan, A., Backus, J., Sen,
S., Lewis, M., Bai, Y., et al. (2007). Chzl, a nuclear chaperone for histone H2AZ. Mol
Cell 25, 357-368.
Lupien, M., Eeckhoute, J., Meyer, C.A., Wang, Q., Zhang, Y., Li, W., Carroll, J.S., Liu,
X.S., and Brown, M. (2008). FoxAl translates epigenetic signatures into enhancer-driven
lineage-specific transcription. Cell 132, 958-970.
Lusser, A., and Kadonaga, J.T. (2003). Chromatin remodeling by ATP-dependent
molecular machines. Bioessays 25, 1192-1200.
Malik, H.S., and Henikoff, S. (2003). Phylogenomics of the nucleosome. Nat Struct Biol
70,882-891.
Malik, S., and Roeder, R.G. (2000). Transcriptional regulation through Mediator-like
coactivators in yeast and metazoan cells. Trends Biochem Sci 25, 277-283.
Malik, S., and Roeder, R.G. (2010). The metazoan Mediator co-activator complex as an
integrative hub for transcriptional regulation. Nat Rev Genet 11, 761-772.
Mangelsdorf, D.J., Thummel, C, Beato, M., Herrlich, P., Schutz, G., Umesono, K.,
Blumberg, B., Kastner, P., Mark, M., Chambon, P., et al. (1995). The nuclear receptor
superfamily: the second decade. Cell 83, 835-839.
Margueron, R., Trojer, P., and Reinberg, D. (2005). The key to development: interpreting
the histone code? Curr Opin Genet Dev 15, 163-176.
Marmorstein, R. (2001). Protein modules that manipulate histone tails for chromatin
regulation. Nat Rev Mol Cell Biol 2, 422-432.
Marquez, D.C., and Pietras, R.J. (2001). Membrane-associated binding sites for estrogen
contribute to growth regulation of human breast cancer cells. Oncogene 20, 5420-5430.
Martin, M.B., Franke, T.F., Stoica, G.E., Chambon, P., Katzenellenbogen, B.S., Stoica,
B.A., McLemore, M.S., OHvo, S.E., and Stoica, A. (2000). A role for Akt in mediating
the estrogenic functions of epidermal growth factor and insulin-like growth factor I.
Endocrinology 141, 4503-4511.
Mattera, L., Courilleau, C, Legube, G., Ueda, T., Fukunaga, R., Chevillard-Briet, M.,
Canitrot, Y., Escaffit, F., and Trouche, D. (2010). The ElA-associated p400 protein
181
modulates cell fate decisions by the regulation of ROS homeostasis. PLoS Genet 6,
el 000983.
Mattera, L., Escaffit, F., Pillaire, M.J., Selves, J., Tyteca, S., Hoffmann, J.S., Gourraud,
P.A., Chevillard-Briet, M., Cazaux, C, and Trouche, D. (2009). The p400/Tip60 ratio is
critical for colorectal cancer cell proliferation through DNA damage response pathways.
Oncogene 28, 1506-1517.
Matthews, J., and Gustafsson, J.A. (2003). Estrogen signaling: a subtle balance between
ER alpha and ER beta. Mol Interv 3, 281-292.
Mavrich, T.N., Ioshikhes, LP., Venters, B.J., Jiang, C, Tomsho, L.P., Qi, J., Schuster,
S.C., Albert, 1., and Pugh, B.F. (2008a). A barrier nucleosome model for statistical
positioning of nucleosomes throughout the yeast genome. Genome Res 18, 1073-1083.
Mavrich, T.N., Jiang, C, Ioshikhes, LP., Li, X., Venters, B.J., Zanton, S.J., Tomsho, L.P.,
Qi, J., Glaser, R.L., Schuster, S.C., et al. (2008b). Nucleosome organization in the
Drosophila genome. Nature 453, 358-362.
Mazurkiewicz, J., Kepert, J.F., and Rippe, K. (2006). On the mechanism of nucleosome
assembly by histone chaperone NAP1. J Biol Chem 281, 16462-16472.
McClelland, R.A., Manning, D.L., Gee, J.M., Anderson, E., Clarke, R., Howell, A.,
Dowsett, M., Robertson, J.F., Blarney, R.W., Wakeling, A.E., et al. (1996). Effects of
short-term antiestrogen treatment of primary breast cancer on estrogen receptor mRNA
and protein expression and on estrogen-regulated genes. Breast Cancer Res Treat 41, 3141.
McKittrick, E., Gafken, P.R., Ahmad, K., and Henikoff, S. (2004). Histone H3.3 is
enriched in covalent modifications associated with active chromatin. Proc Natl Acad Sci
US A 101, 1525-1530.
Mellor, J. (2005). The dynamics of chromatin remodeling at promoters. Mol Cell 19,
147-157.
Meneghini, M.D., Wu, M., and Madhani, H.D. (2003). Conserved histone variant H2A.Z
protects euchromatin from the ectopic spread of silent heterochromatin. Cell 112, 725736.
Metivier, R., Huet, G., Gallais, R., Finot, L., Petit, F., Tiffoche, C, Merot, Y., LePeron,
C, Reid, G., Penot, G., et al. (2008). Dynamics of estrogen receptor-mediated
182
transcriptional activation of responsive genes in vivo: apprehending transcription in four
dimensions. Adv Exp Med Biol 617, 129-138.
