UNIVERSITE DE SHERBROOKE Mecanisme moleculaire du transport du cholesterol par la

UNIVERSITE DE SHERBROOKE
Mecanisme moleculaire du transport du cholesterol par la
Steroidogenic Acute Regulatory Protein (StAR)
ALIREZA ROOSTAEE
Departement de Biochimie
Memoire presente a la Faculte de Medecine
de 1'Universite de Sherbrooke
en vue de l'obtention du grade de
Maitre es sciences (M.Sc.) en biochimie
Le jury est compose de Dr Jean-Guy LeHoux, Dr Pierre Lavigne, Dr Martin Bisaillon
et Dr Michel Grandbois
Sherbrooke,Quebec,Canada,Janvier 2008
i
1*1
Library and
Archives Canada
Bibliotheque et
Archives Canada
Published Heritage
Branch
Direction du
Patrimoine de I'edition
395 Wellington Street
Ottawa ON K1A0N4
Canada
395, rue Wellington
Ottawa ON K1A0N4
Canada
Your file Votre reference
ISBN: 978-0-494-43014-9
Our file Notre reference
ISBN: 978-0-494-43014-9
NOTICE:
The author has granted a nonexclusive license allowing Library
and Archives Canada to reproduce,
publish, archive, preserve, conserve,
communicate to the public by
telecommunication or on the Internet,
loan, distribute and sell theses
worldwide, for commercial or noncommercial purposes, in microform,
paper, electronic and/or any other
formats.
AVIS:
L'auteur a accorde une licence non exclusive
permettant a la Bibliotheque et Archives
Canada de reproduire, publier, archiver,
sauvegarder, conserver, transmettre au public
par telecommunication ou par I'lnternet, prefer,
distribuer et vendre des theses partout dans
le monde, a des fins commerciales ou autres,
sur support microforme, papier, electronique
et/ou autres formats.
The author retains copyright
ownership and moral rights in
this thesis. Neither the thesis
nor substantial extracts from it
may be printed or otherwise
reproduced without the author's
permission.
L'auteur conserve la propriete du droit d'auteur
et des droits moraux qui protege cette these.
Ni la these ni des extraits substantiels de
celle-ci ne doivent etre imprimes ou autrement
reproduits sans son autorisation.
In compliance with the Canadian
Privacy Act some supporting
forms may have been removed
from this thesis.
Conformement a la loi canadienne
sur la protection de la vie privee,
quelques formulaires secondaires
ont ete enleves de cette these.
While these forms may be included
in the document page count,
their removal does not represent
any loss of content from the
thesis.
Bien que ces formulaires
aient inclus dans la pagination,
il n'y aura aucun contenu manquant.
•*•
Canada
UNIVERSITE DE SHERBROOKE
Insights into the mechanism of cholesterol transport by the
Steroidogenic Acute Regulatory Protein (StAR)
ALIREZA ROOSTAEE
Departement de Biochimie
Memoire presente a la Faculte de Medecine
de l'Universite de Sherbrooke
en vue de l'obtention du grade de
Maitre es sciences (M.Sc.) en biochimie
Le jury est compose de Dr Jean-Guy LeHoux, Dr Pierre Lavigne, Dr Martin Bisaillon
et Dr Michel Grandbois
Sherbrooke,Quebec,Canada,Janvier 2008
11
I would like to dedicate this thesis to my
parents, for their never-ending support,
for their unconditional love and the sense
of security they have given when I
wanted it most. I also dedicate this thesis
to my brother, Amir and to my sister,
Zahra for their ongoing support and
encouragement.
iii
Table of contents
Table of contents
iv
List of figures
ix
List of tables
xi
List of abbreviations
xii
Summary
xiv
1. Introduction
1
1.1 Endocrine System
1
1.2 Hypothalamic-Pituitary unit
2
1.3 The hormone adrenocorticotropin (ACTH)
4
1.4 Adrenal gland
4
1.5 Hormones of the Adrenal Cortex
7
1.6 Adrenal steroids
7
1.6.1 Mineralocorticoids
7
1.6.2 Glucocorticoids
8
1.6.3 Androgens
8
1.7 Organization of the pituitary-adrenal-axis (PAA)
10
1.8 Adrenal insufficiencies
12
1.9 Assessement of testicular function
14
1.10 Leydig cell function
14
1.11 Abnormalities of androgen metabolism
16
1.11.1 Gynecomastia
16
iv
1.12 Steroid hormone metabolism (Steroidogenesis)
16
1.13 Cholesterol
17
1.14 Cholesterol structure and metabolism
18
1.15 Cholesterol trafficking in the body
22
1.16 Intracellular cholesterol transport
24
1.17 Sterol transport proteins
24
1.17.1 Transmembrane proteins
25
1.17.2 Intracellular cholesterol transporters
26
1.18 Cholesterol and steroidogenesis
29
1.18.1 START domain proteins
31
1.19 Steroidogenic acute regulatory protein (StAR) as acute regulator
32
1.20 StAR abnormality: lipoid congenital adrenal hyperplasia (LCAH)
33
1.21 Transcriptional regulation of the StAR gene
36
1.21.1 Positive regulation
36
1.21.2 Steroidogenic factor-1 (SF-1)
36
1.21.3 Spl
37
1.21.4 GATA-binding protein 4 (GATA-4)
37
1.21.5 Steroid regulatory element binding protein (SREBP)
37
1.21.6 Other factors
38
1.22 Negative regulation of the StAR gene
38
1.22.1 DAX-1
38
1.23 Posttranslational Modifications of StAR
39
1.24 StAR protein structure/function relationships
39
v
1.24.1 Functional domains
39
1.24.2 The StAR homolog MLN64
40
1.24.3 Structure of StAR-START
41
1.24.4 Mechanism of StAR's action
43
1.24.5 Contact sites
43
1.24.6 Desorption model
44
1.24.7 PBR, a potential mitochondrial receptor for StAR
44
1.24.8 Theory of Molten Globular state
45
1.24.9 Our proposed model for the StAR action
48
Research objectives
50
2. Materials and Methods
52
2.1 Description of MA-10 and Y-l steroidogenic cell lines
52
2.2 Description of the vectors for expression of 6His-Tag recombinant N-62 StAR
53
2.3 Preparation of competent bacteria, bacterial transformation and plasmid purification
56
2.4 Preparation of the N-terminal 6His tag N-62 StAR sequence motif
56
2.4.1 Cloning of the N-N62 StAR
57
2.5 Preparation of the recombinant proteins
58
2.5.1 N-62 StAR expression
58
2.6 Purification of the recombinant proteins
58
2.7 Analysis of the purified proteins
59
2.7.1 Separation on SDS-PAGE
59
2.8 Staining of the SDS-PAGE
60
vi
2.9 Evaluation of the Steroidogenic Activity of N-62 StAR in the presence of Isolated
Mitochondria
60
2.9.1 Mitochondria purification
60
2.10 The steroidogenic in vitro assay
61
2.11 Radioimmunoassay (RIA)
64
2.11.1 Descriptions of radiolabled pregnenolone and anti-pregnenolone
64
2.11.2 Assay conditions
65
2.11.3 Separation and measurement of bound pregnenolone
65
2.12 StAR Radiolabled Cholesterol-Binding Assay
71
2.13 Structural characterization of AN62 StAR
71
2.13.1 Determination of the secondary structure of proteins by Circular Dichroism
72
2.13.2 Far-UV spectra of the AN62 StAR
75
2.13.3 Thermal unfolding studies
75
2.13.4 Determination of stoichiometry and binding affinity of the StAR-cholesterol
complex
78
3. RESULTS (Part I: In vitro activity of the recombinant N-62 StAR)
80
3.1 Expression and purification of functional tagged StAR and evaluation of
steroidogenic activity
80
3.2 Binding of StAR to cholesterol is best characterized at physiological pH
86
3.3 pH-induced cholesterol dissociation
89
4. RESULTS (Part II: Structural characterization of the StAR in complex with
cholesterol)
93
4.1 Circular dichroism spectroscopy of StAR at different pH
93
vii
4.2 Cholesterol-induced conformational changes of StAR
95
4.3 Time dependent changes of secondary structure of N-62 StAR following the addition
of cholesterol
101
4.4 Stoichiometry and dissociation constant of StAR/cholesterol complex
103
4.5 Stability of the folded conformation of StAR
106
5. RESULTS (Part III: Energetics of the pereferential binding of cholesterol to StAR.. 107
5.1 Physiological pH increases the stability of N-62 StAR against heat denaturation....l07
5.2 Binding of cholesterol improves the conformational stability of StAR
Ill
6. Discussion
122
6.1 In vitro activity of the N-62 StAR
123
6.2 pH-induced binding and release of cholesterol from StAR
125
6.3 Cholesterol-induced conformational stability of StAR
126
6.4 Contribution of cholesterol to the conformational stability of StAR
127
6.5 Proposed models, conclusion and remarks
132
viii
List of figures
Figure 1. The Hypothalamic-Pituitary Axis
3
Figure 2. Adrenal glands
6
Figure 3. Three main types of hormones that are produced by the adrenal cortex
9
Figure 4. Organization of the pituitary-adrenal-axis (PAA)
11
Figure 5. Schematic diagram of the hypothalamic-pituitary-gonadal axis
15
Figure 6. Cholesterol synthesis in the cytoplasm
20
Figure 7. Structure and classification of steroid hormones
21
Figure 8. Schematic overview of the major routes of cholesterol in human body
23
Figure 9. Key proteins governing cellular cholesterol distribution and flow
27
Figure 10. Model of Congenital Lipoid Adrenal Hyperplasia in an Adrenal Cell
34
Figure 11. Ribbon diagram of StAR model
42
Figure 12. Molecular mechanism of cholesterol binding to StAR
49
Figure 13. The pET Vectors
54
Figure 14. Determination of the optimal mitochondrial quantity
63
Figure 15. Illustration of the Radioimmunoassay
67
Figure 16. Radiodilution curve obtained by charcoal immunoassay
70
Figure 17. Circular dichroism spectra of "pure" secondary structures
73
Figure 18. Purification of recombinant human N-62 StAR protein
81
Figure 19. Validation of the performed in vitro steroidogenesis system
82
Figure 20. Steroidogenic capacity of the N- and C-terminaly 6His- tagged N-62 StAR...85
Figure 21. Measurement of StAR binding to cholesterol across a broad pH range
87
Figure 22. Competitive binding of cholesterol at different pH values
88
ix
Figure 23. Measurement of cholesterol dissociation from StAR across a broad pH range.
91
Figure 24. Irreversible dissociation of cholesterol from the StAR at acidic pH
92
Figure 25. Effect of pH on protein conformation
94
Figure 26. Effect of cholesterol binding on circular dichroic spectra of N-62 StAR protein
at neutral pH
96
Figure 27. Effect of cholesterol binding on circular dichroic spectra of N-62 StAR protein
at acidic pH
98
Figure 28. Schematic representation of cholesterol-induced helical changes in StAR
protein
102
Figure 29. Circular dichroism-monitored cholesterol titration of the N-62 StAR
105
Figure 30.Temperature-induced denaturations monitored by the change in molar
ellipticity at 222 nm (0222)
109
Figure 31. Stability curve of StAR at pH 7.4
114
Figure 32. Populations of the native, intermediate, and unfolded states of N-62 StAR and
StAR/cholesterol complex
117
Figure 33. Determination of AH°uand AS°U from Van't Hoff plot
119
Figure 34. Graph of AHU versus T for StAR and StAR/Cholesterol complex
120
Figure 35. Plot of ASU versus T for StAR and StAR/Cholesterol complex
121
Figure 36. Molecular mechanism of cholesterol binding in StAR
136
Figure 37. Proposed model of the cholesterol transport by StAR
137
Figure 38. Comparison of the structures of of NBD-Cholesterol and cholesterol
138
x
List of tables
Table 1. Adrenocortical diseases
13
Table 2.Tube contents for Assay of Standard and Unknown samples
69
Table 3. Comparison of the cholesterol-induced helical changes of N-62 StAR
99
Table 4. Thermodynamic parameters obtained from thermal unfolding profiles
116
Table 5. Thermodynamic parameters measured from the simulations of the temperatureinduced denaturation of N-62 StAR and N-62 StAR/Cholesterol complex at 37°C (yalues in
kcal/mol)
117
xi
List of abbreviations
N-62 StAR
(AN62-StAR)
StAR protein lacking the mitochondrial targeting sequence
eHis
Sequence of 6 histidines
a.a.
Amino acid
ACTH
Adrenocorticotropin hormone
BSA
Bovine Serum Albumin
CD
Circular Dichroism
cDNA
Complementary DNA
DNA
Deoxyribonucleic acid
dNTP
Deoxyribonucleic acid triphosphate
DTT
Dithiothreitol
EDTA
Ethylene diamine tetraacetic acid
EtBr
Ethidium bromide
FSH
Follicle-stimulating hormone
GH
Growth hormone
Gu.HCL
Guanidium-HCl
HEPES
(4-(2-hydroxyethyl)-1 -piperazineethanesulfonic acid)
IMAC
Immobilized Metal ion Affinity Chromatography
IMM
Inner mitochondrial membrane
IPTG
Isopropyl P-D-1 -thiogalactopyranoside
kb
Kilobase
xii
kDa
KiloDalton
KOAc
Potassium acetate
LB
Luria bertoni broth
LCAH
Lipoid congenital adrenal hyperplasia
LH
Luteinizing hormone
ME
PMercapto-2-ethanol
MG
Molten Globule
NaN3
Sodium azide
Ni-NTA
Nickel-nitrilotriacetic acid resin
nt
Nucleotide
OD
Optical density
OMM
Outer mitochondrial membrane
PBS
Phosphate-buffered saline
PCR
Polymerase Chain Reaction
PMSF
Phenylmethylsulfonyl fluoride
RIA
Radioimmunoassay
SDS-PAGE
Sodium dodecyl sulphat Polyacrylamide Gel Electerophoresis
StAR
Steroidogenic Acute Regulatory protein
START
StAR-related lipid transfer domain
TCEP
Tris(2-carboxyethyl)phosphine hydrochloride
TLC
Thin Layer Chromatography
TSH
Thyroid - stimulating hormone
xiii
Summary
The rate-limiting step in steroidogenesis is the delivery of cholesterol to the
mitochondrial inner membrane by the steroidogenic acute regulatory protein (StAR). A
number of developmental and reproductive abnormalities in humans are related to the
misregulation of StAR expression and/or to a nonfunctioning StAR gene. For example,
lipoid congenital adrenal hyperplasia, a potentially lethal autosomal recessive disease that
manifests as cholesterol accumulation in steroidogenic cells of newborn, is a consequence
of StAR deficiency.
The exact mechanism of cholesterol transfer by StAR is still under debate. On one
hand, a molten globular state of StAR observed under acidic conditions, namely pH 3.5,
has been suggested to bind and transfer cholesterol. On the other hand, we have proposed
that the state of StAR that binds cholesterol has a well-defined tertiary structure.
Therefore, the purpose of this project was to investigate the biological and structural
features involved in binding of StAR to cholesterol and its steroidogenic activity. There
were three specific aims to achieve this goal: the first was to determine the steroidogenic
activity of StAR and also to find the environment in which it could bind to cholesterol to
promote steroidogenesis, using a quantitative in vitro activity and binding assays. The
second was to inquire the various conformational changes of the StAR in the presence of
cholesterol through circular dichroism (CD) and the third, to measure the binding affinity
of StAR/cholesterol complex.
To construct biologically active recombinant StAR and study its activity on
isolated mitochondria we elected to produce human StAR proteins lacking the
mitochondrial import sequence in bacteria, and to incorporate a 6His-N-62 StAR to
facilitate their purification. Using these constructs, we could examine the action of StAR
independent of the protein import process. Here we show that the 6His-tag StAR is
biologically active and binding of protein to free cholesterol is necessary to trigger
steroidogenesis.
As a prerequisite for clarifying the mechanism of StAR action, it was first decided
to determine the mechanism by which StAR bound to cholesterol. The mechanism of
xiv
binding was evaluated under acidic and physiological pH to compare molten globule
theory with our proposed model. Thermal denaturation monitored by CD at physiological
pH revealed that StAR had a well- defined tertiary structure as depicted by an increase in
cooperative denaturation transition. However, the denaturation profile of StAR at pH 3.5
was non-cooperative, as expected for a molten globule. The cooperativity, thermal
unfolding transition and an increase in secondary structure content of StAR were
observed upon addition of cholesterol. This was a clear indication of the formation of a
stable StAR/choleterol complex at physiological pH. In addition, a CD-monitored time
course study showed that binding of StAR to cholesterol requires secondary structural
changes (unfolding-refolding) that eventually resulted in a more folded protein. Titration
of StAR with cholesterol monitored by CD allowed us to determine the stoichiometry of
1:1 and a Kd ~1 x 10"6 M. Binding assays at lower pHs demonstrated that the interaction
of StAR with cholesterol was pH sensitive and diminished as the pH was lowered.
Furthermore, a decrease of pH resulted in the dissociation of the protein-ligand complex.
Taken together, the results presented herein suggest that a native partially
unfolded StAR binds to cholesterol at physiological pH while release of cholesterol may
coincide with a transition of StAR to a molten globule state, which is yet to be proven.
xv
1. Introduction
1.1 Endocrine System
The human endocrine system is made up of glands that produce and secrete
hormones. These hormones regulate the body's growth, metabolism (the physical and
chemical processes of the body), and sexual development and function. Hormones travel
throughout the body, either in the blood stream or in the fluid around cells, interacting
with target cells. Once hormones find a target cell, they bind with specific protein
receptors inside or on the surface of the cell and specifically change the cell's activities.
The protein receptor reads the hormone's message and carries out the instructions by
either influencing gene expression or altering cellular protein activity. These actions
produce a variety of rapid responses and long-term effects. Based on their chemical
structure, hormones are categorized into three classes:
1-Steroid hormones are fat-soluble molecules derived from cholesterol. Among
these are the three major sex hormones groups: estrogens, androgens, and progesterone.
Males and females make all three, just in different amounts. Steroids pass into a cell's
nucleus, bind to specific receptors and genes and trigger the cell to synthesize proteins
(Kumar, etal., 2005).
2-Amino acid derivatives, such as epinephrine, are water-soluble molecules.
These hormones are stored in endocrine cells until needed. They act by binding to protein
receptors on the outer surface of the cell (Vaidehi, et al, 2002). The binding alerts a
second messenger molecule inside the cell that activates enzymes and other cellular
proteins or influences gene expression.
1
3-Insulin, growth hormone, prolactin and other water-soluble polypeptide
hormones consist of long chains of amino acids, from several to 200 amino acids length.
They are stored in endocrine cells until needed to regulate such processes as metabolism,
lactation, growth and reproduction (Posner, et al, 1974).
The major glands of the endocrine system are the hypothalamus, pituitary,
thyroid, parathyroids, adrenals, pineal body, and the reproductive organs. The pancreas is
also part of this system; it has a role in hormone production as well as in digestion.
1.2 Hypothalamic-Pituitary unit
The hypothalamus is one of the most evolutionary conserved and essential region
of the mammalian brain. Indeed, the hypothalamus is the ultimate brain structure that
allows mammals to maintain homeostasis, and destruction of the hypothalamus is not
compatible with life (Bean, et al, 1955; Makridis, et al, 1990). The pituitary gland, also
known as the hypophysis, is a roundish organ that lies immediately beneath the
hypothalamus, resting in a depression of the base of the skull called the sella turcica
("Turkish saddle").The pituitary gland is often considered the "master gland" because it
regulates most of the body's hormonal balance (Zee, et al, 2003). The pituitary is
composed of anterior and posterior portions. The anterior pituitary is formed of a range of
cells producing several hormones such as ACTH, TSH, LH, FSH, GH, and prolactin.
Indeed, secretion of hormones from the anterior pituitary is under strict control by
hypothalamic hormones (Figure 1). It would be difficult to overstate the influence of
hypothalamic and pituitary hormones over physiological processes.
2
Inflowing
blood —
Portal blood
vessels
Secretory
cells
/
Anterior
pituitary
erve endings
secrete neurohormones
Blood picks up
neurohormones
Pituitary stalk
Posterior pituitary
/
\
Anterior pituitary
hormones leave
gland in the blood
Neurohormones
from the hypothalamus stimulate
or inhibit the
release of anterior
pituitary hormones
Figure 1. The Hypothalamic-Pituitary Axis
The hypothalamus is connected to the posterior pituitary, and sends nerve impulses which
stimulate the release of hormones, and to the anterior pituitary by the hypothalamicpituitary portal system (http://www.emc.maricopa.edu).
3
The target cells for most of the hormones produced in these tissues are themselves
endocrine cells and a seemingly small initial signal is thus amplified to cause widespread
effects on many cells and tissues.
Pituitary trophoic hormones, the predominant regulators of steroid hormone
biosynthesis, stimulate steroidogenesis in two temporal phases. The acute phase, which
occurs within seconds to minutes, involves enhanced mobilization and delivery of
cholesterol to the steroidogenic complex, whereas the chronic phase, which requires hours
to days predominantly involves increased transcription of the genes involved in
steroidogenesis (Ishii, et al, 2002; Simpson and Waterman, 1988). The focus here is to
emphasize on importance of acute pituitary trophic hormone regulation of steroidogenesis
in the adrenal gland and gonads.
1.3 The hormone adrenocorticotropin (ACTH)
ACTH regulates steroid synthesis by the adrenal cortex thereby stimulating the
secretion of Cortisol from the adrenal glands (Ray, et al, 1980). Cortisol and other
glucocorticoids increase glucose production, inhibit protein synthetis and increase protein
breakdown, stimulate lipolysis, and affect immunological and inflammatory responses
(Manary, et al., 2006).
1.4 Adrenal gland
The adrenal, or suprarenal, gland is paired with one gland located near the upper
portion of each kidney (Figure 2, top). Each gland is divided into an outer cortex and an
inner medulla (Figure 2, bottom). The cortex and medulla of the adrenal gland, like the
4
anterior and posterior lobes of the pituitary, develop from different embryonic tissues and
secrete different hormones (Mulrow, 1972).
The adrenal cortex is essential to life (Arlt and Stewart, 2005), but the medulla
may be removed with no life-threatening effects. The hypothalamus of the brain
influences both portions of the adrenal gland but by different mechanisms. The adrenal
cortex
is
regulated
by
negative
feedback
involving
the
hypothalamus
and
adrenocorticotropic hormone (Syed and Weaver, 2005) whereas the medulla is regulated
by nerve impulses from the hypothalamus (Wojcik-Gladysz, et al, 2006).
5
Adrenal glands
Figure 2. Adrenal glands
Top, in mammals, the adrenal glands (also known as suprarenal glands) are the triangleshaped endocrine glands that are located in the thoracic abdomen situated atop the
kidneys; their name indicates that position {ad-, "near" or "at" + -renes, "kidneys").
Bottom (inset), when observed at low magnification (left) the capsule, cortex, and
medulla are visible. At higher magnifications (right) the divisions of the cortex are
visible: the zona glomerulosa with cells in small clusters which secrete aldosterone, the
zona fasciculata with cells arranged in columns or strips which secrete Cortisol and the
zona reticularis with cells that are somewhat unorganized which secretes sex steroids and
may also secrete Cortisol. The medulla is the site of epinephrine and norepinephrine
production (http://www.medicalook.com/human_anatomy/organs/Adrenal_glands.html).
6
1.5 Hormones of the Adrenal Cortex
Using cholesterol as the starting material, the cells of the adrenal cortex secrete a
variety of steroid hormones. The adrenal cortex consists of three different regions, with
each region producing a different group or type of hormones. Chemically, all the cortical
hormones are steroid. The secretion of ACTH from the anterior lobe of the pituitary
triggers the production of all hormones.
1.6 Adrenal steroids
Three main types of hormones are produced by the adrenal cortex:
Glucocorticoids
(Cortisol,
corticosterone),
mineralocorticoids
(aldosterone,
deoxycorticosterone [DOC]), and sex steroids (mainly androgens).
1.6.1 Mineralocorticoids
Mineralocorticoids are secreted by the outermost region of the adrenal cortex. The
mineralocorticoids get their name from their effect on mineral metabolism. The principal
mineralocorticoid is aldosterone, which acts to conserve sodium ions and water in the
body. Aldosterone also acts on sweat glands to reduce the loss of sodium in perspiration
and increases the sensitivity of the taste buds to sources of sodium (for review see
(Verrey, 1998).
The secretion of aldosterone is stimulated by a drop in the level of sodium ions
and/or a rise in the level of potassium ions in the blood (Salemi, et al, 2000), angiotensin
11 (Shelat, et al, 1999) and ACTH (as is that of Cortisol) (Zager, et al, 1979).
7
1.6.2 Glucocorticoids
Glucocorticoids are secreted by the middle region of the adrenal cortex (Mukai, et
al, 2003). The glucocorticoids get their name from their effect of raising the level of
blood sugar (glucose). One way they do this is by stimulating gluconeogenesis in the
liver: the conversion of fat and protein into intermediate metabolites that are ultimately
converted into glucose (Tappy, 1999).
The most abundant glucocorticoid is Cortisol (also called hydrocortisone). Cortisol
and the other glucocorticoids also have a potent anti-inflammatory effect on the body.
They depress the immune response, especially cell-mediated immune responses
(Buttgereit, etal., 2005).
1.6.3 Androgens
The third group of steroids secreted by the adrenal cortex is the gonadocorticoid,
or sex hormones (androgens). These are secreted by the innermost region. Male
hormones, androgens, and female hormones, estrogens, are secreted in minimal amounts
in both sexes by the adrenal cortex (Leo, et al, 2004). In sexually-mature males, this
source is so much lower than that of the testes that it is probably of little physiological
significance. However, excessive production of adrenal androgens can cause premature
puberty in young boys. In females, the adrenal cortex is a major source of androgens.
Their hypersecretion may produce a masculine pattern of body hair and cessation of
menstruation (Hunter and Carek, 2003).
8
Cortisol
Aldosterone
Androsterone
Figure 3. Three main types of hormones that are produced by the adrenal cortex
Glucocorticoids
(androsteron).
(Cortisol),
mineralocorticoids
(aldosterone)
and
sex
steroids
9
1.7 Organization of the pituitary-adrenal-axis (PAA)
Stressful environmental stimuli trigger the release of corticotrophin releasing
factor (CRF) from nerve cells in the hypothalamus into a blood system that travels to the
anterior pituitary. In response to CRF, the anterior pituitary releases adrenocorticotrophic
hormone (ACTH) into the blood system and this one is transported to the remotely
located adrenal gland. ACTH stimulates the production of Cortisol in the adrenal cortex
and Cortisol is released into the blood stream and affects the body's reaction to stress.
