Role of 17β-hydroxysteroid dehydrogenase type 5

ROLE OF 17β-HYDROXYSTEROID DEHYDROGENASE TYPE 5
IN BREAST CANCER STUDIED BY INTRACRINOLOGY
Thèse
DAN XU
Doctorat en physiologie-endocrinologie
Philosophiae Doctor (Ph.D.)
Québec Canada
© Dan Xu, 2015
RÉSUMÉ COURT
Le cancer du sein (BC) est la deuxième cause de décès relié au cancer chez les femmes.
Son incidence continue d'augmenter en particulier chez les femmes post-ménopausées.
L’exploration de la pathogenèse et la recherche de nouveaux traitements restent des
points d’intérêt. L'expression et le rôle de la 17β-HSD5 (AKR1C3) sont controversés.
Ici, nous avons répondu à la question si la 17β-HSD5 est une cible potentielle pour le
traitement du BC et nous avons comparé son expression chez des échantillons de
tumeurs mammaires et des tissus normaux. De plus, nous avons proposé qu’une plus
faible expression d’AKR1C3 puisse être utilisée comme biomarqueur pour un pronostic
du BC. Nous suggérons de fournir du DHEA comme source d'hormone
intracrinologique et de comparer le rôle des enzymes en utilisant la DHEA et leurs
substrats directs. La provision de DHEA est un bon choix pour mimer un état
post-ménopausique dans le métabolisme cellulairedes stéroïdes.
III
SHORT SUMMARY
Breast cancer (BC) is the second leading cause of cancer death in western women. Its
incidence continues to increase, especially in post-menopausal women. Exploring the
pathogenesis and seeking new treatments remain hotspots. In spite of the increasing
number of studies on 17β-hydroxysteroid dehydrogenases (17β-HSDs), the expression
and role of 17β-HSD5 (AKR1C3) remain controversial. Here we answered the question
whether 17β-HSD5 is a possible target for BC therapy and made the comparison of
AKR1C3 expression in normal breast and tumor samples. In addition, we propose that
the lower expression of AKR1C3 is a biomarker for poor prognostic in breast cancer.
We suggest to provide DHEA as intracrinological hormone source and to compare the
role of steroid-converting enzymes using DHEA and their direct substrates. We
demonstrated that provision of DHEA was a good choice to mimic postmenopausal
condition in steroid metabolism in cell culture.
V
RÉSUMÉ LONG
Dans cette thèse, je présente une étude (1) du rôle de la 17β-HSD5 dans la modulation
des taux d'hormones et dans la prolifération, et l'impact de l'expression de la 17β-HSD5
sur d’autres protéines de BC cellules; (2) une étude comparative sur trois enzymes
(17β-HSD1, 17β-HSD7 et 3α-HSD3) avec la provision de DHEA et ses substrats
directes soit l’E1 ou la DHT. Les principaux résultats obtenus dans cette étude sont les
suivants: (1) en utilisant l'ARN d’interférence de la 17β-HSD5, des immunodosages
enzymatiques et des tests de prolifération de cellules démontrent que l'expression de la
17β-HSD5 est positivement corrélée à un niveau de T et de DHT dans les BCC, mais
négativement corrélée pour l’E2 et la prolifération des cellules de BC (2) les analyses
quantitatives de PCR en temps réel et de Western blot ont démontré que l’inhibition de
l’expression de la 17β-HSD5 régule à la hausse l'expression de l'aromatase dans les
cellules MCF-7. (3) L’analyse d’ELISA de la prostaglandine E2 a vérifié que
l'expression accrue de l'aromatase a été modulée par des niveaux élevés de PGE2 après
l’inactivation de l’expression du gène de la 17β-HSD5. (4) Le test de cicatrisation a
montré que l’inactivation de l’expression du gène de la 17β-HSD5 favorise
l’augmentation de la migration cellulaire. (5) L'expression du gène 17β-HSD5 dans des
échantillons cliniques, à partir de l'analyse de base de données ONCOMINE, a montré
que sa plus faible expression a été corrélée avec le statut de l’HER-2 et de la métastase
de la tumeur. (6) Les données protéomiques révèlent également que des protéines
impliquées dans les voies métaboliques sont fortement exprimées dans les cellules
MCF-7 après l’inactivation de l’expression du gène de la 17β-HSD5. (7) L’étude n'a
démontré aucune différence dans la fonction biologique de la 17β-HSD1 et de la
17β-HSD7 lorsqu'elles sont cultivées avec différentes stéroïdes: tel que les niveaux de
stéroides, la prolifération cellulaire et les protéines régulées. (8) Toutefois, la
supplémentation du milieu de culture se révèle avoir un impact marqué sur l'étude de la
3α-HSD3. (9). Nous avons proposé que l'utilisation de la DHEA comme source
d'hormone puisse entraîner une meilleure imitation des conditions physiologiques
VII
post-ménopausales en culture cellulaire selon l’intracrinologie.
VIII
LONG SUMMARY
Human 17β-hydroxysteroid dehydrogenase type 5 (17β-HSD5) mainly synthesizes
the activate androgen testosterone (T) from △4-androstenedione (4-dione), then 4-dione
and T aromatazion to estrone (E1) and estradiol (E2) by the action of aromatase.
17β-HSD1 and 7 catalyze the formation of E2 from E1 and inactivate androgen
dihydrotestosterone (DHT). In this thesis, I present the study of (1) the roles of
17β-HSD5 in the modulation of hormone levels and in the proliferation. and the
proteomic study of the impact of the 17β-HSD5 knock down in BCC; (2) a comparative
study of three enzymes (17β-HSD1，7 and 3α-HSD3) with the provision of DHEA and
the direct substrates, E1 or DHT. The main results obtained in this study are as follow:
(1) Using RNA interference of 17β-HSD5, enzyme immunoassays, and cell
proliferation assays demonstrate that 17β-HSD5 expression is positively correlated
with T and DHT levels in BCC, but negatively correlated with E2 levels, and BCC
proliferation. (2) Quantitative real-time PCR analyzes and western blot showed that
17β-HSD5 knockdown up-regulates aromatase expression in MCF-7 cells. (3)
Prostaglandin E2 ELISA assay verified that aromatase expression increase was
modulated by elevated PGE2 levels after 17β-HSD5 knockdown. (4) Wound healing
assay showed that with the knockdown of 17β-HSD5 expression, cell migration
increased. (5)17β-HSD5 gene expression in clinical samples from ONCOMINE
analysis showed its lower expression was correlated with HER-2 status and tumor
metastasis. (6) The proteomic data also reveal that proteins involved in metabolic
pathways are highly expressed in 17β-HSD5 knockdown MCF-7 cells. (7) Cell biology
study showed no difference in biological function for 17β-HSD1 and 17β-HSD7 when
cultured with different steroids cell proliferation and estradiol levels decreased,
whereas DHT accumulated; cyclin D1, PCNA, and pS2 were down-regulated after
knocking down these two enzymes. (8) The culture medium supplementation was
found to have a marked impact on the study of 3α-HSD3. (9) We first proposed that
IX
using DHEA as hormone source may result in better mimicking of the physiological
conditions of post-menopausal in cell culture according intracrinology.
X
TABLE OF CONTENTS
RÉSUMÉ COURT ......................................................................................................... III
SHORT SUMMARY ...................................................................................................... V
RÉSUMÉ LONG ..........................................................................................................VII
LONG SUMMARY ....................................................................................................... IX
List of Publication ........................................................................................................ XV
Foreword .................................................................................................................... XVII
ACKNOWLEDGEMENTS ........................................................................................ XIX
List of Tables .............................................................................................................. XXI
List of Figures .......................................................................................................... XXIII
List of Abbreviations ................................................................................................ XXV
CHAPTER Ⅰ ................................................................................................................. 1
GENERAL INTRODUCTION ........................................................................................ 1
1.1 Breast cancer emergence and impact factor ........................................................ 3
1.2. Origins of estradiol ............................................................................................. 8
1.3. Enzymes involved in the synthesis of estradiol ............................................... 11
1.3.1. Aromatase ..................................................................................................... 11
1.3.2. Steroid sulfatase ............................................................................................ 11
1.3.3. 17β-HSDs ...................................................................................................... 13
1.3.3.1. 17β-HSD1 .................................................................................................. 13
1.3.3.2. 17β-HSD7 .................................................................................................. 14
1.3.3.3. 17β-HSD5 .................................................................................................. 14
1.3.4 3α-HSD3 ........................................................................................................ 15
1.4. Anti-estrogen approaches for breast cancer endocrine therapy and prevention
................................................................................................................................. 16
1.4.1 Selective estrogen receptor modulators ......................................................... 16
1.4.2 Aromatase Inhibitors (AIs) ............................................................................ 18
1.4.3. Selective estrogen receptor down regulator (fulvestrant) ............................. 21
1.4.4. Steroid sulfatase inhibitors ............................................................................ 23
1.4.5. 17β-HSDs inhibitors...................................................................................... 23
XI
1.5. Working hypothesis and Research Objectives ................................................. 23
1.5.1. Hypothesis ..................................................................................................... 23
1.5.2. Objectives ...................................................................................................... 25
Chapter Ⅱ ..................................................................................................................... 27
Hypo-expression of AKR1C3 in breast tumors undergoes further reduction with
metastasis: the enzyme knockdown up-regulates aromatase by increasing PGE2 ........ 27
2.1 Résumé en français ............................................................................................ 29
2.2. Summary........................................................................................................... 31
Article 1
Hypo-expression of AKR1C3 in breast tumors undergoes further reduction with
metastasis: the enzyme knockdown up-regulates aromatase by increasing PGE2 .. 33
Chapter Ⅲ ..................................................................................................................... 65
Proteomic study reveals that the knockdown of 17beta-hydroxysteroid dehydrogenase
type 5 in MCF-7 cells up-regulates proteins such as GRP78 and enhances breast cancer
cell development ............................................................................................................ 65
3.1 Résumé en français ............................................................................................ 67
3.2. Summary........................................................................................................... 69
Article 2
Proteomic study reveals that 17beta-hydroxysteroid dehydrogenase type 5
knockdown in MCF-7 cells up-regulates proteins such as GRP78 and enhances
breast cancer cell development ................................................................................ 71
Chapter Ⅳ ................................................................................................................... 107
Mimicking postmenopausal steroid metabolism in breast cancer cell culture:
differences in response to DHEA or other steroids as hormone sources ..................... 107
4.1. Résumé en français ......................................................................................... 109
4.2. Summary......................................................................................................... 111
Article 3
Mimicking postmenopausal steroid metabolism in breast cancer cell culture:
differences in response to DHEA or other steroids as hormone sources............... 113
Chapter V ..................................................................................................................... 145
XII
DISCUSSION AND GENERAL CONCLUSION ...................................................... 145
REFERENCES ...................................................................................................... 153
XIII
List of Publication
1. Dan Xu and Sheng-Xiang Lin. Mimicking postmenopausal steroid metabolism in
breast cancer cell culture: differences in response to DHEA or other steroids as
hormone sources. J. Steroid Biochem. Mol. Biol. 2015 Jul 19. pii:
S0960-0760(15)30022-4. doi: 10.1016/j.jsbmb.2015.07.009.