Metivier, R., Penot, G., Carmouche, R.P., Hubner, M.R., Reid, G., Denger, S., Manu, D.,
Brand, H., Kos, M., Benes, V., et al. (2004). Transcriptional complexes engaged by apoestrogen receptor-alpha isoforms have divergent outcomes. Embo J 23, 3653-3666.
Metivier, R., Penot, G., Hubner, M.R., Reid, G., Brand, H., Kos, M., and Gannon, F.
(2003). Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment
of cofactors on a natural target promoter. Cell 115, 751-763.
Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez,
P., Brockman, W., Kim, T.K., Koche, R.P., et al. (2007). Genome-wide maps of
chromatin state in pluripotent and lineage-committed cells. Nature 448, 553-560.
Millar, C.B., Xu, F., Zhang, K., and Grunstein, M. (2006). Acetylation of H2AZ Lys 14
is associated with genome-wide gene activity in yeast. Genes Dev 20, 711-722.
Miller, S.A., Mohn, S.E., and Weinmann, A.S. (2010). Jmjd3 and UTX play a
demethylase-independent role in chromatin remodeling to regulate T-box family
member-dependent gene expression. Mol Cell 40, 594-605.
Miller, S.A., and Weinmann, A.S. (2009). An essential interaction between T-box
proteins and histone-modifying enzymes. Epigenetics 4, 85-88.
Miller, S.A., and Weinmann, A.S. (2010). Molecular mechanisms by which T-bet
regulates T-helper cell commitment. Immunol Rev 238, 233-246.
Mitchell, P.J., and Tjian, R. (1989). Transcriptional regulation in mammalian cells by
sequence-specific DNA binding proteins. Science 245, 371-378.
Mizuguchi, G., Shen, X., Landry, J., Wu, W.H., Sen, S., and Wu, C. (2004). ATP-driven
exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex.
Science 303, 343-348.
Mo, R., Rao, S.M., and Zhu, Y.J. (2006). Identification of the MLL2 complex as a
coactivator for estrogen receptor alpha. J Biol Chem 281, 15714-15720.
Muegge, K., Xi, S., and Geiman, T. (2008). The see-saw of differentiation: tipping the
chromatin balance. Mol Interv 8, 15-18, 12.
183
Mukhopadhyay, D., and Riezman, H. (2007). Proteasome-independent functions of
ubiquitin in endocytosis and signaling. Science 315, 201-205.
Muller, J., Hart, CM., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L.,
O'Connor, M.B., Kingston, R.E., and Simon, J.A. (2002). Histone methyltransferase
activity of a Drosophila Polycomb group repressor complex. Cell 111, 197-208.
Nagl, N.G., Jr., Wang, X., Patsialou, A., Van Scoy, M., and Moran, E. (2007). Distinct
mammalian SWI/SNF chromatin remodeling complexes with opposing roles in cell-cycle
control. Embo J 26, 752-763.
Narita, M., and Lowe, S.W. (2005). Senescence comes of age. Nat Med 11, 920-922.
Natarajan, T.G., Kallakury, B.V., Sheehan, C.E., Bartlett, M.B., Ganesan, N., Preet, A.,
Ross, J.S., and Fitzgerald, K.T. (2010). Epigenetic regulator MLL2 shows altered
expression in cancer cell lines and tumors from human breast and colon. Cancer Cell Int
10, 13.
Naughton, C, MacLeod, K., Kuske, B., Clarke, R., Cameron, D.A., and Langdon, S.P.
(2007). Progressive loss of estrogen receptor alpha cofactor recruitment in endocrine
resistance. Mol Endocrinol 21, 2615-2626.
Ng, S.S., Yue, W.W., Oppermann, U., and Klose, R.J. (2009). Dynamic protein
methylation in chromatin biology. Cell Mol Life Sci 66, 407-422.
Niessen, H.E., Demmers, J.A., and Voncken, J.W. (2009). Talking to chromatin: posttranslational modulation of polycomb group function. Epigenetics Chromatin 2, 10.
Normanno, N., Di Maio, M., De Maio, E., De Luca, A., de Matteis, A., Giordano, A., and
Perrone, F. (2005). Mechanisms of endocrine resistance and novel therapeutic strategies
in breast cancer. Endocr Relat Cancer 12, 721-747.
O'Lone, R., Frith, M.C., Karlsson, E.K., and Hansen, U. (2004). Genomic targets of
nuclear estrogen receptors. Mol Endocrinol 18, 1859-1875.
Ordonez-Moran, P., and Munoz, A. (2009). Nuclear receptors: genomic and non-genomic
effects converge. Cell Cycle 8, 1675-1680.
Osborne, C.K., Bardou, V., Hopp, T.A., Chamness, G.C., Hilsenbeck, S.G., Fuqua, S.A.,
Wong, J., Allred, D.C., Clark, G.M., and Schiff, R. (2003). Role of the estrogen receptor
184
coactivator AIB1 (SRC-3) and HER-2/neu in tamoxifen resistance in breast cancer. J Natl
Cancer Inst 05, 353-361.
Ozsolak, F., Song, J.S., Liu, X.S., and Fisher, D.E. (2007). High-throughput mapping of
the chromatin structure of human promoters. Nat Biotechnol 25, 244-248.