The pituitary-adrenal-axis is a complex feedback mechanism. In fact, Cortisol feeds back
to the hypothalamus to control release of CRF (Figure 4).
10
The Pituitary-Adrenal-Axis
Cortisol exerts a negative feedback effect on the
hypothalamus that inhibits future release of CRF
hypothalamus *"
T
CRF (corticotropin
releasing factor)
anterior pituitary
T
ACTH
(adrenocorticotropic
hormone)
adrenal cortex!
Cortisol increases:
blood glucose
blood pressure
Amino acids
1
-*• Cortisol
Figure 4. Organization of the pituitary-adrenal-axis (PAA)
The pituitary-adrenal-axis is a complex feedback mechanism. Cortisol feeds back to the
hypothalamus to control release of CRF. High levels of Cortisol in the blood tend to
inhibit the release of CRF by the hypothalamus. Therefore less ACTH is released by the
anterior pituitary. Consequently, the amount of Cortisol circulating in the blood stream is
reduced. This is called a negative feedback system
11
1.8 Adrenal insufficiencies
The adrenal glands can have congenital defects and can be damaged by infections
and destructive tumors. Adrenocortical disease are relatively rare, but their importance
lies in their morbidity and mortality if untreated coupled with the relative ease of
diagnosis and availability of effective therapy. The diseases are most readily classified on
the basis of hormone excess or deficiency (Table 1) (Endocrinology. William). For
instance, Congenital lipoid adrenal hyperplasia (CLAH) is known as the severest form of
congenital adrenal hyperplasia, which is characterized by the lack of biosynthesis of all
steroid hormones and its metabolites due to the failure in converting cholesterol to
pregnenolone. The genetic etiology has been identified; trafficking defect of cholesterol
to mitochondria due to defect of StAR gene, and conversion fault of cholesterol to
pregnenolone at the mitochondrial membrane due to the deficiency of CYP11A,
cholesterol side chain cleavage enzyme (Horikawa, 2004). More details about LCAH
would be explained in next sections.
12
Table 1. Adrenocortical diseases
Glucocorticoid Excess
Cushing's disease
Pseudo-Cushing's syndromes
Glucocorticoid Resistance
Glucocorticoid deficiency
Primary hypoadrenalism
Secondary hypoadrenalism
Post-chorionic corticosteroid replacement therapy
Congelital Adrenal Hyperplasia
21-hydroxylase, 3p-hydroxysteroid dehydrogenase, 17a-hydroxylase, 11 (3-hydroxylase,
and StAR deficiencies
Mineralocorticoid Excess
Mineralocorticoid deficiency
Defect in aldosterone synthetis
Defects in aldosterone action
Hyporeninemic hypoaldosteronism
Adrenal Incidentalomas, and Carcinomas
1.9 Assessement of testicular function
Sperm production is entirely hormonally driven. Both the brain and the testis are
responsible for hormone secretion, and the male genitalia are responsible for semen
production and delivery. Within the brain, the hypothalamus and anterior pituitary are
concerned with hormone delivery and control of spermatogenesis. The hypothalamus
secretes the gonadotropin releasing hormone (GnRH), which acts on the anterior pituitary
gland, stimulating it to release the follicle stimulating hormone (FSH) and leutinizing
hormone (LH). FSH and LH are released into the bloodstream and act only on the testes
to encourage spermatogenesis within seminiferous tubules (action of FSH) and
testosterone production by neighboring Leydig cells (action of LH) between the
seminiferous tubules. This hormone axis is illustrated in Figure 5.
The testis is functionally compartmentalized into seminiferous tubules and
endocrine compartments where spermatogenesis and testosterone biosynthesis take place,
respectively. Seminiferous tubules are lined by layers of germ cells in various stages of
development (spermatogonia, spermatocytes, spermatids, spermatozoa) and supporting
Sertoli cells. The interstitium consists of loose connective tissue, blood and lymphatic
vessels, and various cell types, including Leydig cells, fibroblasts, macrophages and
leukocytes (Akingbemi, 2005).
1.10 Leydig cell function
The endocrine compartment of testis is the testicular interstitium, which contains
Leydig cells, the site of testosterone biosynthesis. Intratesticular testosterone is mainly
bound to androgen binding protein and secreted into the seminiferous tubules.
14
Figure 5. Schematic diagram of the hypothalamic-pituitary-gonadal axis
Representation of an expanded view of testis tissue with neural systems that regulate
GnRH secretion and feedback of gonadal steroid hormones at the level of the
hypothalamus and pituitary (adjusted from (Ankley and Johnson, 2004)).
15
Inside the Sertoli cells, testosterone is selectively bound to the androgen receptor
and activation of the receptor will result in initiation and maintenance of the
spermatogenic process and inhibition of germ cell apoptosis (Dohle, et al, 2003),
Leydig cell dysfunction usually results in defective spermatogenesis, and men
with the clinical features of Leydig cell dysfunction are usually infertile. Indeed, Leydig
cells have been widely used for endocrine studies, specially in steroidogenesis, as an
endocrine compartment with hormone-dependent steroidogenic activity (Calikoglu,
2003).
1.11 Abnormalities of androgen metabolism
1.11.1 Gynecomastia
Administration of large amounts of estrogen to men, as for carcinoma of the
prostate or in preparation for sex change surgery, causes a variety of side effects,
including
fluid
retention
and
congestive
heart
failure,
hypertension,
and
electrocardiographic changes (De Voogt, et al, 1986). At lower levels, as can occur with
estrogen-secreting testicular tumors, estrogen excess suppresses gonadotropin secretion,
secondarily impairs testosterone production, and inhibits spermatogenesis. However, the
most common manifestation of estrogen excess in men is gynicomastia (breast
enlargement). (Williams Text Book of Endocrinology, 10th ed, 2003).
1.12 Steroid hormone metabolism (Steroidogenesis)
As explained in the preceding chapters, steroids are lipophilic, low-molecular
weight compounds derived from cholesterol that play a number of important
16
physiological roles. The steroid hormones are synthesized mainly by endocrine glands
such as the gonads (testis and ovary), the adrenals (during gestation) (Mastorakos and
Ilias, 2003), and are then released into the blood circulation. They act both on peripheral
target tissues and the central nervous system (CNS) (Baulieu, 1997). Steroid hormones
manage different physiological and behavioural responses for specific biological
purposes, e.g. reproduction. Therefore,
gonadal steroids influence
the sexual
differentiation of the genitalia and of the brain, determine the development of both
primary and secondary sexual characteristics after the initial fetal stage where the
presence or absence of the Y-chromosome determines development, contributes to the
maintenance of their functional state in adulthood and controls or modulates sexual
behaviour. In addition to the endocrine glands, the CNS is also able to form a number of
biologically active steroids directly from cholesterol (the so-called "neurosteroids").
These neurosteroids, however, are more likely to have "autocrine" or "paracrine"
functions rather than true endocrine effects (Ko, et al, 2005).
1.13 Cholesterol
The precursor from which all steroids are derived is cholesterol. Cholesterol is the
most important sterol in mammals. It is an integral part of plasma and organel
membranes as well as a precursor of important molecules like bile salts and steroid
hormones. During embryogenesis, cholesterol is involved in pattern formation in the
developing animals. In cell membranes it is situated in parallel to the fatty acid chains of
phospholipids, with the polar hydroxyl group close to phospholipids head group. Indeed,
membrane fluidity is largly dependent upon the concentration of sterols present due to
their rigid structure.
17
Defects in cholesterol synthesis or intracellular routing have devastating
consequences for the individual. In humans, the Smith-Lemi-Optiz syndrome,
desmosterolosis, Niemann-Pick CI disease and Lipoid Congenital Adrenal Hyperplasia,
as described bellow, are the examples for inherited disease caused by mutations of genes
involved in cholesterol metabolism or 'traffiking'.
1.14 Cholesterol structure and metabolism
Slightly less than half of the cholesterol in the body derives from biosynthesis de
novo, in the cytoplasm and microsomes of intestines and liver tissues, from the twocarbon acetate group of acetyl-CoA. As summarized in Figure 6, three molecules of
acetate are condenced to form 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA),
which is then converted to mevalonic acid by the enzyme HMG-CoA reductase. Through
a series of steps, mevalonic acid is converted to cholesterol. (Bloch, 1965; Goldstein and
Brown, 1990; Knopp, 1999; Scallen and Sanghvi, 1983)
Cholesterol is composed of three hexagonal carbon rings (A,B,C) and a
pentagonal carbon ring (D) to which a side-chain (carbons 20-27) is attached (at position
17 of the polycyclic hydrocarbon), (Figure 7, top) Two angular methyl groups are also
found at position 18 and 19. Removal of part of the side-chain gives rise to C21compounds of the pregnane series (progestins and corticosteroids), like pregnenolone.
Total removal produces C19-steroids of the androstane series (including the androgens),
whereas loss of the 19-methyl group (usually after conversion of the A-ring to a phenolic
structure, hence the term "aromatization") yields the estrone series, to which estrogens
belong (Figure 7, bottom). Individual compounds are characterised by the presence or
absence of specific functional groups (mainly hydroxy, keto(oxo) and aldehyde functions
18
for the naturally occurring steroids) at certain positions of the carbon skeleton
(particularly at positions 3,5,11,17,18,20 and 21), (Hanson, 2006).
3 CH3 COO - Acetate
v
HO
^|
-0*
CH 2 —C — SCOA
Vf!
u HMC-CaA
©
CHi
I
"OOC—CH2—C—CHa—CH2-—OH
OH
CH3
Mevaionate
®i
1
O
O
I
1
C H 2 = C ~ C H 2 - - - C H 2 —•©—P—O—P—<0~
L ^
__^__1
|
1
isoprene
O"
O"*
Activated isoprene
Squalene
HO
Cholesterol
Figure 6. Cholesterol synthesis in the cytoplasm
Cholesterol synthesis in the cytoplasm occurs in the cytoplasm and microsomes
two carbon acetate group of acetyl-CoA.
Pregnane
(C21)
Androstane
(C19)
Estrane
(C18)
Figure 7. Structure and classification of steroid hormones
Top: Structure of cholesterol, with numbering of carbons (1 to 27) and identification of
cycles (A to D). Bottom: The three main classes of steroids ("parents compounds")
derived from cholesterol, with number of carbons in brackets (C21 to CI8). Pregnanes
(C21) form the basic structure of progestins and corticosteroids, Androstanes (CI9) of
androgens and Estranes (CI 8) of estrogens (with of phenolic A- ring).
21
1.15 Cholesterol trafficking in the body
Cholesterol and other fats cannot dissolve in the bloodstream. They have to be
transported to and from the cells by special carriers called lipoproteins. There are
severaltypes, but the ones to be most concerned about are low-density lipoprotein (LDL)
and high-density lipoprotein (HDL). The liver plays a central role in distribution of
cholesterol and several distinct pathways can be distinguished (Figure 8): Flux from the
liver to periphery; flux from the periphery to the liver; flux from the intestine to the liver
and hepatobiliary excretion (Rudel and Shelness, 2000; Tall, 1998).
22
Figure 8. Schematic overview of the major routes of cholesterol in human body
Ch, cholesterol; HDL, high Density lipoprotein; IDL, intermediate-density-lipoprotein;
LDL, low-density-lipoprotein, VLDL, very-low-density-lipoprotein. (Adopted from
Nature Medicine 7, 1282 -1284 (2001))
23
1.16 Intracellular cholesterol transport
Mammalian cells obtain cholesterol by internalization of low density lipoproteins
(LDL) or by de novo synthesis in the endoplasmic reticulum (ER). Deposition of excess
cellular cholesterol in the form of cholesteryl esters, which are then stored in lipid
droplets and accessed for cellular needs by activation of cholesterol esterase (hormonesensitive lipase, HSH), is catalyzed by acyl CoAxholesterol acyltransferase (ACAT), a
resident ER enzyme (Bruscalupi, et al, 1985). Once cholesterol is liberated as the free
form, the challenge for the cell is to transport this highly insoluble molecule to target
compartments such as various cellular membranes. Steroidogenic cells face the additional
requirement to deliver large amounts of cholesterol to the cholesterol side-chain cleavage
enzyme, which lies on the inner mitochondrial membrane (IMM); this enzyme activity is
the first and rate-limiting in steroidogenesis, converting insoluble cholesterol to soluble
pregnenolone (Miller, 2006).
Owing to high hydrophobicity, intracellular traveling of cholesterol requires its
incorporation into vesicle membranes (lysosomes, endosomes, peroxisomes) which can
combine with other membranes, thus transporting cholesterol between intracellular
membranes (Soccio and Breslow, 2004). Nevertheless, most of the cholesterol transport
among intracellular membranes being done in complex with carrier proteins, which
solubilize cholesterol in aqueous cytoplasm.
1.17 Sterol transport proteins
Because cholesterol is essentially insoluble, a variety of sterol transporters are
involved in cholesterol trafficking (Figure 9). Essentially, non-vesicular transport of
24
lipids within cells requires that the lipids are extracted from the cytoplasmic face of
intracellular membranes and transported by lipid transfer proteins (LTPs). Next sections
give a summary of function and specificity of the proteins involved in cholesterol
internalization and subsequent distribution within intracellular compartment.
1.17.1 Transmembrane proteins
A number of transmembrane proteins have been shown to play an important role
in facilitating cholesterol transport, however, the exact mechanisms by which these
proteins facilitate transport remain obscure. The best studied of these are members of the
ABC (ATP-binding cassette) super-family of transporters, which facilitate the transfer of
sterol to acceptors, mainly HDLs and their major associated apolipoprotein, ApoA-I
(Oram and Heinecke, 2005; Zannis, et al, 2006). Defects in one of these proteins,
ABCA1, are responsible for Tangier disease, a rare autosomal recessive disorder that is
characterized by a severe deficiency in HDL and reduced efflux of cholesterol, especially
from macrophages (Stefkova, et al., 2004). In cell culture studies it has been shown that
ABCA1 promotes the transfer of cholesterol and phospholipids to lipid-poor forms of
ApoA-I, which bind to ABCA1 (Oram and Heinecke, 2005).There is evidence that
ABCA1 may function both at the PM and in endosomes (Alpy, et al, 2001). ABCG1 also
promotes cholesterol efflux to HDL particles (Maxfield and Menon, 2006; Wang, et al,
2006).
Free cholesterol exits from lysosomes and is transported to sites of operation.
Mobilization of lysosomal free sterol is mediated by the Niemann-Pick type CI protein
(NPC-1), encoded by a gene which when mutated produces a lysosomal storage disease
25
(Watari, et al, 2000). Recently, a protein related to NPC1, NPC1L1, has been shown to
play an important role in the absorption of cholesterol from the intestines (Altmann, et
al, 2004). This protein has been shown to be the target for ezetimibe, a drug that blocks
the uptake of dietary cholesterol and is in clinical use (Garcia-Calvo, et al, 2005). The
real mechanisms by which NPC1 and NPC1L1 facilitate sterol delivery into the cytosol
remain uncertain. It was recently shown that NPC1 can facilitate the transbilayer
movement of some nonpolar molecules (Sturley, et al., 2004), but it is unclear how this
relates to movement of cholesterol, which can spontaneously flip between the leaflets of a
membrane bilayer. One possibility is that the flipping of another molecule helps to
present sterol in the cytoplasmic leaflet in a way that promotes its delivery to cytoplasmic
acceptors. Another possibility is that the NPC1 proteins bind other proteins that facilitate
sterol transport into the cytosol (Maxfield and Menon, 2006).
1.17.2 Intracellular cholesterol transporters
Non-vesicular sterol transport between intracellular compartments is presumably
mediated by LTPs (lipid transfer proteins). An LTP that mediates inter-organelle sterol
transport in vivo has yet to be identified although various proteins, including caveolin and
non-specific lipid transfer protein (SCP-2), have been proposed — but not proven — to
perform this function (Liscum and Munn, 1999; Maxfield and Menon, 2006).
26
Figure 9. Key proteins governing cellular cholesterol distribution and flow
Major (continuous lines) and minor (discontinuous lines) routes of cholesterol trafficking
are indicated by arrows. Endogenously synthesized cholesterol as well as cholesterol
precursors reach the plasma membrane mostly via Golgi bypass route(s). Lipoprotein
cholesterol is internalized via receptor-mediated uptake and reaches the endocytic circuits
from where it is redistributed to the plasma membrane, Golgi complex, and ER. ARH,
autosomal reccesive hypercholesterolemia, functioning in the endocytic routing of LDL
receptors, and several Rab proteins regulating membrane trafficking are involved in
endosomal cholesterol movement. Some of the cholesterol interacting proteins, such as
NPC1, NPC2, and MLN64, localize mostly to late endocytic compartments while
caveolin localizes to plasma membrane caveolae and lipid droplets, as well as the Golgi
27
complex and caveosomes. Several ABC transporters synergize to mediate cholesterol
efflux.
StAR protein with mediation of PBR (peripheral-type
receptor)(Liu,
et
ah,
2006), transports
cholesterol
across
the
benzodiazepine
mitochondrial
membrane.(Modified from (Ikonen, 2006)).
28
1.18 Cholesterol and steroidogenesis
The acute response to steroidogenic stimuli (e.g. ACTH) is initiated by the
mobilization and delivery of the substrate for all steroid hormone biosynthesis,
cholesterol, from the outer to the inner mitochondrial membrane where it is metabolized
to pregnenolone by the cytochrome P450 cholesterol side chain cleavage enzyme
(P450scc) (Miller, 1988). In fact, the level of steroidogenic capacity of a cell is
determined by the net conversion of cholesterol to pregnenolone by the cholesterol sidechain cleavage enzyme, P450scc which is located on the matrix side of the inner
mitochondrial membrane (Farkash, et al, 1986). This mitochondrial enzyme catalyzes
three distinct reactions, 22a-hydroxylation, 22-hydroxylation and scission of the 20,22
carbon-carbon bond, to convert cholesterol to pregnenolone. Each of these reactions
requires donation of a separate pair of electrons from NADPH to P450scc via the
intermediary of two electron-transfer proteins, ferrodoxin reductase and ferrodoxin
[reviewed in (Miller, 1988, 2006)].
For many years, it was believed that the rate limiting step in steroidogenesis is the
function of P450scc in conversion of cholesterol to pregnenolone. It can indeed be the
rate limiting, if free sources of cholesterol are readily available for the enzyme. However,
due to high insolubility, cholesterol cannot bypass the aqueous mitochondrial
intramembrane. While the cholesterol pools accessible for P450scc in the matrix are not
sufficient for the acute response to stimuli to trigger steroidogenesis, necessity of a
specific mediator to provide adequate cholesterol for rapid synthesis of new steroids
seems essential.
29
Therefore, the presence of transporter protein(s) was proposed. Early studies
indicated that steroidogenesis coincides with expression of new proteins (Davis and
Garren, 1968; Ferguson, 1963; Garren, et al, 1965). Nonetheless, in a short time it
became clear that the inhibition of protein synthesis had no effect on the delivery of
cellular cholesterol to the outer mitochondrial membrane, but that the delivery of this
substrate from the outer membrane to the inner mitochondrial membrane was completely
inhibited (Ohno, et al,
1983; Privalle, et al,
1983). These observations led to
characterizing the action of a putative regulator protein for mediating the transfer of
cholesterol from the outer mitochondrial membrane, through the aqueous intermembrane
space, to the inner membrane. A number of candidate protein have been proposed for this
role, and a listing of these proteins and the data supporting their candidacies have been
discussed in a number of previous reviews (Cherradi, et al, 1998; Clark and Stocco,
1997; Miller, 1997; Stocco, 1997a, b, 1998, 2000; Stocco and Clark, 1996, 1997; Wang
and Wang, 2006).
A likely candidate for the suggested corticosteroid stimulatory protein was
identified by Krueger and Orme-Johnson (Krueger and Orme-Johnson, 1983) who
reported the discovery of a protein produced during acute ACTH stimulation in isolated
rat adrenal cells (Lehoux, et al, 2003). Subsequently, it was found that a family of 28-32
kDa phosphoproteins in various steroidogenic tissues fulfills the requirements of the
hypothesized labile steroidogenic stimulatory protein. It was further shown that these
proteins all originated from a common 37 kDa precursor that was rapidly phosphorylated
in response to cAMP (detailed in the next section), and cleaved during its import into
mitochondria (Lehoux et al, 2003). Finally it was proposed that this phosphoprotein
30
could transport cholesterol inside mitochondria during its trafficking process (Epstein and
Orme-Johnson, 1991b).
1.18.1 START domain proteins
The best evidence for LTP-mediated lipid transport in vivo comes from studies of
proteins containing the lipid-binding START (steroidogenic acute regulatory-related lipid
transfer) domains (Reviewed in next sections). Recently it was shown that members of
START domain proteins such as StARD4, 5, and 6 contribute to the intracellular
transport of cholesterol (Soccio and Breslow, 2003). Overexpression of STARD4 or
STARD5 stimulates steroidogenesis by P450scc and liver X receptor reporter gene
activity, thus indicating that both proteins function in cholesterol metabolism and might
be cholesterol or sterol-specific binding proteins (Soccio, et al., 2005). Crystal structure
of the START domains in StARD4 and MLN64 (closest homolog to StARDl-START)
does not exhibit any specific subcellular targeting sequence, suggesting that these are
cytoplasmic proteins which bind to insoluble cholesterol thereby facilitating its
transportation across aqueous cytosol. Actually, the current view of steroidogenesis
process is that StARD4 or a related protein is probably responsible for delivering
cholesterol to the outer mitochondrial membrane (OMM) from elsewhere in the cell (lipid
droplets, endoplasmic reticulume), whereas StAR itself is responsible for delivery from
the OMM to the IMM (Miller, 2006) (see below). The similarities in the sequence and
activity of START domain proteins led to investigations of computational databases,
categorizing comparable domains in many other proteins found in a broad spectrum of
eukaryotic organisms, including plants and invertebrates (Iyer, et al., 2001; Ponting and
Aravind, 1999).
31
1.19 Steroidogenic acute regulatory protein (StAR) as acute regulator
The discovery of StAR protein can be traced back to the description of a group of
30 kDa phosphoprotein induced in rodent adrenal cells by ACTH and in rat luteal cells
and murine Leydig cells by LH by Orme-Johnson and collegues (Alberta, et al, 1989;
Epstein and Orme-Johnson, 1991a; Krueger and Orme-Johnson, 1983; Pon and OrmeJohnson, 1988). A direct relationship was found between the appearance of a specific 30
kDa protein and steroid secretion. The induction of the 30 kDa protein was prevented by
the protein synthesis inhibitor, cycloheximide, in conjunction with inhibition of
steroidogenesis. Identical proteins were also found in dibutiryl-cAMP-stimulated MA-10
mouse Leydig tumor cells by Stocco and colleagues (Stocco and Ascoli, 1993; Stocco
and Chen, 1991; Stocco and Kilgore, 1988). The 30 kDa proteins were localized to
mitochondria and were shown to be derived from a 37 kDa precursor (Epstein and OrmeJohnson, 1991a, b; Krueger and Orme-Johnson, 1983; Pon, et al, 1986; Stocco and
Clark, 1996; Stocco and Sodeman, 1991). In 1994, the 30 kDa proteins from MA-10
Leydig cells (see last section) were purified, cloned, and expressed and it was established
that expression of these proteins in transfected MA-10 cells in the absence of hormonal
stimulation was sufficient to induce steroid production (Clark, et al, 1994). In addition to
the 30-kDa proteins, steroidogenic activity of 37-kDa precursor forms of these proteins
containing N-terminal mitochondrial signal sequences were also examined (Epstein and
Orme-Johnson, 1991b) (Stocco and Sodeman, 1991); a direct cause-and-effect role for
the 37- and 30-kDa proteins in hormone-regulated steroid production was identified
(Stocco, 2001b).
32
1.20 StAR abnormality: lipoid congenital adrenal hyperplasia (LCAH)
The observation that provided the strongest evidence for the essential requirement
for StAR in steroidogenesis came with the finding that mutations in the StAR gene were
the cause of the potentially lethal condition known as congenital lipoid adrenal
hyperplasia (lipoid CAH) (Lin, et ah, 1995). Lipoid CAH (Figure 10) is the most severe
form of congenital adrenal hyperplasia, which is characterized by deficiency in steroid
hormone biosynthesis that disrupts the synthesis of all adrenal and gonadal steroids and
leads to the accumulation of cholesterol and cholesterol esters in new born (Bose, et ah,
1996). The clinical phenotype of this disease is manifested as considerable adrenocortical
insufficiency shortly after birth, hyperpigmentation reflecting increased production of
proopiomelanocortin, elevated plasma renin activity as a consequence of reduced
aldosterone synthesis, and male pseudohermaphroditism resulting from deficient fetal
testicular testosterone synthesis (Hauffa, et ah, 1985; Miller and Strauss, 1999). Analysis
of the StAR gene revealed more than 30 different mutations in patients with congenital
lipoid adrenal hyperplasia (Bose, et ah, 2000a; Bose et ah, 1996; Fujieda, et ah, 1997;
Lin et ah, 1995;Nakae, et ah, 1997; Okuyama, etah, 1997; Tee, etah, 1995).
33
Figure 10. Model of Congenital Lipoid Adrenal Hyperplasia in an Adrenal Cell
In the normal cell (Panel A), cholesterol is derived by endogenous synthesis from acetylcoenzyme A in the endoplasmic reticulum, from cholesterol esters stored in lipid
droplets, and from low-density lipoprotein cholesterol, which after receptor-mediated
endocytosis, is processed in lysosomes before it is used or stored in lipid droplets.
Cholesterol is transported to the outer mitochondrial membrane by ill-defined processes
involving the cytoskeleton. The rate-limiting step in steroidogenesis is the movement of
cholesterol from the outer to the inner mitochondrial membrane; this can be promoted by
steroidogenic acute regulatory protein (StAR), but may also be mediated by mechanisms
independent of this protein. Thus, the net synthesis of steroid is due to mechanisms
dependent on, as well as independent of, the protein. In Panel B, in the absence of
steroidogenic acute regulatory protein, as in early congenital lipoid adrenal hyperplasia or
in a placental cell, mechanisms independent of the protein can still move some
cholesterol into the mitochondria, resulting in a low level of steroidogenesis. In patients
34
with affected adrenal cells this results in increased corticotropin secretion, stimulating
further production of cholesterol and its accumulation as cholesterol esters in lipid
droplets. In Panel C, as lipid droplets accumulate they engorge the cell, damaging its
cytoarchitecture through both physical displacement and the chemical action of
cholesterol
auto-oxidation
products.