2. Dan Xu, Tang li, Xiaoqiang Wang, Sheng-Xiang Lin. Hypo-expression of
AKR1C3 in breast tumors undergoes further reduction with metastasis: the enzyme
knockdown up-regulates aromatase by increasing PGE2. (article under
submission)
3. Dan Xu and Sheng-Xiang Lin. Proteomic study reveals that the knockdown of
17beta-hydroxysteroid dehydrogenase type 5 in MCF-7 cells up-regulated proteins
such as GRP78 and enhance breast cancer cell development. (article under
submission)
XV
Foreword
This thesis is submitted to the “Faculté des études supérieures de l'Université Laval”
for the requirement of a doctor’s degree in science. Except for the short and long
summaries and the abstract of each article, which are in French, the thesis is written in
English in the form of three scientific manuscripts. One article has been accepted by J.
Steroid Biochem. Mol. Biol. and is now under revision. The other two are being
submitted for publication or in preparation.
In chapter I, the general introductory section, the breast cancer incidence, emergence
and impact factor were reviewed. The estradiol synthesis and the enzymes involved in
such synthesis, especially 17β-HSD 1, 17β-HSD 5 and 17β-HSD 7, are summarized.
Anti-estrogen approaches for breast cancer endocrine therapy and prevention now used
are also discussed. Working hypothesis and research objectives are described at the end
of this chapter.
Chapter II contains an article in preparation, presenting the use of DHEA as hormone
source and the use of 17β-HSD5 specific small interfering RNAs (siRNAs) to silence
17β-HSD5 gene transcription selectively. It is demonstrated that expression of
17β-HSD5 is reduced in breast tumor cells, and undergoes further reduction with
metastasis. The enzyme knockdown up-regulates aromatase by PGE2 increasing cell
proliferation, significantly increases estradiol levels, and induce cell cycle progression.
Chapter III contains an article in preparation presenting proteomic study results, which
reveal that proteins involved in metabolic pathways are highly expressed in breast
cancer
cells
with
17β-HSD5
knockdown.
Especially,
the
expression
of
glucose-regulated protein (GRP78) and phosphoglycerate kinase 1 (PGK1) were
significantly elevated. These enzymes can be potent therapeutic targets for breast
XVII
cancer. In chapter IV we used three target human enzymes, 17β-HSD 1, 17β-HSD 7
and 3α-HSD3 to analyze their functional differences by providing DHEA and other
steroids as hormone source. We demonstrated that provision of different steroids as
substrates or hormone sources may promote modified biological effects. In cell culture,
provision of DHEA is a proper choice to mimic postmenopausal condition in steroid
metabolism. The conclusion is summarized in chapter V.
All experimental work in each publication was my individual contribution, except that
Tang Li analyzed and processed the clinical raw data from ONCOMINE database in
the chapter II.
The references of chapters I and V are listed at the end. References of publications are
listed after the text of each article.
XVIII
ACKNOWLEDGEMENTS
I would like to express my immeasurable gratitude to my director of research, professor
Sheng-Xiang Lin, for accepting me as a PhD candidate. My educational background is
internal medicine and major in hematology and oncology. I was not familiar with
research. During my period of study for this degree, it was his meticulous guidance,
enlightening discussions and continual encouragement that opened my interests,
established confidence in research that enabled me to present this thesis. I have learned
a lot from him: not only on fundamental theories of breast cancer endocrinology, new
targets for therapies and on approaches to scientific research, but also on the
importance of hard work and his tireless insistence on scientific research and
independently thinking. I believe that the attitudes and skills I have acquired will be
beneficial for my entire life and future career.
I was fortunate to have Dr. Sylvie Mader, Dr. Jacques Huot and Dr. Donald Poirier as
the reviewers of my thesis.
I would like to thank all the professors and professional staff of our research center, and
all the graduate students and postdoctoral fellows, who kindly helped me when I had
questions, doubts or problems. Thank Jean-Francois Theriault for helping of my French
writing and thank Alessander Laurentino and Preyesh Stephen for my English revision.
I also thank all the members of my research group: Ming Zhou, Dao-Wei Zhu for their
help in familiar with the surroundings; thank you Mouna Zerradi, Xiao-Qiang Wang
and Jian Song for giving me some suggestions on my research. I also shall remember
friendship with them and with Hui Han, Rui-Xuan Wang and Xin-Xia Liang.
XIX
Four years of financial support from China Scholarship Council (CSC) were of
unimaginable value. It would have been impossible for me to study abroad without
their financial support.
Finally, I am very grateful to my family, especially to my parents in China, who always
showed their love, encouragement and support to me during my studies.
XX
List of Tables
Table 3. 1 Sequences of 17β-HSD5 and GRP78 specific siRNA ......................... 103
Table 3.2 Mass spectrometry identification of proteins spot upregulated in
MCF-7-17β-HSD5 siRNA as compare to MCF-7 control siRNA * .... 105
Table 4. 1 Sequences of 17β-HSD1 and 17β-HSD7 specific siRNAs ...................... 135
Table 4. 2 Primers used in RT-PCR ...................................................................... 135
XXI
List of Figures
Figure 1. 1 The percentage of all estimated new cancer cases and death in women
in 2015. .............................................................................................................. 4
Figure 1. 2 Average number of new cases per year and age-specific incidence rates
per 100,000 population, Females, UK. ............................................................. 5
Figure 1. 3 The biological effects of estardiol (E2) are mediated through at least
four ER pathway. .............................................................................................. 7
Figure 1. 4 Schematic representation of DHEA as the unique source of sex steroid
in women after menopause.
........................................................................... 9
Figure 1. 5 Human steroidogenic and steroid-inactivating enzymes in peripheral
intracrine tissues.
......................................................................................... 10
Figure 1. 6 Proposed regulation of aromatase gene expression in breast adipose
tissue. ............................................................................................................. 12
Figure 1. 7 A model for the action of SERMs (such as tamoxifen) through estrogen
response element (ERE)-dependent and non-ERE-dependent (e.g.
API-tethered) pathways in target tissues.
.................................................... 17
Figure 1. 8 Mechanism of action of aromatase inhibitors and tamoxifen. ............ 20
Figure 1. 9 Mechanism of action of fulvestrant.
................................................. 22
Figure 2. 1 AKR1C3 expression and siRNA knockdowm. . .................................. 55
Figure 2. 2 Modulation of cell cycle, cell proliferation migration. . ....................... 56
Figure 2. 3 Relationship between the expression of AKR1C3 and aromatase.
Figure 2. 4 Schematic representation of AKR1C3 knockdown.
.. 58
. ........................ 60
Figure 2. 5 AKR1C3 expression levels in breast cancer tissues. . ....................... 61
Figure 3. 1 Representative 2-D gel images for MCF-7 cells and 17β-HSD5
knock-down MCF-7 cells showing some differentially expressed spots. . ..... 93
Figure 3. 2 Functions of the proteins differentially expressed in 17β-HSD5 knock
down and parental MCF-7 cells. ..................................................................... 94
XXIII
Figure 3. 3 The first network:
.............................................................................. 95
Figure 3. 4 The second interaction network .......................................................... 96
Figure 3. 5 Protein ubiquitination pathway generated by the ingenuity pathway
analysis (IPA) software.
.............................................................................. 97
Figure 3. 6 Negative crosstalk between expression of 17β-HSD5 and GRP78. ... 98
Figure 3. 7 MCF-7 cell growth and E2 production.
. ........................................... 99
Figure 3. 8 The expression of PGK1 was up-regulated in 17β-HSD5 knockdown
MCF-7 cells. .............................................................................................. 100
Figure 4. 1 Simplified pathway showing human steroidogenic and
steroid-inactivating enzyme involved in the steroid metabolism pathway in
peripheral intracrine tissues. ........................................................................ 137
Figure 4. 2 Expression of 17β-HSD1 and 17β-HSD7 and knockdown effect by
siRNA. ........................................................................................................... 138
Figure 4. 3 Cell proliferation after transfection with siRNA. .............................. 139
Figure 4. 4 Effect of 17β-HSD1 and 17β-HSD7 knockdown on E2 and DHT
production.
................................................................................................. 140
Figure 4. 5 Cell cycle was evaluated by flow cytometry. ..................................... 141
Figure 4. 6 Cyclin D1, PCNA and pS2 expression in 17β-HSD1- or
17β-HSD7-knockdown cells compared with normal MCF-7 cells in response
to 1 μM DHEA, 0.5 nM E1S, or 0.1 nM E1 as hormone sources in the culture
medium. ......................................................................................................... 142
Figure 4. 7 Apoptosis-regualted proteins and cell viability................................... 143
XXIV
List of Abbreviations
△4-dione
△4-androstenedione
17β-HSD
17β-hydroxysteroid dehydrogenase
3β-diol
5α-androstane-3β,17β-diol
5-diol
androst-5-ene-3β,17β-diol
AIs
aromatase inhibitors
AKR
aldo-ketoreductase
BC
breast cancer
Bcl-2
B-cell lymphoma 2
CHOLS
cholesterol sulfate
CoA
co-activator molecules
DCIS
ductal carcinoma in situ
DHEA
dehydroepiandrosterone
DHEAS
dehydroepiandrosterone sulfate
DHT
dihydrotestosterone
E1S
estrogen sulfate
E2S
estradiol sulfate
ER
estrogen receptor
ERBB2/HER2
human epidermal growth factor receptor 2
EREs
estrogen responsive elements
ERα
estrogen receptor α
Estradiol
E2
Estrone
E1
FBS
fetal bovine serum
GRP78
glucose-regulated protein 78
H
hour
HSP
heat shock protein
XXV
IC50
half maximal inhibitory concentration
IDC
infiltrating ductal carcinoma
ILC
infiltrating lobular carcinoma
LCIS
lobular carcinoma in situ
M
metastasis
Min
minute
NAD+
nicotinamide adenine dinucleotide
NADPH
nicotinamide adenine dinucleotide phosphate
nm
nanometer
nM
nanomolar
NME1
nucleoside diphosphate kinase
OD
optical density
PAGE
polyacrylamide gel electro phoresis
PGE2
prostaglandin E2
PGK1
phosphoglycerate kinase
PI
propidium iodide
PRAP
prolactin receptor-associated protein
PREGS
pregnenolone sulfate
Q-RT-PCR
quantitative real-time PCR
RT-PCR
real-time PCR
S
second
SDR
short chain dehydrogenase/reductase
SDS
sodium dodecyl sulfate
SERDs
selective estrogen receptor down regulators
SERMs
selective estrogen receptor down modulators
siRNA
small interfering RNA
STS
steroid sulfatase
T
testosterone
UV
ultra-violet
mg
microgram
XXVI
ml
microliter
μM
micromolar
XXVII
CHAPTER Ⅰ
GENERAL INTRODUCTION
1.1 Breast cancer emergence and impact factor
Breast cancer (BC) is the most commom cancer among Canadian women. It is the
second leading cause of cancer death in women. BC can also occur in men, but it is not
common [1]. It is estimated that 25,000 women will be diagnosted BC in 2015 [2].