Pan, Y.F., Wansa, K.D., Liu, M.H., Zhao, B., Hong, S.Z., Tan, P.Y., Lim, K.S., Bourque,
G., Liu, E.T., and Cheung, E. (2008). Regulation of estrogen receptor-mediated long
range transcription via evolutionarily conserved distal response elements. J Biol Chem
283, 32977-32988.
Park, J.H., and Roeder, R.G. (2006). GAS41 is required for repression of the p53 tumor
suppressor pathway during normal cellular proliferation. Mol Cell Biol 26, 4006-4016.
Park, S., Song, J., Joe, CO., and Shin, I. (2008). Akt stabilizes estrogen receptor alpha
with the concomitant reduction in its transcriptional activity. Cell Signal 20, 1368-1374.
Paruthiyil, S., Parmar, H., Kerekatte, V., Cunha, G.R., Firestone, G.L., and Leitman, D.C.
(2004). Estrogen receptor beta inhibits human breast cancer cell proliferation and tumor
formation by causing a G2 cell cycle arrest. Cancer Res 64, 423-428.
Pasini, D., Hansen, K.H., Christensen, J., Agger, K., Cloos, P.A., and Helin, K. (2008).
Coordinated regulation of transcriptional repression by the RBP2 H3K4 demethylase and
Polycomb-Repressive Complex 2. Genes Dev 22, 1345-1355.
Pasini, D., Malatesta, M., Jung, H.R., Walfridsson, J., Wilier, A., Olsson, L., Skotte, J.,
Wutz, A., Porse, B., Jensen, O.N., et al. (2010). Characterization of an antagonistic
switch between histone H3 lysine 27 methylation and acetylation in the transcriptional
regulation of Polycomb group target genes. Nucleic Acids Res 38, 4958-4969.
Pearce, S.T., and Jordan, V.C. (2004). The biological role of estrogen receptors alpha and
beta in cancer. Crit Rev Oncol Hematol 50,
'i-ll.
Peckham, H.E., Thurman, R.E., Fu, Y., Stamatoyannopoulos, J.A., Noble, W.S., Struhl,
K., and Weng, Z. (2007). Nucleosome positioning signals in genomic DNA. Genome Res
77,1170-1177.
Pedersen, M.T., and Helin, K. (2010). Histone demethylases in development and disease.
Trends Cell Biol 20, 662-671.
185
Perillo, B., Ombra, M.N., Bertoni, A., Cuozzo, C, Sacchetti, S., Sasso, A., Chiariotti, L.,
Malorni, A., Abbondanza, C, and Avvedimento, E.V. (2008). DNA oxidation as
triggered by H3K9me2 demethylation drives estrogen-induced gene expression. Science
319, 202-206.
Pickart, CM. (2004). Back to the future with ubiquitin. Cell 116, 181-190.
Pietras, R.J., and Marquez-Garban, D.C. (2007). Membrane-associated estrogen receptor
signaling pathways in human cancers. Clin Cancer Res 13,4672-4676.
Pike, A.C., Brzozowski, A.M., and Hubbard, R.E. (2000a). A structural biologist's view
of the oestrogen receptor. J Steroid Biochem Mol Biol 74, 261-268.
Pike, A.C., Brzozowski, A.M., Walton, J., Hubbard, R.E., Bonn, T., Gustafsson, J.A., and
Carlquist, M. (2000b). Structural aspects of agonism and antagonism in the oestrogen
receptor. Biochem Soc Trans 28, 396-400.
Polo, S.E., and Almouzni, G. (2006). Chromatin assembly: a basic recipe with various
flavours. Curr Opin Genet Dev 16, 104-111.
Preuss, U., Landsberg, G., and Scheidtmann, K.H. (2003). Novel mitosis-specific
phosphorylation of histone H3 at Thrl 1 mediated by Dlk/ZIP kinase. Nucleic Acids Res
31, 878-885.
Ptashne, M. (2005). Regulation of transcription: from lambda to eukaryotes. Trends
Biochem Sci 30, 275-279.
Pusarla, R.H., and Bhargava, P. (2005). Histones in functional diversification. Core
histone variants. FEBS Journal 272, 5149-5168.
Rada-Iglesias, A., Bajpai, R., Swigut, T., Brugmann, S.A., Flynn, R.A., and Wysocka, J.
(2010). A unique chromatin signature uncovers early developmental enhancers in
humans. Nature.
Raisner, R.M., Hartley, P.D., Meneghini, M.D., Bao, M.Z., Liu, C.L., Schreiber, S.L.,
Rando, O.J., and Madhani, H.D. (2005). Histone variant H2A.Z marks the 5' ends of both
active and inactive genes in euchromatin. Cell 123, 233-248.
Rangasamy, D., Berven, L., Ridgway, P., and Tremethick, D.J. (2003). Pericentric
heterochromatin becomes enriched with H2A.Z during early mammalian development.
Embo J 22, 1599-1607.
186
Razandi, M., Pedram, A., Greene, G.L., and Levin, E.R. (1999). Cell membrane and
nuclear estrogen receptors (ERs) originate from a single transcript: studies of ERalpha
and ERbeta expressed in Chinese hamster ovary cells. Mol Endocrinol 13, 307-319.
Reese, J.C. (2003). Basal transcription factors. Curr Opin Genet Dev 13, 114-118.