Steroidogenic
capacity
is
destroyed,
and
consequently tropic stimulation continues. In the ovary, follicular cells remain
unstimulated and, hence, undamaged until they are recruited at the beginning of each
menstrual cycle. Small amounts of estradiol are produced, as shown in Panel B, effecting
phenotypic feminization and vaginal bleeding, but the cycles are anovulatory, resulting in
infertility and progressive hypergonadotropic hypogonadism. cAMP denotes cyclic AMP.
Adopted from (Bose et al. (1996). N. Engl. J. Med).
35
1.21 Transcriptional regulation of the StAR gene
Different regulatory and transctiption factors are involved in positive or negative
regulation of the StAR gene (Stocco, 2001b). The following sections will summarize
elements which contribute to the StAR gene transcription and regulation.
1.21.1 Positive regulation
Early studies demonstrated that hormone-stimulated steroid synthesis was
accompanied by a rapid increase in StAR mRNA levels (Clark, et al, 1995). It was later
found that trophic hormone-dependent increase in cAMP levels resulted in a rapid and
positive regulation of the StAR gene (Caron, et al, 1997; Sandhoff et al, 1998;
Sugawara, et al, 1997; Sugawara, et al, 1995b). Most studies revealed that the cAMPresponsive site was located within the first 254 nucleotides downstream of transcription
start site (Caron et al, 1997; Sandhoff et al, 1998; Sugawara, et al, 1996; Sugawara et
al, 1997), and this region has been the focus of studies to identify promoter elements and
their cognate-binding proteins that mediate the cAMP response. However, the StAR
promoter lacks a consensus full cAMP response element, raising the possibility that the
cAMP response element binding protein might not act directly on sequences found in the
StAR promoter (Stocco, 2001b). Therefore, the presence of other factors was proposed.
1.21.2 Steroidogenic factor-1 (SF-1)
SF-l, a member of the steroid hormone receptor family of nuclear transcription
factors identified in adrenocortical cells (Ikeda, et al, 1993), was the first transcription
factor to be studied as a potential regulator of the StAR gene (Stocco, 2001b). SF-1 can
efficiently transactivate the StAR promoter in transient transfection assays in numerous
36
cell types (Caron et al, 1997; Sugawara et al, 1996; Sugawara et al, 1997). It is also
required for protein-DNA interactions and maximal transactivation of StAR promoter in
the region of the StAR promoter flanked by positions -105 and -60 (Wooton-Kee and
Clark, 2000).
1.21.3 Spl
Spl is a member of the zinc finger family of transcription factors (Berg, 1992).
Spl is involved in the expression of multiple steroidogenic genes including CYP11A
(P450scc) (Ahlgren, et al, 1990; Venepally and Waterman, 1995), CYP21B (P450c21)
(Kagawa and Waterman, 1991), and CYP17 (P450cl7p) (Borroni, et al, 1997). Spl may
contribute to the regulation of StAR gene thereby interacting with a number of
transcription factors such as GATA-4 (Lee, et al, 1997; Rodenburg, et al, 1997; Sun, et
al, 1998).
1.21.4 GATA-binding protein 4 (GATA-4)
Functional assays on FSH-induced primary granulosa cells (Silverman, et al,
1999) led to the identification of two trans-acting proteins, C/EBPP and GATA-4, which
were required for the transcriptional activation of the StAR promoter. GATA-4 has been
suggested to play a regulatory role in the acute rate of StAR transcription (Sugawara et
al, 1997).
1.21.5 Steroid regulatory element binding protein (SREBP)
A recent study defined a conditional response of the human StAR gene promoter
to sterol regulatory element binding protein-la (SREBP) (Christenson, et al, 2001).
37
Concomitantly, other laboratories demonstrated the presence of a potential sterol
regulatory element binding site in the rat StAR promoter (Shea-Eaton, et al, 2001).
"These studies found that SREBP is capable of transactivating the StAR promoter. It was
further indicated that other transcription factors such as SF-1, nuclear factor-Y, yin yang
1 and Sp-1 may also be involved in the action of SREBP on the StAR promoter (Stocco,
2001b). Based on these results, it is possible to conclude that StAR may be cooperatively
regulated by SREBP along with other mentioned factors.
1.21.6 Other factors
In addition to the mentioned factors, other less known positive regulators have
been also proposed to be involved in StAR gene expression, such as arachidonic acid
metabolites (Wang, et al, 1999), arylhydrocarbon receptor (AhR) (Sugawara, et al,
2001) and Cyclic AMP response element binding protein (CREB) (Stocco, et al, 2001).
1.22 Negative regulation of the StAR gene
1.22.1 DAX-1
Besides the discussed positive regulatory factors, the StAR promoter may also
port elements involved in repression of its transcription; overexpression of DAX-1
(dosage-sensitive sex reversal, adrenal hypoplasia congenita, critical region on the X,
gene 1) in Y-l cells blocks expression of the StAR gene, probably through binding to a
hairpin structure in the 5' flanking region of the StAR promoter (Zazopoulos, et al,
1997).
38
1.23 Posttranslational Modifications of StAR
Post-translational modifications such as phosphorylation and specific proteolysis
affect the (StAR) activity (Fleury, et ah, 2004; LeHoux, et ah, 2004). Three putative
phosphorylation sites have been reported to be required for the (Bu^-cAMP-stimulated
activity of full length hamster StAR in transfected COS-1 cells. In effect, cyclic AMP is a
known activator of PKA, qualifying these sites as potential candidates for modulation of
StAR activity via PKA-mediated phosphorylation. Prior to that, it had been shown that
alkaline phosphatase treatment of human StAR expressing COS-1 cells lysates had
resulted in loss of two acidic species noted by two dimensional gel electrophoresis
(Arakane, et ah, 1997). Consistent results obtained by other laboratories confirmed that
StAR phosphorylation is one of the regulatory steps in hormone-stimulated steroid
formation.
1.24 StAR protein structure/function relationships
1.24.1 Functional domains
In humans, StAR is expressed in adrenal gland, gonads, and brain, and consists of
285 amino acids (Sugawara, et ah, 1995a) separated into two functional domains: (1)
mitochondrial import sequence responsible for its translocation in mitochondria, and (2)
the StAR lipid transfer (START) domain (Ponting and Aravind, 1999; Ponting, et ah,
1999) responsible for the transfer of cholesterol to the mitochondrial inner membrane
(IMM). StAR is targeted to the mitochondria by its N-terminal presequence that allows
mitochondrial import of the protein, but it is rapidly degraded after entering the
mitochondria (Granot, et ah, 2002). However, studies revealed that deletion of first N-
39
terminal 46 amino acid residues of the hamster StAR expressed in COS-1 cells did not
have any significant effect on steroidogenic activity of the mutant (Fleury et al., 2002).
This report was in agreement with observation that human StAR retained full activity
even in the absence of complete targeting sequence (Arakane, et al, 1998). These
findings demonstrated that in vitro, only the segment of StAR including START domain
(AN62-StAR) is enough to support cholesterol transfer across the mitochondrial
membrane.
1.24.2 The StAR homolog MLN64
After the experiments determined StAR sequence (Clark et al, 1994), it was
speculated to represent a new, unique class of proteins. However, concomitant studies of
metastatic breast carcinoma led to the cloning of MLN64 (metastatic lymph node, clone
64), whose START domain displayed -37% identity and 50%< similarity to that of the
StAR protein (Moog-Lutz, et al, 1997). When this StAR-like domain (N-218 MLN64)
was either expressed in transfected COS-1 cells (in vivo) or purified and added to
mitochondria in vitro, it exhibited about half of the ability of StAR to promote
steroidogenesis (Bose, et al, 2000b; Watari, et al, 1997). The similarity in the sequence
and activities of StAR and MLN64 led to characterization of the START domain of StAR
(referred to hereafter as StAT-START) through standard homology modeling based on
the MLN64 structure (Mathieu, et al, 2002a).
40
1.24.3 Structure of StAR-START
A complete understanding of the StAR's molecular structure and mechanism is
essential to understand LCAH and explain experimental results at the molecular level. To
date, the StAR structure has not been defined directly, but X-ray crystal structures for two
closely-related proteins N-216 MLN64 (Tsujishita and Hurley, 2000) and StARD4
(Romanowski, et al, 2002) have been determined. Based on these data, computational
modeling of StAR-START with Mathieu et.al. (2002) provided new insights into the
mechanism of StAR function. The StAR structure was modeled in our laboratory through
standard homology modeling procedures based on the MLN64 crystal structure (Mathieu
et al, 2002a). As shown in (Figure 11), the cholesterol binding site composed of a Ushaped unclosed P-barrel topped by the parallel C-terminal a-helix. The structure is of the
a/p type, consisting of nine-stranded twisted anti parallel p-sheet with strand order of
123987654, and 4 a-helices. Two Q-loops are inserted between P5P6 and P7P8. The most
important feature of cholesterol binding domain of StAR is a hydrophobic pocket
matching the size and structure of cholesterol, extending nearly the entire length of the
protein. The hydrophobic cavity of StAR-START can be predicted as the driving force
allowing StAR to open, exposing the binding site to incoming cholesterol molecules
More details about structural changes of the StAR-START upon binding to
cholesterol and our proposed mechanistic model will be discussed in the next sections.
41
Figure 11. Ribbon diagram of StAR model
Helices in red, strands in blue, and loops in yellow. There is 'fog' in the image for depth
perception. All structural elements have been labled according to the human MLN64
crystal structure. (Mathieu et al, J. mol. Endo (2002) 29, 327-345).
42
1.24.4 Mechanism of StAR's action
The regulation of StAR at the level of transcription and second messenger
pathway have been previously characterized (Lehoux, et al, 1998; Stocco, et al, 2005).
However, the exact biochemical mechanism of StAR's action has been remained obscure
up to now. It has been well established that StAR facilitates the cholesterol movement
from the outer mitochondrial membrane (OMM) to the IMM. In this regard, four models
of StAR's action are to be discussed: contact sites; desorption; mediation of
mitochondrial receptors; and molten globular state.
1.24.5 Contact sites
As discussed in section 1.19, early studies (Clark et al, 1994; Epstein and OrmeJohnson, 1991b; Krueger and Orme-Johnson, 1983; Pon et al, 1986; Stocco and
Sodeman, 1991) described the StAR as a cytoplasmic 37kDa precursor phosphoprotein
which is rapidly directed into mitochondria through its targeting sequence to be cleaved
to produce mature long-lived 30kDa protein. It has been suggested that during or after
translocation, StAR desorbs one cholesterol molecule and load onto the P450scc. Taking
into consideration the model in that other investigators had shown the existence of
contact sites at loci where proteins were imported into mitochondria (Schwaiger, et al.,
1987), it was hypothesized that formation of lipid bridges during import of StAR
facilitates cholesterol flow into the cholesterol depleted inner mitochondrial membrane
(Stocco and Clark, 1996).
This model was censured when it was found StAR protein lacking the N-terminal
62 amino acids (targeting sequence) supported steroid synthesis to the same extent as
43
wild-type StAR either in transfected COS-1 (Arakane, et al, 1996) cells or with isolated
mitochondria (Arakane et al, 1998), yet never imported into mitochondria.
1.24.6 Desorption model
Studies with bacterially-expressed N-62 StAR showed that the protein could
stimulate cholesterol transfer from synthetic liposomes to trypsin-pretreated mitochondria
as well as microsomal membranes (Kallen, et al, 1998). Given that StAR alone is
sufficient to support cholesterol transfer to acceptor membranes, it was suggested that a
mitochondrial StAR receptor is not required to mediate the transportation process. The
notion that sterol transfer does not involve fusion of liposomes with mitochondrial
membrane (acceptor) is suggestive of a stimulatory role of StAR to promote desorption
of cholesterol from the donor vesicle.
This hypothesis is relevant to the situation in steroidogenic mitochondria because
the outer mitochondrial membrane is cholesterol rich, whereas the inner membrane is
relatively devoid of cholesterol (Stocco, 2001a).
1.24.7 PBR, a potential mitochondrial receptor for StAR
Some studies propose the peripheral type benzodiazepine receptors (PBRs) as
indispensable factors which maintain the cholesterol translocation process (Amri, et al,
1996; Papadopoulos, 1993). In situ and in vitro experiments by these groups indicated
that in steroidogenic cells the StAR-induced cholesterol import into mitochondria was
mediated by the outer mitochondrial membrane PBR. This theory is based on the
involvement of three essential factors in acute stimulation of cholesterol transport into
mitochondria: cAMP-dependent protein kinase (PKA), peripheral-type benzodiazepine
44
receptor (PBR), and the steroidogenesis acute regulatory (StAR) proteins (Hauet, et al,
2002). Recently evidence was provided that formation of a mitochondrial signaling
complex composed of outer mitochondrial membrane translocation protein (TSPO) and
PAP7 (TSPO-associated protein), which binds and bridges to mitochondria the regulatory
subunit RIa of the cAMP-dependent protein kinase (PKARIcc); and the horomone
induced PKA substrate, StAR (Liu et al, 2006).
This model could be interpreted as placing StAR upstream from signaling
multifaceted and raise the possibility that StAR is a ligand for this mitochondrial complex
(Miller and Strauss, 1999). However, it was previously (Arakane et al, 1998) shown that
N-62 StAR is not selectively accumulated by mitochondria, indicative of the low affinity
of mitochondrial receptors for the C-terminus of StAR. Conclusively, more effort should
be taken to provide further evidences to clarify the nature of interaction between StAR
and the outer mitochondrial membrane.
1.24.8 Theory of Molten Globular state
Globular proteins can be denatured by changing pH and ionic strength (Stigter, et
al, 1991). Recent evidence has led to the conclusion that there are two acid-denatured
states: one highly unfolded and the other more compact, sometimes called the "molten
globule" (Stigter et al, 1991). A molten globule (MG) is a stable, partially folded protein
state found in mildly denaturing conditions such as low pH. MGs are collapsed and
generally have some native-like secondary structure but a dynamic tertiary structure as
seen by far and near circular dichroism (CD) spectroscopy, respectively. In this context,
Miller and colleagues provided evidence that when StAR is subjected to limited
45
proteolysis at different pH values, the molecule behaves differently as the pH decreases
(Bose, et al, 1999). That is, StAR unfolding at pH values in the 3.5-4 range, giving rise
to a biologically active molten globular state. However, an acidic microenvironment in
close proximity of mitochondrial membrane still needed to be proven. Therefore, they
proposed that the acidic pH is provided by the expulsion of protons from the
mitochondrial matrix by the proton pump (Allen, et al., 2006) and/or by the presence of
the negatively charged head groups of the phospholipids (Tamm, 1986) in the outer
mitochondrial membrane. This theory further proposed that transition to a MG, stimulates
the opening of folded protein, exposing a hydrophobic region to the cholesterol, or it may
prolong lifetime of the StAR, thereby increasing the transfer of cholesterol during this
phase. Laboratory evidence for transition of StAR to a molten globule included changes
in spectroscopic behavior (changes in circular dichroism (CD) spectra) and increase in
sensitivity to proteolysis. A previous study (Song, et al, 2001) on a recombinant protein
lacking both the signaling sequence and a substantial part of the c-terminal (including ahelix 4), namely 63-193 StAR, asserted that the N-terminal domain of StAR is a molten
globule state. They also suggested that transition to this molten globule state facilitates
the interaction of StAR with the negatively charged membranes. The extent to which this
model can be applied to a biological system will be discussed in the DISCUSSION
section.
Despite considerable advances, there are questions concerning the ability of MG
protein to deliver cholesterol to P450scc in the matrix side of mitochondrial inner
membrane. Moreover, the model does not explain the acid-induced protonation of amino
acids located in the interior of hydrophobic pocket, leading to loss of StAR integrity and
46
even ability of binding to cholesterol. Of these, this theory is strongly based on the pH of
the microenvironment close to the mitochondria being much lower than the rest of the
cytosol, a condition has not yet been demonstrated.
47
1.24.9 Our proposed model for the StAR action
Following the observations that (1) the C-terminal region of StAR is important for
proper StAR activity (Lin et al. 1995, Bose et al. 1996), (2) the C-terminal region is
suggested to transiently change conformation for cholesterol binding (Tsujishita &
Hurley 2000), (3) the loss of StAR helical structure is obtained upon the binding of a
cholesterol analog (Petrescu et al. 2001), (4) molten globular states of StAR are possible
(Bose et al. 1999, Christensen et al. 2001), and (5) the C-terminal a-helix in MLN64
entirely covers the putative cholesterol binding site, Mathieu et al (2002) in our
laboratory investigated the possible implication of various conformational states of this
C-terminal a-helix in the binding of cholesterol to StAR through molecular modeling.
They hypothesized that in the absence of cholesterol StAR population is in equilibrium
between the native and partially unfolded state. The hydrophobic cavity of StAR was
proposed to be the driving force for the unfolding of the C-terminal a-helix revealing the
cholesterol binding site. In fact, According to this model, binding of cholesterol occurs
preferentially to a partially unfolded state of StAR. The refolding of C-terminal a-helix
on top of the cholesterol binding site can bring about a complete sequestration of
cholesterol from solvent, thereby forming a stable StAR/cholesterol complex. This theory
suggests a rapid unfolding StAR mechanism for the transfer of cholesterol from the outer
to the inner mitochondrial membranes, driven by the transmembrane cholesterol gradient.
In addition, refolding of c-terminal domain guarantees the inaccessibility of cholesterol to
the aqueous environment and leads to formation of an active hydrophobic protein/ligand
complex (Figure 12).
48
'^^IJuLlA*
>
#1
'#mv
D
^^
^f
m
# ^ \
Figure 12. Molecular mechanism of cholesterol binding to StAR
The cholesterol binding site of StAR is opened through two movements of the C-terminal
a-helix (dark gray) from the original folded conformation (A): step #1 opened (B) completely removed from the cholesterol binding site, and step #2 partially unfolded (C)
- all of the a-helical structure of the C-terminal a-helix is lost. Once open, cholesterol can
bind to StAR (D) as indicated in step #3; a theoretical Kd in micromolar range was
calculated with STC (structure-based thermodynamics calculation). StAR is represented
as a ribbons diagram while cholesterol is depicted as van der Waals surface. StAR is
white with the C-terminal a-helix black, and cholesterol dark gray.
49
Research objectives
The mechanism and site(s) of StAR action are controversial. Indeed, it has not yet
been clearly established whether StAR binds to free cholesterol in the cytosol or desorbs
it from the outer mitochondrial membrane (Christenson and Strauss, 2000). However,
there is a consensus that StAR acts outside of mitochondria to promote cholesterol
transfer across its membrane. In addition, the molecular mechanism of transport is still
under debate. On one hand, evidence suggests that the binding and release of cholesterol
is dependent on the existence of a molten globular state of StAR that is promoted near the
mitochondrial membrane where the pH is supposedly acidic. On the other hand, we have
proposed that the cholesterol binding site is a well ordered hydrophobic cavity which
contains a salt bridge important for the specify of the interaction and that the entry of
cholesterol into this cavity coincides with the reversible unfolding of the C-terminal ahelix on top of the binding site (Mathieu et al, 2002a). The sizeable cavity is predicted to
provide the driving force for the reversible unfolding. This implies that in absence of
cholesterol, the fully folded state of StAR is in equilibrium with a partially folded state
that allows for the entry (and exit) of cholesterol. Binding of cholesterol to the cavity is
hypothesized to stabilize the fully folded state and the C-terminal helix.
To shed light on the mechanism by which StAR transports cholesterol across the
mitochondrial membrane, we sought to clarify the exact mechanism by which StAR
binds to cholesterol, assuming that this is the first step in the mechanism. To achieve this
goal, we would express, purify and confirm the steroidogenic activity of StAR lacking
first 62 amino acids at the N-terminus (N-62 StAR). To determine the effect of
50
environmental pH on the binding capacity of StAR to cholesterol classical in vitro
binding assays would be performed. This would give a global idea about the effect of pH
on the formation of StAR/cholesterol complex. To characterize the molecular
mechanisms involved in the activity of StAR to bind to cholesterol, circular dichroism
(CD) studies will be done to determine the effect of cholesterol binding on the secondary
structure of StAR as a function of pH at different temperatures. This would enable us to
characterize the structural changes and thermodynamic elements which contribute to the
binding process. In addition to that, kinetic studies would be carried out to clarify the
binding mechanism as a function of time. Based on the cholesterol-induced secondary
structural modifications of StAR, this study will also develop a methodology for
determining the stoichiometry and dissociation constant (Kn) of the protein/ligand
complex.
Eventually, we will combine our results with the current models of StAR function
to signify new insights into the mechanism of cholesterol transport by StAR protein.
51
2. Materials and Methods
2.1 Description of MA-10 and Y - l steroidogenic cell lines
About 20 years ago, a report was published on the establishment of a mouse
Leydig tumor cell line (designated MA-10) that retained many of the properties of normal
Leydig cells, including potent steroidogenic mitochondria produce steroids in responses
to trophic hormone stimulation (Ascoli, 1981).
The MA-10 mouse leydig tumor cell line used in the current study was kindly
provided by Dr. M. Ascoli (Dep. Of Pharmacology, University of Iowa College of
Medicine, Iowa City). The cells were grown in Waymouth's MB752/1 media including
20mM HEPES and 15% horse serum with the pH of 7.7 in a humidified incubator
containing 5% C02.
Mouse Y-l adrenal cell lines were also used. These cell lines have proven to be of
considerable value in studying the molecular and biochemical mechanisms controlling
adrenal steroidogenesis.
Y-l cells were obtained from American Tissue Culture Co. and grown in Ham's
F10 medium with 2mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate
(82.5%), 15% horse serum, 2.5% fetal bovine serum. Both cell lines were maintained and
propagated using standard techniques.
52
2.2 Description of the vectors for expression of 6His-Tag recombinant N-62
StAR
A pET vector is a bacterial plasmid designed to enable the quick production of a
large quantity of any desired protein when activated. This plasmid (pictured below)
contains several important elements - a lad gene which codes for the lac repressor
protein, a T7 promoter which is specific to only T7 RNA polymerase (not bacterial RNA
polymerase) and also does not occur anywhere in the prokaryotic genome, a lac operator
which can block transcription, a polylinker, an f1 origin of replication (so that a singlestranded plasmid can be produced when co-infected with Ml3 helper phage), an
ampicillin resistance gene, and a ColEl origin of replication (Figure 13).
The pET-3a vector (Novagen Inc. Madison, WI, U.S.A.), used for cloning of Cterminal 6xHis tag AN62-StAR, is a 4640bp plasmid which carry an N-terminal T7-Tag
sequence and cloning sites including BamHl and Ndel.
The pET-21b vector (Novagen Inc. Madison, WI, U.S.A.), used for cloning of Nterminal 6xHis tag AN62-StAR, is a 5443 bp plasmid.
53
Figure 13. The pET Vectors
These plasmids contain a drug resistant marker for ampicillin resistance, the lad gene,
the T7 transcription promoter, the lac operator region 3' to the T7 promoter, and a
polylinker region. Also, there are two origins of replication - one is the f1 origin which
enables the production of a single stranded vector under appropriate conditions, and the
other is the conventional origin of replication. A) Map of pET-3a vector; B) Map of the
pET-21b vector.
54
ECOR 1(4638)
, A p o 1(4638)
j , C l a 1(24!
. , „
1 { H i n d 111(29)
A a t 11(4567).
>< |
S s p i(J449!_;s
_J U [_/
^^ L /. /
yJ^.^'''^
Sea 3(4125) v
, - B p u l l 0 2 1(458)
,«BamH 1(510)
/
/
_,. Ncte 1(550)
^ ^ B ^ ' ^ ' . . . - X b a 1(588)
^ ^ • ^ ,
P s t 1(3890) v
Bgl 11(646)
^ ^ \
///&
S g r A 1(687)
>v .,_• S p h 1(843)
\
/ /
„- ECON 1(303)
V
Sol 1(928)
\~- P s h A 1(993)
j
pET-3a
\
(4S40bp)
{
H g i E 11(3338) \
L - E a g 1(1216)
V
f - N m I{l25l)
i - A p a B 1(1329)
A B s p M 1(1331)
\
A l w N !(316B)
-<
«k
/
*•*- B s m 1(1636)
X \ x - A v a 1(1702)
^MSC 1(1723)
\ N B p u l O 1(1858)
^ B s c G 1(1912)
,/
B s p L U V ! 1(2752) .,--f-,, v
Af! 111(2752)''
y-S a p 1(2636) •'
~T'{ ~ . ~ r
Bst 1107 1 ( 2 8 2 3 ) / /
/ /
B s a A 1(2504) •'/
I j
T t h l H 1(2437) I
I I
B s m B 1(2393)!' /
Pvu 11(2343) I
-
B
" 1 - N h e 1(231)
;.,.- N d e 1(238)
X b a 1(276)
Bgl 11(342)
S g r A 1(383)
S p h 1(539)
" \ . _ . . . — E c o N 1(599)
Dra 111(5201),
="Z>
-543
v
:^
'<*#
*'
Sea 1(4538)
Pvu 1(4428) ~J/
X X " ~ ~ ~ p f l M '< 646 )
\
f
\ - - A p a 8 1(748)
^ \ \ w M l u 1(1064)
f , \ \ V - B c l 1(1078)
Jin
Pst 1(4303) JI
, A v a 1(158)
X h O 1(158)
N o t 1(166)
E a g 1(166)
H i n d 111(173)
S a l 1(179)
S a c 1(190)
ECOR 1(192)
B a m H 1(198)
If I
8 s a 1(4119V-
.