Figure 1.1 showed the percentage of all estimated new cancer cases and deaths in
women in 2015 [2]. Women diagnosted with BC often after age of 45, they most after
menopause [3]. Figure 1.2 showed Average number of new cases per year and
age-specific incidence rates per 100,000 Population, Females, UK [3].
BC emerges by a multistep process including the transformation of normal cells
through hyperplasia, precancerous lesions, in situ carcinoma, progression of primary
breast cancer and metastasis formation. In this developmental process, the hormones
estrogen and hormones, acting through their receptors, stimulate cellular proliferation
by receptor-mediated signaling pathways as well as the accumulation of various genetic
alternation [4].
Estradiol (E2), the most potent estrogen, plays a critical role in tumor cellular
proliferation and cancer development [5], stimulating cellular proliferation through
nuclear receptor-mediated signaling pathways [6, 7]. E2, a small hydrophobic ligand
that can diffuse through the cell membrane, distributes throughout the cell and binds to
estrogen receptor α (ERα), which is located in the nucleus bound to heat shock protein
90 (hsp90). The binding of E2 to ERα induces a conformational change in the receptor,
which results in the dissociation of hsp90 and formation of the ER homodimer.
Subsequent interaction of the ER homodimer with estrogen responsive elements (EREs)
in the E2-responsive gene promoter leads to binding of co-activator molecules (CoA),
upregulating gene transcription and leading to cellular proliferation increase [6, 7] (ER
signaling pathway. Four distinct pathways of estrogen signaling through ER are shown
in Figure 1.3). Therefore, in the field of endocrine research, much emphasis has been
placed on functional studies of estrogen and estrogen receptor.
3
Figure 1. 1 The percentage of all estimated new cancer cases and death in women
in 2015. 25,000 women will be diagnosed with breast cancer. This represents 26% of
all new cancer cases in women in 2015. 5,000 women will die from breast cancer. This
represents 14% of all cancer deaths in women in 2015.
4
Figure 1. 2 Average number of new cases per year and age-specific incidence rates
per 100,000 population, Females, UK.
5
Tumorigenesis involves amplification of oncogenes and mutation or loss of tumor
suppressor genes by cytogenetic and molecular genetic analysis. For example, the
modification of predisposing genes (BRCA1, BRCA2, P53), oncogenes (c-myc, erbB2)
and growth factors (EGF, TGFa) is one of these mechanisms. These defets result in
atypical cellular proliferation and further progress to ductal carcinoma in situ, lobular
carcinoma in situ, infiltrating ductal carcinoma, infiltrating lobular carcinoma in a
multistep process [4].
6
Figure 1. 3 The biological effects of estardiol (E2) are mediated through at least
four ER pathway. Path 1 is called the classical genomic pathway; E2 bounds ER,
leading to its dimerization of the later. After a conformational change, ER binds to
EREs in regulatory regions to activate the transcription of target genes. Path 2 is the
ligand-independent pathway. In the E2-independent pathway, ER is activated through
phosphorylation
induced
by
growth
factors
(GF).
Path
3
describes
the
ERE-independent pathway, in which E2-ER complexes alter transcription of genes
containing alternative response elements. Path 4 highlights the nongenomic pathway,
which involves a small pool of ER located close to the membrane that, through
recruitment of protein kinases (e.g. Scr and PI3K, not shown), activates signaling
cascades.
7
1.2. Origins of estradiol
Estrogens in women are produced from two sources: 1) direct secretion from the
ovary; 2) conversion from the adrenal precursors dehydroepiandrosterone-sulfate
(DHEA-S), dehydroepiandrosterone (DHEA) and androstenedione in the peripheral
tissues [8, 9]. In premenopausal women, DHEA-S is produced exclusively by the
adrenal gland [10], and while 50% of DHEA is produced in the adrenal gland, 20% of
DHEA production occurs in the ovary and the other 30% by peripheral conversion of
DHEA-S by sulfatase [11]. Half of androstenedione is produced by the ovary and the
other half by the adrenals [8]. Interestingly, half of testosterone (T) in women is
produced via the peripheral conversion of androsterone [11]. In post-menopausal
women, the ovaries become atrophied and almost cease function, such that nearly all
E2 is produced in peripheral target tissues from precursor steroids of the adrenal
glands. Therefore, the aromatase and 17β-hydroxysteroid dehydrogenases (17β-HSDs)
are critical for E2 formation in these sites, particularly for postmenopausal
estrogen-dependent breast cancer [9]. These steroidogenic enzymes responsible for the
synthesis of all steroid hormones and are expressed in many peripheral tissues,
providing the basis for a new area in the study of hormone action, namely
intracrinology [9]. Intracrinology is a term coined in 1988, which describes the local
formation, action and inactivation of sex steroids from the inactive sex precursor
DHEA [10]. The best estimate of the intracrine formation of estrogens in peripheral
tissue of women is about 75% before menopausal and almost 100% after menopause [9,
13] Figure 1. 4 is a schematic representation of DHEA as the unique source of sex
steroid in women after menopause [13]. High amounts of DHEA secreted by the
adrenals, serving as precursor, are converted to various estrogens and androgens by the
action of steroid-converting enzymes expressed in peripheral tissue in the manner of
intracrinology (Figure 1.5 Human steroidogenic and steroid-inactivating enzyme in
peripheral intracrine tissue) [13]. Intracrine activity describes the formation of active
hormones that exert their action in the same cells in which synthesis tooks place
without release into the pericellular compartment. Therefore, steroid metabolizing
8
enzymes and their encoding genes may represent primary targets of novel therapies for
hormone-dependent cancers, especially breast cancer [9, 14].
Figure 1. 4 Schematic representation of DHEA as the unique source of sex steroid
in women after menopause. In pre-menopausal women about 20% is circulating
DHEA that released from the ovary and approximately 80% is of adrenal origin. After
the menopause, the ovaries atrophy and lose their secretory function. All estrogens and
androgens are then made locally from DHEA in peripheral target tissues. Thus, DHEA
becomes
the
unique
gonadotropin-releasing
source
hormone;
of
estrogens
LH,
after
menopause.
GnRH,
luteinizing
hormone;
CRH,
corticotropin-releasing hormone; ACTH, an adrenocorticotropic hormone. (Labrie F
and Labrie C. 2013)
9
Figure 1. 5 Human steroidogenic and steroid-inactivating enzymes in peripheral
intracrine tissues. 4-dione, androstenedione; A-dione, 5α-androstane-3,17-dione; ADT,
androsterone; epi-ADT, epiandrosterone; E1, estrone; E1-S, estrone sulfate; E2,
17β-estradiol; E2-S, estradiol sulfate; 5-diol, androst-5-ene-3β, 17β-diol; 5-diol-FA,
5-diol fatty acid; 5-diol-S, 5-diol sulfate; HSD, hydroxysteroid dehydrogenase; testo,
testosterone; RoDH-1, Ro dehydrogenase 1; ER, estrogen receptor; AR, androgen
receptor; UGT2B28, uridine glucuronosyl transferase 2B28; Sult2B1, sulfotransferase
2B1; UGT1A1, uridine glucuronosyl transferase 1A1 (Labrie F and Labrie C, 2013)
10
1.3. Enzymes involved in the synthesis of estradiol
1.3.1. Aromatase
Aromatase is an enzyme belonging to the cytochrome P-450 superfamily. Aromatase is
expressed from the CYP19 gene [15]. In humans, aromatase is expressed in cells such
as the ovarian granulosa cells, the placental syncytiotrophoblast, the testicular Leydig
cells, and the brain and skin fibroblasts [16]. Additionally, aromatase is expressed in
the human adipose tissue. However, the highest levels of aromatase are in the ovarian
granulosa cells in pre-menopausal women, the adipose tissue becoming the
predominant site expressing aromatase after the menopause [17-18]. The expression of
aromatase is regulated in a tissue-specific manner by promoters that are in turn
controlled by hormones, cytokines, and other factors [19–21]. Estrogen-dependent BC
uses four promoters (Ⅱ, Ⅰ.3, Ⅰ.7, andⅠ.4) to regulate the expression of aromatase
[22]. PromoterⅠ.4 regulates aromatase gene expression by cytokines. Malignant breast
epithelial cells secrete factors that induce aromatase expression in adipose fibroblasts
and in fibroblasts of the tumor itself via promoter Ⅱ [23].One possible factor is
prostaglandin E2 (PGE2), which is produced by malignant breast epithelium as well as
by macrophages recruited to the tumor site [23]. (Figure 1.6 proposes regulation of
aromatase gene expression in breast adipose tissue from cancer-negative and -positive
subjects). The enzyme aromatase is responsible for synthesis of estrogens estrone (E1)
from the preferred substrate androstenedione and of estradiol from testosterone.
Aromatase inhibitors work by inhibiting the action of the enzyme in this process [24].
1.3.2. Steroid sulfatase
Steroid sulfatase (STS) is widely distributed throughout the body and it involved in
physiological processes and pathological conditions [25]. STS is a member of the
mammalian sulfatase superfamily. The substrates of STS include cholesterol sulfate
11
(CHOLS), pregnenolone sulfate (PREGS), dehydroepiandrosterone sulfate (DHEAS)
and estrogen sulfate (E1S) [26-28]. It was revealed that the expression of STS in the
breast is significantly higher than in normal tissues, which suggests that the STS might
be a potent target for breast cancer treatment [29].
Figure 1. 6 Proposed regulation of aromatase gene expression in breast adipose
tissue.In cancer-free individuals, the expression is stimulated primarily by class I
cytokines and TNFα produced locally in the presence of systemic glucocorticoids.
Promoter I.4–specific transcripts of aromatase predominate. In breast cancer, PGE2
produced by the tumorous epithelium, tumor-derived fibroblasts, and/or macrophages
recruited to the tumor site becomes the major factor stimulating aromatase expression,
indicated by the predominance of promoter II and I.3–specific transcripts of aromatase.