Ren, Q., and Gorovsky, M.A. (2001). Histone H2A.Z acetylation modulates an essential
charge patch. Mol Cell 7, 1329-1335.
Rhodes, D.R., Yu, J., Shanker, K., Deshpande, N., Varambally, R., Ghosh, D., Barrette,
T., Pandey, A., and Chinnaiyan, A.M. (2004). Large-scale meta-analysis of cancer
microarray data identifies common transcriptional profiles of neoplastic transformation
and progression. Proc Natl Acad Sci U S A 101, 9309-9314.
Rice, J.C, and Allis, CD. (2001). Code of silence. Nature 414, 258-261.
Richly, H., Lange, M., Simboeck, E., and Di Croce, L. (2010). Setting and resetting of
epigenetic marks in malignant transformation and development. Bioessays 32, 669-679.
Riggins, R.B., Schrecengost, R.S., Guerrero, M.S., and Bouton, A.H. (2007). Pathways to
tamoxifen resistance. Cancer Lett 256, 1-24.
Rodriguez, P., Munroe, D., Prawitt, D., Chu, L.L., Brie, E., Kim, J., Reid, L.H., Davies,
C, Nakagama, H., Loebbert, R., et al. (1997). Functional characterization of human
nucleosome assembly protein-2 (NAP1L4) suggests a role as a histone chaperone.
Genomics 44, 253-265.
Ruff, M., Gangloff, M., Wurtz, J.M., and Moras, D. (2000). Estrogen receptor
transcription and transactivation: Structure-function relationship in DNA- and ligandbinding domains of estrogen receptors. Breast Cancer Res 2, 353-359.
Ruhl, D.D., Jin, J., Cai, Y., Swanson, S., Florens, L., Washburn, M.P., Conaway, R.C,
Conaway, J.W., and Chrivia, J.C. (2006). Purification of a Human SRCAP Complex That
Remodels Chromatin by Incorporating the Histone Variant H2A.Z into Nucleosomes.
Biochemistry 45, 5671-5677.
Saha, A., Wittmeyer, J., and Cairns, B.R. (2006). Chromatin remodelling: the industrial
revolution of DNA around histones. Nat Rev Mol Cell Biol 7, 437-447.
Sakabe, N.J., and Nobrega, M.A. (2010). Genome-wide maps of transcription regulatory
elements. Wiley Interdiscip Rev Syst Biol Med 2, 422-437'.
187
Samuelson, A.V., Narita, M., Chan, H.M., Jin, J., de Stanchina, E., McCurrach, M.E.,
Narita, M., Fuchs, M., Livingston, D.M., and Lowe, S.W. (2005). p400 is required for
E1A to promote apoptosis. J Biol Chem 280, 21915-21923.
Sanchez, R., and Zhou, M.M. (2009). The role of human bromodomains in chromatin
biology and gene transcription. Curr Opin Drug Discov Devel 12, 659-665.
Sandelin, A., Carninci, P., Lenhard, B., Ponjavic, J., Hayashizaki, Y., and Hume, D.A.
(2007). Mammalian RNA polymerase II core promoters: insights from genome-wide
studies. Nat Rev Genet 8,424-436.
Santisteban, M.S., Kalashnikova, T., and Smith, M.M. (2000). Histone H2A.Z regulats
transcription and is partially redundant with nucleosome remodeling complexes. Cell
705,411-422.
Sarcinella, E., Zuzarte, P.C., Lau, P.N., Draker, R., and Cheung, P. (2007).
Monoubiquitylation of H2A.Z distinguishes its association with euchromatin or
facultative heterochromatin. Mol Cell Biol 27, 6457-6468.
Sawan, C, and Herceg, Z. (2010). Histone modifications and cancer. Adv Genet 70, 5785.
Schiff, R., Massarweh, S.A., Shou, J., Bharwani, L., Mohsin, S.K., and Osborne, C.K.
(2004). Cross-talk between estrogen receptor and growth factor pathways as a molecular
target for overcoming endocrine resistance. Clin Cancer Res 10, 331S-336S.
Schiltz, R.L., Mizzen, C.A., Vassilev, A., Cook, R.G., Allis, CD., and Nakatani, Y.
(1999). Overlapping but distinct patterns of histone acetylation by the human coactivators
p300 and PCAF within nucleosomal substrates. J Biol Chem 274,1189-1192.
Schones, D.E., Cui, K., Cuddapah, S., Roh, T.Y., Barski, A., Wang, Z., Wei, G., and
Zhao, K. (2008). Dynamic regulation of nucleosome positioning in the human genome.
Cell 132, 887-898.
Schuettengruber, B., Chourrout, D., Vervoort, M., Leblanc, B., and Cavalli, G. (2007).
Genome regulation by polycomb and trithorax proteins. Cell 128, 735-745.
Schwartz, Y.B., Kahn, T.G., Stenberg, P., Ohno, K., Bourgon, R., and Pirrotta, V. (2010).
Alternative epigenetic chromatin states of polycomb target genes. PLoS Genet 6,
el 000805.
188
Schwarz, P.M., Felthauser, A., Fletcher, T.M., and Hansen, J.C. (1996). Reversible
oligonucleosome self-association: dependence on divalent cations and core histone tail
domains. Biochemistry 35, 4009-4015.