^
pET-21b(+)
t B s t E 11(1245)
, ' l - B m g 1(1273)
| j F'Apa 1(1275)
Eam1105 1(4058)4
(5443bp)
A l w N 1(3581) ^
F/BssHII(1475)
/ E c o R V(1514)
"*Hpa 1(1570)
\
/ \ p s h
/
/•\.PpM
B s p L U 1 1 1(3165) /
/'"--,-,
S a p 1(3049) '
//
B s t 1 1 0 7 1(2936) 1 j
1(2171)
11(2171)
^ ,~-\ \ B p\uP1s0p 51(2271)
~
I B s p G 1(2691)
T t h 1 1 1 1(2910)'
55
2.3 Preparation of competent bacteria, bacterial transformation and plasmid
purification
Competent E. coli XLl-Blue (Statagene, La Jolla,CA) were prepared using CaC^
method (Ausubel et al., 1995) and were stored at -80°C for further use. The pET-3a
constructs containing C-terminal 6His N-62 StAR (referred to hereafter as C-N62 StAR)
were transformed into E. coli XLl-Blue as was described previously (Hanahan, et al,
1991). The transformed bacteria were streaked on Petri-dishes of 100X15mm (Baxter,
Pointe-Claire, QC) that had been pre-filled with autoclaved Luria-Bertani (LB;
(Sambrooke et al., 1989)) containing 1.5% agar and 50 ug/ml ampicilin, followed by 16h
incubation at 37°C. Colonies were picked and transferred into the liquid culture media
(LB + lOOug/ml ampicillin) followed by incubating in a shaking incubator at 37°C at 225
rpm overnight (-16 h). Plasmid DNA was purified using a QIAGEN Plasmid Maxi Kit
(Qiagen Inc., Mississauga, ON) according to the manufacturer's protocol.
2.4 Preparation of the N-terminal 6His tag N-62 StAR sequence motif
To produce NL^-terminal 6His-tag StAR proteins lacking the mitochondrial
import sequence including first 62 amino acids (referred to hereafter as N-N62 StAR),
pET-3a plasmids containing DNA encoding for human StAR sequence from amino acid
63-285 were amplified using the following PCR conditions: hot start of 5 min at 94°C
(polymerase was added just 30 seconds befor the end of the cycle), completed by 30
cycles of 94°C/58°C/72°C and a final elongation of 72°C forlO min; using primers 5'[TTCGCGGATCCTGATCAGTGGTGGTGGTGGTGGTGACACCTGGCTTCAGAGG
C]-3' and 5'-[GGAATTCCATATGCTGGAGAGATTT CAGTGACC]-3'. Then the PCR
56
products were separated through 1% agarose gel electrophoresis (Southern 1979) at 100
V for at least 45 minutes in TAE buffer (40mM Tris-acetate, ImM EDTA), stained with
ethidium bromide, and visualized by UV illumination. DNA bands corresponding to
desired fragments were excised and purified using QIAEX11 Gel Extraction Kit (Qiagen
Inc., Mississauga, ON) according to the manufacturer's recommendations. DNA was
eluted in 50ul water and repurified by a QIAquick PCR Purification Kit (Qiagen Inc.,
Mississauga, ON).
2.4.1 Cloning of the N-N62 StAR
pET-21b vectors were digested with BamHl and Nhel restriction enzymes (NEW
ENGLAND Bio labs Inc) using 5 ug of plasmid DNA with 30 U of enzyme in the
appropriate reaction buffer giving a total volume of 50 ul. The mixture was incubated for
2 h and depleted from salts and proteins by passing it through QIAprep Spin Miniprep Kit
(Qiagen Inc., Mississauga, ON) column, following by dephosphorylation to prevent selfligation or DNA concatemer formation (Spinella, et al, 1999). The PCR products were
digested accordingly and were washed using a QIAquick Nucleotide removal Kit (Qiagen
Inc., Mississauga, ON). The recovered DNA was ligated into pET-21b and the constructs
were transformed into competent E.coli BL21(DE3) bacteria. Colonies were grown and
transferred into liquid LB medium as described above. Plasmids were purified as above
and sent for sequencing and corresponding bacteria were frozen in 20% glycerol at 80°C.
57
2.5 Preparation of the recombinant proteins
2.5.1 N - 6 2 StAR expression
A few microliters of the bacteria were incubated in LB medium containing 50
ug/ml ampicillin for 16h at 37°C with shaking at 225 rpm overnight. Cultures were
diluted 1:50 into fresh LB medium and were grown at 37°C to an OD600 of approximately
0.4 to 0.6. At this point, expression of the N-N62 StAR was induced by 0.5 mM-1 mM
IPTG (Promega, Madison, WI).
2.6 Purification of the recombinant proteins
After at least 4h induction, bacteria were spun at 6000 rpm for 10 min and pellets
were stored at -20°C. For native purification , bacterial pellets were lysed in 300mM
NaCl, pH 8.0, 50 mM NaH 2 P0 4 , 1 mM PMSF and 1 mM Tris(2-carboxyethyl)phosphine
(TCEP), 1 mg/ml lyzozyme followed by drawing-expelling of the lysates through a 21
gauge needle and were spun for 45 min at 15000 rpm. Native purification of protein from
supernatant was carried out using the nitrilotriacetic acid-chelate resin (Qiagen Inc.,
Mississauga, ON) according to manufacturer's recommendations.
For refolding purification, inclusion bodies were solubilized in 8 M urea or 6 M
GuHCI and proteins were recovered from a gradually decreasing of the denaturant
concentration as has been described elsewhere (Li, et al., 2004). The proteins were eluted
in a buffer containing 25 mM NaH 2 P0 4 , 125 mM NaCI, pH 7.4, 300 mM imidazole, 1
mM TCEP and were subjected to three consecutive centrifugation steps in millipore
ultracentrifugation filter device (Amicon) at 3000 rpm for 30,60,45 min respectively. To
remove the residual imidazol, in the last two spins proteins were washed and
58
concentrated through physiological buffer (Godt and Maughan, 1988) gradient. Protein
concentration was estimated at A280 , considering 1A[280] corresponds to 0.96 mg/ml
calculated from the amino acid sequence using the Vector NTI program (Invitrogen).
2.7 Analysis of the purified proteins
2.7.1 Separation on SDS-PAGE
Separation of the proteins was carried out through SDS-PAGE (Laemmli, 1970)
using two sequential gels; The composition of the top gel, called the stacking gel, is
slightly acidic (pH 6.8) and has a low (5.5%) acrylamide concentration to make a porous
gel. Under these conditions proteins separate poorly but form thin, sharply defined bands.
The lower gel, called the separating, or resolving gel, was more basic (pH 8.8), and has a
higher polyacrylamide content (in our case, 12%), which causes the gel to have narrower
channels or pores. The proteins were denatured in IX SDS (50mM Tris pH 6.8, 2% SDS,
10%o glycerol, 5% ME) followed by boiling for 5 min. One dimensional SDS gel
electrophoresis was performed at 200 V for 45 min in electrophoresis buffer containing
1% SDS, 25 mM Tris, 0.25 M glycine. AN62-StAR bands (-25.750 kDa) were
determined on the basis a molecular weight marker « Prestained SDS-PAGE Low Range
Standard» (Bio-Rad).
59
2.8 Staining of the SDS-PAGE
A commonly used stain for detecting proteins in polyacrylamide gels is
Coomassie blue (Towbin, et ah, 1979). Gel staining was done in staining solution (0.2%
Coomassie Blue R250 [Sigma-Aldrich Canada Ltd., Oakville, ON], 45% methanol and
10% glacial acetic acid) with moderate shaking (120 rpm). As a result, acidified methanol
precipitates the proteins and the agitation circulates the dye, facilitating penetration, and
helps ensure uniformity of staining. The gel was distained in decolorant solution (15%
ethanol, 5% glacial acetic acid) for lh at 25°C with gentle shaking.
2.9 Evaluation of the Steroidogenic Activity of N-62 StAR in the presence
of Isolated Mitochondria
As previously mentioned, StAR lacking mitochondrial targeting sequence
displays the same activity as wild type protein. To evaluate the steroidogenic activity of
our recombinant proteins, an in vitro assay was performed by incubating isolated
steroidogenic mitochondria and the purified recombinant N-62 StAR following by
measurement of pregnenolone produced per assay.
2.9.1 Mitochondria purification
Mitochondria were isolated from both MA-10 and Y-l cells similar to protocols
that have been described elsewhere (Della-Cioppa, et ah, 1986; Krueger and
Papadopoulos, 1990). Cells were grown in T75 Tissue Culture Flasks (SARSTEDT) until
~90% confluence was reached. The medium was then removed and cells were washed
with PBS (5 ml), scraped from the flasks and centrifuged at 4°C at 1000 rpm for 10 min.
60
Cells were resuspended in the same buffer and pelleted as before and homogenized in a
cold isotonic buffer containing 250 mM sucrose, 10 mM Tris, pH7.4, 1 mM EDTA, 1
mM Tris (2-carboxyethyl) phosphine hydrochloride (TCEP), 0.1 mM PMSF, a protease
inhibitor cocktail tablet (Roche, Germany), and 10 mg/ml bovine serum albumin (BSA)
with a tight fitting pestle in a Potter-Elvehjem homogenizer. Therefore, cells were
sheared between a close-fitting rotating plunger and the thick walls of a glass vessel,
providing a cell extract (homogenate) which contains large and small molecules from the
cytosol, such as enzymes, ribosomes and metabolites as well as all the membranebounded organelles. Homogenate was centrifuged at 2900 rpm for 10 min and the
recovered supernatant was spun again at 2900 rpm to isolate nuclei and cellular debris.
The combined supernatant layers were retrieved and centrifuged at 9600 rpm for 10 min
to pellet mitochondria and the resulting pellets were resuspended in homogenizing buffer
and were spun at 9600 rpm for an additional 10 min to yield an enriched mitochondrial
fraction. Mitochondrial pellets were resuspended in homogenization buffer containing
lmg/ml BSA and were used directly or stored at -80°C (Dickinson, et al, 1970;
Fleischer, 1979).
2.10 The steroidogenic in vitro assay
Isolated mitochondria and purified StAR were subjected to an in vitro assay
system (Arakane et al, 1998) with a modified incubation buffer. Purified N-62 StAR was
incubated at a concentration of 10 uM in 125 mM KC1, 5 mM MgCl2 , 10 mM KH 2 P0 4 ,
25 mM HEPES, 1 uM 3p-hydroxysteroid dehydrogenase inhibitor epostane, 100 uM
GTP, 10 mM isocitrate, 5 mM sodium succinate, 200 uM cholesterol in 40 ul incubation
reaction. Most efficient concentration for mitochondria was determined from titration
61
curves to be 1 ug protein per 1 ul of assay reaction (Figure 14). Incubations were carried
out at 37°C and pH 7.4 for 90 min. As for the controls, 22R-hydroxycholesterol was used
as a positive and mitochondria incubated with cholesterol were served as the negative
controls. Some assays were performed in the absence of exogenous cholesterol. After 90
min, reactions were terminated by flash-freezing in liquid nitrogen, centrifuged at 15000
rpm for 10 min and the supernatants were recovered. The amount of pregnenolone
produced per assay was quantitated by radioimmunoassay (RIA).
62
10
15
20
25
30
Mitochondrial proteins (ng)
Figure 14. Determination of the optimal mitochondrial quantity
A 10 uM of the purified N-62 StAR was incubated with different mitochondrial
quantities. Data are expressed as the pregnenolone produced per assay, relative to the
respective mitochondrial concentrations. The most efficient and cost effective amount of
mitochondria was determined as 1 |ig per 1 ul assay.
63
2.11 Radioimmunoassay (RIA)
A highly sensitive and specific assay method that uses the competition between
radiolabeled and unlabeled substances in an antigen-antibody reaction to determine the
concentration of the unlabeled substance; it can be used to determine antibody
concentrations or to determine the concentration of any substance against which specific
antibody can be produced. In (RIA), a fixed concentration of labeled tracer antigen is
incubated with a constant amount of antiserum such that the concentration of antigen
binding sites on the antibody is limiting. If unlabeled antigen is added to this system,
there is competition between labeled tracer and unlabeled (cold) antigen for the limited
and constant number of binding sites on the antibody, and thus the amount of tracer
bound to antibody will decrease as the concentration of unlabeled antigen increases
(Figure 14). This can be measured after separating antibody-bound from free tracer and
counting either the bound fraction, the free fraction or both. A calibration or standard
curve is set up with increasing amounts of known antigen, and from this curve the
amount of antigen in the unknown samples can be calculate. Thus, the four basic
necessities for a radioimmunoassay system are an antiserum to the compound to be
measured, the availability of a radioactively labeled form of the compound, a method
whereby antibody-bound tracer can be separated from unbound tracer, and a standard
unlabeled material.
2.11.1 Descriptions of radiolabled pregnenolone and anti-pregnenolone
[ H]Pregnenolone was used as radioactive labeled antigen tracer in our lab. It
emits a very low energy beta particle. This particle only travels about 1/2 centimeter in
64
air. So, we count these low-energy beta particles using a liquid scintillation counter. The
3
H sample was suspended in a cocktail which absorbs beta energy and produces flashes
of blue light (approximately 1 - 3 flashes per keV for H ). This blue light was detected
and measured by photomultiplier as 'counts per minute' (CPM's), in a Beckman LS8000
CE Scintillation Counter (Beckman Coulter). Anti-Pregnenolone was purchased from MP
Biomedicals, LLC, and used as [1/115 x 10"6] per 500 ml of each RIA assay tube.
2.11.2 Assay conditions
Table II summarizes the preparation of standard and unknown samples.
Disposable glass tubes, 12 x 75 mm, were used. Standards were prepared by incubating
constant amounts of Ab with serial dilutions of 'cold' pregnenolone, in a buffer
containing 0.1 M PBS (50 mM NaT^PCUHaO, 70 mM Na 2 HP04, 150 mM Nacl, 15 mM
NaN30.1% gelatin) plus constant quantity of H-pregnenolone (6000 cpm/tube). As for
the unknown (recovered pregnenolone from in vitro assay), samples were diluted 1/50
and 10 (j.1 was added to assay buffers. All tubes were incubated at 4°C for 24 hours.
2.11.3 Separation and measurement of bound pregnenolone
Bound samples were separated with dextran-coated charcoal procedure of Herbert
et al (Herbert, et al, 1965). Briefly, a five percent suspension of neutral charcoal was
prepared in PBS and a 1% solution of Dextran T70 (Uppsala, Sweden) was prepared with
the same buffer. Equal volumes of the charcoal suspension and dextran solution were
mixed overnight at 4°C. Next morning, aliquots of 200 ul from this mixture were added
to RIA samples in a total volume of 700 ml. Samples were shaked for 20sec and
incubated at 4°C for 20 min, followed by centrifugation at 3000 rpm for 15 min at 4°C.
65
Supematants were transferred into scintillation vials containing 10ml scintillation fluid
and radioactivity of the samples were measured with a Beckman LS8000 CE Scintillation
Counter (Beckman Coulter). Backgrounds were subtracted from the total counts.
Eventually, pregnenolone was quantitated using standard curve and data were expressed
as ng pregnenolone produced per |j,g of mitochondrial proteins.
66
Figure 15. Illustration of the Radioimmunoassay
(A) Unlabeled pregnenolone is present.
Labeled pregnenolone ( H-pre) was incubated with a quantity of pregnenolone antibody
(AB) so that, at equilibrium, 50% of the labeled insulin was bound to the antibody and
50% was free.
(B) Unlabeled or 'cold' pregnenolone is present
Unlabeled pregnenolone competed with 3H-pre for the limited amount of antibody. At
equilibrium, the amount of H-pre bound to antibody was inversely proportional to the
amount of cold pregnenolone in the system.
4
+
4
4
3
H
B
m
"P
4Bt 4
=
+
4
50% 3H-pre
BOUND
re
^
4
4 4 « B 44
4<
44
^
3
H-pre
^
Pre
25%.3H-pre
BOUND
68
Unlabeled Pregnenolone
Standard ng / 0.5 ml
in Buffer
0.000
0.0125
0.05
0.1
0.25
0.5
1
Total count
Background
Maximum binding tubes (Bo)
Unknown sample
No. of APAa
Tubes 1:16,000
3
3
3
3
3
3
3
3
3
3
3
3
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
0.1
—
—
0.1
0.1
H-pregnenolone
60000 cpm / 1 ml
l
Anti-Pregnenolone Antiserum
Table 2.Tube contents for Assay of Standard and Unknown samples
Serial standard dilutions with the increasing amounts of pregnenolone (ng), ranging from
zero to one ng pregnenolone were used as calibrators. Total counts are tubes that represent
the total amount of radioactivity added in an RIA tube. These tubes were not subjected to
separation step. Backgrounds (nonspecific binding tubes) are tubes that contain labeled
antigen and assay buffer, but not any antibody. B0, 100%, or Maximum binding tubes are
tubes that contain labeled antigen, antibody and assay buffer but do not have any unlabeled
antigen such as unknown samples or standards (except zero standard). After separating the
free from the bound fraction, these tubes will have the highest CPM's, other than the total
count tubes. Therefore, all samples, except total counts and background tubes, contained
100 ul 3H-pregnenolone and 100 |il Ab in a totall volume of 700 (il. Numbers represent the
volumes in ml.
69
1.2
•0.0592
y = 2.7241 e
c
a>
c
o
0.8
o 0.6
c
a>
S.0.4
O.
0.2
0 0.0
20.0
40.0
60.0
80.0
100.0
Binding of Ag-Ab(%)
Figure 16. Radiodilution curve obtained by charcoal immunoassay
The bound to free ratio of
H-pregnenolone is plotted against the added cold
pregnenolone. From the binding amount of Ab to 3H-pregnenolone, the quantity of
displaced pregnenolone could be directly measured, (direction of the arrow).
70
2.12 StAR Radiolabled Cholesterol-Binding Assay
Binding assays on purified N-62 StAR were performed using [3H] cholesterol as
radioligand (Sigma-Aldrich). A 2.5 (ag/ml purified protein was incubated with 0.25 pmol
[3H]cholesterol in the presence or absence of 5 uM cold cholesterol for 45 min in 50 ul
PBS (100 mM NaH2P04, 50 mM Na 2 HP0 4 , 150 mM Nacl ) at the indicated pHs. After
the incubation time the total volume was increased to 500 ul with 0.1 M PBS buffer
containing 0.1% gelatin (Murphy and Marvin, 1974). To examine the stability of binding
under condition of varying pH, incubations were initiated in 10 mM PBS (pH 7.4) and
after the equilibrium time were diluted 1:20 in buffer containing 150 mM NaCl, 100 mM
PBS and 0.3% gelatin at pH 3.5 for maintaining the ionic strength, stability of the
StAR/Cholesterol complex and acidic pH. To examine the effect of dilution on StARcholesterol dissociation, some binding experiments were performed directly in the total
volume of the standard buffer. Bound and free cholesterol were separated using RIA
(Herbert et al, 1965). Prior to centrifugation of the RIA mixture, 0.01% triton X-100 was
added to reduce binding of StAR to the spin tubes or local aggregations. Radioactivity of
the bound [3H]cholesterol were measured with a Beckman LS8000 CE Scintillation
Counter (Beckman Coulter). Backgrounds were subtracted from the total counts and data
were analyzed using the program SigmaPlot.
2.13 Structural characterization of AN62 StAR
In order to evaluate the structural origins of the pH modulation of cholesterol
binding and to characterize the presence of a stable folded protein the overall secon the
71
prethe Far-UV CD spectra of StAR were recorded at pH 7.4 and 3.5 in the absence of
cholesterol.
2.13.1 Determination of the secondary structure of proteins by Circular
Dichroism
Circular dichroism (CD) is a powerful tool for determining several features of
protein secondary structure in solution. It is defined as the difference between absorption
of left or right handed circularly polarized light, measured as a function of wavelength.
Chiral or asymmetric molecules produce a CD spectrum because they absorb left and
right handed polarized light to different extents and thus are considered to be "optically
active" molecules.
One of the most successful applications of the CD, the structural characrerization
of proteins, depends upon the remarkable sensitivity of the far-UV CD (180 to 250nm) to
the backbone conformation of proteins which reflects the secondary structure content of
the proteins. In fact, different types of protein secondary structures (helices, sheets, turns
and coils) give rise to different CD spectra. Because the spectrum of a protein is directly
related to its secondary structure content, the spectrum will be a linear combination of
each of these "reference" spectra, weighted by the fraction of the type of secondary
structure (Figure 17).
72
Figure 17._Circular dichroism spectra of "pure" secondary structures
(A) Circular dichroism is the difference in absorption of left and right circularly
polarized light by an asymmetric or chiral molecule.
(B) In proteins the amide chromophore absorbs in the 'far-UV region (160-240
nm) and chirality arises from the asymmetry of secondary structure where the peptide
bonds are formed.
(C) In a folded protein the amide is in a continuous array. For example, the FarUV CD spectra of poly-L-lysine in an a-helix, p-sheet, and unordered (random coil)
differ due to long-range order in the amide chromophore.Contributions of the different
secondary structural content of proteins in CD spectra are as follow: random coils (RCs)
produce a positive peak at 212 nm (TC—>7t*) and a negative one at 196nm
(n—> 7t*); (3-sheets give two peaks of negative at 216 nm (n—>n*) and positive at 196 nm
(n—• TC*); in a-helix, exciton coupling of the (n—»7T*) transitions lead to a positive peak
(TC—* 7i*)Perpendicuiar at 192 and a negative (7t—>7T*)Paraiiei at 208 nm and a red shifted
(n—> 7t*) at 222nm. Parentheses represent transitions (Greenfield and Fasman, 1969).
73
208
216
222
250
Wavelength (nm)
74
2.13.2 Far-UV spectra of the AN62 StAR
Circular dichroism (CD) measurements were carried out on a JASCO J-810
spectropolarimeter, equipped with a Peletier-type temperature controller, and a
thermostated cell holder with a thermostatic bath. Spectra were recorded in 0.1-cm path
length quartz cells at a protein concentration of 1.55 mg/ml (6 uM) in 25 mM phosphate
buffer at pH values of 7.4 and 3.5 at 25°C. Cholesterol-induced changes in the secondary
structure were evaluated with monitoring the spectra in different time intervals within 90
min of cholesterol addition. Five consecutive scans in the far-UV (190-250) were
accumulated and the average spectra were stored.
2.13.3 Thermal unfolding studies
One important application of CD is to determine the protein's secondary and
tertiary structure stability as a function of temperature. Thermal denaturation curves were
determined for the StAR in the absence or presence of cholesterol at two pH values of 3.5
and 7.4 by monitoring the CD values at 222 nm, with increasing temperature from 5 to
90°C. In the experiments including cholesterol, StAR was preincubated for 45 min with
the substrate .The temperature induced denaturation curves monitored by CD were
acquired as described elsewhere (Lavigne, et ah, 1995). The temperature dependence of
mean residue ellipticity (0) at 222nm was fitted, using an in-house non-linear least square
fitting program. Midpoint of thermal unfolding curves, Tm, and thermodynamic
parameters were determined according to the method of Lavigne et al. (Lavigne, et ah,
1998).
75
Data analysis
In thermal unfolding experiments, the thermodynamic properties of StAR were
calculated assuming a two-state unfolding mechanism, TV (native) *ss U (unfolded) (Pace,
1986; Privalov, 1979), in which Pp + Pu = 1, where PF and Pu represent the fraction of
protein in the folded and unfolded states, respectively, with a negligible intermediate (I)
state. The observed value of 6 at any point is 6 - 6?P¥ + 6\jPv, where #F and 6\j are the
values of 6 in the folded and unfolded states, respectively. The Tm of each temperature
induced denaturation curve was determined by fitting the temperature dependence of
molar ellipticity (6) using an in-house non-linear least-squares program to fit the pre- and
post-transition baselines, according to the following equation:
0(7) = (1-PU(7))-0N(7)+PU(7>0 u(7)
(Eq. 1)
where ®N(7) and 0u(7) were the observed temperature-dependent molar ellipticities for
the native and unfolded states, respectively, assuming following linear equations:
0 N (7) = ©N(0) - d0N(7)/dP- T
(Eq. 2)
0u(7) = 0u(O) - d®v(T)/dT-T
(Eq. 3)
where ©N(0) and ©u(0) are the mean residue ellipticities at 0°C for the folded and
unfolded states, respectively; likewise d&^(T)/dT and d®u(T)/dT are the constant slopes
of ©N(P) and &\j(T).Pu(T), the population of the unfolded state, is given by:
p (T) = exp(-AG°»//tr)
wV
' \ + exp(-AG°u/RT)
(E
4)
76
The apparent equilibrium constant of unfolding {K^appj) and the corresponding free
energy change (AG u) at temperature, T can be calculated using Equations 5 and 6
AGU°= RTlnKu
(Eq.5)
(Ku) = Pu/(\-Pu)
(Eq.6)
where R is the gas constant, T is the absolute temperature. The change in enthalpy (AHU)
and entropy (ASU) accompanying unfolding at T are related to AGU by Equation 6
AGU° = RTlnKu = AHU - TASU
(Eq. 7)
The temperature dependence of AHU and AS*U assuming that the heat capacity change
(ACP;U) between the native (N) and unfolded (U) state of the system is relatively
independent of the temperature in the range of measurements (Freire, 1995; Privalov and
Makhatadze, 1990), are as shown in Equations 5 and 6:
o
AHU=AHU + ACP(T-Tm)
(Eq. 8)
ASU = ASU + ACpln(T/Tm)
(Eq. 9)
o
where AHa and ASU are the enthalpy and entropy changes respectively at the midpoint
transition, /. e. when T = T°. Therefore, at T°, AGU = 0 according to Equation 9
AGU(T) = AH°(l - 1 U AC P , U (T-T°)-Th(^\
^
A 0
^ >
where 7° is the melting temperature, AHU° is the apparent enthalpy of unfolding at T and
AC PJU
is the temperature-independent heat capacity of unfolding.
77
The van't Hoff plot ln{K.T(app)) against \IT was linearly fitted to Equation 11
2.13.4 Determination of stoichiometry and binding affinity of the StARcholesterol complex
In this section, a procedure is described for determining the stoichiometry and
dissociation constant (Ku) of cholesterol binding to StAR-START using circular
dichroism. To determine the StAR binding affinity for cholesterol at 25 C, titration of the
protein with cholesterol was monitored with a Jasco J-810 spectropolarimeter (Japan
Spectroscopic Co., Tokyo, Japan). The 3.6-ul aliquots from N-N62 StAR protein stock
solution (12.9 mg/ml in 25 mM phosphate buffer and 125 mM NaCI) were diluted to
300ul of 25 mM phosphate buffer, pH 7.4 or 3.5. For the stoichiometric and affinity
analysis, titration was carried out using the increasing amounts of cholesterol from 0 to
200% relative to the total protein concentration (6 uM). After at least 45min equilibrium
time, samples were loaded into quartz cells with a path-length of 1.0 mm. Wavelength
spectra were recorded at 25 C from 195 nm to 250nm by averaging five scans at 0.1 min
intervals. The values are shown as mean residue molar ellipticity (mdegcm dmol ). The
CD values were also recorded at 222 nm as a time course experiment. Time points were
accumulated over three scans of 30 seconds for each sample and the average between the
3 scans is reported. Apparent Ku was obtained by fitting the following equation (Naud, et
al, 2005):
78
P
(M)+C(M)
ACD222 =
ACD222MAX»
+
P
KA)
(M)
+C
{M)
+"
KA
"(4«(/|M)»C{J
(Eq. 12)
2»C,(M)
Where P(M) = total protein concentration in M, QM) = total cholesterol concentration in M
and KB(1/KA)
is the dissociation constant (Jean-Francois, et al, 2003). The binding curves
were simulated using Kaliedagraph (Synergy Software, Reading PA).