(Simpson ER, et al. Annu.Rev.Physiol.2002.64:93-129)
12
1.3.3. 17β-HSDs
17β-Hydroxysteroid dehydrogenases (17β-HSDs) are NADPH/NAD+-dependent
oxidoreductases that play a significant role in estrogen and androgen metabolism [30].
Until now, fourteen different isoforms of 17β-HSDs have been identified in mammals
[31-33]. Exceptionally, 17β-HSD5 belongs to the aldo-ketoreductase (AKR), while all
other 17β-HSDs belong to the short chain dehydrogenase/reductase (SDR) protein
family [34-35]. The participation of several types of 17β-HSDs in the pathophysiology
of human diseases has been suggested, and some of them were reported to play roles in
breast cancer. 17β-HSD types 1, 5, 7 are the most important reductive enzymes in the
synthesis of estrogens.
1.3.3.1. 17β-HSD1
17β-HSD1 catalyzes the activation of estrone (E1) to the most potent estrogen
17β-estradiol (E2) (Fig.1.3) [36]. E2 is known to have a critical role in the development
of estrogen-dependent diseases. 17β-HSD1 mRNA expression levels and its induced
E2/E1 ratio were significantly higher in postmenopausal than in premenopausal breast
cancer [37], 17β-HSD1 catalysis also the inactivation of the potent androgen
dihydrotestosterone (DHT) into 5α-androstane-3α/β, 17β-diol (3α/β-diol). This
demonstrates its importance in BC cells due to the anti-proliferation effect of DHT that
has been found in estrogen-dependent breast cancer cell lines （MCF-7 and ZR-75-1）
[38-40]. 17β-HSD1 up-regulates BC cell proliferation by a dual action on E2 synthesis
and DHT inactivation, and 17β-HSD1 can enhance the expression of estrogen
responsiveness gene pS2 [41]. High levels of 17β-HSD1 activity facilitate the E2
synthesis and DHT inactivation in BC cells. Thus, a potent inhibitor of 17β-HSD1
could open new possibilities in clinical endocrine therapy.
13
1.3.3.2. 17β-HSD7
17β-HSD7 is a membrane-associated reductive enzyme. It is another recently found
member of the family that can synthesize E2 and it was detected in humans in 1999
[42]. 17β-HSD7 was formerly named the prolactin receptor-associated protein (PRAP).
It was later established as a novel 17β-HSD, and named 17β-HSD7 [43-45]. This
enzyme has specificity for E1 conversion to E2 [44]. Recently, 17β-HSD7 was reported
to possess dual enzymatic activity; it also participates in cholesterol biosynthesis
[45-46]. Another interesting finding is the stimulation of 17β-HSD7 expression by E2
in MCF-7 cells [47]. Moreover, expression of the 17β-HSD7 gene is positively
correlated with tumor E2 levels in postmenopausal women [48]. Together, these data
provided convincing evidence that 17β-HSD7 is an essential enzyme for E2
biosynthesis in BC cells. Thus, 17β-HSD7 should be a potent target for breast cancer
treatment.
1.3.3.3. 17β-HSD5
17β-HSD5 is an essential enzyme in androgen conversion with roles in BC cells.
17β-HSD5 belongs to the aldo-keto reductase (AKR) superfamily [49] and is widely
expressed in human tissues including the prostate, endometrium and mammary gland
[50]. 17β-HSD5 synthesizes 5-diol from DHEA and catalyzes 4-Dione reduction to T,
which, when followed by aromatization by CYP19 aromatase, provides a route for E2
biosynthesis independent of 17β-HSD1. However, the expression of 17β-HSD5 and
its relationship with the E2 level is controversial. Some researchers found that
17β-HSD5 was detected in mammary glands of premenopausal women [51]. Vihko and
co-workers found that 17β-HSD5 mRNA expression was detected in the epithelial cells
of normal and malignant breast tissue specimens from both pre- and postmenopausal
women [52]. In fact, 65% of the samples expressed 17β-HSD5. Also, the expression of
17β-HSD5 was significantly higher in BC specimens than normal breast tissues [52].
14
Some researchers found that high 17β-HSD5 was related to the significantly higher risk
of late relapse in ER-positive BC patients [53]. Penning’s group found that
over-expression of 17β-HSD5 (AKR1C3) increases cellular proliferation in MCF-7
cells and also reduces the anti-proliferative effects of prostaglandins, particularly PGD2,
such that cellular proliferation can be inhibited by non-steroidal anti-inflammatory
drugs [54, 55]. However, other researchers held the opposite opinions: using
immunocytochemistry they studied the expression of 17β-HSD5 in 50 specimens of
breast carcinoma and adjacent non-malignant tissues. They found that 17β-HSD5 was
expressed in 56% of BC samples, indicating that the enzyme was significantly lower in
BC than in normal adjacent tissues [56]. Ben P. and co-workers found that the
expression of 17β-HSD5 was significantly lower in ER+ tumors compared with normal
tissues [57]. Therefore, the expression and the role of 17β-HSD5 in ER+ BC are not
entirely clear. Thus, further research is necessary to determine if 17β-HSD5 is a target
for BC treatment.
1.3.4 3α-HSD3
3α-Hydroxysteroid dehydrogenase type 3 (3α-HSD3) is a member of the aldo-keto
reductase (AKR) family, also named AKR1C2. The best known activity of 3α-HSD3 is
the transformation of the most potent natural androgen dihydrotestosterone (DHT) into
its much less active form, 5α-androstan-3α, 17β-diol (3α-diol) [58–59]. Because of the
importance of 3α-HSD3 in prostate growth, 3α-HSD3 was mostly studied in prostate
cancer cells. However, DHT also plays an important role in inhibiting BC cell
proliferation, as mentioned above. Therefore, 3α-HSD3 may be critical in BC
progression.
15
1.4. Anti-estrogen approaches for breast cancer endocrine therapy and prevention
1.4.1 Selective estrogen receptor modulators
Selective estrogen receptor modulators (SERMs) are therapeutic agents available for
the treatment of estrogen receptor-positive breast cancer. Three of the most known
SERMs are tamoxifen (Nolvadex), raloxifene (Evista) and toremifene (Fareston).
Figure 1.7 shows the model for the action of SERMs (tamoxifen and raloxifene) [60].
SERMs bind to ER and induce different conformational states that facilitate the
interaction of corepressors (CoR) to the ERE-driven promoter, which inhibits the
recruitment of the basal transcription machinery and thus inhibits transcription [60].
Tamoxifen, whose generic name is Nolvadex, is the oldest and most-prescribed
SERM. It is an E2 competing antagonist that binds to the estrogen receptors in breast
cells. Thus it prevents binding of estradiol onto its receptor and inhibits transcriptional
activity of the receptor. Tamoxifen is approved by the U.S. Food and Drug
Administration (FDA) to treat diagnosed hormone-receptor-positive early-stage BC
after surgery (and/or possibly chemotherapy and radiation) [61].
16
Figure 1. 7 A model for the action of SERMs (such as tamoxifen) through estrogen
response element (ERE)-dependent and non-ERE-dependent (e.g. API-tethered)
pathways in target tissues. Tamoxifen and raloxifene work as estrogen antagonists via
the ERE, but estrogen agonist via the AP-1 tethered pathway. (J.S. Lewis, V.C. Jordan.
Mutation Research 591.247-263.2005)
17
Tamoxifen, the first clinically relevant SERM, is an antagonist of ER in the breast
and has been used for more than 30 years to treat ER-positive breast cancer. It has been
firmly established that tamoxifen is used for both premenopausal and postmenopausal
BC adjuvant endocrine therapy. In women with ER BC, oral tamoxifen adjuvant
therapy can decrease the annual odds of recurrence by 39% and the annual odds of
death by 31%, regardless of the use of chemotherapy, patient age, menopausal status, or
axiliary lymph node status [62]. However, long-term oral tamoxifen has several side
effects, one of the worst being the increased risk of endometrial cancer because SERMs
are agonists in some tissues such as bone and liver, but are antagonists in other tissues
such as brain and breast. In fact, they have the double function of agonist/antagonist in
the uterus [60]. Tamoxifen has also other side effects: hot flushes and sweats, change in
menstrual periods, vaginal discharge, nausea and indigestion, weight gain, and
thrombosis, among others [63].
1.4.2 Aromatase Inhibitors (AIs)
To date, three generations of aromatase inhibitors have been developed as
representative drugs. Figure 1.8 showed the mechanism of action of aromatase
inhibitors and tamoxifen [64]. One of the most important developments in BC therapy
has shown that letrozole is superior to tamoxifen as the first-line treatment for
advanced BC [65-67], thus estrogen levels decreased and the growth of breast cancer
cells was slowed. It has been indicated that aromatase inhibitors （AIs） can effectively
treat the hormone-sensitive breast cancer in postmenopausal women. Overall trails
indicated that AIs are superior to tamoxifen in postmenopausal ER+BC women, and
also decreased recurrence and caused a reduction in undesirable side effects, typically
endometrial cancer and venous thrombosis. The disadvantage of aromatase inhibitors is
the higher incidence of osteoporosis that subsequent increases the risk of bone fracture
as well as results in higher cholesterol levels [65]. The aromatase inhibitor can only be
18
used in ER+ postmenopausal BC women. They are not to be used in premenopausal
women because the reduction of estrogen activates the hypothalamus and pituitary axis
causing an increased secretion of gonadotropin, the later in turn not only stimulates the
ovary to increase the production of androgen, but also the heightened gonadotropin
levels up-regulate the aromatase promoter, consequently increasing aromatase
production with increased androgen substrate. As a consequence, the estrogen is
increased when AIs are used in premenopausal women [68].
19
Figure 1. 8 Mechanism of action of aromatase inhibitors and tamoxifen. Aromatase
inhibitors inhibit the synthesis of estradiol by blocking the androstenedione conversion
to estrone and of testosterone to estradiol. Tamoxifen inhibits the growth of breast
tumors by competitive antagonism of estrogen at its receptor site. (Smith IE, Dowsett.
Aromatase inhibitors in breast cancer. M. N Engl J Med. 2003. 348:2431-2442.)
20
1.4.3. Selective estrogen receptor down regulator (fulvestrant)
Fulvestrant, whose generic name is Faslodex, belongs to the first selective estrogen
receptor down regulators (SERDs). It is an estrogen receptor (ER) antagonist that
competitively binds to the ER with a much greater affinity than that of tamoxifen [69].