Seenundun, S., Rampalli, S., Liu, Q.C., Aziz, A., Palii, C, Hong, S., Blais, A., Brand, M.,
Ge, K., and Dilworth, F.J. (2010). UTX mediates demethylation of H3K27me3 at musclespecific genes during myogenesis. Embo J 29, 1401-1411.
Segal, E., Fondufe-Mittendorf, Y., Chen, L., Thastrom, A., Field, Y., Moore, I.K., Wang,
J.P., and Widom, J. (2006). A genomic code for nucleosome positioning. Nature 442,
112-11%.
Segal, E., and Widom, J. (2009). What controls nucleosome positions? Trends Genet 25,
335-343.
Seligson, D.B., Horvath, S., Shi, T., Yu, H., Tze, S., Grunstein, M., and Kurdistani, S.K.
(2005). Global histone modification patterns predict risk of prostate cancer recurrence.
Nature 435, 1262-1266.
Seoane, J., Le, H.V., and Massague, J. (2002). Myc suppression of the p21(Cipl) Cdk
inhibitor influences the outcome of the p53 response to DNA damage. Nature 419, 729734.
Shang, Y., Hu, X., DiRenzo, J., Lazar, M.A., and Brown, M. (2000). Cofactor dynamics
and sufficiency in estrogen receptor-regulated transcription. Cell 103, 843-852.
Shao, Z., Raible, F., Mollaaghababa, R., Guyon, J.R., Wu, C.T., Bender, W., and
Kingston, R.E. (1999). Stabilization of chromatin structure by PRC1, a Polycomb
complex. Cell 98, 37-46.
Sharov, A.A., and Ko, M.S. (2007). Human ES cell profiling broadens the reach of
bivalent domains. Cell Stem Cell 1, 237-238.
Shin, J.Y., Kim, H.S., Park, J., Park, J.B., and Lee, J.Y. (2000). Mechanism for
inactivation of the KIP family cyclin-dependent kinase inhibitor genes in gastric cancer
cells. Cancer Res 60, 262-265.
Shivaswamy, S., Bhinge, A., Zhao, Y., Jones, S., Hirst, M., and Iyer, V.R. (2008).
Dynamic remodeling of individual nucleosomes across a eukaryotic genome in response
to transcriptional perturbation. PLoS Biol 6, e65.
189
Shou, J., Massarweh, S., Osborne, C.K., Wakeling, A.E., Ali, S., Weiss, H., and Schiff,
R. (2004). Mechanisms of tamoxifen resistance: increased estrogen receptor-HER2/neu
cross-talk in ER/HER2-positive breast cancer. J Natl Cancer Inst 96, 926-935.
Sims, R.J., 3rd, Nishioka, K., and Reinberg, D. (2003). Histone lysine methylation: a
signature for chromatin function. Trends Genet 19, 629-639.
Smith, C.L., Onate, S.A., Tsai, M.J., and O'Malley, B.W. (1996). CREB binding protein
acts synergistically with steroid receptor coactivator-1 to enhance steroid receptordependent transcription. Proc Natl Acad Sci U S A 93, 8884-8888.
Smith, E.R., Lee, M.G., Winter, B., Droz, N.M., Eissenberg, J.C., Shiekhattar, R., and
Shilatifard, A. (2008). Drosophila UTX is a histone H3 Lys27 demethylase that
colocalizes with the elongating form of RNA polymerase II. Mol Cell Biol 28, 10411046.
Smith, S., and Stillman, B. (1989). Purification and characterization of CAF-I, a human
cell factor required for chromatin assembly during DNA replication in vitro. Cell 58, 1525.
Smith, S., and Stillman, B. (1991). Stepwise assembly of chromatin during DNA
replication in vitro. Embo J 10, 971-980.
Sommer, S., and Fuqua, S.A. (2001). Estrogen receptor and breast cancer. Semin Cancer
Biol 11, 339-352.
Song, R.X., McPherson, R.A., Adam, L., Bao, Y., Shupnik, M., Kumar, R., and Santen,
R.J. (2002). Linkage of rapid estrogen action to MAPK activation by ERalpha-Shc
association and She pathway activation. Mol Endocrinol 16, 116-127.
Soshnikova, N., and Duboule, D. (2009). Epigenetic regulation of vertebrate Hox genes:
a dynamic equilibrium. Epigenetics 4, 537-540.
Splinter, E., Heath, H., Kooren, J., Palstra, R.J., Klous, P., Grosveld, F., Galjart, N., and
de Laat, W. (2006). CTCF mediates long-range chromatin looping and local histone
modification in the beta-globin locus. Genes Dev 20, 2349-2354.
Srinivasan, S., Dorighi, K.M., and Tamkun, J.W. (2008). Drosophila Kismet regulates
histone H3 lysine 27 methylation and early elongation by RNA polymerase II. PLoS
Genet 4, el000217.
190
Stargell, L.A., Bowen, J., Dadd, C.A., Dedon, P.C, Davis, M., Cook, R.G., Allis, CD.,
and Gorovsky, M.A. (1993). Temporal and spatial association of histone H2A variant hvl
with transcriptionally competent chromatin during nuclear development in Tetrahymena
thermophila. Genes Dev 7, 2641-2651.
Sterner, D.E., and Berger, S.L. (2000). Acetylation of histones and transcription-related
factors. Microbiol Mol Biol Rev 64,435-459.