All titration experiment were repeated three to five times and the mean CD signal changes
were plotted against the concentration of total cholesterol in solution.
The a-helical contents of the AN62 StAR were also calculated from titration
experiments using the method of Alder et al (Adler, et al, 1973) and Zagrovic et al
(Zagrovic, et al, 2005), which was based on far-UV data at 208 and 222 nm at 37°C.
79
3. RESULTS (Part I: In vitro activity of the recombinant N-62 StAR)
3.1 Expression and purification of functional tagged StAR and evaluation of
steroidogenic activity
Recombinant human StAR with a 6His tag at both NH2- and C-terminal were
expressed in bacteria and purified using the 6His.Bind metal chelation resin to nearly
homogeneity. The purity of the purified protein was determined by Coomassie Brilliant
Blue staining (Figure 18). Previous studies showed that addition of His tag to the either
NH2- or C-terminal of the StAR protein does not affect its steroidogenic activity
(Arakam etal., 1998).
To test the steroidogenic activity of the bacterially expressed AN62-StAR we
performed an in vitro assay using mitochondria isolated from steroidogenicY-l and
Leydig MA-10 cells, purified recombinant StAR and measured the production of
pregnenolone from the endogenous cholesterol presented in the mitochondrial outer
membrane or free cholesterol exogenously added to the assay. This in vitro system was
similar to those which have been already described elsewhere (Arakane et al, 1998; Bose
et al, 2000b). The system was first validated by testing 22(R)hydroxycholesterol, a
cholesterol analog displaying a direct passage through mitochondrial membrane, resulted
in 40-fold increase of the pregnenolone production over control (Figure 19).
80
Figure 18. Purification of recombinant human N-62 StAR protein
SDS polyacrylamide gel. Lane 1, total extraction after induction with IPTG ; lane 2 and
3 are the material eluted from Ni-NTA column. Lane 2, flow through of total protein;
lane 3, after elution with 300mM imidazole, and lane 4 represents molecular weight
marker. The symbols n and c signify the position of 6His.tag in NH2- or C-terminal of the
N-62 StAR, respectively.
81
• Y-1
3.5 n
• MA-10
3
2.5
c
o 1.5
c
c
O)
<u
1
0.5
Mitochondria
Mitochondria +Ch
Mitochondria +22R-(OH)
Figure 19. Validation of the performed in vitro steroidogenesis system.
A luM of 22-(R)-hydroxycholesterol was incubated with 50ug mitochondria for 90 min.
Results are expressed as the pregnenolone produced per each assay. Two other controls
are mitochondria, with or without cholesterol. Addition of this soluble oxysterol increases
the pregnenolone formation up to 40-fold.
82
As shown in Figure 20, both C- and N-6His-tag StAR recombinants stimulated
the pregnenolone production. In four separate experiments, 10 uM C- and N-His-tag
StAR increase the production of pregnenolone in Y-l mitochondria to 6.86 ± 0.81- and
7.35 ± 0.55-fold (mean ± S.E.), respectively, over that of the controls. Correspondingly,
the level of pregnenolone production increased up to 14.36 ± 0.94 and 15.86- ± 0.78-fold
(mean ± S.E.) in MA-10 mitochondria. In the absence of exogenous cholesterol Y-l
mitochondria display 6.57 ± 0.44- and 5.76 ± 0.66-fold decrease of pregnenolone when
incubated with the C-and N-terminally tagged proteins, respectively. In the same way,
5.85 ± 0.35- and 7.23 ± 0.52-fold diminution in pregnenolone production is observed in
MA-10 mitochondria, indicating that the presence of exogenous sources of cholesterol is
necessary for StAR activity and for promoting pregnenolone production.
As depicted in Figure 20, the steroidogenic activity of refolded proteins is higher
than that of the controls; 2.87 ± 0.78- and 3.43 ± 0.66-fold increase of pregnenolone
production in Y-l and MA-10 mitochondria, respectively, but lower than that of the
native proteins. This could be due to lower activity of those proteins that had not been
properly recovered from refolding purification. Nevertheless, new methods of protein
recovery from inclusion bodies, including denaturing/refolding, have been developed in
our laboratory (Barbar et al., unpublished results), which have enabled us to produce high
quantities of soluble StAR protein with full steroidogenic activity.
In the absence of exogenous cholesterol, synthesis of pregnenolone decreased near
to the control levels (Figure 20). This is normal, because pregnenolone production in
isolated steroidogenic mitochondria is ultimately limited by the pools of available
cholesterol in the outer mitochondrial membrane. Given that precence of exogenous
83
cholesterol is essential for steroidogenesis, in the next section we would determine the
binding properties of StAR to free cholesterol.
84
BY-1
• MMO
2.50 n
^rifirt I
22(R)-ch
Mito
R-StAR
+ Mito
C-StAR
+ Mito
N-StAR
+
Mito
R-StAR
+ mito
+
ch
C-StAR
+ mito
+Ch
N-StAR
+mito
+ch
Figure 20. Steroidogenic capacity of the N- and C-terminaly 6His- tagged N-62 StAR
The steroidogenic activities of native and refolded N-62 StAR is assessed by its capacity
to promote cholesterol transfer into mitochondria isolated from mouse Leydig MA-10
(black columns) or Y-l (grey columns) cells. A 10 uM protein was added to
mitochondria (lug/ul) preincubated with 200 uM cholesterol, incubated for 90 min at pH
7.4, 37°C, and pregnenolone produced from exogenous and endogenous mitochondrial
cholesterol were measured by immunoassay. The added StAR proteins are indicated; N
and C represent the location of His6. Data are expressed as the mean pregnenolone
produced per microgram of mitochondria (ng/ug protein) from three experiments
85
3.2 Binding of StAR to cholesterol is best characterized at physiological pH
The N-62-6His.StAR contains 31 acidic amino acids (Asp and Glu) and 28 basic
amino acids (Lys, Arg, His). In addition to the involvement of these pH sensitive amino
acids in maintaining the tertiary structure of StAR protein, presumably, they also
participate in formation of a salt bridge, which plays an important role in binding of StAR
to cholesterol (Mathieu et ah, 2002a). However, according to Miller et ah (Bose et ah,
1999), the acidic pH near the OMM leads StAR to adopt a molten globule state. In this
context, we have examined the in vitro effect of pH on the ability of N-62 StAR to bind
cholesterol. In this assay, [ H]-cholesterol is added to N-62 StAR and the bound
radioactivity is separated from the free radioactivity after incubation as described in
materials and method. In Figure 21, we report the amount of bound radioactivity as a
function of pH. As seen, there is a dramatic reduction of cholesterol binding starting from
pH 6.5. Furthermore, the binding capacity was decreased to only 10% at pH 2.5. This
indicates that physiological pH is required for maximal binding of StAR to the
cholesterol.
To
determine
extent
of
the
binding
specificity
of
cholesterol
to
StAR,
competitive/displacement binding assays were performed with unlabeled cholesterol as
competitor(Figure 22). Addition of unlabeled cholesterol to StAR/[ Hjcholesterol
complex resulted in a 0.136 ± 0.035 pmol displacement (p<0.005) equal to >50% of the
total amount of bound [3H]cholesterol. This is indicative of the specificity of binding.
However, only a non-significant displacement 0.036 ± 0.004 pmol of [3H]cholesterol at
pH 3.5 clearly indicates the absence of specific binding at this pH.
86
9000 Q
8000 ¥
E
7000
•o
6000
a.
o
c
3
o
QQ 5000
O
fl)4000
M
a> 3000
o
£
•»!»
o
X
2000
1000 A
7.5
*
»
i
*
pH vs StAR-Ch binding (cpm)
— • • — pH vs control
• • • O • • • pH vs StAR-Ch binding (relative percentage)
6.5
5.5
4.5
3.5
2.5
Binding pH
Figure 21. Measurement of StAR binding to cholesterol across a broad pH range
Purified N-62 StAR proteins (25ug/ml) were incubated with 1 pmol [3H]cholesterol in
phosphate buffers , spanning the range from pH 2.5 to 7.5. Data are expressed as the
mean cholesterol binding (cpm, left Y-axis) relative to the respective control values from
three independent experiments. Right Y-axis represents the corresponding percentage of
cholesterol binding at different pH. Solid line (filled circles) and dotted line (empty
circles) represent the binding in terms of cpm and relative percentage, respectively.
Dashed line (filled circles) corresponds to the binding capacity of BSA in the same
experiment.
87
9 0 0 0 -i
8000 H
(Ul
7000 -
Q.
O
6000 -
•D
C
3
O
5000 -
m
1
4000 -
(A
0)
O
3000 -
+J
£
o
X
2000 -
e>
1000 0 -L
StAR
Ch*
Ch
+
+
+
+
+
pH 7.4
+
+
+
+
+
+
+
+
+
pH 3.5
Figure 22. Competitive binding of cholesterol at different pH values
Purified N-62 StAR (2.5ug/ml) was incubated with [3H]cholesterol in PBS (pH 7.4 or
3.5) at 25°C. For the radioligand binding measurement, aliquots were removed at the
time indicated and centrifuged to separate free and bound cholesterol, and bound counts
were measured. Binding after pre-incubation for 45 min at pH 7.4 and 3.5 was 0.132 ±
0.015 pmol and 0.036 ± 0.004 pmol of [3H]cholesterol, respectively.(p = 0.03 in a twotailed, paired t test).
88
3.3 pH-induced cholesterol dissociation
The results of preceding section indicated that lowering of the pH resulted in a
decrease in binding capacity of StAR to cholesterol. The question we then addressed was
whether the microenvironmental pH change would result in an alteration in binding
specificity of StAR to cholesterol. For that reason, in a complementary set of
experiments, we studied the impact of a pH transition on the binding of StAR to
cholesterol. N-62 StAR was preincubated with radiolabeled cholesterol at pH 7.4,
followed by a dilution to a lower pH. Interestingly, decrease of pH resulted in a
significant dissociation of cholesterol at lower pH (Figure 23). This behavior is onset at
pH 5.5 (88% ± 3.29% binding) and reaches a minimum at pH 2.5 (13% ± 1.4% binding),
which is in agreement with the minimal binding observed when StAR is directly
incubated with cholesterol at pH 2.5 (Figure 23). Furthermore, the loss of binding was
found to be irreversible. For instance, samples diluted from the pH 3.5 to 7.4 did not
recover their binding capacity (Figure 24).
Based on these results and regarding the theory of molten globule proposing an
active conformation for StAR protein in the acidic pH, namely 3.5 (Bose et al, 1999), we
elected pH 7.4 and pH 3.5 as the two extreme pH values where StAR exhibits maximal
and minimal binding, as well as minimal and near-maximal dissociation, respectively.
Those two pH values will be the focus of the rest of this study.
It has been known that START-domain-containing
proteins completely
sequestrate their ligands from solutions (Im, et al, 2005). In the bound conformation of
StAR the sterol ligand within the complex is inaccessible from the outside (Murcia, et al.,
2006), indicative of a well folded protein-ligand complex. This is in agreement with our
89
finding that after dilution, complexes remained stable at neutral pH while a drastic
dissociation at acidic pH occurred (Figure 24), presumably, due to collapse of tertiary
structure of protein as a general consequence of acidification (Morar, et al, 2001). The
biochemical mechanisms involved in ligand uncoupling are not completely understood,
but clearly involved a significant reduction in affinity of the StAR for cholesterol as a
consequence of the pH decreases.
90
9000 C
r 100
"•'••••.~ft
"-"--^T
-75
'""•a.
6000 -
5000 -
X
'f>
- 33
4000 I 14
3000 -
Percentage Bound (%)
7000 -
2000 -
2
J
H-Cholesterol Bound (cpm)
-88
¥•••...
8000 «
1000 -
n 75
^
— •
— • —
• ••<>•••
pH vs StAR-Ch binding (cpm)
pH vs control
pH vs StAR-Ch binding (relative percentage)
i
6.5
5.5
4.5
3.5
2.5
Dissociation pH
Figure 23. Measurement of cholesterol dissociation from StAR across a broad pH
range
Purified N-62-StAR proteins (25^g/ml) were incubated with 1 pmol [ H]cholesterol in
phosphate buffer at pH 7.4 and 25°C. After 45 min samples were diluted 1/20 at the same
buffers containing 0.3% gelatin with decreasing pH range from 7.4 to 3.5. Data are
expressed on the left axis as the mean cholesterol binding (cpm) relative to the respective
control values from three independent experiments. Right Y axis represents the
corresponding data as the percentage binding between cholesterol and StAR, assuming a
maximum (100%) binding at pH 7.4. Solid line (filled circles) and dotted line (empty
circles) represent the binding in terms of cpm and relative percentage, respectively.
Dashed line (filled circles) corresponds to the binding capacity of BSA in the same
experiment.
91
10000
•p-
8000
3
O
6000
m
<u
"S>
4000 -
2000
7.4->7.4
7.4->3.5
3.5->3.5
3.5->7.4
Figure 24. Irreversible dissociation of cholesterol from StAR at acidic pH
[3H] cholesterol was allowed to bind to N62-StAR under the standard buffer conditions
and after 45 min incubation, the pH was lowered to 3.5. samples were diluted 1:20 into
lOOmM PBS, pH 3.5 (filled columns) and were incubated for an additional 45 min.
Binding after acidification of the samples pre-incubated at pH 7.4 and 3.5 (marked within
parentheses) was 0.076 ± 0.005 pool of [3H]cholesterol and 0.041 ± 0.004 pool
[ H]cholesterol, respectively (p<0.05 in a two-tailed, paired t test; all data represent mean
± S.E., n=3). Notably, dilution from pH 7.4 to the same buffer, contained 0.3% gelatin),
did not have a significant effect on binding. By contrast, more than 50% dissociation was
recorded after acidification.
92
4. RESULTS (Part II: Structural characterization of the StAR in complex
with cholesterol)
4.1 Circular dichroism spectroscopy of StAR at different pH
In order to evaluate the structural origins of the pH modulation of cholesterol
binding, the Far-UV CD spectra of N-62 StAR were recorded at pH 7.4 and 3.5 in the
absence of cholesterol. The CD spectrum of N-62 StAR recorded at pH 7.4 is shown in
Figure 25 (empty circles). The spectrum depicts shallow double minima at 208 and
222nm and a maximum at -193 nm as expected for proteins composed of a-helical and Psheet secondary structures. In accordance with this result and based on the molecular
model of N-62 StAR (Mathieu et al, 2002a; Murcia et al, 2006), the secondary structure
content can be estimated to -35% a-helices and -43% p-strands. In contrast, the Far-UV
CD spectra of N-62 StAR recorded at pH 3.5 (Figure 25. filled circles) shows a slight
blue-shift of the 208 nm minimum coupled to a decrease in the intensity of the maximum
at 193 nm. This is indicative of a significant random coil content. The double minima at
222 nm and at 218 nm representative of 21.1 ± 1.1% and 24.0 ± 1.3% helical structure,
respectively, are of the same magnitude as at pH 7.4 (20.7 ± 0.8% and 22.8 ± 0.9%
helicity at 222nm and 208nm, respectively), suggesting a similar content in P-sheet and
a-helix at pH 3.5. However and as suggested by others (Baker, et al, 2005), under acidic
pH StAR exists as a molten globule, which by definition retains native secondary
structure but lacks a defined tertiary structure.
93
190
200
210
220
230
240
250
Wavelenght (nm)
Figure 25. Effect of pH on protein conformation
Unsmoothed far-UV CD spectra of N-62 StAR protein, recorded between 190 and 250 nm
and equilibrated at the pH 7.4 (empty circles) and pH 3.5 (filled circles). CD intensity is
expressed in terms of molar ellipticity ([0], expressed in degrees cm2mol~1) according to
the following equation,
© = (©'observed * molecular mass) I (10 x / X c)
where 0O\,S is the observed ellipticity in millidegrees, / is the cell path length in cm; and C
is the molar concentration of the protein.
94
4.2 Cholesterol-induced conformational changes of StAR
In the last section it was shown that interaction with cholesterol modulated the
secondary structure content (mostly the helical structure) of the StAR protein. To study
these structural changes in more details we proceeded with a time course experiment by
CD. Figure 26 shows the CD spectra of StAR recorded in the presence of an equimolar
concentration of cholesterol. Addition of cholesterol at pH 7.4 resulted in a transient
decrease in the CD signal at both 222nm and 208nm, followed by increase in helicity that
reaches an equilibrium plateau value within 45 to 90 min. As for the acidic pH (Figure
27), addition of cholesterol showed only a minor decrease (2.1 ± 0.4)% in the proportion
of secondary structure (helix plus sheet). Furthermore, contrary to the physiological pH,
exposure of StAR to cholesterol did not cause any significant increase in the observed
ellipticity at the acidic pH (Figure 27), except for a slight increase at 208 nm after the
approximate equilibrium time. The results summarized in terms of percentage helicity in
Table 3, clearly show a direct effect of cholesterol on loss and gain of the helical
structure of StAR in a time-dependent fashion at physiological pH. Supporting evidence
for helical changes upon cholesterol binding to StAR is a sharp isodichroic point near 203
nm (Lu, et ah, 1991) in the interception of CD spectra of StAR/cholesterol complex,
taken from different time intervals.
95
Figure 26. Effect of cholesterol binding on circular dichroic spectra of N-62 StAR
protein at neutral pH
Circular dichroic spectra of StAR (8uM) in the absence (Blue) and in the presence of
cholesterol (8 uM) were obtained as described under experimental procedures. Spectra
were taken at different time intervals from 0 to 90 min; Four spectra were selected and
shown:
To= Before addition of cholesterol.
Ti = Immediately after addition of cholesterol.
T2 = 45 min after addition of cholesterol.
T3 = 90 min after addition of cholesterol.
An isodichroic point (black arrow) occurs at 204 nm, indicating that cholesterol
induces mainly coil to helix transition at both 222nm and 208 nm (Defossez, et al,
1997).
96
30 n
190
200
210
220
230
240
250
Wavelength (nm)
97
30 -i
1 min (T.,)
20 H
0 min (T0)
45 min (T2)
10
60 min (T3)
•D
X
.5]
-10
-20
190
200
210
220
230
240
250
Wavelength (nm)
Figure 27 Effect of cholesterol binding on circular dichroic spectra of N-62 StAR
protein at acidic pH
A 8uM cholesterol was added to the protein preincubated at pH 3.5, and spectra were
recorded as for the neutral pH. All assays were done in 25 mM phosphate buffer at 25°C.
98
Table 3. Comparison of the cholesterol-induced helical changes of N-62 StAR.
Assuming that only helical structures contribute to the CD spectra at 222 and 208 nm,
percentage helicity of the StAR was calculated using following approximations (Material
and methods):
1-
a-helix% [9]222
222 =
2.
a-hehx%[e] 208 =
[6] 222
———"
40,030
[9] 08 " 4000
— — 2^
33,000 - 4000
99
Cholesterol
%helicity (222nm)
(n—* 7i*)
(71^71*)
To
—
21.1 ± 1.1
24.0 ± 1.3
Ti
+
19.0 ± 0.7
22.8 ±1.2
T2
+
22.7 ± 1.0
25.1 ± 0.9
T3
+
22.6 ± 0.8
25.8 ±1.5
pH3.5
pH7.4
Cholesterol
%helicity (222nm)
%helicity (208nm)
%helicity(208nm)
To
—
20.7 ± 0.8
22.8 ± 0.9
Ti
+
14.9 ± 2.2
14.3 ±1.9
T2
+
28.7 ± 1.5
31.2 ± 1.1
T3
+
33.9 ± 2.3
40.8 ±2.1
4.3 Time dependent changes of secondary structure of N-62 StAR following
the addition of cholesterol
The CD technique was further used to assess the evolution of secondary structures
during the course of cholesterol binding, thereby monitoring cholesterol-induced helical
variations of N-62 StAR at 222nm. As illustrated in Figure 28, addition of cholesterol to
the protein favors the equilibrium of the population of StAR to the partially unfolded
state (Figure 28. state A). A recent paper reported the same conformational changes upon
binding of cholesterol to StAR-D4, a member of START domain proteins, with
approximately 25% sequence identity with StAR (Rodriguez-Agudo, et al, 2005).
However, through time-dependent transitions a substantial increase in [©I222, which
mainly represented the helical content of the protein, was recorded (Figure 28. state B).
This step is energetically active (Mathieu et al., 2002a) and involves the movement of a
pair of loops adjacent to the a-helix 4. The steady state (Figure 28. state C) is achieved
when preferential refolding of a-helix 4 further improves the conformational stability of
StAR/cholesterol complex. This suggests that cholesterol is completely sequestrated from
solvent and trapped in a maximally folded protein (Mathieu et al., 2002a).
101
-10
-11 -\
"o
E
3
-12
CM
E
u
d>
»
-13
-14
-15
-16
20
40
60
80
100
Time (min)
Figure 28. Schematic representation of cholesterol-induced helical changes in StAR
protein
Profile of the changes in ellipticity at 222nm as a function of time. (A) Addition of
cholesterol results in a transient decrease of [®]222nm- (B) Transition between partially
unfolded and steady state with significant gain of helicity. (C) Steady state.
102
4.4 Stoichiometry and dissociation constant of StAR/cholesterol complex
Cholesterol is insoluble in aqueous solutions, making equilibrium binding
analysis in solution impossible. To date no data have been reported on direct binding of
cholesterol to START domain proteins. In this study, it is shown that circular dichroism
can be successfully applied to determine binding characteristics of StAR-START like
stoichiometry and dissociation constant. Thus, the measurable conformational changes
observed upon cholesterol binding were recruited to develop a quantitative binding assay
based on cholesterol-induced modification of StAR's secondary structure, monitored by
CD at 222nm.
Titration of 6uM protein solution resulted in a stoichiometric binding behavior, as
almost every added cholesterol molecule was bound by one of the protein molecules . As
every single StAR molecule changed its conformation upon binding of cholesterol, the
CD signal [®222nm], which represented the peak of a-helix content, was increased (Figure
29). When a molar equivalent of 5.85 moles cholesterol per 6 moles protein had been
added, the CD signal did not change anymore (Figure 29. intercept of dashed lines). The
saturable binding at approximately unit stoichiometry suggested that binding occurred at
a specific site, and is not the result of nonspecific aggregation of protein and cholesterol.
This suggests that StAR-START has only one specific binding site for cholesterol. The
theoretically predicted saturation of 6.00 was not achieved, probably due to minor
inaccuracies in the determination of StAR and/or cholesterol concentrations.
Another parameter that defines the quality of protein-ligand interactions is the
dissociation constant Ko. The literature value of K^for the StAR/cholesterol complex has
been 32nM, in vitro (Petrescu, et ah, 2001). However, simulation of the saturation curve
103
(Figure 29) with best fit of saturation points into Equation 11 showed a Kv ~ 1 x 10"6 M,
which was more likely to happen in vivo due to the fast steroidogenic response to stimuli.
14 n
[Cholesterol] |xM
Figure 29. Circular dichroism-monitored cholesterol titration of the N-62 StAR
Titration of the AN62 StAR with cholesterol was carried out at a protein concentration of
6 uM. Saturation occured at Ctotai ch = 5.85 uM (dotted lines). The saturation curve
obtained by curve fitting was overlaid (solid line) and a corresponding ^ D ~ 1 x 10" M
was calculated using Equation 12. Dashed line perpendicular to the X-axis represents the
saturation point and error bars represent standard deviations from 4 different experiments.
105
4.5 Stability of the folded conformation of StAR
The folded conformation of proteins are only marginally stable under the best
of conditions and can often be disrupted by an environmental change, such as a rise in
temperature, variation of pH, increase in pressure, or the addition of a variety of
denaturants. Among these, pH variations may naturally occur in microenvironment of
human cells, i.e., acidic pH (3.5 - 4) near phospholipid head groups of lipid bilayers,
which suggested being necessary for the function of some proteins (Banuelos and Muga,
1995; Qi and Grabowski, 2001). In this regard, it was proposed that the acidic pH close to
the mitochondrial membrane was a driving force, which enabled StAR to bind and
transfer cholesterol in the course of a global conformational shift toward a molten globule
state. This was not, however, in agreement with the finding that StAR did not bind to
cholesterol at high acidic pH (section 3.2).
To further study the nature of StAR/cholesterol binding, it was decided to
characterize the stability of the complexes as a function of pH and temperature. In the
next sections, thermal unfolding of the StAR/cholesterol complexes will be determined at
different pH; thermodynamic parameters from corresponding profiles will be analyzed
and compared with those of native proteins.
106
5. RESULTS (Part III: Energetics of the pereferential binding of cholesterol
to StAR
The binding of ligands to proteins usually leads to an increase in protein thermal
stability with modifications in the midpoint denaturation temperature (Tm), enthalpy of
unfolding (AHU) and unfolding entropy (A,SU). These modifications are due to the
coupling of unfolding with binding equilibrium and changes in protein structure and
conformational flexibility induced by ligand interaction (Fukada, et al, 1983; Shrake and
Ross, 1990). The nature of these structural changes varies according to conformational
diversity of proteins and chemical characters of corresponding ligands. Therefore, the
understanding of molecular recognition processes of small ligands and biological
macromolecules requires a complete characterization of the binding energetics and
correlation of thermodynamic data with interacting structures involved. In view of that,
the binding properties of StAR/cholesterol complex were investigated with thermal
denaturation studies using CD spectroscopy,
5.1 Physiological pH increases the stability of N-62 StAR against heat
denaturation
The stability of N-62 StAR against heat denaturation was characterized in CD
over temperature range of 10°C to 90°C in 25 mM phosphate buffer by monitoring
[®]222nm since at this wavelength the changes in ellipticity are significant upon protein
denaturation. Unfolding profile of the StAR at physiological pH was associated with
cooperativity that obeyed two-state unfolding model, N (native) <-> U (unfolded),
suggesting that at physiological pH the transition N++U occurred over a narrow range of
107
changing temperature. The cooperativity of unfolding was the hallmark of the two-state
unfolding model (Bolen and Santoro, 1988) and indicated that at physiological pH the
transition N*-+U occurred over a narrow range of changing temperature. In addition, a
single transition between native and denatured state demonstrated that the unfolding did
not involve any intermediary state (Figure 30A).