The fulvestrant down-regulates ER, and it has no estrogen agonist effects. The absence
of estrogen agonist effects for fulvestrant is different from tamoxifen and the other
selective ER modulator (SERMs) [70]. Fulvestrant-ER binding impairs receptor
dimerization and affects the energy-dependent nucleo-cytoplasmic shutting, thus
blocking nuclear localisation of the receptor. Also, the fulvestrant-ER complex enters
the nucleus which cannot activate the transcription because the AF1 and AF2 stop
working. In the end, the fulvestrant-ER complex is erratic and causes accelerated
degradation of ER. Down regulation of ER proteins occurs without the decrease of
mRNA in ER. Therefore, the fulvestrant binding to ER leads to complete inhibition of
estrogen signaling pathway [71]. Figure 1.9. Represent the Mechanism of action of
fulvestrant. Until now, it has been demonstrated that this new type of endocrine therapy
is not only agonism-free in estrogen but also a lack of cross-resistance between the
SERMs. Thus, fulvestrant will be useful in patients with tamoxifen-resistant disease [69,
71].
21
Figure 1. 9 Mechanism of action of fulvestrant. ERE = estrogen response element;
ER = estrogen receptor; F= fulvestrant. (CK Osborne, A Wakeling and RI Nicholson.
Fulvestrant: an oestrogen receptor antagonist with a novel mechanism of action. British
Journal of Cancer 90 (Suppl 1), S2 – S6, 2004.)
22
1.4.4. Steroid sulfatase inhibitors
The first reports on STS inhibition started in the 1970s. Maltais & Poirier have recently
published a comprehensive review covering the steroid sulfatase inhibitors regarding
the promising 2000-2010 decades [72]. This section intends to discuss clinical trials.
667 COUMATE was the first STS inhibitor to enter the phase I clinical trial in
postmenopausal women with hormone-dependent breast cancer [73-74]. Phases I/II
clinical trials on 667 COUMATE now have given it the generic name Irosustat. In a
phase II endometrial cancer trial Irosustat did not reach the endpoint. The use of STS
inhibitors as a treatment for estrogen or androgen-dependent cancers remains to be
studied [75].
1.4.5. 17β-HSDs inhibitors
Inhibitors of 17β-HSD isoforms are worth studying, as they may block the formation of
hydroxysteroids that stimulate estrogen-sensitive cancers. Several families of 17β-HSD
inhibitors were reported to block the synthesis of estradiol. Poirier D gives a
description of novel inhibitors of 17β-HSDs from 2003 to 2010 [76-77]. Inhibitors of
17β-HSD1 are suitable in the treatment of estrogen-dependent BC, but the role of types
5, 7 and 12 is still controversial [77].
1.5. Working hypothesis and Research Objectives
1.5.1. Hypothesis
Based on the above introduction, it is known that estradiol (E2) plays a critical role in
breast cancer (BC). Endocrine therapy of BC decreases E2 activity or block its synthesis.
Letrozole, tamoxifen and fulvestrant have been shown to be effective in BC treatment
23
in clinical or pre-clinical trials, but because of the side effects, limited use and
resistance, further development of drug targets and enzyme inhibitors are necessary.
First, the role of 17β-HSD5 (AKR1C3) is controversial. We thus proposed to study
if 17β-HSD5 is a target for ER+BC therapy. We first provided DHEA as hormone
source to mimic the postmenopausal conditions in women. Following 17β-HSD5
depletion by siRNA in ER+BC cells, DHEA cannot be converted to 5-diol, nor Δ
4-dione into testosterone. As showed steroidogenic pathway in the peripheral tissues in
Figure 1.3. Testosterone is a direct precursor steroid used for the synthesis of E2. Thus,
it is hypothesized that E2 level is reduced and cellular proliferation decreases. If this is
the case, the inhibitor of 17β-HSD5 may be used independently or in combination with
the inhibitors of 17β-HSD 1 and /or 17β-HSD 7 for breast cancer therapy.
Second, most studies of 17β-HSD1 and 17β-HSD7 inhibitots in vivo and in vitro
used estrone (E1) as substrate, while studies of 3α-HSD3 used DHT as substrate. These
studies all used the direct substrate as hormone source. However, E2 synthesis involves
multiple pathway, conversion from E1 to E2 being the last step, so providing E1 cannot
fully mimic the physiological condition, As well as reflect the difference in the origins
of estrogen before and after menopause. After the menopause, close to 100% estrogens
are synthesized in peripheral target tissues from precursor steroids of adrenal origin.
We are suggesting to provide DHEA as intracrine hormone source and to compare the
role of steroid-converting enzymes using DHEA and their direct substrates when an
extensive understanding of the mechanism is necessary. Thus, we hypothesized that
providing different hormone sources may have similar or different effects on
17β-HSD1, 17β-HSD7 or 3α-HSD3 knockdown cells. Providing DHEA is mimicking
the postmenopausal condition in steroid metabolism in BC cell culture.
24
1.5.2. Objectives
Objective one: To evaluate of the biological function of 17β-HSD5 in MCF-7 BC
cells. To achieve this, we will employ siRNA or 17β-HSD5 inhibitor (such as EM1404)
in the MCF-7 cell line, followed by assaying cellular proliferation and cell cycle
changes. At the same time, androgens and estrogens related to 17β-HSD5 (such as
DHEA, 5-diol, 4-dione, T, DHT, E1 and E2) and cell migration will be determined.
Objective two: To identify mechanisms responsible for cell proliferation and
steroidal changes after 17β-HSD5 depletion.
Objective three: To use clinical sample information in ONCOMINE data base to
determine the 17β-HSD5 expression in BC and normal tissues.
Objective four: To compare the differences of using DHEA or E1S as substrates
with E1 as substrate in the previous experiments and to demonstrate that BC cell
biology changes after knockdown the expression of 17β-HSD1 or 17β-HSD7. To
compare the differences of providing DHEA as hormone sources and providing DHT to
show the function of 3α-HSD3 in BC cells.
25
Chapter Ⅱ
Hypo-expression of AKR1C3 in breast tumors undergoes further reduction with
metastasis: the enzyme knockdown up-regulates aromatase by increasing PGE2
2.1 Résumé en français
La sous-expression d’AKR1C3 dans les tumeurs du sein subit est augmentée lors
de la formation de métastases: l’inhibition de l’expression du gène de l’enzyme
régule à la hausse l'aromatase en augmentant la PGE2
.
Des rapports sur l’expression de l’AKR1C3 (17β-HSD5) dans des échantillons de
cancer du sein (BC) et son utilité comme cible potentielle pour le cancer du sein sont
controversés. En utilisant les informations d’échantillons cliniques dans la base de
données Oncomine, nous avons démontré l'expression significativement inférieure de
l’AKRIC3 dans des cancers du sein positifs pour le récepteur des œstrogènes par
rapport aux échantillons de tissu de sein normal. En outre, le gène AKR1C3 est moins
exprimé chez les patients avec des métastases. Nous avons fourni du DHEA comme
source d'hormone pour imiter les conditions post-ménopausiques ales chez les femmes.
Des petits ARN interférents ont été utilisés pour éteindre la transcription du gène
AKR1C3 dans les cellules MCF-7 ce qui a produit une diminution de la quantité des
androgènes actifs (T, DHT), ainsi qu’une augmentation simultanée inattendue du
niveau d’E2 (1,8 fois) et de prolifération cellulaire (46%). L’inhibition du gène
AKR1C3 a également stimulé la migration des cellules MCF-7 de 12%. Par ailleurs,
nous démontrons que l’inhibition de l’expression du gène AKR1C3 a stimulé
l'expression du gène de l'aromatase de 31% en raison de l'augmentation de la
prostaglandine E2 (PGE2). Par conséquent, l’expression moindre de l’AKR1C3 dans le
cancer du sein conduit à la régulation positive de l’aromatase, à la prolifération
cellulaire et à la métastase. Une telle expression plus faible peut être utilisée pour
prédire un pronostic lors du suivi clinique.
29
2.2. Summary
Human 17β-hydroxysteroid dehydrogenase type 5 (17β-HSD5, AKR1C3) belongs to
the
aldo-keto
reductase
(AKR)
superfamily.
This
enzyme
synthesizes
androst-5-ene-3β ， 17 β -diol (5-diol) from dehydroepiandrosterone (DHEA) and
catalyzes △4-androstenedione (△4-dione) reduction to testosterone (T), which is further
converted to estradiol (E2) by aromatase in breast cancer cells (BCC). Therefore,
17β-HSD5 must play a critical role in estrogen receptor (ER)-positive breast cancer
(ER+BC). However, its function in BCC development remains unclear and its
expression in BC tumor samples is controversial. We provided DHEA as hormone
source to mimic the postmenopausal conditions in women. Small interfering RNAs
were used to silence AKR1C3 gene transcription in MCF-7 cells. Cell proliferation was
assayed by CyQUANT cell proliferation kit, steroidal hormone levels were determined
by ELISA kit and cell migration was measured by wound healing assay. Aromatase and
AKR1C3 regulation were determined by western blot and Q-RT-PCR. We used clinical
sample information available on Oncomine data base to compare the expression of
AKR1C3 in different conditions and tissues. The silencing of AKR1C3 gene
transcription produced a decrease in active androgens (T and DHT), an unexpected
simultaneous increase of E2 levels (1.8 fold) and MCF-7 cell proliferation (46%).
Inhibition of AKR1C3 also stimulated MCF-7 cells migration by 12%. AKR1C3
knockdown stimulated expression of the aromatase gene by 31% due to the increase of
prostaglandin E2 (PGE2). PGE2 increases the binding activity of the Jun and ATF
groups of transcription factors of the aromatase promoter I.3/II region. AKR1C3
expression was significantly lower in estrogen-receptor BC cells (p=2.88E-06) than in
normal breast tissue. It was also significantly lower in HER-2 positive patients than in
HER-2 negative cases (P=0.0003). In ductal breast carcinoma, AKR1C3 gene is less
expressed in patients with metastasis than without it (P=0.008). The lower expression
of AKR1C3 in BC leads to aromatase up-regulation, MCF-7 cell proliferation and
metastasis. These findings are important as they propose a new mechanism to explain
reduced expression of AKR1C3 in BC compared to normal breast tissue. This reduced
31
expression of AKR1C3 in BC may serve as a poor prognostic factor, which is strongly
supported by clinical sample statistics, bur remains to be further validated in clinical
tests and observation.