Stock, J.K., Giadrossi, S., Casanova, M., Brookes, E., Vidal, M., Koseki, H., Brockdorff,
N., Fisher, A.G., and Pombo, A. (2007). Ring 1-mediated ubiquitination of H2A restrains
poised RNA polymerase II at bivalent genes in mouse ES cells. Nat Cell Biol 9, 14281435.
Stoica, G.E., Franke, T.F., Moroni, M., Mueller, S., Morgan, E., Iann, M.C., Winder,
A.D., Reiter, R., Wellstein, A., Martin, M.B., et al. (2003a). Effect of estradiol on
estrogen receptor-alpha gene expression and activity can be modulated by the ErbB2/PI
3-K/Akt pathway. Oncogene 22, 7998-8011.
Stoica, G.E., Franke, T.F., Wellstein, A., Czubayko, F., List, H.J., Reiter, R., Morgan, E.,
Martin, M.B., and Stoica, A. (2003b). Estradiol rapidly activates Akt via the ErbB2
signaling pathway. Mol Endocrinol 17, 818-830.
Stoica, G.E., Franke, T.F., Wellstein, A., Morgan, E., Czubayko, F., List, H.J., Reiter, R.,
Martin, M.B., and Stoica, A. (2005). Heregulin-betal regulates the estrogen receptoralpha gene expression and activity via the ErbB2/PI 3-K/Akt pathway. Oncogene 24,
1964.
Strahl, B.D., and Allis, CD. (2000). The language of covalent histone modifications.
Nature 403, 41-45.
Strom, A., Hartman, J., Foster, J.S., Kietz, S., Wimalasena, J., and Gustafsson, J.A.
(2004). Estrogen receptor beta inhibits 17beta-estradiol-stimulated proliferation of the
breast cancer cell line T47D. Proc Natl Acad Sci U S A 101, 1566-1571.
Sun, M., Paciga, J.E., Feldman, R.I., Yuan, Z., Coppola, D., Lu, Y.Y., Shelley, S.A.,
Nicosia, S.V., and Cheng, J.Q. (2001). Phosphatidylinositol-3-OH Kinase (PI3K)/AKT2,
activated in breast cancer, regulates and is induced by estrogen receptor alpha (ERalpha)
via interaction between ERalpha and PI3K. Cancer Res 61, 5985-5991.
191
Suto, R.K., Clarkson, M.J., Tremethick, D.J., and Luger, K. (2000). Crystal structure of a
nucleosome core particle containing the variant histone H2A.Z. Nat Struct Biol 7, 11211124.
Svotelis, A., Gevry, N., and Gaudreau, L. (2009). Regulation of gene expression and
cellular proliferation by histone H2A.Z. Biochem Cell Biol 87, 179-188.
Svotelis, A., Gevry, N., Grondin, G., and Gaudreau, L. (2010). H2A.Z overexpression
promotes cellular proliferation of breast cancer cells. Cell Cycle 9, 364-370.
Swigut, T., and Wysocka, J. (2007). H3K27 demethylases, at long last. Cell 131,29-32.
Szutorisz, H., Dillon, N., and Tora, L. (2005). The role of enhancers as centres for
general transcription factor recruitment. Trends Biochem Sci 30, 593-599.
Talbert, P.B., and Henikoff, S. (2010). Histone variants-ancient wrap artists of the
epigenome. Nat Rev Mol Cell Biol 11, 264-275.
Tang, Y., Luo, J., Zhang, W., and Gu, W. (2006). Tip60-dependent acetylation of p53
modulates the decision between cell-cycle arrest and apoptosis. Mol Cell 24, 827-839.
Tarakhovsky, A. (2010). Tools and landscapes of epigenetics. Nat Immunol //, 565-568.
Taubert, S., Gorrini, C, Frank, S.R., Parisi, T., Fuchs, M., Chan, H.M., Livingston, D.M.,
and Amati, B. (2004). E2F-dependent histone acetylation and recruitment of the Tip60
acetyltransferase complex to chromatin in late Gl. Mol Cell Biol 24, 4546-4556.
Teixeira, C, Reed, J.C., and Pratt, M.A. (1995). Estrogen promotes chemotherapeutic
drug resistance by a mechanism involving Bcl-2 proto-oncogene expression in human
breast cancer cells. Cancer Res 55, 3902-3907.
Theo Sijtse Palstra, R.J. (2009). Close encounters of the 3C kind: long-range chromatin
interactions and transcriptional regulation. Brief Funct Genomic Proteomic 8, 297-309.
Tie, F., Banerjee, R., Stratton, C.A., Prasad-Sinha, J., Stepanik, V., Zlobin, A., Diaz,
M.O., Scacheri, P.C., and Harte, P.J. (2009). CBP-mediated acetylation of histone H3
lysine 27 antagonizes Drosophila Polycomb silencing. Development 136, 3131-3141.
Tirosh, I., and Barkai, N. (2008). Two strategies for gene regulation by promoter
nucleosomes. Genome Res 18, 1084-1091.
192
Tiwari, V.K., McGarvey, K.M., Licchesi, J.D., Ohm, J.E., Herman, J.G., Schubeler, D.,
and Baylin, S.B. (2008). PcG proteins, DNA methylation, and gene repression by
chromatin looping. PLoS Biol 6, 2911-2927.
Tolstorukov, M.Y., Kharchenko, P.V., Goldman, J.A., Kingston, R.E., and Park, P.J.