The temperature denaturation of acidic samples, including StAR plus cholesterol,
did not depict any cooperativity and displayed a melting profile similar to that of the
samples with no cholesterol (Figure 3OB). This finding provided further evidence that at
acidic conditions, StAR is an ensemble of solvent accessible peptide chains with a high
content of secondary structure lacking a stable tertiary structure to maintain the binding
state. Therefore, it was hypothesized that at strong acidic conditions StAR population
might consist of a large number of short-lived and very unstable intermediates, which did
not contribute to the energetic parameters of the folding/unfolding reaction, even in the
presence of cholesterol.
108
Figure 30.Temperature-induced denaturations monitored by the change in molar
ellipticity at 222 nm (©222)
Thermal unfolding profiles obtained from temperature-induced denaturation of the N62StAR (blue dots) and StAR/cholesterol complex (red dots) recorded in 50 mM potassium
phosphate at pH 7.4,(A), and at pH 3.5 (B).
109
i
I
-10
&
-14
-16
Temperature ( C)
B
-8 -
"5
E
|
ci)
<u
t
•«A<tf9^
-10-
•
n
-
12
*
^
•5 - -
^I^JK
•"I
&
*
*
cflcJW^
•
20
40
60
80
Temperature (°C)
110
Using an in-house non-linear least-squares fitting program, cooperative unfolding
curve was simulated according to Equation 1, and expressed as the population of
unfolding (Pu) relative to temperature values (Figure 31). Thermodynamic parameters
AHU, Tm, ASU° (AHU°/Tm), and AGU° for thermal unfolding were obtained from fit to the
stability curves. The results are discussed in next sections.
5.2 Binding of cholesterol improves the conformational stability of StAR
Regulatory ligands can be employed to enhance or repress the activity of
functional proteins. The presence of a ligand at the binding site typically changes the
difference in free energy between 'active' and "inactive' states of the protein, thereby
switching the protein on or off (Graham and Duke, 2005). In this context, the difference,
if any, in stability between apo and cholesterol-bound StAR protein, would lead to better
understanding the nature of this type of sterol-protein binding. Therefore, experiments
were performed to investigate the global effect of cholesterol on thermal stability of
StAR.
As depicted in Figure 31, binding of cholesterol to native StAR at physiological
pH increases the Tm of denaturation. To increase the consistency in measurments,
temperature-dependent [0]222nm values obtained from thermal unfolding curves were
fitted to Equation 1 to get f (Tm), AH(f),
AS(f)
and eventually AG(f).
All the
thermodynamic parameters were assessed from the equations represented in Data
analysis, assuming ACP = 1 kcal/mol.K. Consistent with the primary denaturation profiles
(Figure 30), the Tm was increased from 42.3 C (Tml) in the absence of cholesterol to
45.9 C (Tm2) at cholesterol saturation, (Figure 31. bottom, filled circles). The
corresponding thermodynamic parameters at Tm are presented in Table 4. As expected, at
111
Tm the equilibrium between native and unfolded states distincts a AG°U = 0 in both apo
and cholesterol-bound states. However, at 37°C the free energy of unfolding of the bound
state has a higher magnitude (AGU (37 C) = 2.43 ± 0.07 kcal/mol) when compared with
that of the apo state (AGU° (37°C) = 1.35 ± 0.08 kcal/mol), with a AAGU° = 1.08 ± 0.01
kcal/mol (Table 5). The increase in free energy of unfolding clearly indicates the
favorable interactions between StAR and cholesterol, giving rise to a more stable
conformation of the protein. This is consistent with the finding that stabilization of the
bound state by cholesterol is accompanied by a decrease in the population of the unfolded
state (Pu) (Figure 32). As one can see, at physiological temperature (37°C), the Pu (37) of
StAR in absence of cholesterol is approx. 8% (Figure 32, top). In presence of equimolar
concentration of cholesterol, this population is decreased to approx. 2 %. (Figure 32,
bottom). From eqs 6 and 11, a van't Hoff plot of lnKu versus 1/T allowed for the
measurement of AHU° values at Tm (Figure 33)
The observed increase of the Tm and AG u upon cholesterol binding is due to the
additive enthalpic and entropic factors that probably contribute to promote the stability of
StAR/cholesterol complexes. Therefore, to obtain a better understanding of the nature of
interactions between StAR and cholesterol, variations in enthalpy and entropy of
unfolding were determined as a function of temperature (Figures 35,36). As summarized
in Table 5, the AHU° for StAR and StAR/cholesterol complex are 87.55 ±0.15 and 79.80
± 0.15, respectively, with a AAHU (37 C) = -7.75 kcal/mol. Knowing the corresponding
AAGU (37 C), the variation in entropy of unfolding (-TAASU (37 C)) was measured from
the empirical formula of -TAASU° = AAGU - AAHU = 8.83 kcal/mol. Indeed, a higher
decrease in entropy of water upon unfolding of StAR/cholesterol complex (TASta> lAS"^)
112
clearly demonstrating the more favorable contribution of entropic forces to the overall
stability of the protein.
Given the above results, it is reasonable to conclude that most of the interactions
between cholesterol and StAR are more favorable energetically, in entropy and free
energy, than the corresponding interactions of the StAR with itself and with water, when
cholesterol is absent.
113
Figure 31. Stability curves of StAR and StAR/cholesterol complex at pH 7.4
(A) The stability curves for StAR (dotted line) and StAR/cholesterol complexes
(continuous line) obtained from a non-linear least squares fitting using Equation 10, as
described in Material and Methods. (B) Temperature dependence of the population of
unfolded state (Pu) was obtained by Equation 4. The thermodynamic parameters obtained
for the AN62 StAR and StAR/cholesterol are summarized in Tables 4,5.
Open and filled circles represent the variation of unfolded population (Pu) for StAR and
complex, respectively.The denaturation curve of protein and complexes at pH 3.5 was not
fitted due to the absence of an apparent cooperative transition.
114
StAR
StAR + Ch
•
°
StAR + Ch
StAR
70
Temperature ( C)
115
Table 4. Thermodynamic parameters obtained from thermal unfolding profiles of
N-62 StAR and N-62 StAR/Cholesterol complex at the melting temperature (values
in kcal/mol)
[Protein] (6(iM) [Ch] (uM)
N-62 StAR
N-62 StAR
6
Tm (°C )
42.3
45.8
A/f(r m )
90.05 ±2.1
83.80 ±1.5
TAS(Tm)
90.03 ± 0.87
83.77 ±0.55
Table 5. Thermodynamic parameters measured from the simulations of the
temperature-induced denaturation of N-62 StAR and N-62 StAR/Cholesterol
complex at 37 C (values in kcal/mol)
[Protein] (6uM) [Ch] (uM)
N-62 StAR
N-62 StAR
6
A//U"(37°C)
87.55 ±0.15
79.80 ±0.15
7ASUU(37°C)
86.17 ±0.20
77.37 ±0.28
AGU"( 37°C)
1.35 ±0.08
2.43 ± 0.07
116
Figure 32. Populations of the native, intermediate, and unfolded states of N-62 StAR
and StAR/cholesterol complex
Population of unfolded (Pu •), native (PN * ), and intermediate (Pi -) states are plotted as
a function of temperature. Data from Figure 31, are expressed as the population of folded
(blue), intermediates (gray), and unfolded (red) states at any given temperature between
10°C to 90°C. At the midpoint of transition temperature (Tm) depicted by green arrow, KJJ
= l,[F] = [U], PU = PF = 0.5 and AGU°= 0.
117
Populations
• • l ^
\
S
StAR
0.8
0.6
r
Tm = 42.3 C
0.4
0.2
p
Pu-
i -
>v
PN
•
f ^
StAR+Ch
0.8
0.6
A*
i
m
- 4ZD.O L,
0.4
0.2
1
35
Temperature °C
65
95
118
25
0.0028
0.0030
0.0032
0.0034
1/T (K 1 )
Figure 33. Determination ofAHu and AS„ from Van't Hoff plot
The temperature dependence of the equilibrium constant was used to determine AHU°. A
plot of ln^u against 1/T(K) produced a straight line with a slope equal to -AHU° I R. The
blue and red lines correspond to StAR and StAR/Cholesterol Van't Hoff plots,
respectively.
119
120
60
J
1
20
—,
40
1
r-
60
80
Temperature (°C)
Figure 34. Graph of AHU° versus T for StAR and StAR/Cholesterol complex
The corresponding enthalpies (A//u° (37°C)) obtained for the StAR (blue line) and
StAR/Cholesterol (red line) are listed in table 5.
Temperature (°C)
Figure 35. Plot of A£u versus T for StAR and StAR/Cholesterol complex
Difference between entropy of two samples at 37°C, obtained from the extrapolation of
dashed lines over StAR (blue solid line) and StAR/cholesterol (red solid line) plots and
Y-axis, is depicted as &T/±SU°.
121
6. Discussion
A number of developmental and reproductive abnormalities in humans are related
to the misregulation of StAR expression and/or to a nonfunctioning StAR gene (Baker, et
al, 2006). For example, more than 34 different congenital mutants are known to produce
nonfunctional StAR proteins, which lead to a potentially lethal autosomal recessive
disease known as congenital lipoid adrenal hyperplasia (LCAH). The defect in steroid
synthesis in lipoid CAH is caused by the failure of affected individuals to transport
cholesterol to the inner mitochondria membrane, thus proving the essential role of StAR
in cholesterol transport (Lin et al, 1995; Stocco, 2002).
As of now, the exact mechanism of StAR activity is a matter of debate. There are
suggestions that StAR undergoes a conformational change to a molten globular state
upon interaction with the outer mitochondrial membrane were the pH is presumably more
acidic. It is proposed that this molten globule state of StAR acts as an on/off switch for
cholesterol entry into the mitochondria (Bose et al, 1999). However, based on molecular
modeling, we have proposed that at neutral pH, StAR is in a dynamic equilibrium
between its native and partially folded states with the c-terminal a-helix undergoing a
folding/unfolding transition in absence of cholesterol. The unfolding of the C-terminal
helix is hypothesized to allow access of cholesterol to its binding site on StAR. Once
loaded with one cholesterol molecule, the refolding of the c-terminal helix stabilizes the
complex (Figure 36) and allows for transport from the site of binding to the
mitochondria. Further unfolding of the c-terminal helix is assumed to allow for the
dissociation of cholesterol to the mitochondria directly either to the membrane or a
transporter (Figure 37), (Mathieu et al, 2002a). This theory was recently supported by
122
the molecular dynamics (MD) simulation- of the uptake and release of cholesterol by
StAR-START (Murcia et al, 2006), showing that uptake and release could occur via
conformational changes localized at the entrance of the binding site while preserving the
native conformation of the protein.
6.1 In vitro activity of the N-62 StAR
Cholesterol transport by StAR-START has been directly demonstrated in vivo
(Kallen et al, 1998) and in vitro (Kallen et al, 1998; Lin et al, 1995; Sugawara et al,
1995a). To pursue functional studies of the role of StAR on cholesterol transport, we
purified the bacterially expressed N-62 StAR to examine the protein activity independent
of its mitochondrial import. Consistent with previously published results (Arakane et al,
1998), our data confirmed the steroidogenic activity of StAR without being imported into
mitochondria. In our assay conditions, recombinant proteins increased delivery of added
cholesterol to the P450scc as detected by an increase in pregnenolone production up to
20-fold. However, the level of pregnenolone remained roughly unchanged in the samples
lacking the exogenous cholesterol. Although cholesterol is a normal component of OMM
and other membranes, it is known that the cholesterol in steroidogenic mitochondria
behaves as two kinetically distinct pools: a stable pool, presumably the structural
cholesterol, and a minor labile pool, which is imported and becomes a substrate for
steroidogenesis (Stevens, et al, 1992). This may suggest that cholesterol pools in outer
mitochondrial membrane may not provide enough substrate for the StAR during acute
regulation of steroidogenesis. In other words, steroidogenesis in mitochondria is
eventually limited by the pools of available cholesterol in the OMM. Alternatively, cAMP-dependent mobilization of intracellular cholesterol reservoirs to the mitochondrial
123
membrane induces a maximal rate of cholesterol transport to IMM by StAR (Jefcoate,
2002; Liu et al, 2006).Therefore, we propose that StAR is both a cytoplasmic cholesterol
transporter and a stimulator for rapid burst of steroidogenesis.
We recently provided evidence that phosphorylation of StAR at serine residue
195 by PKA is necessary for maximal steroidogenic activity (LeHoux et al, 2004),
consistent with earlier studies representing StAR as a phosphoprotein (Epstein and OrmeJohnson, 1991b; Hartigan, et al, 1995). The bacterially expressed proteins used in this
study were not phosphorylated. However, treatment with protein kinase A catalytic
subunit and ATP did not increase the steroidogenic activity of recombinant protein
(Strauss, et al, 1999). The finding that removal of first 62 amino acids from NH2terminal of StAR overcomes the off-putting impact of SI95A mutation (Arakane et al,
1998), suggesting that phosphorylation either increases the activity of wild-type by
retarding mitochondrial import or conquers a negative influence of NH2 terminus.
We have successfully refolded recombinant N-62 StAR from bacterial inclusion
bodies into active forms. One source of difference between our results and nonfunctional
refolded proteins reported by Arakane et al. (Arakane et al, 1998), may come from
carrying out the refolding through dialysis, which is often associated with loss or
aggregation of protein on membrane; in our experiments, we relied on Millipore
centrifugal concentrators as alternative to the dialysis. The results presented herein clearly
indicate that refolded proteins, although less than native ones, show significant
steroidogenic activity (Figure 20). Presumably, loss of StAR activity was mostly due to
improper refolding conditions (Swietnicki, 2006), as a high standard deviation obtained
124
from the activity of triplicate samples indicated considerable variation in the efficiency of
performed refolding method.
6.2 pH-induced binding and release of cholesterol from StAR
The notion that free cholesterol is essential to trigger steroidogenesis (Figure 20), led to
hypothesize that binding of StAR to accessible cholesterol is essential to promote StAR
activity and subsequent cholesterol transfer across the mitochondrial membrane. Given
that StAR-cholesterol association is the first step in the mechanism, we attempted to
characterize the in vitro cholesterol-binding properties of StAR. Competition /
displacement binding assays demonstrate that cholesterol binds to StAR specifically at
physiological pH, as the presence of unlabeled cholesterol competes with [ H]cholesterol
for binding to StAR (Figure 22). Decrease of the binding capacity at acidic pH (Figure
21) provides evidence that a well-folded protein is essential to promote StAR/cholesterol
complex formation. Furthermore, our results provide direct experimental observation of
acid-induced release of cholesterol from StAR. A substantial dissociation of
StAR/cholesterol complex below pH 4.5 (Figure 23), where the ionizable amino acids at
the proposed acidic pH are protonated, suggests a mechanism for cholesterol release and
confirms the possible contribution of the essential amino acid residues to the uptake and
release of cholesterol (Mathieu et al, 2002a; Murcia et al, 2006).
The exact biochemical mechanisms involved in cholesterol uncoupling are not
completely understood, but clearly involve a significant reduction in affinity of StAR for
cholesterol as a consequence of the pH change. The results of this work provide evidence
that cholesterol release from the StAR can be promoted by changes in the composition
and properties of the medium with respect to water. By lowering pH of aqueous
125
solutions, cholesterol dissociation does occur but only in concomitance with the transition
of the protein to a denatured state, which exhibits features characteristic of a molten
globule. One explanation for this phenomenon is that structural changes in the carrier
protein may be induced by interaction with the target membrane. Consequently, the
ligand is released concomitantly with conformational changes in the protein (Forker and
Luxon, 1983; Rudenko and Deisenhofer, 2003; Weisiger, et al, 1981).
6.3 Cholesterol-induced conformational stability of StAR
The loss of stability of protein/ligand complex is known to reflect major changes
in the tertiary or secondary structure of the protein. To investigate this issue, we further
characterized a set of structural variations upon cholesterol binding to StAR. This study
confirms that at physiological pH upon binding of cholesterol, StAR undergoes structural
changes which are readily detected with far-UV CD. A previous study reported that
cholesterol binding to StAR altered the secondary structure of StAR to dramatically
reduce the proportion of a-helix (Petrescu et al, 2001). However, our measurements
revealed a transient loss of <10% a-helical structure upon cholesterol binding (Table 3).
The CD signals recorded in that study represented conformational
characters
corresponding to a protein possessing two binding sites, whereas our binding experiments
clearly show a 1:1 binding stoichiometry for StAR/cholesterol complex.
The decrease of <10% in the amount of helical content is in accord with the
theoretical value of 15%> contribution of a-helix 4 to the overall structure of N-62 StAR.
Thus, the observed decrease of helical structure is reversible and cholesterol can further
induce helical conformation of the protein (Figure 26). This finding is in a good
126
agreement with the proposed docking models of StAR / cholesterol complex (Mathieu et
al, 2002a; Mathieu, etal, 2002b).
At the acidic pH, however, addition of the cholesterol to StAR does not induce a
significant modification of helical structure (Figure 27), indicating that the binding is
weak or absent. This finding in association with binding experiments propose a probable
lack of active tertiary structure of StAR at highly acidic conditions and that the transition
from water-soluble to the membrane associated state (Bose, et al., 2002) and subsequent
cholesterol release involve the tertiary structural changes (Cramer, et al, 1990; Muga, et
al, 1991).
6.4 Contribution of cholesterol to the conformational stability of StAR
The results from previous sections indicated that cholesterol binding is an obligate
prerequisite for the steroidogenic activity of StAR. The understanding of molecular
recognition processes of StAR-cholesterol complex requires a complete characterization
of the binding energetics and correlation of thermodynamic data with interacting
structures involved. In this study, for the first time, we have investigated the effect of
cholesterol on thermal stability of StAR at different pH values. Our results demonstrate
that although at low pH (3.5) secondary structure of StAR remains intact, a major loss of
tertiary structure diminishes the affinity of protein for binding to cholesterol. This is not
unexpected, because analysis of thermal unfolding profiles at acidic pH does not
represent a cooperative process owing to the transition of protein to a molten globular
state.
The contribution of cholesterol to protein stability was expressed as the changes
in protein thermal stability with modifications in the midpoint denaturation temperature,
127
and AGU° (Figure 31). The magnitude of changes in both the M/ u and TASU upon
cholesterol uptake along with time course study of complex formation, provided further
information about the structural modifications upon cholesterol binding in terms of (i) the
StAR-cholesterol binding dynamics and (ii) the nature of interactions between ligand and
protein, such as hydrophobic and electrostatic interactions. Our results suggest that
unfolding of cholesterol-bound proteins is dominated by higher unfolding entropy TASU
(37°C) change (from 86.17 ± 0.20 to 77.37 ± 0.28 kcal/mol/K for the native and
cholesterol-bound N-62 StAR, respectively) as compared with a weaker decrease in
corresponding unfolding enthalpy (from 87.55 ± 0.15 to 79.80 ±0.15 kcal/mol for the
native and cholesterol-bound N-62 StAR, respectively). This indicates that the StARcholesterol association is an entropy-driven interaction. Given that these interactions are
O
0
0
associated with a relatively small AHU (compared with AGU) and a higher A5U (Konig
and Dandekar, 2001; Ross and Subramanian, 1981), it might be concluded that the
hydrophobic interactions between the binding site (Mathieu et al., 2002a) of StAR and
cholesterol, force the complex formation (Scheraga, et al, 1962). In addition to that, the
enthalpy of denaturation in the presence of cholesterol (e.g. hydrogen bonds), contributes
to a small proportion of the complex stability, as molecular dynamics (MD) simulations
have shown that favorable electrostatic contributions resulted from the formation of
hydrogen bonds between the hydroxyl group of cholesterol and polar amino acids inside
the hydrophobic core of StAR (Murcia et al., 2006). Of these, cholesterol binding can
itself increase tight packing of StAR conformation, thereby maximizing van der Waals
interactions and, by efficiently excluding solvent, contributes to the hydrophobic
stabilization.
128
Cholesterol-induced helical modification of StAR at neutral pH allowed us to
determine a 1:1 stoichiometry and affinity constant KD ~ lxl0" 6 M for StAR/cholesterol
complex. This is contradictory to the previous work reporting a KD of 32 x 10" M and
two sites for binding of NBD-cholesterol to StAR (Petrescu et at, 2001), but in
agreement with recent models of StAR characterizing the cholesterol binding site as a
hydrophobic pocket which can incorporate only one cholesterol molecule (Mathieu et at,
2002a; Murcia et at, 2006). Therefore, the second 'cholesterol' binding site may be an
artifact from the intrinsic polar properties of NBD-cholesterol chromophoric side-chain
(Figure 38). Although strong association of cholesterol to StAR could explain the
dissociation of cholesterol from the outer mitochondrial membrane (Petrescu et at, 2001)
it does not account for the mechanism of release to the IMM. Furthermore, such strong
interactions are against a rapid cholesterol transfer, as they would slow down StAR
efficiency. For that reason, a KD in micromolar range would support a rapid release of
cholesterol by StAR (Mathieu et at,
2002a). Recent experiments show that
stoichiometric rate of cholesterol transfer between phospholipid vesicles in acidic pH is
about 2 molecules of cholesterol per molecule of StAR per minute (Tuckey, et at, 2002).
This does not appear to satisfy the requirement of steroidogenic cells for producing high
amounts of steroids in a short period of time, as Jefcoate et al. (Artemenko, et at, 2001)
recently reported high activity of cholesterol transport (over 400 molecules of
cholesterol/StAR/min) in bromo-cAMP activated steroidogenic mitochondria. It is
therefore logical to assume that such a steroidogenic cell must spend a lot of energy for a
fast response to stimuli. We show that in vitro, lowering of the pH compensates for the
energetically nonfavorable release of cholesterol. Conceivably, an acidic environment
129
near the region of phospholipids head groups and outer hydrocarbon region of the bilayer
(Frey and Tamm, 1990) may facilitate cholesterol release and its subsequent transport to
the cholesterol-depleted IMM.
6.5 Active StAR is not a molten globule
It is well established that a proper protein fold is required for protein activity. In this
paradigm, protein activity is directly dependant on the tertiary structure. In contrast,
molten globular (MG) states possess secondary but not a tertiary structure, are less likely
to be active, especially in the case of ligand recognition. An important feature of the MG
states is their position in the energy landscape (Onuchic, et al, 1996). According to the
energy landscape theory, protein folding undergoes four states driven by entropy, where
it starts with fast secondary structure formation, followed by MG states, then a transient
intermediates ensemble where these accumulate before reaching the final native state.
The MG states are characterized by a considerable conformational mobility and can be
observed under mildly denaturing conditions, such as moderate concentrations of
detergents, strong denaturants (guanidium hydrochloride, urea), and alkaline or acidic
pH, where the latter is a particularly more effective method. For instance, at low pH, alactalbumin, equine lysozyme, RNase HI from Escherichia coli, and (3-lactoglobulin form
molten globules(Arai and Kuwajima, 2000). Under mildly denaturing conditions, other
MG states of typical globular proteins have also been studied, including Ca2+-binding
milk lysozyme, apomyoglobin, staphyococcal nuclease, carbonic anhydrase and (3lactamase (Arai and Kuwajima, 2000). Also, NMR methods have not yet been able to
identify long-range tertiary interactions that may exist in a MG state. This lack of fixed
130
tertiary interactions in many MG's results in a fluctuating ensemble of structures, which
inter-convert
on a millisecond to microsecond time scale (Redfield,
2004).
Physiologically, extremely low pH in the range of 2-4 does not exist in the cell or in the
plasma, and is merely used as a tool to study the folding pathways of proteins. pH
measurements of the mitochondrial intermembrane space (pH 6.9),mitochondrial matrix
(pH 7.8) and cytosol (pH7.6) (Porcelli, et al, 2005) are remote to the only known acidic
lOcompartments in the cell including the lysosome (pH 5.0), late endosome (pH 5.3),
early endosome(pH 6.2), secretory granules (pH 5.4) and Golgi (pH 6.4) (Grabe and
Oster, 2001). It was suggested that the acidic phospholipids composing the mitochondrial
membrane may generate an acidic microenvironment that induces the MG states of StAR
(Bose et al, 1999). Nevertheless, experimental data show that the negatively charged
phospholipids at the membranes attract positive counter ions (Garcia-Manyes, et al,
2005) such as sodium and more strongly divalent ions like calcium (Pedersen, et al,
2006), thus creating an electric bilayer around the membrane that neutralize such
microenvironments. In the case of StAR, we show in this study that a transition to an
acidic pH of 3.5 generates an artificial MG state, as previously described (Bose et al,
1999), but abolishes the tertiary structure and, most importantly, the subsequent
holesterol binding. Moreover, shifting the pH back to 7.4 failed to regenerate the native
state and the ligand binding. This shows that here, the MG states are irreversible and nonfunctional, and may not account for the high activity of StAR or a KD in the micromolar range
as we determined.
131
6.6 Proposed models, conclusion and remarks
A general consequence of cholesterol (Ch) binding is that StAR is stabilized
against unfolding and is less flexible. This is a result of the ligand binding more tightly to
the native partially unfolded conformation (PN) than to the fully unfolded state (U) and
any extreme distorted forms (e.g. molten globule state). As demonstrated in
thermodynamic studies, binding of cholesterol to the partially unfolded state resulted in
an increase in the secondary structure content of the StAR protein. The fully folded state
(N) might have resulted from the refolding of c-terminal helix on top of the cholesterol
binding site. This can be illustrated for the case of StAR unfolding when cholesterol (Ch)
binds solely to the native partially unfolded state (PN):
Ch
PN-Ch
f
+4N^U
KD
Ku
where K-Q ~ 1 x 10"6 M is the dissociation constant of complex formation and K\j is
equilibrium constant of protein unfolding. This approximation yields two distinct
mechanisms for ligand binding and release.