32
Hypo-expression of AKR1C3 in breast tumors undergoes further reduction with
metastasis: the enzyme knockdown up-regulates aromatase by increasing PGE2
Dan Xu1, Tang li1, Xiaoqiang Wang1, Sheng-Xiang Lin1
1
Centre de recherche du Centre hospitalier universitaire de Québec – Laval University,
Quebec City, Canada G1V 4G2
Authors’ e-mail addresses:
Dan Xu: [email protected]
Tang Li: [email protected]
Xiaoqiang Wang: [email protected]
Corresponding author:
Sheng-Xiang Lin, PhD
CHUL Research Center
Laval University
2705 Blvd. Laurier, Quebec City, Quebec, G1V 4G2, Canada.
Phone: +1 418 525 4444 ext 46367;
e-mail : [email protected]
Abstract
Introduction AKR1C3 (HSD17B5) is widely expressed in human tissues including
mammary gland. AKR1C3 synthesizes Δ5-androstene-3β,17β-diol (5-DIOL) from
dehydroepiandrosterone (DHEA) and catalyzes the reduction of Δ4-androstenedione
(4-DIONE) into testosterone (T). Subsequent T aromatization by CYP19 aromatase
provides a route for E2 biosynthesis independent of HSD17B1. However, reports of its
expression in BC tumor samples, and whether AKR1C3 is a potent target for BC
treatment are controversial. A limited number of conflicting studies have investigated
the importance of AKR1C3 in BC. Methods We provided DHEA as hormone source to
mimic the postmenopausal conditions in women to study the enzyme role in BC. Small
interfering RNAs were used to silence AKR1C3 gene transcription in MCF-7 cells, cell
proliferation was assayed by CyQUANT cell proliferation kit, steroidal hormone levels
were determined by ELISA kit and cell migration were measured by wound healing
assay. Aromatase and AKR1C3 regulation were determined by western blot and
Q-RT-PCR. We used clinical sample information available on Oncomine data base to
compare the expression of AKR1C3 in different conditions and tissues. Results The
silencing of AKR1C3 gene transcription produced a decrease in active androgens (T
and DHT), an unexpected simultaneous increased in E2 levels (1.8 fold) and MCF-7
cell proliferation (46%). Inhibition of AKR1C3 also stimulated MCF-7 cells migration
by 12%. Meanwhile, AKR1C3 knockdown stimulated expression of aromatase gene by
31% due to the increase of prostaglandin E2 (PGE2). PGE2 increases the binding
activity of the Jun and ATF groups of transcription factors to the aromatase promoter
I.3/II region. AKR1C3 expression was significantly lower in estrogen-receptor BC cells
(p=2.88E-06) than in normal breast. In HER-2 positive patients it was also significantly
lower than in HER-2 negative cases (P=0.0003). In ductal breast carcinoma, AKR1C3
gene is less expressed in patients with metastasis than without it (P=0.008). Conclusion
The lower expression of AKR1C3 in BC leads to aromatase up-regulation, MCF-7 cell
proliferation and metastasis. Such lower expression could be used as a biomarker for
poor prognosis after further clinical follow-up.
Key words: Breast Cancer, Aromatase, AKR1C3, PGE2
35
Introduction
Breast cancer (BC) is the most common cancer in women regardless of race and
socioeconomic factors, and is the second leading cause of cancer death in women in
North America [1–2]. Estradiol (E2), the most potent estrogen, plays a critical role in
tumor cellular proliferation and cancer development by stimulating cell proliferation
via estrogen receptor (ER) activation [3–4]. Interestingly, several studies suggest that
androgens may lead to resistance to the proliferative effects of estrogens and
progesterone in the mammary gland as androgens have been shown to exert
anti-proliferative effects [5–8].
The balance between the stimulatory effects of estrogens versus the inhibitory effects
of androgens is one critical factor that regulates mammary cell proliferation in both
normal and carcinomatous tissues [9]. AKR1C3 (HSD17B5) is widely expressed in
human tissues including the prostate, endometrium and mammary gland [10–11].
AKR1C3 synthesizes 5-androstene-3β,17β-diol (5-DIOL) from dehydroepiandrosterone
(DHEA) and catalyzes the reduction of 4-androstenedione (4-DIONE) into testosterone
(T). Subsequent T aromatization by CYP19 aromatase provides a route for E2
biosynthesis independent of HSD17B1 [12]. The structure of AKR1C3 was reported by
Qiu et al. 2004, which provided a foundation for inhibitor development [13]. However,
reports of its expression in BC tumor samples, and of its usefulness as a potential target
for BC treatment are controversial. A limited number of conflicting studies have
investigated the importance of AKR1C3 in BC: Oduwole and colleagues [14] found
that AKR1C3 mRNA was detected in 65% of breast cancer specimens and was
significantly higher in breast tumors than in normal tissue. The prognosis for patients
with a high level of expression of tumoral AKR1C3 was worse than for those with low
or no expression. Agneta et al. [15] found that a high level of AKR1C3 was related to a
significantly higher risk of late relapse in ER+ patients compared with tumors
expressing low and intermediate levels of the enzyme. Nevertheless, Han et al [16]
found that lower levels of AKR1C3 were expressed in tumor tissue than in adjacent
37
normal tissue. Ben et al [17] found that the expression of AKR1C3 was significantly
lowered (4.3-fold) in ER+ tumors compared with normal tissue. It is currently unclear
whether AKR1C3 is expressed more highly in normal tissue or in tumor tissue.
Therefore, the correlation between AKR1C3 expression and BC is also unclear. In this
study, we analyzed a large number of clinical samples from the Oncomine database
[18], and provide statistical evidence that lower expression of AKR1C3 correlates with
ER+, ERBB2+ and ductal breast carcinoma metastasis. Small interfering RNAs were
used to silence AKR1C3 gene transcription in MCF-7 cells. We demonstrate that
AKR1C3 knockdown stimulated expression of the aromatase gene by 31% due to an
increase in prostaglandin E2 (PGE2) expression levels.
Materials and methods
Cell culture
MCF-7 cells were from the American Type Culture Collection (ATCC). MCF-7 cells
were derived from a 69 years female mammary gland metastatic site. MCF-7 cells were
maintained in phenol red-free, low glucose DMEM supplemented with 10% fetal
bovine serum (FBS). Cells were cultured at 37℃ in a humidified atmosphere of 95%
air and 5% CO2. Cells were plated in charcoal-treated medium to eliminate exogenous
hormones and to permit application of different concentrations of DHEA in order to
simulate the physiological conditions of postmenopausal women. A stable expression
of aromatase, ER positive MCF-7 cell line, named MCF-7-aro, was generated by
aromatase cDNA transfection and G418 selection in the laboratory of Shiuan Chen [19,
20]. The culture method used in MCF-7 was used in MCF-7-aro.
siRNA synthesis and transfections
Sense and antisense sequences of three AKR1C3siRNAs (Table 2.1) were selected.
Duplex siRNAs of AKR1C3 were synthesized and purified by HPLC by Gene Pharma
(Shanghai, China). Transfection of MCF-7 cells with siRNAs was carried out using
38
Lipofectamine 2000 (Invitrogen) and a 100nM mixture of the three siRNA duplexes.
Control siRNA were used as a negative control in the transfection experiments.
Western blot
Total proteins were extracted from cells with RIPA buffer (Invitrogen) supplemented
with a 1% protease inhibitor cocktail (EMD Chemicals, Gibbstown, NJ, 100:1 v/v).
The Bradford method was used to quantify proteins: 40μg total proteins from each
sample were separated on a 12% SDS-polyacrylamide gel and then electro-blotted
overnight onto a nitrocellulose membrane. The membranes were blocked with 5%
skimmed milk in TBS-Tween 20. The membranes were hybridized to a polyclonal
antibody directed against rabbit AKR1C3 or aromatase (Abcam) at dilutions of 1:1,000.
The membranes were subsequently incubated with a goat anti-rabbit IgG peroxidase
conjugated secondary antibody (Santa Cruz Biotechnology) at a dilution of 1:2,000. A
1:5,000 dilution of monoclonal anti-β-actin antibody produced in mouse (Sigma) was
used as a loading control. Membranes were washed with TBST and proteins were
visualized using Western Lighting™ Plus ECL (Perkin Elmer), followed by exposure
of the membranes to X-ray films. The radiographic films were scanned and the Image
program (Molecular Dynamics, Sunnyvale, CA) was used to quantify band density.
Steroid quantification in MCF-7 culture medium
Cells were seeded into 24-well plates at a density of 5×104cells/well in 500μl
hormone-free culture medium. Cells were transfected with 100nM siRNA or control
siRNA as negative control after 24h. Each condition was performed in duplicate. The
culture medium was replaced with hormone-free medium, hormone-free medium
containing 8, 20, 100nM or 1μM DHEA five hours after transfection. The medium was
collected from wells 4 days after transfection and immediately frozen at −80℃ until
analysis. The levels of DHEA (Eagle Biosciences), 4-Dione (Eagle Biosciences), T
(Cayman Chemical), DHT (Alpha Diagnostic), E1 (Abnova), and E2 (Cayman
39
Chemical) in the medium were determined by commercial ELISA kit. The levels of E2
and prostaglandin E2 (PGE2) in MCF-7 BC cell line supernatants were determined
using a commercial E2 enzyme immunoassay kit and PGE2 EIA Kit (Cayman
Chemical). All assays were performed according to the supplier’s protocols.
Cell cycle assay
MCF-7 cells were seeded in 6-well plates at a density of 5×104 cells per well in
hormone-free
medium
and
were
transfected
with
100nMAKR1C3-specific
siRNA(mixed siRNA1, siRNA2 and siRNA3) or control siRNA using lipofectamine
2000. 5h after transfection the medium was replaced with medium containing 1μM
DHEA. Cell incubation was continued for 4 days after which the cells were washed and
collected, fixed at −20℃ in 70% ethanol, stained with PI, and read by flow cytometry.
Quantitative real-time PCR
MCF-7 cells were seeded in 6-well plates at a density of 2.5×105 cells/well in
hormone-free medium and transfected with 100nM AKR1C3-specific siRNA or control
siRNA using lipofectamine 2000. 5h after transfection the medium was replaced with
medium containing 1μM DHEA. Cell incubation was continued for another 4 days,
after which total RNA was extracted from cells using Trizol reagent and then sent to
the Q-RTPCR Platform service (Research Center of the Laval University Hospital
Center, Quebec, Canada) for quantification of ARK1C3 and CYP19A mRNA by
Quantitative real-time PCR. The quantity of total RNA was measured using a
NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE,
USA) and total RNA quality was assayed on an Agilent BioAnalyzer (Agilent
Technologies, Santa Clara, CA, USA). Oligo primer pairs were designed by GeneTool
2.0 software (BiotoolsInc, Edmonton, AB, CA) and their specificity was verified by
BLAST in the GenBank database. Synthesis was performed by IDT (Integrated DNA
Technology, Coralville, IA, USA)
40
(CYP19A1
primers
5’-CGACAGGCTGGTACCGCATGCTC/AAGAGGCAATAATAAAGGAAATCCA
GAC-3’,
AKR1C3
primers
5’-CAACCAGGTAGAATGTCATCCGTAT/ACCCATCGTTTGTCTCGTTGA-3’).