(2009). Comparative analysis of H2A.Z nucleosome organization in the human and yeast
genomes. Genome Res 19, 967-977.
Tyler, J.K., Adams, C.R., Chen, S.R., Kobayashi, R., Kamakaka, R.T., and Kadonaga,
J.T. (1999). The RCAF complex mediates chromatin assembly during DNA replication
and repair. Nature 402, 555-560.
Tyteca, S., Legube, G., and Trouche, D. (2006a). To die or not to die: a HAT trick. Mol
Cell 24, 807-808.
Tyteca, S., Vandromme, M., Legube, G., Chevillard-Briet, M., and Trouche, D. (2006b).
Tip60 and p400 are both required for UV-induced apoptosis but play antagonistic roles in
cell cycle progression. Embo J 25, 1680-1689.
Valouev, A., Ichikawa, J., Tonthat, T., Stuart, J., Ranade, S., Peckham, H., Zeng, K.,
Malek, J.A., Costa, G., McKernan, K., et al. (2008). A high-resolution, nucleosome
position map of C. elegans reveals a lack of universal sequence-dictated positioning.
Genome Res 18, 1051-1063.
van Bakel, H., and Hughes, T.R. (2009). Establishing legitimacy and function in the new
transcriptome. Brief Funct Genomic Proteomic 8, 424-436.
van Daal, A., White, E.M., Gorovsky, M.A., and Elgin, S.C. (1988). Drosophila has a
single copy of the gene encoding a highly conserved histone H2A variant of the H2A.F/Z
type. Nucleic Acids Res 16, 7487-7497.
van de Nobelen, S., Rosa-Garrido, M., Leers, J., Heath, H., Soochit, W., Joosen, L.,
Jonkers, I., Demmers, J., van der Reijden, M., Torrano, V., et al. (2010). CTCF regulates
the local epigenetic state of ribosomal DNA repeats. Epigenetics Chromatin 3, 19.
van de Vijver, M.J., He, Y.D., van't Veer, L.J., Dai, H., Hart, A.A., Voskuil, D.W.,
Schreiber, G.J., Peterse, J.L., Roberts, C, Marton, M.J., et al. (2002). A gene-expression
signature as a predictor of survival in breast cancer. N Engl J Med 347, 1999-2009.
193
Venkatasubrahmanyam, S., Hwang, W.W., Meneghini, M.D., Tong, A.H., and Madhani,
H.D. (2007). Genome-wide, as opposed to local, antisilencing is mediated redundantly by
the euchromatic factors Setl and H2A.Z. Proc Natl Acad Sci U S A 104, 16609-16614.
Venters, B.J., and Pugh, B.F. (2009). How eukaryotic genes are transcribed. Crit Rev
Biochem Mol Biol 44, 117-141.
Villard, J. (2004). Transcription regulation and human diseases. Swiss Med Wkly 134,
571-579.
Wang, L.H., Yang, X.Y., Zhang, X., An, P., Kim, H.J., Huang, J., Clarke, R., Osborne,
C.K., Inman, J.K., Appella, E., et al. (2006). Disruption of estrogen receptor DNAbinding domain and related intramolecular communication restores tamoxifen sensitivity
in resistant breast cancer. Cancer Cell 10, 487-499.
Wang, T.T., and Phang, J.M. (1995). Effects of estrogen on apoptotic pathways in human
breast cancer cell line MCF-7. Cancer Res 55, 2487-2489.
Wang, Z., Gerstein, M., and Snyder, M. (2009). RNA-Seq: a revolutionary tool for
transcriptomics. Nat Rev Genet 10, 57-63.
Wang, Z., Zang, C, Rosenfeld, J.A., Schones, D.E., Barski, A., Cuddapah, S., Cui, K.,
Roh, T.Y., Peng, W., Zhang, M.Q., et al. (2008). Combinatorial patterns of histone
acetylations and methylations in the human genome. Nat Genet 40, 897-903.
Weake, V.M., and Workman, J.L. (2010). Inducible gene expression: diverse regulatory
mechanisms. Nat Rev Genet / / , 426-437.
Weber, CM., Henikoff, J.G., and Henikoff, S. (2010). H2A.Z nucleosomes enriched over
active genes are homotypic. Nat Struct Mol Biol 17,1500-1507.
Wei, Y., Xia, W., Zhang, Z., Liu, J., Wang, H., Adsay, N.V., Albarracin, C, Yu, D.,
Abbruzzese, J.L., Mills, G.B., et al. (2008). Loss of trimethylation at lysine 27 of histone
H3 is a predictor of poor outcome in breast, ovarian, and pancreatic cancers. Mol
Carcinog 47,701-706.
Welboren, W.J., Sweep, F.C, Span, P.N., and Stunnenberg, H.G. (2009). Genomic
actions of estrogen receptor alpha: what are the targets and how are they regulated?
Endocr Relat Cancer 16, 1073-1089.
194
West, M.H., and Bonner, W.M. (1980). Histone 2B can be modified by the attachment of
ubiquitin. Nucleic Acids Res 8, 4671-4680.
White, C.L., Suto, R.K., and Luger, K. (2001). Structure of the yeast nucleosome core
particle reveals fundamental changes in internucleosome interactions. Embo J 20, 52075218.