First, cholesterol essentially binds to the native state of StAR. In fact, trapping of
the water molecules in the hydrophobic cavity of StAR and particularly the disruption of
electrostatic interactions stabilizing the arrangement of the C-terminal helix, such as the
Aspl06-Arg272 ion pair in StAR, would lead to changes in the protein fold and the
exposure of the binding site to the lipid phase (Baker et al, 2005; Yaworsky, et al,
2005). This is partly in agreement with the acid-induced molten globular state theory
proposing that cholesterol binding entails changes in the secondary and possibly tertiary
132
structure of the protein (Bose, et al, 2000a).This notion originates from the fact that
circular dichroism and fluorescence spectra are altered under low pH conditions, either in
solution (Bose et al, 2000a; Bose et al, 1999; Bose et al, 2000b; Strauss, et al, 2003) or
in the presence of zwitterionic synthetic membranes (Christensen, et al, 2001; Murcia et
al, 2006; Song et al, 2001). However, as mentioned in the Introduction, structural
modulation of a part of StAR (63-193 StAR) could not be accounted for the overall
structure of the protein. For example, their NMR signals at pH 7.4 were broad without the
dispersion that is the characteristic of a folded protein, whereas our NMR experiments on
the complete structure of N-62 StAR (unpublished data) strongly suggest the presence of
a protein with a well-defined tertiary structure at pH 7.4. Of that, crystallographic data
and the structural and functional similarity of StART domains with other lipid binding
proteins suggest that the uptake of cholesterol may simply involve the transient opening
of its narrow entrance without a significant perturbation of the overall fold of the domain
(Mathieu et al, 2002a; Murcia et al, 2006; Roderick, et al, 2002; Tsujishita and Hurley,
2000). Thus, the present study is in agreement with the view that uptake of cholesterol
could take place via conformational changes localized at the entrance of the binding
cavity (Mathieu et al, 2002b) while preserving the secondary structure and overall fold
of the protein.
Secondly, since the unfolding and ligand dissociation are chronological, exchange
from the bound conformation must occur through a local fluctuation or partial unfolding
mechanism. The biochemical mechanisms involved in ligand uncoupling are not
completely understood, but clearly involve a significant reduction in affinity of StAR for
cholesterol as a consequence of pH change. Based on our results, the most likely
133
explanation for cholesterol release is that interaction of StAR with an acidic environment,
e.g. an anionic membrane interface (Davies, et al, 1999), induces a rapid conformational
change, thereby releasing the bound cholesterol.
Despite the satisfying attractiveness of the model, the extent to which the results
of this study can be extrapolated to the intact cell remains unclear. Considering the over
10-fold difference in StAR activity observed in vivo (Artemenko et al, 2001) and in vitro
in isolated mitochondria (Bose et al, 2002), one could question whether the in vitro
system reliably recapitulates the in vivo situation or that other protein components of the
pathway are missing, or whether StAR in vitro can not achieve the optimal conformation
responsible for its maximal biological activity (Papadopoulos, et al, 2007). Moreover, in
vitro irreversible dissociation of cholesterol at the acidic pH (Figure 24) criticizes the
model and therefore alternative models should be considered.
There are growing evidence showing that StAR interacts with membrane proteins
(e.g., PBR) and that these interactions are important for cholesterol transport inside the
mitochondria (Hauet, et al, 2005). Based on our results and the recent theory of
cholesterol transport (Liu et al, 2006), we re-review possible mechanisms involved in
cholesterol transfer by StAR (Figure 37). Upon stimulation with cAMP (Fleury, et al,
1996; Fleury et al, 2004; Lehoux et al, 2003) StAR is targeted to the cholesterol pools in
the vicinity of outer mitochondrial membrane translocator protein (TSPO) complex
(Hauet et al, 2005). Opening of the a-helix 4 (Mathieu et al, 2002a) and affinity of the
cholesterol binding site (Murcia et al., 2006) favor the sequestration of cholesterol from
aqueous cytosol and subsequent transport to the OMM signaling complex (Papadopoulos
et al., 2007). During the transport process, StAR/cholesterol complexes remain intact due
134
to the favorable hydrophobic and electrostatic interactions between ligand and
protein. The activated complex is then represented to an outer mitochondrial membrane
signaling complex composed of the outer mitochondrial membrane translocator protein
(TSPO), the TSPO-associated protein PAP7, in association with the voltage-dependent
anion channel protein (VDAC) (Papadopoulos et al, 2007), and cholesterol is released
either through the interaction of StAR with the OMM complex or through an acidinduced transition of the protein to a molten globular state.
Overall, our finding that binding of StAR to cholesterol is essential to trigger
protein activity can count for either of in vivo or in vitro models of StAR action. A more
detailed understanding of the StAR's molecular structure and mechanism of action is
under investigation in our laboratory.
135
B
LZ
Figure 36. Molecular mechanism of cholesterol binding in StAR.
(A) Ribbon diagram of the StAR model. In the absence of cholesterol StAR is in equilibrium
between to the native (right) and partially unfolded state (left). (B) Binding of cholesterol
(green) to the native partially unfolded state (left), induces the refolding of C-terminal ahelix 4 (right) on top of the cholesterol binding site.
136
Figure 37. Proposed model of the cholesterol transport by StAR.
(A) Acid-induce cholesterol release from StAR in OMM. (B) Schematic representation of the
identified mitochondrial signaling complex that mediates and amplifies the hormone and
cAMP signals to mitochondrial cholesterol transport and subsequent steroid biosynthesis. Ch,
cholesterol; IMM, inner mitochondrial membrane; LDs, lipid droplets; OMM, outer
mitochondrial membrane; P, pregnenolone; PAP7, PKARIa-anchoring protein; TSPO,
outermitochondrial membrane translocator protein; VDAC, voltage-dependent anion channel.
137
oo
H3C
- NN; P
o-
CH3I
.rXX^
o
CH 3
<
CH 3
HO
Cholesterol
NBD-cholesterol
Figure 38. Comparison of the structures of of NBD-Cholesterol and cholesterol.
Left,
structure
of
NBD-Cholesterol
(25-[N-[(7-nitro-2-l,3-benzoxadiazol-4-
yl)methyl]amino]-27-norcholesterol) and right, cholesterol.
138
References
Adler AJ, Greenfield NJ & Fasman GD (1973) Circular dichroism and optical rotatory
dispersion of proteins and polypeptides. Methods Enzymol 27 675-735.
Ahlgren R, Simpson ER, Waterman MR & Lund J (1990) Characterization of the
promoter/regulatory region of the bovine CYP11A (P-450scc) gene. Basal and cAMPdependent expression. J Biol Chem 265 3313-3319.
Akingbemi BT (2005) Estrogen regulation of testicular function. Reprod Biol Endocrinol
351.
Alberta JA, Epstein LF, Pon LA & Orme-Johnson NR (1989) Mitochondrial localization
of a phosphoprotein that rapidly accumulates in adrenal cortex cells exposed to
adrenocorticotropic hormone or to cAMP. J Biol Chem 264 2368-2372.
Allen JA, Shankara T, Janus P, Buck S, Diemer T, Hales KH & Hales DB (2006)
Energized, polarized, and actively respiring mitochondria are required for acute Leydig
cell steroidogenesis. Endocrinology 147 3924-3935.
Alpy F, Stoeckel ME, Dierich A, Escola JM, Wendling C, Chenard MP, Vanier MT,
Gruenberg J, Tomasetto C & Rio MC (2001) The steroidogenic acute regulatory protein
homo log MLN64, a late endosomal cholesterol-binding protein. J Biol Chem 276 42614269.
Altmann SW, Davis HR, Jr., Zhu LJ, Yao X, Hoos LM, Tetzloff G, Iyer SP, Maguire M,
Golovko A, Zeng M, et al. (2004) Niemann-Pick CI Like 1 protein is critical for
intestinal cholesterol absorption. Science 303 1201-1204.
Amri H, Ogwuegbu SO, Boujrad N, Drieu K & Papadopoulos V (1996) In vivo
regulation of peripheral-type benzodiazepine receptor and glucocorticoid synthesis by
Ginkgo biloba extract EGb 761 and isolated ginkgolides. Endocrinology 137 5707-5718.
Ankley GT & Johnson RD (2004) Small fish models for identifying and assessing the
effects of endocrine-disrupting chemicals. liar J 45 469-483.
Arai M & Kuwajima K (2000) Role of the molten globule state in protein folding. Adv
Protein Chem 53 209-282.
Arakane F, Kallen CB, Watari H, Foster JA, Sepuri NB, Pain D, Stayrook SE, Lewis M,
Gerton GL & Strauss JF, 3rd (1998) The mechanism of action of steroidogenic acute
regulatory protein (StAR). StAR acts on the outside of mitochondria to stimulate
steroidogenesis. J Biol Chem 273 16339-16345.
139
Arakane F, King SR, Du Y, Kallen CB, Walsh LP, Watari H, Stocco DM & Strauss JF,
3rd (1997) Phosphorylation of steroidogenic acute regulatory protein (StAR) modulates
its steroidogenic activity. J Biol Chem 272 32656-32662.
Arakane F, Sugawara T, Nishino H, Liu Z, Holt JA, Pain D, Stocco DM, Miller WL &
Strauss JF, 3rd (1996) Steroidogenic acute regulatory protein (StAR) retains activity in
the absence of its mitochondrial import sequence: implications for the mechanism of
StAR action. Proc Natl Acad Sci USA 93 13731-13736.
Arlt W & Stewart PM (2005) Adrenal corticosteroid biosynthesis, metabolism, and
action. Endocrinol Metab Clin North Am 34 293-313, viii.
Artemenko IP, Zhao D, Hales DB, Hales KH & Jefcoate CR (2001) Mitochondrial
processing of newly synthesized steroidogenic acute regulatory protein (StAR), but not
total StAR, mediates cholesterol transfer to cytochrome P450 side chain cleavage enzyme
in adrenal cells. J Biol Chem 276 46583-46596.
Ascoli M (1981) Characterization of several clonal lines of cultured Leydig tumor cells:
gonadotropin receptors and steroidogenic responses. Endocrinology 108 88-95.
Baker BY, Lin L, Kim CJ, Raza J, Smith CP, Miller WL & Achermann JC (2006)
Nonclassic congenital lipoid adrenal hyperplasia: a new disorder of the steroidogenic
acute regulatory protein with very late presentation and normal male genitalia. J Clin
Endocrinol Metab 91 4781-4785.
Baker BY, Yaworsky DC & Miller WL (2005) A pH-dependent molten globule transition
is required for activity of the steroidogenic acute regulatory protein, StAR. J Biol Chem
280 41753-41760.
Banuelos S & Muga A (1995) Binding of molten globule-like conformations to lipid
bilayers. Structure of native and partially folded alpha-lactalbumin bound to model
membranes. J Biol Chem 270 29910-29915.
Baulieu EE (1997) Neurosteroids: of the nervous system, by the nervous system, for the
nervous system. Recent Prog Horm Res 52 1-32.
Bean WB, Olch D & Weinberg HB (1955) The syndrome of carcinoid and acquired valve
lesions of the right side of the heart. Circulation 12 1-6.
Berg JM (1992) Spl and the subfamily of zinc finger proteins with guanine-rich binding
sites. Proc Natl Acad Sci USA 89 11109-11110.
Bloch K (1965) The biological synthesis of cholesterol. Science 150 19-28.
140
Bolen DW & Santoro MM (1988) Unfolding free energy changes determined by the
linear extrapolation method. 2. Incorporation of delta G degrees N-U values in a
thermodynamic cycle. Biochemistry 27 8069-8074.
Borroni R, Liu Z, Simpson ER & Hinshelwood MM (1997) A putative binding site for
Spl is involved in transcriptional regulation of CYP17 gene expression in bovine ovary.
Endocrinology 138 2011-2020.
Bose H, Lingappa VR & Miller WL (2002) Rapid regulation of steroidogenesis by
mitochondrial protein import. Nature All 87-91.
Bose HS, Baldwin MA & Miller WL (2000a) Evidence that StAR and MLN64 act on the
outer mitochondrial membrane as molten globules. Endocr Res 26 629-637.
Bose HS, Sato S, Aisenberg J, Shalev SA, Matsuo N & Miller WL (2000a) Mutations in
the steroidogenic acute regulatory protein (StAR) in six patients with congenital lipoid
adrenal hyperplasia. J Clin Endocrinol Metab 85 3636-3639.
Bose HS, Sugawara T, Strauss JF, 3rd & Miller WL (1996) The pathophysiology and
genetics of congenital lipoid adrenal hyperplasia. International Congenital Lipoid
Adrenal Hyperplasia Consortium. N EnglJ Med 335 1870-1878.
Bose HS, Whittal RM, Baldwin MA & Miller WL (1999) The active form of the
steroidogenic acute regulatory protein, StAR, appears to be a molten globule. Proc Natl
AcadSci USA96 7250-7255.
Bose HS, Whittal RM, Huang MC, Baldwin MA & Miller WL (2000b) N-218 MLN64, a
protein with StAR-like steroidogenic activity, is folded and cleaved similarly to StAR.
Biochemistry 39 11722-11731.
Bruscalupi G, Leoni S, Mangiantini MT, Piemonte F, Spagnuolo S & Trentalance A
(1985) Short term regulation of acyl CoA: cholesterol acyl transferase (ACAT) activity in
the regenerating and perinatal liver. Biosci Rep 5 237-242.
Buttgereit F, Burmester GR & Lipworth BJ (2005) Optimised glucocorticoid therapy: the
sharpening of an old spear. Lancet 365 801-803.
Calikoglu AS (2003) Adrenocorticotropic hormone, a new player in the control of
testicular steroidogenesis. Endocrinology 144 3277-3278.
Caron KM, Ikeda Y, Soo SC, Stocco DM, Parker KL & Clark BJ (1997) Characterization
of the promoter region of the mouse gene encoding the steroidogenic acute regulatory
protein. Mol Endocrinol 11 138-147.
141
Cherradi N, Brandenburger Y & Capponi AM (1998) Mitochondrial regulation of
mineralocorticoid biosynthesis by calcium and the StAR protein. Eur J Endocrinol 139
249-256.
Christensen K, Bose HS, Harris FM, Miller WL & Bell JD (2001) Binding of
steroidogenic acute regulatory protein to synthetic membranes suggests an active molten
globule. J Biol Chem 276 17044-17051.
Christenson LK, Osborne TF, McAllister JM & Strauss JF, 3rd (2001) Conditional
response of the human steroidogenic acute regulatory protein gene promoter to sterol
regulatory element binding protein-la. Endocrinology 142 28-36.
Christenson LK & Strauss JF, 3rd (2000) Steroidogenic acute regulatory protein (StAR)
and the intramitochondrial translocation of cholesterol. Biochim Biophys Acta 1529 175187.
Clark BJ, Soo SC, Caron KM, Ikeda Y, Parker KL & Stocco DM (1995) Hormonal and
developmental regulation of the steroidogenic acute regulatory protein. Mol Endocrinol 9
1346-1355.
Clark BJ & Stocco DM (1997) Steroidogenic acute regulatory protein: the StAR still
shines brightly. Mol Cell Endocrinol 134 1-8.
Clark BJ, Wells J, King SR & Stocco DM (1994) The purification, cloning, and
expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10
mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein
(StAR). J Biol Chem 269 28314-28322.
Cramer WA, Cohen FS, Merrill AR & Song HY (1990) Structure and dynamics of the
colicin El channel. Mol Microbiol 4 519-526.
Davies JK, Thumser AE & Wilton DC (1999) Binding of recombinant rat liver fatty acidbinding protein to small anionic phospholipid vesicles results in ligand release: a model
for interfacial binding and fatty acid targeting. Biochemistry 38 16932-16940.
Davis WW & Garren LD (1968) On the mechanism of action of adrenocorticotropic
hormone. The inhibitory site of cycloheximide in the pathway of steroid biosynthesis. J
Biol Chem 243 5153-5157.
De Voogt HJ, Smith PH, Pavone-Macaluso M, De Pauw M & Suciu S (1986)
Cardiovascular
side
effects
of
diethylstilbestrol,
cyproterone
acetate,
medroxyprogesterone acetate and estramustine phosphate used for the treatment of
advanced prostatic cancer: results from European Organization for Research on
Treatment of Cancer trials 30761 and 30762. J Urol 135 303-307.
142
Defossez PA, Baert JL, Monnot M & de Launoit Y (1997) The ETS family member
ERM contains an alpha-helical acidic activation domain that contacts TAFII60. Nucleic
Acids Res 25 4455-4463.
Della-Cioppa G, Muffly KE, Yanagibashi K & Hall PF (1986) Preparation and
characterization of submitochondrial fractions from adrenal cells. Mol Cell Endocrinol 48
111-120.
Dickinson DB, Misch MJ & Drury RE (1970) Freezing Damage to Isolated Tomato Fruit
Mitochondria as Modified by Cryoprotective Agents and Storage Temperature. Plant
Physiol 46 200-203.
Dohle GR, Smit M & Weber RF (2003) Androgens and male fertility. World J Urol 21
341-345.
Epstein LF & Orme-Johnson NR (1991a) Acute action of luteinizing hormone on mouse
Leydig cells: accumulation of mitochondrial phosphoproteins and stimulation of
testosterone synthesis. Mol Cell Endocrinol 81 113-126.
Epstein LF & Orme-Johnson NR (1991b) Regulation of steroid hormone biosynthesis.
Identification of precursors of a phosphoprotein targeted to the mitochondrion in
stimulated rat adrenal cortex cells. J Biol Chem 266 19739-19745.
Farkash Y, Timberg R & Orly J (1986) Preparation of antiserum to rat cytochrome P-450
cholesterol side chain cleavage, and its use for ultrastructural localization of the
immunoreactive enzyme by protein A-gold technique. Endocrinology 118 1353-1365.
Ferguson JJ, Jr. (1963) Protein Synthesis and Adrenocorticotropin Responsiveness. J Biol
Chem 238 2754-2759.
Fleischer S (1979) Long-term storage of mitochondria to preserve energy-linked
functions. Methods Enzymol 55 28-32.
Fleury A, Cloutier M, Ducharme L, Lefebvre A, LeHoux J & LeHoux JG (1996)
Adrenocorticotropin regulates the level of the steroidogenic acute regulatory (StAR)
protein mRNA in hamster adrenals. Endocr Res 22 515-520.
Fleury A, Mathieu AP, Ducharme L, Hales DB & LeHoux JG (2004) Phosphorylation
and function of the hamster adrenal steroidogenic acute regulatory protein (StAR). J
Steroid Biochem Mol Biol 91 259-271.
Forker EL & Luxon BA (1983) Albumin-mediated transport of rose bengal by perfused
rat liver. Kinetics of the reaction at the cell surface. J Clin Invest 72 1764-1771.
Freire E (1995) Thermal denaturation methods in the study of protein folding. Methods
Enzymol 259 144-168.
143
Frey S & Tamm LK (1990) Membrane insertion and lateral diffusion of fluorescencelabelled cytochrome c oxidase subunit IV signal peptide in charged and uncharged
phospholipid bilayers. Biochem J272 713-719.
Fujieda K, Tajima T, Nakae J, Sageshima S, Tachibana K, Suwa S, Sugawara T &
Strauss JF, 3rd (1997) Spontaneous puberty in 46,XX subjects with congenital lipoid
adrenal hyperplasia. Ovarian steroidogenesis is spared to some extent despite inactivating
mutations in the steroidogenic acute regulatory protein (StAR) gene. J Clin Invest 99
1265-1271.
Fukada H, Sturtevant JM & Quiocho FA (1983) Thermodynamics of the binding of Larabinose and of D-galactose to the L-arabinose-binding protein of Escherichia coli. J
Biol Chem 258 13193-13198.
Garcia-Calvo M, Lisnock J, Bull HG, Hawes BE, Burnett DA, Braun MP, Crona JH,
Davis HR, Jr., Dean DC, Detmers PA, et al. (2005) The target of ezetimibe is NiemannPickCl-Like 1 (NPC1L1). Proc Natl Acad Sci USA 102 8132-8137.
Garcia-Manyes S, Oncins G & Sanz F (2005) Effect of ion-binding and chemical
phospholipid structure on the nanomechanics of lipid bilayers studied by force
spectroscopy. Biophys J 89 1812-1826.
Garren LD, Ney RL & Davis WW (1965) Studies on the role of protein synthesis in the
regulation of corticosterone production by adrenocorticotropic hormone in vivo. Proc
Natl Acad Sci USA 53 1443-1450.
Godt RE & Maughan DW (1988) On the composition of the cytosol of relaxed skeletal
muscle of the frog. Am J Physiol 254 C591-604.
Goldstein JL & Brown MS (1990) Regulation of the mevalonate pathway. Nature 343
425-430.
Grabe M & Oster G (2001) Regulation of organelle acidity. J Gen Physiol 117 329-344.
Graham I & Duke T (2005) The logical repertoire of ligand-binding proteins. Phys Biol 2
159-165.
Granot Z, Silverman E, Friedlander R, Melamed-Book N, Eimerl S, Timberg R, Hales
KH, Hales DB, Stocco DM & Orly J (2002) The life cycle of the steroidogenic acute
regulatory (StAR) protein: from transcription through proteolysis. Endocr Res 28 375386.
Greenfield N & Fasman GD (1969) Computed circular dichroism spectra for the
evaluation of protein conformation. Biochemistry 8 4108-4116.
Hanahan D, Jessee J & Bloom FR (1991) Plasmid transformation of Escherichia coli and
other bacteria. Methods Enzymol 204 63-113.
144
Hanson JR (2006) Steroids: partial synthesis in medicinal chemistry. Nat Prod Rep 23
886-892.
Hartigan JA, Green EG, Mortensen RM, Menachery A, Williams GH & Orme-Johnson
NR (1995) Comparison of protein phosphorylation patterns produced in adrenal cells by
activation of c AMP-dependent protein kinase and Ca-dependent protein kinase. J Steroid
Biochem Mol Biol 53 95-101.
Hauet T, Liu J, Li H, Gazouli M, Culty M & Papadopoulos V (2002) PBR, StAR, and
PKA: partners in cholesterol transport in steroidogenic cells. Endocr Res 28 395-401.
Hauet T, Yao ZX, Bose HS, Wall CT, Han Z, Li W, Hales DB, Miller WL, Culty M &
Papadopoulos V (2005) Peripheral-type benzodiazepine receptor-mediated action of
steroidogenic acute regulatory protein on cholesterol entry into leydig cell mitochondria.
Mol Endocrinol 19 540-554.
Hauffa BP, Miller WL, Grumbach MM, Conte FA & Kaplan SL (1985) Congenital
adrenal hyperplasia due to deficient cholesterol side-chain cleavage activity (20, 22desmolase) in a patient treated for 18 years. Clin Endocrinol (Oxf) 23 481-493.
Herbert V, Lau KS, Gottlieb CW & Bleicher SJ (1965) Coated charcoal immunoassay of
insulin. J Clin Endocrinol Metab 25 1375-1384.
Horikawa R (2004) [Congenital lipoid adrenal hyperplasia]. Nippon Rinsho 62 351-356.
Hunter MH & Carek PJ (2003) Evaluation and treatment of women with hirsutism. Am
Fam Physician 67 2565-2572.
Ikeda Y, Lala DS, Luo X, Kim E, Moisan MP & Parker KL (1993) Characterization of
the mouse FTZ-F1 gene, which encodes a key regulator of steroid hydroxylase gene
expression. Mol Endocrinol 7 852-860.
Ikonen E (2006) Mechanisms for cellular cholesterol transport: defects and human
disease. Physiol Rev 86 1237-1261.
Im YJ, Raychaudhuri S, Prinz WA & Hurley JH (2005) Structural mechanism for sterol
sensing and transport by OSBP-related proteins. Nature 437 154-158.
Ishii T, Hasegawa T, Pai CI, Yvgi-Ohana N, Timberg R, Zhao L, Majdic G, Chung BC,
Orly J & Parker KL (2002) The roles of circulating high-density lipoproteins and trophic
hormones in the phenotype of knockout mice lacking the steroidogenic acute regulatory
protein. Mol Endocrinol 16 2297-2309.
Iyer LM, Koonin EV & Aravind L (2001) Adaptations of the helix-grip fold for ligand
binding and catalysis in the START domain superfamily. Proteins 43 134-144.
145
Jean-Francois N, Frederic G, Raymund W, Benoit C & Lavigne P (2003) Improving the
thermodynamic stability of the leucine zipper of max increases the stability of its b-HLHLZ:E-box complex. J Mol Biol 326 1577-1595.
Jefcoate C (2002) High-flux mitochondrial cholesterol trafficking, a specialized function
of the adrenal cortex. J Clin Invest 110 881-890.
Kagawa N & Waterman MR (1991) Evidence that an adrenal-specific nuclear protein
regulates the cAMP responsiveness of the human CYP21B (P450C21) gene. J Biol Chem
266 11199-11204.
Kallen CB, Billheimer JT, Summers SA, Stayrook SE, Lewis M & Strauss JF, 3rd (1998)
Steroidogenic acute regulatory protein (StAR) is a sterol transfer protein. J Biol Chem
273 26285-26288.
Knopp RH (1999) Drug treatment of lipid disorders. N EnglJ Med 341 498-511.
Ko DC, Milenkovic L, Beier SM, Manuel H, Buchanan J & Scott MP (2005) Cellautonomous death of cerebellar purkinje neurons with autophagy in Niemann-Pick type C
disease. PLoS Genet 1 81-95.
Konig R & Dandekar T (2001) Solvent entropy-driven searching for protein modeling
examined and tested in simplified models. Protein Eng 14 329-335.
Krueger KE & Papadopoulos V (1990) Peripheral-type benzodiazepine receptors mediate
translocation of cholesterol from outer to inner mitochondrial membranes in
adrenocortical cells. J Biol Chem 265 15015-15022.
Krueger RJ & Orme-Johnson NR (1983) Acute adrenocorticotropic hormone stimulation
of adrenal corticosteroidogenesis. Discovery of a rapidly induced protein. J Biol Chem
258 10159-10167.
Kumar R, Gururaj AE, Vadlamudi RK & Rayala SK (2005) The clinical relevance of
steroid hormone receptor corepressors. Clin Cancer Res 11 2822-2831.
Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227 680-685.
Lavigne P, Crump MP, Gagne SM, Hodges RS, Kay CM & Sykes BD (1998) Insights
into the mechanism of heterodimerization from the 1H-NMR solution structure of the cMyc-Max heterodimeric leucine zipper. J Mol Biol 281 165-181.
Lavigne P, Kondejewski LH, Houston ME, Jr., Sonnichsen FD, Lix B, Skyes BD,
Hodges RS & Kay CM (1995) Preferential heterodimeric parallel coiled-coil formation
by synthetic Max and c-Myc leucine zippers: a description of putative electrostatic
interactions responsible for the specificity of heterodimerization. J Mol Biol 254 505-520.