Cell proliferation assay
Cell proliferation was determined by CyQuant cell proliferation kit. MCF-7 cells
(3×103) were plated into 96-well plates containing 100μl hormone-free culture medium.
After 24h cells were transfected with 100nM siRNA and the culture medium was
replaced with medium containing different concentrations of DHEA. Cells were
cultured for 4 days, the culture medium was removed. Cells were washed with PBS,
and frozen overnight in 96-well plates at −80℃. The plates were thawed at room
temperature for 15 min then 200μl of CyQuant GR dye/cell-lysis buffer were added.
The sample was protected from light and incubated for 2–5 min at room temperature.
Sample fluorescence was measured using a fluorescence micro plate reader at 480nm
excitation and 520nm emission.
Cell migration assay
Cell migration was carried out using a wound-healing assay. Cells were plated at a
density of 5×105 cells in 24-well plates in E2-free medium containing 5% fetal bovine
serum (FBS). After 24h the wound was created by manually scraping the cell
monolayer using a 20μl tip. The cells were washed 3 times, then the cells were treated
with 6.4nM (2-fold IC50) AKR1C3 inhibitor (EM1404) [21]. Scratched cells were
removed and a photograph was taken (0h). Cells were incubated in E2-free medium
supplemented with 5% FBS. Photographs were taken at 24h intervals. All experiments
were performed in quadruplicate. The scratch widths were measured at specific time
points using Image J software.
41
Clinical data from the Oncomine data base
The expression of AKR1C3 in normal breast and breast carcinoma was analyzed by
mRNA level using 4 different probes. We retrieved the raw data from 593 cases from
the TCGA cohort from the Oncomine platform. The data had been previously
processed and normalized [18]. Seventeen normal cases were filtered from 61 normal
postmenopausal cases, and 160 tumor cases were filtered from 524 postmenopausal,
ER+ tumor cases. We then employed differential expression analysis using the
non-parametric Mann–Whitney U test as a measure of significance, and fold change as
a method of differences evaluation. Since all the equal variances were assumed the
t-statistic was used as the method of measurement for the differential fold change
analysis of different ER status, BC type, ERBB2 status, and M stage.
Results
Regulation of principal androgens and estrogens with AKR1C3 knockdown
AKR1C3 mRNA levels were analyzed by quantitative real-time PCR (Q-RT-PCR) 4
days after transfection with control of AKR1C3 targeted siRNAs: this revealed 863,000
copies of mRNA/μg total RNA in control siRNA, and 207,000 copies mRNA/μg total
RNA after transfection with AKR1C3 siRNA. Thus AKR1C3 is expressed in MCF-7
cells, and the siRNAs specifically silence approximately 80% of AKR1C3 gene
expression (Figure 2.1A). In comparison with control siRNA, expression of the
AKR1C3 protein in MCF-7 cells was decreased by 60% 48h after transfection with
AKR1C3 siRNA (100nM) (Figure 2.1A). Therefore, these siRNAs were used in
following experiments at a concentration of 100nM.
Steroid measurement was performed by ELISA on cell culture medium in order to
establish the impact of AKR1C3 knockdown on steroid hormone levels in MCF-7 cells.
We compared different steroid hormone concentrations in MCF-7 cell culture medium
42
after transfection with either control siRNA or AKR1C3-siRNA 96 h after treatment.
The following steroid hormones were quantified: DHEA, 4-DIONE, T, DHT, E1 and
E2. Several concentrations of DHEA (without steroid hormones [charcoal-eliminated],
exogenously-administered 8nM, 20nM, 100nM and 1µM DHEA) were used. We
increased the DHEA concentration to 20nM and 100nM, which is higher than the
physiological
concentration
found
in
blood
from
postmenopausal
women
(approximately 8nM) [22], but close to the concentration in BC tissue (approximately
34.7nM) [23]. After 4 days of treatment, AKR1C3 was depleted by siRNA, metabolism
of 4-DIONE to T did not occur, and the T and DHT concentrations decreased. This
revealed that the predominant function of AKR1C3 was the conversion of 4-DIONE to
T. The decrease in DHT level was attributed to the decrease in testosterone level, as the
latter is the substrate for DHT formation. We detected an unexpected increase in E2
when the concentration of DHEA was increased to 1μM: AKR1C3 siRNA resulted in a
significantly higher E2 level (1.8-fold, an increase from 0.65nM to 1.18nM, p=0.02)
than the control siRNA after 96h incubation. No significant changes were observed for
DHEA, 4-dione or E1 (Table 2.2).
Effects of AKR1C3 knockdown on cell cycle, cell proliferation and cell migration
The MCF-7 cell cycle was studied by flow cytometry after treatment with control siRNA
and AKR1C3 siRNA for 4 days. Compared with control siRNA, AKR1C3 depletion by
siRNA resulted in more cells entering the G2/M phase. The percentage of cells in G0/G1
decreased by 0.65% (P = 0.04), the percentage of cells in the S-phase decreased by
1.75% (p = 0.01), and the percentage of cells in G2/M increased by 2.2% (p = 0.02) in
response to treatment with AKR1C3 siRNA. In other words, cell mitosis increased
(Figures 2.2A, B and C). To evaluate the impact of AKR1C3 knockdown on MCF-7
cell proliferation, cells were cultured for 4 days after transfection with AKR1C3 siRNA
in
physiological
concentrations
or
higher
(8nM,
20nM,
and
1μM)
of
DHEA-supplemented medium. DHEA was included as the hormone source to mimic the
intracrine condition. Cell proliferation tended to increase in response to increasing
43
concentrations of DHEA in the control siRNA group. However, compared with control
siRNA, cell proliferation showed significant increases after transfection with AKR1C3
siRNA for 96h in the presence of increasing concentrations of DHEA (8nM DHEA, 38%
(p = 0.018); 20nM DHEA 46% (p = 0.007); 1μΜ DHEA 46% (p= 0.0005).
Therefore, knockdown of AKR1C3 does not inhibit but increase MCF-7 cell
proliferation (Figure 2.2D). A wound-healing assay was performed to investigate
whether AKR1C3 is associated with BC metastasis. The effect of AKR1C3 inhibition
on cell migration was tested in MCF-7 cells treated with either the AKR1C3 inhibitor,
EM1404, or an ethanol control. Inhibition of AKR1C3 in MCF-7 cells was associated
with increased cell migration (12%, p=0.02) compared with ethanol-treated control
cells after treatment for 3 days (Figure 2.2E, F).
Negative regulation betweenAKR1C3 and aromatase
We performed a Western blot and Q-RT-PCR to evaluate the aromatase protein and
CYP19A gene levels, respectively, after AKR1C3 depletion by siRNA. We found a 25%
increase in aromatase protein expression along with a 31% increase in transcription of
the CYP19A gene when the expression of the AKR1C3 gene was reduced by 80%
(Figure 2.3A, B and C). The up-regulation of the aromatase gene was coincident with a
significant increase in PGE2 level in response to AKR1C3 knockdown. The control
PGE2
level
increased
DHEA-supplemented
from
medium,
47.8pg/ml
from
to
69.75pg/ml
56.90pg/ml
to
(p=0.004)
93.25pg/ml
in
in
8nM
100nM
DHEA-supplemented medium (p=0.0008), and from 126.03pg/ml to 190.25pg/ml in
1μM DHEA-supplemented medium (p=0.02) (Figure 2.3D). The mechanism proposed
for AKR1C3 knockdown-induced increase in PGE2 levels, and the stimulated
expression of aromatase is presented in Figure 2.4. In contrast, in the over-expressed
aromatase cell line (MCF-7-aro), the AKR1C3 gene was found obviously
down-regulated by RT-PCR, and the AKR1C3 protein was hardly expressed in
44
MCF-7-aro by western blot (Figure 2.3E, F).
AKR1C3 hypo-expression in breast carcinomas compared with normal breast tissue
A comparison between expression of AKR1C3 mRNA in BC or in normal tissue using
a large number of clinical samples from the Oncomine database is shown in Figure 2.5.
AKR1C3 is widely expressed in normal breast tissue and breast carcinoma. It is
expressed at a lower level in both ER+- (fold change= −9.88463, N=115) and ER−-BC
(fold change= −7.79201, N=45) compared with normal breast tissue (N=17, fold
change=1) but the difference is even more important when we compare ER + BC to
normal breast tissue. We then compared ER+- and ER−-BC patients; AKR1C3
expression is significantly lower (p=2.88E−06) in ER+ patients than in ER− patients.
AKR1C3 is expressed at a significantly lower level in invasive ductal breast carcinoma
(IDC, fold change=−10.86, p value<3.30E−18, N=99) and invasive lobular breast
carcinoma (ILC, fold change=−4.69, p value<1.66E−05, N=16) than normal breast
tissue (fold change=1, N=17), and is significantly lower in IDC than in ILC
(p=1.29E−07). Comparison of ERBB2+ with ERBB2− patients revealed that AKR1C3
is expressed at a significantly lower level in ERBB2+ (p=0.0003). The expression of
AKR1C3 in IDC is significantly lower (p = 0.005) in patients with metastasis (M1,
N=3) than in those without metastasis (M0, N=94).
Discussion
DHEA as hormone source for study and AKR1C3 knockdown effect
Estradiol secretion by the ovaries stops after menopause and all estrogens and
androgens are synthesized in peripheral target tissues from DHEA, which is the only
post-menopausal source of sex steroids [24]. According to estimates of intracrine
formation, the majority of estrogens in women (75% before menopause and nearly
100% after menopause) are synthesized in peripheral target tissues from precursor
steroids of adrenal origin [25]. For this reason, DHEA was chosen as the hormonal
45
source for MCF-7 cells to simulate the physiological environment in postmenopausal
women with BC. The enzyme under study in this work, AKR1C3, affects conversions
of DHEA to 5-DIOL, and 4-DIONE to T. The use of DHEA as a hormone source can
thereby reveal all hormone changes caused by AKR1C3 modification and better reflect
hormone metabolism in postmenopausal women. Our methods involved culturing cells
in hormone-free medium that had been treated with charcoal in order to eliminate
interfering exogenous hormones and to allow application of physiological (or higher)
concentrations of DHEA.
The results demonstrate that by providing DHEA to the culture medium, the following
hormones generated by DHEA conversion reflect the concentration gradient occurring
in response to the multi-step biosynthesis of steroidal hormones by steroidogenic
enzymes. Knockdown of AKR1C3 in MCF-7 cells produced changes in T and DHT,
and in E2, the most important estrogen (Table 2.2). Therefore, we propose that DHEA
could be used as a hormone source for the study of enzymes and inhibitors in BC cells,
and in particular for multiple substrate enzymes in postmenopausal BC.