Whittle, CM., McClinic, K.N., Ercan, S., Zhang, X., Green, R.D., Kelly, W.G., and Lieb,
J.D. (2008). The genomic distribution and function of histone variant HTZ-1 during C.
elegans embryogenesis. PLoS Genet 4, el000187.
Williams, S.K., and Tyler, J.K. (2007). Transcriptional regulation by chromatin
disassembly and reassembly. Curr Opin Genet Dev 17, 88-93.
Witcher, M., and Emerson, B.M. (2009). Epigenetic silencing of the pl6(INK4a) tumor
suppressor is associated with loss of CTCF binding and a chromatin boundary. Mol Cell
34,271-284.
Workman, J.L., and Kingston, R.E. (1998). Alteration of nucleosome structure as a
mechanism of transcriptional regulation. Annu Rev Biochem 67, 545-579.
Wu, R.S., and Bonner, W.M. (1981). Separation of basal histone synthesis from S-phase
histone synthesis in dividing cells. Cell 27, 321-330.
Wu, S.C, and Zhang, Y. (2009). Minireview: role of protein methylation and
demethylation in nuclear hormone signaling. Mol Endocrinol 23, 1323-1334.
Wu, W.H., Alami, S., Luk, E., Wu, C.H., Sen, S., Mizuguchi, G., Wei, D., and Wu, C
(2005). Swc2 is a widely conserved H2AZ-binding module essential for ATP-dependent
histone exchange. Nat Struct Mol Biol 12, 1064-1071.
Wysocka, J., Swigut, T., Xiao, H., Milne, T.A., Kwon, S.Y., Landry, J., Kauer, M.,
Tackett, A.J., Chait, B.T., Badenhorst, P., et al. (2006). A PHD finger of NURF couples
histone H3 lysine 4 trimethylation with chromatin remodelling. Nature 442, 86-90.
Xella, B., Goding, C, Agricola, E., Di Mauro, E., and Caserta, M. (2006). The ISWI and
CHD1 chromatin remodelling activities influence ADH2 expression and chromatin
organization. Mol Microbiol 59,1531-1541.
Xiang, Y., Zhu, Z., Han, G., Lin, H., Xu, L., and Chen, CD. (2007). JMJD3 is a histone
H3K27 demethylase. Cell Res 17, 850-857.
195
Yde, C.W., Gyrd-Hansen, M., Lykkesfeldt, A.E., Issinger, O.G., and Stenvang, J. (2007).
Breast cancer cells with acquired antiestrogen resistance are sensitized to cisplatininduced cell death. Mol Cancer Ther 6, 1869-1876.
Yuan, G.C., Liu, Y.J., Dion, M.F., Slack, M.D., Wu, L.F., Altschuler, S.J., and Rando,
O.J. (2005). Genome-scale identification of nucleosome positions in S. cerevisiae.
Science 309, 626-630.
Zanton, S.J., and Pugh, B.F. (2006). Full and partial genome-wide assembly and
disassembly of the yeast transcription machinery in response to heat shock. Genes Dev
20, 2250-2265.
Zemach, A., McDaniel, I.E., Silva, P., and Zilberman, D. (2010). Genome-wide
evolutionary analysis of eukaryotic DNA methylation. Science 328, 916-919.
Zeng, W., Ball, A.R., Jr., and Yokomori, K. HP1: heterochromatin binding proteins
working the genome. Epigenetics 5, 287-292.
Zeng, W., Ball, A.R., Jr., and Yokomori, K. (2010). HP1: heterochromatin binding
proteins working the genome. Epigenetics 5, 287-292.
Zhang, G., Campbell, E.A., Minakhin, L., Richter, C, Severinov, K., and Darst, S.A.
(1999). Crystal structure of Thermus aquaticus core RNA polymerase at 3.3 A resolution.
Cell 98, 811-824.
Zhang, H. (2007). Molecular signaling and genetic pathways of senescence: Its role in
tumorigenesis and aging. J Cell Physiol 210, 567-574.
Zhang, H., Roberts, D.N., and Cairns, B.R. (2005a). Genome-wide dynamics of Htzl, a
histone H2A variant that poises repressed/basal promoters for activation through histone
loss. Cell 123, 219-231.
Zhang, L., Schroeder, S., Fong, N., and Bentley, D.L. (2005b). Altered nucleosome
occupancy and histone H3K4 methylation in response to 'transcriptional stress'. Embo J
24, 2379-2390.
Zhang, Y. (2006). It takes a PHD to interpret histone methylation. Nat Struct Mol Biol
13, 572-574.
Zhou, V.W., Goren, A., and Bernstein, B.E. (2010). Charting histone modifications and
the functional organization of mammalian genomes. Nat Rev Genet 12, 7-18.
196
Zilberman, D., Coleman-Derr, D., Ballinger, T., and Henikoff, S. (2008). Histone H2A.Z
and DNA methylation are mutually antagonistic chromatin marks. Nature 456, 125-129.
Zlatanova, J., and Thakar, A. (2008). H2A.Z: view from the top. Structure 16, 166-179.
Zucchi, I., Mento, E., Kuznetsov, V.A., Scotti, M, Valsecchi, V., Simionati, B.,
Vicinanza, E., Valle, G., Pilotti, S., Reinbold, R., et al. (2004). Gene expression profiles
of epithelial cells microscopically isolated from a breast-invasive ductal carcinoma and a
nodal metastasis. ProcNatl Acad Sci U S A 101, 18147-18152.
197