146
Lee YH, Williams SC, Baer M, Sterneck E, Gonzalez FJ & Johnson PF (1997) The
ability of C/EBP beta but not C/EBP alpha to synergize with an Spl protein is specified
by the leucine zipper and activation domain. Mol Cell Biol 17 2038-2047.
Lehoux JG, Fleury A & Ducharme L (1998) The acute and chronic effects of
adrenocorticotropin on the levels of messenger ribonucleic acid and protein of
steroidogenic enzymes in rat adrenal in vivo. Endocrinology 139 3913-3922.
LeHoux JG, Fleury A, Ducharme L & Hales DB (2004) Phosphorylation of the hamster
adrenal steroidogenic acute regulatory protein as analyzed by two-dimensional
polyacrylamide gel electrophoreses. Mol Cell Endocrinol 215 127-134.
Lehoux JG, Mathieu A, Lavigne P & Fleury A (2003) Adrenocorticotropin regulation of
steroidogenic acute regulatory protein. Microsc Res Tech 61 288-299.
Leo JC, Guo C, Woon CT, Aw SE & Lin VC (2004) Glucocorticoid and
mineralocorticoid cross-talk with progesterone receptor to induce focal adhesion and
growth inhibition in breast cancer cells. Endocrinology 145 1314-1321.
Li M, Su ZG & Janson JC (2004) In vitro protein refolding by chromatographic
procedures. Protein Expr Purif'33 1-10.
Lin D, Sugawara T, Strauss JF, 3rd, Clark BJ, Stocco DM, Saenger P, Rogol A & Miller
WL (1995) Role of steroidogenic acute regulatory protein in adrenal and gonadal
steroidogenesis. Science 267 1828-1831.
Liscum L & Munn NJ (1999) Intracellular cholesterol transport. Biochim Biophys Acta
1438 19-37.
Liu J, Rone MB & Papadopoulos V (2006) Protein-protein interactions mediate
mitochondrial cholesterol transport and steroid biosynthesis. J Biol Chem 281 3887938893.
Lu S, Ciardelli T, Reyes VE & Humphreys RE (1991) Number and placement of
hydrophobic residues in a longitudinal strip governs helix formation of peptides in the
presence of lipid vesicles. J Biol Chem 266 10054-10057.
Makridis C, Oberg K, Juhlin C, Rastad J, Johansson H, Lorelius LE & Akerstrom G
(1990) Surgical treatment of mid-gut carcinoid tumors. World J Surg 14 377-383;
discussion 384-375.
Manary MJ, Muglia LJ, Vogt SK & Yarasheski KE (2006) Cortisol and its action on the
glucocorticoid receptor in malnutrition and acute infection. Metabolism 55 550-554.
Mastorakos G & Ilias I (2003) Maternal and fetal hypothalamic-pituitary-adrenal axes
during pregnancy and postpartum. Ann N YAcadSci 997 136-149.
147
Mathieu AP, Fleury A, Ducharme L, Lavigne P & LeHoux JG (2002a) Insights into
steroidogenic acute regulatory protein (StAR)-dependent cholesterol transfer in
mitochondria: evidence from molecular modeling and structure-based thermodynamics
supporting the existence of partially unfolded states of StAR. J Mol Endocrinol 29 327345.
Mathieu AP, Lavigne P & LeHoux JG (2002b) Molecular modeling and structure-based
thermodynamic analysis of the StAR protein. Endocr Res 28 419-423.
Maxfield FR & Menon AK (2006) Intracellular sterol transport and distribution. Curr
Opin Cell Biol 18 379-385.
Miller WL (1988) Molecular biology of steroid hormone synthesis. Endocr Rev 9 295318.
Miller WL (1997) Congenital lipoid adrenal hyperplasia: the human gene knockout for
the steroidogenic acute regulatory protein. J Mol Endocrinol 19 227-240.
Miller WL (2006) StAR Search - What We Know About How the Steroidogenic Acute
Regulatory Protein Mediates Mitochondrial Cholesterol Import. Mol Endocrinol.
Miller WL & Strauss JF, 3rd (1999) Molecular pathology and mechanism of action of the
steroidogenic acute regulatory protein, StAR. J Steroid Biochem Mol Biol 69 131-141.
Moog-Lutz C, Tomasetto C, Regnier CH, Wendling C, Lutz Y, Muller D, Chenard MP,
Basset P & Rio MC (1997) MLN64 exhibits homology with the steroidogenic acute
regulatory protein (STAR) and is over-expressed in human breast carcinomas. Int J
Cancer 71 183-191.
Morar AS, Olteanu A, Young GB & Pielak GJ (2001) Solvent-induced collapse of alphasynuclein and acid-denatured cytochrome c. Protein Sci 10 2195-2199.
Muga A, Mantsch HH & Surewicz WK (1991) Membrane binding induces
destabilization of cytochrome c structure. Biochemistry 30 7219-7224.
Mukai K, Mitani F, Nagasawa H, Suzuki R, Suzuki T, Suematsu M & Ishimura Y (2003)
An inverse correlation between expression of a preprocathepsin B-related protein with
cysteine-rich sequences and steroid 11 beta -hydroxylase in adrenocortical cells. J Biol
Chem21% 17084-17092.
Mulrow PJ (1972) The adrenal cortex. Annu Rev Physiol 34 409-424.
Murcia M, Faraldo-Gomez JD, Maxfield FR & Roux B (2006) Modeling the structure of
the StART domains of MLN64 and StAR proteins in complex with cholesterol. J Lipid
Res 47 2614-2630.
148
Murphy BE & Marvin M (1974) Interaction of gelatin with stereospecific binding
proteins and its enhancement of competitive binding assays. J Clin Pathol 27 687-692.
Nakae J, Tajima T, Sugawara T, Arakane F, Hanaki K, Hotsubo T, Igarashi N, Igarashi
Y, Ishii T, Koda N, et al. (1997) Analysis of the steroidogenic acute regulatory protein
(StAR) gene in Japanese patients with congenital lipoid adrenal hyperplasia. Hum Mol
Genet 6 571-576.
Naud JF, McDuff FO, Sauve S, Montagne M, Webb BA, Smith SP, Chabot B & Lavigne
P (2005) Structural and thermodynamical characterization of the complete p21 gene
product of Max. Biochemistry 44 12746-12758.
Ohno Y, Yanagibashi K, Yonezawa Y, Ishiwatari S & Matsuba M (1983) A possible role
of "steroidogenic factor" in the corticoidogenic response to ACTH; effect of ACTH,
cycloheximide and aminoglutethimide on the content of cholesterol in the outer and inner
mitochondrial membrane of rat adrenal cortex. EndocrinolJpn 30 335-338.
Okuyama E, Nishi N, Onishi S, Itoh S, Ishii Y, Miyanaka H, Fujita K & Ichikawa Y
(1997) A novel splicing junction mutation in the gene for the steroidogenic acute
regulatory protein causes congenital lipoid adrenal hyperplasia. J Clin Endocrinol Metab
82 2337-2342.
Onuchic JN, Socci ND, Luthey-Schulten Z & Wolynes PG (1996) Protein folding
funnels: the nature of the transition state ensemble. Fold Des 1 441-450.
Oram JF & Heinecke JW (2005) ATP-binding cassette transporter Al: a cell cholesterol
exporter that protects against cardiovascular disease. Physiol Rev 85 1343-1372.
Pace CN (1986) Determination and analysis of urea and guanidine hydrochloride
denaturation curves. Methods Enzymol 131 266-280.
Papadopoulos V (1993) Peripheral-type benzodiazepine/diazepam binding inhibitor
receptor: biological role in steroidogenic cell function. Endocr Rev 14 222-240.
Papadopoulos V, Liu J & Culty M (2007) Is there a mitochondrial signaling complex
facilitating cholesterol import? Mol Cell Endocrinol.
Pedersen UR, Leidy C, Westh P & Peters GH (2006) The effect of calcium on the
properties of charged phospholipid bilayers. Biochim Biophys Acta 1758 573-582.
Petrescu AD, Gallegos AM, Okamura Y, Strauss JF, 3rd & Schroeder F (2001)
Steroidogenic acute regulatory protein binds cholesterol and modulates mitochondrial
membrane sterol domain dynamics. J Biol Chem 276 36970-36982.
149
Pon LA, Hartigan JA & Orme-Johnson NR (1986) Acute ACTH regulation of adrenal
corticosteroid biosynthesis. Rapid accumulation of a phosphoprotein. J Biol Chem 261
13309-13316.
Pon LA & Orme-Johnson NR (1988) Acute stimulation of corpus luteum cells by
gonadotrophin or adenosine 3',5'-monophosphate causes accumulation of a
phosphoprotein concurrent with acceleration of steroid synthesis. Endocrinology 123
1942-1948.
Ponting CP & Aravind L (1999) START: a lipid-binding domain in StAR, HD-ZIP and
signalling proteins. Trends Biochem Sci 24 130-132.
Ponting CP, Schultz J, Milpetz F & Bork P (1999) SMART: identification and annotation
of domains from signalling and extracellular protein sequences. Nucleic Acids Res 27
229-232.
Porcelli AM, Ghelli A, Zanna C, Pinton P, Rizzuto R & Rugolo M (2005) pH difference
across the outer mitochondrial membrane measured with a green fluorescent protein
mutant. Biochem Biophys Res Commun 326 799-804.
Posner BI, Kelly PA, Shiu RP & Friesen HG (1974) Studies of insulin, growth hormone
and prolactin binding: tissue distribution, species variation and characterization.
Endocrinology 95 521 -531.
Privalle CT, Crivello JF & Jefcoate CR (1983) Regulation of intramitochondrial
cholesterol transfer to side-chain cleavage cytochrome P-450 in rat adrenal gland. Proc
Natl Acad Sci US AM 702-706.
Privalov PL (1979) Stability of proteins: small globular proteins. Adv Protein Chem 33
167-241.
Privalov PL & Makhatadze GI (1990) Heat capacity of proteins. II. Partial molar heat
capacity of the unfolded polypeptide chain of proteins: protein unfolding effects. J Mol
Biol 213 385-391.
Qi X & Grabowski GA (2001) Differential membrane interactions of saposins A and C:
implications for the functional specificity. J Biol Chem 276 27010-27017.
Ray DB, Horst IA & Kowal J (1980) Adrenocorticotropic hormone increases specific
proteins of the mitochondrial fraction that are translated inside or outside this organelle in
cultured adrenal tumor cells. Proc Natl Acad Sci USA 11 4648-4652.
Redfield C (2004) Using nuclear magnetic resonance spectroscopy to study molten
globule states of proteins. Methods 34 121-132.
150
Rodenburg RJ, Holthuizen PE & Sussenbach JS (1997) A functional Spl binding site is
essential for the activity of the adult liver-specific human insulin-like growth factor II
promoter. Mol Endocrinol 11 237-250.
Roderick SL, Chan WW, Agate DS, Olsen LR, Vetting MW, Rajashankar KR & Cohen
DE (2002) Structure of human phosphatidylcholine transfer protein in complex with its
ligand. Nat Struct Biol 9 507-511.
Rodriguez-Agudo D, Ren S, Hylemon PB, Redford K, Natarajan R, Del Castillo A, Gil G
& Pandak WM (2005) Human StarD5, a cytosolic StAR-related lipid binding protein. J
Lipid Res 46 1615-1623.
Romanowski MJ, Soccio RE, Breslow JL & Burley SK (2002) Crystal structure of the
Mus musculus cholesterol-regulated START protein 4 (StarD4) containing a StARrelated lipid transfer domain. Proc Natl Acad Sci USA99 6949-6954.
Ross PD & Subramanian S (1981) Thermodynamics of protein association reactions:
forces contributing to stability. Biochemistry 20 3096-3102.
Rudel LL & Shelness GS (2000) Cholesterol esters and atherosclerosis-a game of ACAT
and mouse. Nat Med 6 1313-1314.
Rudenko G & Deisenhofer J (2003) The low-density lipoprotein receptor: ligands,
debates and lore. Curr Opin Struct Biol 13 683-689.
Salemi R, McDougall JG, Hardy KJ & Wintour EM (2000) Effect of adrenomedullin
infusion on basal and stimulated aldosterone secretion in conscious sheep with cervical
adrenal autotransplants. J Endocrinol 166 389-399.
Sandhoff TW, Hales DB, Hales KH & McLean MP (1998) Transcriptional regulation of
the rat steroidogenic acute regulatory protein gene by steroidogenic factor 1.
Endocrinology 139 4820-4831.
Scallen TJ & Sanghvi A (1983) Regulation of three key enzymes in cholesterol
metabolism by phosphorylation/dephosphorylation. Proc Natl Acad Sci U S A 80 24772480.
Scheraga HA, Nemethy G & Steinberg IZ (1962) The contribution of hydrophobic bonds
to the thermal stability of protein conformations. J Biol Chem 237 2506-2508.
Schwaiger M, Herzog V & Neupert W (1987) Characterization of translocation contact
sites involved in the import of mitochondrial proteins. J Cell Biol 105 235-246.
Shea-Eaton WK, Trinidad MJ, Lopez D, Nackley A & McLean MP (2001) Sterol
regulatory element binding protein-la regulation of the steroidogenic acute regulatory
protein gene. Endocrinology 142 1525-1533.
151
Shelat SG, Flanagan-Cato LM & Fluharty SJ (1999) Glucocorticoid and
mineralocorticoid regulation of angiotensin II type 1 receptor binding and inositol
triphosphate formation in WB cells. J Endocrinol 162 381-391.
Shrake A & Ross PD (1990) Ligand-induced biphasic protein denaturation. J Biol Chem
265 5055-5059.
Silverman E, Eimerl S & Orly J (1999) CCAAT enhancer-binding protein beta and
GATA-4 binding regions within the promoter of the steroidogenic acute regulatory
protein (StAR) gene are required for transcription in rat ovarian cells. J Biol Chem 21A
17987-17996.
Simpson ER & Waterman MR (1988) Regulation of the synthesis of steroidogenic
enzymes in adrenal cortical cells by ACTH. Annu Rev Physiol 50 427-440.
Soccio RE, Adams RM, Maxwell KN & Breslow JL (2005) Differential gene regulation
of StarD4 and StarD5 cholesterol transfer proteins. Activation of StarD4 by sterol
regulatory element-binding protein-2 and StarD5 by endoplasmic reticulum stress. J Biol
Chem 280 19410-19418.
Soccio RE & Breslow JL (2003) StAR-related lipid transfer (START) proteins: mediators
of intracellular lipid metabolism. J Biol Chem 278 22183-22186.
Soccio RE & Breslow JL (2004) Intracellular cholesterol transport. Arterioscler Thromb
Vase Biol 24 1150-1160.
Song M, Shao H, Mujeeb A, James TL & Miller WL (2001) Molten-globule structure
and membrane binding of the N-terminal protease-resistant domain (63-193) of the
steroidogenic acute regulatory protein (StAR). BiochemJ356 151-158.
Spinella DG, Bernardino AK, Redding AC, Koutz P, Wei Y, Pratt EK, Myers KK,
Chappell G, Gerken S & McConnell SJ (1999) Tandem arrayed ligation of expressed
sequence tags (TALEST): a new method for generating global gene expression profiles.
Nucleic Acids Res 27 e22.
Stefkova J, Poledne R & Hubacek JA (2004) ATP-binding cassette (ABC) transporters in
human metabolism and diseases. Physiol Res 53 235-243.
Stevens VL, Xu T & Lambeth JD (1992) Cholesterol pools in rat adrenal mitochondria:
use of cholesterol oxidase to infer a complex pool structure. Endocrinology 130 15571563.
Stigter D, Alonso DO & Dill KA (1991) Protein stability: electrostatics and compact
denatured states. Proc Natl Acad Sci USAS8 4176-4180.
152
Stocco DM (1997a) A StAR search: implications in controlling steroidgenesis. Biol
Reprod 56 328-336.
Stocco DM (1997b) The steroidogenic acute regulatory (StAR) protein two years later.
An update. Endocrine 6 99-109.
Stocco DM (1998) A review of the characteristics of the protein required for the acute
regulation of steroid hormone biosynthesis: the case for the steroidogenic acute
regulatory (StAR) protein. Proc Soc Exp Biol Med 217 123-129.
Stocco DM (2000) The role of the StAR protein in steroidogenesis: challenges for the
future. J Endocrinol 164 247-253.
Stocco DM (2001a) StAR protein and the regulation of steroid hormone biosynthesis.
Annu Rev Physiol 63 193-213.
Stocco DM (2001b) Tracking the role of a star in the sky of the new millennium. Mol
Endocrinol 15 1245-1254.
Stocco DM (2002) Clinical disorders associated with abnormal cholesterol transport:
mutations in the steroidogenic acute regulatory protein. Mol Cell Endocrinol 191 19-25.
Stocco DM & Ascoli M (1993) The use of genetic manipulation of MA-10 Leydig tumor
cells to demonstrate the role of mitochondrial proteins in the acute regulation of
steroidogenesis. Endocrinology 132 959-967.
Stocco DM & Chen W (1991) Presence of identical mitochondrial proteins in
unstimulated constitutive steroid-producing R2C rat Leydig tumor and stimulated
nonconstitutive steroid-producing MA-10 mouse Leydig tumor cells. Endocrinology 128
1918-1926.
Stocco DM & Clark BJ (1996) Regulation of the acute production of steroids in
steroidogenic cells. Endocr Rev 17 221-244.
Stocco DM & Clark BJ (1997) The role of the steroidogenic acute regulatory protein in
steroidogenesis. Steroids 62 29-36.
Stocco DM, Clark BJ, Reinhart AJ, Williams SC, Dyson M, Dassi B, Walsh LP, Manna
PR, Wang XJ, Zeleznik AJ, et al. (2001) Elements involved in the regulation of the StAR
gene. Mol Cell Endocrinol 111 55-59.
Stocco DM & Kilgore MW (1988) Induction of mitochondrial proteins in MA-10 Leydig
tumour cells with human choriogonadotropin. Biochem J 249 95-103.
153
Stocco DM & Sodeman TC (1991) The 30-kDa mitochondrial proteins induced by
hormone stimulation in MA-10 mouse Leydig tumor cells are processed from larger
precursors. J Biol Chem 266 19731-19738.
Stocco DM, Wang X, Jo Y & Manna PR (2005) Multiple signaling pathways regulating
steroidogenesis and steroidogenic acute regulatory protein expression: more complicated
than we thought. Mol Endocrinol 19 2647-2659.
Strauss JF, 3rd, Kallen CB, Christenson LK, Watari H, Devoto L, Arakane F, Kiriakidou
M & Sugawara T (1999) The steroidogenic acute regulatory protein (StAR): a window
into the complexities of intracellular cholesterol trafficking. Recent Prog Horm Res 54
369-394; discussion 394-365.
Strauss JF, 3rd, Kishida T, Christenson LK, Fujimoto T & Hiroi H (2003) START
domain proteins and the intracellular trafficking of cholesterol in steroidogenic cells. Mol
Cell Endocrinol 202 59-65.
Sturley SL, Patterson MC, Balch W & Liscum L (2004) The pathophysiology and
mechanisms of NP-C disease. Biochim Biophys Acta 1685 83-87.
Sugawara T, Holt JA, Driscoll D, Strauss JF, 3rd, Lin D, Miller WL, Patterson D, Clancy
KP, Hart IM, Clark BJ, et al. (1995a) Human steroidogenic acute regulatory protein:
functional activity in COS-1 cells, tissue-specific expression, and mapping of the
structural gene to 8p 11.2 and a pseudogene to chromosome 13. Proc Natl Acad Sci USA
92 4778-4782.
Sugawara T, Holt JA, Kiriakidou M & Strauss JF, 3rd (1996) Steroidogenic factor 1dependent promoter activity of the human steroidogenic acute regulatory protein (StAR)
gene. Biochemistry 35 9052-9059.
Sugawara T, Kiriakidou M, McAllister JM, Kallen CB & Strauss JF, 3rd (1997) Multiple
steroidogenic factor 1 binding elements in the human steroidogenic acute regulatory
protein gene 5'-flanking region are required for maximal promoter activity and cyclic
AMP responsiveness. Biochemistry 36 7249-7255.
Sugawara T, Lin D, Holt JA, Martin KO, Javitt NB, Miller WL & Strauss JF, 3rd (1995b)
Structure of the human steroidogenic acute regulatory protein (StAR) gene: StAR
stimulates mitochondrial cholesterol 27-hydroxylase activity. Biochemistry 34 1250612512.
Sugawara T, Nomura E, Sakuragi N & Fujimoto S (2001) The effect of the
arylhydrocarbon receptor on the human steroidogenic acute regulatory gene promoter
activity. J Steroid Biochem Mol Biol 78 253-260.
Sun G, Porter W & Safe S (1998) Estrogen-induced retinoic acid receptor alpha 1 gene
expression: role of estrogen receptor-Spl complex. Mol Endocrinol 12 882-890.
154
Swietnicki W (2006) Folding aggregated proteins into functionally active forms. Curr
Opin Biotechnol 17 367-372.
Syed AA & Weaver JU (2005) Glucocorticoid sensitivity: the hypothalamic-pituitaryadrenal-tissue axis. Obes Res 13 1131-1133.
Tall AR (1998) An overview of reverse cholesterol transport. Eur Heart J 19 Suppl A
A31-35.
Tamm LK (1986) Incorporation of a synthetic mitochondrial signal peptide into charged
and uncharged phospholipid monolayers. Biochemistry 25 7470-7476.
Tappy L (1999) Metabolic effects of glucocorticoids: the unfinished story. Eur J Clin
Invest 29 814-815.
Tee MK, Lin D, Sugawara T, Holt JA, Guiguen Y, Buckingham B, Strauss JF, 3rd &
Miller WL (1995) T—>A transversion 11 bp from a splice acceptor site in the human
gene for steroidogenic acute regulatory protein causes congenital lipoid adrenal
hyperplasia. Hum Mol Genet 4 2299-2305.
Towbin H, Staehelin T & Gordon J (1979) Electrophoretic transfer of proteins from
polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl
AcadSci USA76 4350-4354.
Tsujishita Y & Hurley JH (2000) Structure and lipid transport mechanism of a StARrelated domain. Nat Struct Biol 7 408-414.
Tuckey RC, Headlam MJ, Bose HS & Miller WL (2002) Transfer of cholesterol between
phospholipid vesicles mediated by the steroidogenic acute regulatory protein (StAR). J
Biol Chem 277 47123-47128.
Vaidehi N, Floriano WB, Trabanino R, Hall SE, Freddolino P, Choi EJ, Zamanakos G &
Goddard WA, 3rd (2002) Prediction of structure and function of G protein-coupled
receptors. Proc Natl Acad Sci USA 99 12622-12627.
Venepally P & Waterman MR (1995) Two Spl-binding sites mediate cAMP-induced
transcription of the bovine CYP11A gene through the protein kinase A signaling
pathway. J Biol Chem 270 25402-25410.
Verrey F (1998) Early aldosterone effects. Exp Nephrol 6 294-301.
Wang CY & Wang YB (2006) [Advances in the study of steroidogenic acute regulatory
protein]. Zhonghua Nan KeXue 12 733-736.
Wang N, Ranalletta M, Matsuura F, Peng F & Tall AR (2006) LXR-induced
redistribution of ABCG1 to plasma membrane in macrophages enhances cholesterol mass
efflux to HDL. Arterioscler Thromb Vase Biol 26 1310-1316.
155
Wang X, Walsh LP & Stocco DM (1999) The role of arachidonic acid on LH-stimulated
steroidogenesis and steroidogenic acute regulatory protein accumulation in MA-10
mouse Ley dig tumor cells. Endocrine 10 7-12.
Watari H, Arakane F, Moog-Lutz C, Kallen CB, Tomasetto C, Gerton GL, Rio MC,
Baker ME & Strauss JF, 3rd (1997) MLN64 contains a domain with homology to the
steroidogenic acute regulatory protein (StAR) that stimulates steroidogenesis. Proc Natl
Acad Sci USA94 8462-8467.
Watari H, Blanchette-Mackie EJ, Dwyer NK, Sun G, Glick JM, Patel S, Neufeld EB,
Pentchev PG & Strauss JF, 3rd (2000) NPC1-containing compartment of human
granulosa-lutein cells: a role in the intracellular trafficking of cholesterol supporting
steroidogenesis. Exp Cell Res 255 56-66.
Weisiger R, Gollan J & Ockner R (1981) Receptor for albumin on the liver cell surface
may mediate uptake of fatty acids and other albumin-bound substances. Science 211
1048-1051.
Wojcik-Gladysz A, Nowak KW, Pierzchala-Koziec K, Wankowska M, Misztal T,
Polkowska J, Nowak M, Kaczmarek P, Gorska T, Szczepankiewicz D, et al. (2006)
Aspects of central and peripheral regulation of reproduction in mammals. Reprod Biol 6
Suppl 1 89-103.
Wooton-Kee CR & Clark BJ (2000) Steroidogenic factor-1 influences proteindeoxyribonucleic acid interactions within the cyclic adenosine 3,5-monophosphateresponsive regions of the murine steroidogenic acute regulatory protein gene.
Endocrinology 141 1345-1355.
Yaworsky DC, Baker BY, Bose HS, Best KB, Jensen LB, Bell JD, Baldwin MA & Miller
WL (2005) pH-dependent Interactions of the carboxyl-terminal helix of steroidogenic
acute regulatory protein with synthetic membranes. J Biol Chem 280 2045-2054.
Zager PG, Luetscher JA, Hsueh WA, Chavarri MR & Dowdy AJ (1979)
Adrenocorticotropin-stimulated secretion of aldosterone and Cortisol, computed from
plasma and red blood cell measurements. J Clin Endocrinol Metab 48 441-450.
Zagrovic B, Jayachandran G, Millett IS, Doniach S & Pande VS (2005) How large is an
alpha-helix? Studies of the radii of gyration of helical peptides by small-angle X-ray
scattering and molecular dynamics. JMol Biol 353 232-241.
Zannis VI, Chroni A & Krieger M (2006) Role of apoA-I, ABCA1, LCAT, and SR-BI in
the biogenesis of HDL. JMol Med 84 276-294.
Zazopoulos E, Lalli E, Stocco DM & Sassone-Corsi P (1997) DNA binding and
transcriptional repression by DAX-1 blocks steroidogenesis. Nature 390 311-315.
156
Zee CS, Go JL, Kim PE, Mitchell D & Ahmadi J (2003) Imaging of the pituitary and
parasellar region. Neurosurg Clin N Am 14 55-80, vi.