AKR1C3 and aromatase interaction in MCF-7
The aromatase enzyme is located in the endoplasmic reticulum of the cell and is
encoded by the CYP19A gene, which is located on chromosome 15q21.2. The
expression of aromatase is regulated in a tissue-specific manner by promoters that are
in
turn
controlled
by
hormones,
cytokines,
and
other
factors
[26–28].
Estrogen-dependent BC uses four promoters (II, I.3, I.7, and I.4) to regulate the
expression of aromatase [28]. Promoter I.4 regulates aromatase gene expression by
cytokines. Promoter switching can occur in malignant breast tissue such that aromatase
gene expression is regulated by P II and PI.3 [29–30]. Prostaglandin E2 (PGE2)
stimulates aromatase expression via cyclic AMP and promoter II [31]. Whereas PGE2
is a primary product of arachidonic acid metabolism and is synthesized by the
46
cyclooxygenase (COX) and prostaglandin synthesis pathways, PGE2 can be directly
produced from PGH2, and indirectly from PGH2 via AKR1C3 to form PGF2α and
from this to produce PGE2 under the action of AKR1C1 and AKR1C2 [32]. Thus, we
propose that interaction between aromatase and AKR1C3 is related at the level of
PGE2: knockdown of AKR1C3 leads to a decrease in PGF2α synthesis, and more
PGH2 can directly lead to PGE2 synthesis, as confirmed by our study. Prostaglandin
E2 increases the binding activity of the Jun and ATF groups of transcription factors to
the aromatase promoter I.3/II region according to the model established by a previous
report [28]. This enhances aromatase expression. Here, we demonstrate that
knockdown of AKR1C3 increased PGE2, which stimulated aromatase expression and
higher E2 levels. By working in concert with paracrine pathways [33] this establishes a
feedback cycle to promote the development of BC. It has been reported that elevated
PGE2 production is associated with BC metastasis, which can be used as a marker for
high metastatic potential for neoplastic cells in BC [34–35]. The reason for low
expression of AKR1C3 correlating with metastasis may be elevated PGE2 production.
Function of AKR1C3 and its expression in BC tissue
To date, a number of studies have investigated the expression and important role of
AKR1C3 in BC; however, reports of whether the expression of AKR1C3 is higher or
lower in breast tumors are inconsistent. Here, we took advantage of the large quantity
of raw data available in the Oncomine data base to analyze AKR1C3 expression in
breast tumors and normal tissue. This data base includes different cohorts with sample
numbers that are higher than those previously reported from individual research articles.
Moreover, the data from different research institutes were processed and normalized to
minimize errors introduced by different individuals and techniques. Four research
cohorts (Finak Breast, TCGA Breast, Richardson Breast 2, Curtis Breast) showed
significantly lower (more than 2-fold change, P value less than 1E−04) expression of
AKR1C3 in BC compared with normal tissue. A limited number of individuals showed
over-expression of AKR1C3 in BC compared with normal breast tissue, but this was
47
not statistically significant. Therefore, we concluded that AKR1C3 is hypo-expressed
in breast carcinoma compared with normal breast tissue. Our results are consistent with
those previously published by Han et al. and Haynes et al. [16–17].
We compared other entries from the TCGA cohort as this contains the largest number
of samples and patients analyzed by multiple probes. We compared AKR1C3 mRNA
levels in ER+ and ER− breast carcinoma. Expression of AKR1C3 was found to be
lower in ER+ than in ER− cases (p=2.88E−06, Figure 2.1A). The ERBB2/HER-2 status
was also used for comparison, and AKR1C3 expression was significantly lower in
ERBB2+ than in ERBB2− patients (P=0.0003, Figure 2.1C). Meanwhile, the
expression of AKR1C3 was lower in patients with metastasis than in those without
metastasis (P=0.005, Figure 2.1D). These results differ from earlier reports by some
researchers [14–15]. Related contradictions may be clarified by coming research
following clinical evaluation of AKR1C3 expression for at least 5 years, with detailed
records of metastasis and recurrence, survival analysis or verification by cell biology
functional methods etc. Nevertheless, the major conclusion from this work is
considered valid as it is based on a large number of clinical samples (593 cases from
the TCGA cohort) and is associated with strong statistical significance.
Conclusion
Knockdown of AKR1C3 in BC cells increased E2 production, which promoted cell
proliferation and cell migration. This can be attributed to negative regulation of
aromatase by PGE2. These results are supported by the fact that AKR1C3 expression
was lower in breast carcinoma than in normal breast tissues, and that the enzyme
expression was further reduced in metastatic BC. This reduction in BC may serve as a
poor prognostic factor, which is strongly supported by clinical sample statistics and will
be further validated in clinical tests and observation.
48
List of abbreviations
DHEA: Dehydroepiandrosterone; HSD17B: Hydroxysteroid (17-Beta) Dehydrogenase;
PGE2: Prostaglandin E2; T: Testosterone; DHT: Dihydrotestosterone; E1: Estrone; E2:
Estradiol; 5-DIOL: 5-androstene-3β,17β-diol; 4-DIONE: 4-androstenedione.
Competing interests
The authors declare that they have no competing interests.
Author contributions
DX and SXL designed all the experiments. DX performed all the cell experiments. TL
collected all the clinical data from the oncomine database. XQW provided some
suggestion on the methods of experiments and help taking photography of wound
healing assay.
Acknowledgment
We thank the Oncomine team for their efforts. This work was supported by Canadian
Institutes of Health Research (CIHR) (MOP 89851 and 97917 to SXL and colleagues).
Dan Xu is grateful to the China Scholarship Council (CSC) for its support.
49
References
[1] Jemal A, Siegel R, Ward E, Hao Y, Xu J, Murray T, Thun MJ: Cancer statistics.
CA Cancer J Clin 2008, 58:71-96.
[2] Lin SX, Chen J, Mazumdar M, Poirier D, Wang C, Azzi A, Zhou M: Molecular
therapy of breast cancer: progress and future directions. Nat. Rev. Endocrinol 2010,
6:485-493.
[3] Kumar KS, Kumar MMJ: Antiestrogen therapy for breast cancer: an overview.
Cancer Therapy 2008, 6:655-664.
[4] Beckmann MW, Niederacher D, Schnürch HG, Gusterson BA, Bender HG:
Multistep carcinogenesis of breast cancer and tumor heterogeneity. J Mol Med
1997, 75(6): 429-439.
[5] Andò S, De Amicis F, Rago V, Carpino A, Maggiolini M, Panno ML, Lanzino M:
Breast Cancer: from estrogen to androgen receptor. MCE 2002, 193(1-2):121-128.
[6] Poulin R, Labrie F: Stimulation of cellular proliferation and estrogen response
by adrenal C-19-delta 5-steroids in the ZR-75-1 human breast cancer cell line.
Cancer Res 1986, 46:4933-4937.
[7] Gangloff A, Shi R, Nahoum V, Lin SX: Pseudo-symmetry of C19 steroids,
alternative binding orientations, and multispecificity in human estrogenic
17beta-hydroxysteroid dehydrogenase. FASEB J 2003, 17:274-276.
[8] Aka JA, Mazumdar M, Chen CQ, Poirier D, Lin SX : 17β-hydroxysteroid
dehydrogenase type1 stimulates breast cancer by dihydrotestosterone inactivation
in addition to estr5-Diol production. Mol Endocrinol 2010, 24(4):832-845.
[9] Labrie F: Dehydroepiandrosterone, androgens and the mammary gland.
Gynecol Endocrinol 2006, 22:118-130.
[10] Jez JM, Flynn TG, Penning TM: A new nomenclature for the aldo-ketoreductase
superfamily. Biochem Pharmacol 1997, 54(6):639-647.
[11] Penning TM, Burczynski ME, Jez JM, Hung CF, Lin HK, Ma H, Moore M, Palackal
N,
Ratnam
K:
Human
3alpha-hydroxysteroid
dehydrogenase
isoforms
(AKR1C1-AKR1C4) of the aldo-keto reductase superfamily: functional plasticity
and tissue distribution reveals roles in the inactivation and formation of male and
51
female sex hormones. Biochem J 2000, 351(Pt 1): 67-77.
[12] Luu-The V, Labrie F: The intracrine sex steroid biosynthesis pathways. Progr
Brain Res 2010, 181: 177-192.
[13] Qiu W, Zhou M, Labrie F, Lin SX: Crystal structures of the multispecific
17β-Hydroxysteroid Dehydrogenase type 5: Critical androgen regulation in
human peripheral tissue. Mol Endocrinol 2004, 18(7):1798-1807.
[14] Oduwole OO, Li Y, Isomaa VV, Mäntyniemi A, Pulkka AE, Soini Y, Vihko PT:
17β-Hydroxysteroid Dehydrogenase type 1 is an independent prognostic marker
in breast cancer. Cancer Res 2004, 64(20):7604-7609.
[15] Jansson AK, Gunnarsson C, Cohen M, Sivik T, Stål O: 17β-Hydroxysteroid
Dehydrogenase 14 affects estradiol levels in Breast Cancer and is a prognostic
marker in estrogen receptor-Positive Breast Cancer. Cancer Res 2006,
66(23):11471-11477.
[16] Han B, Li S, Song D, Poisson-Paré D, Liu G, Luu-The V, Ouellet J, Li S, Labrie F,
Pelletier G: Expression of 17β-Hydroxysteroid Dehydrogenase type 2 and type 5 in
breast
cancer
and
adjacent
non-malignant
tissue:
A
correlation
to
clinicopathological parameters. J Steroid Biochem Mol Biol 2008, 112(4-5):194-200.
[17] Haynes BP, Straume AH, Geisler J, A'Hern R, Helle H, Smith IE, Lønning PE,
Dowsett M: Intratumoral Estrogen Disposition in Breast Cancer. Clin Cancer Res
2010, 16(6):1790-1801
[18] Oncomine (https://www.oncomine.org)
[19]Zhou D, Pompon D, Chen S. Stable expression of human aromatase
complementary DNA in mammalian cells: a useful system for aromatase inhibitor
screening. Cancer Res 1990, 50: 6949-6954.
[20]Sun XZ, Zhou D, Chen S. Autocrine and paracrine actions of breast tumor
aromatase. A three-dimensional cell culture study involving aromatase transfected
MCF-7 and T47D cells. J. Steroid. Biochem.Mol.Biol. 1997, 63:29-36.
[19] Qiu W, Zhou M, Mazumdar M, Azzi A, Ghanmi D, Luu-The V, Labrie F, Lin SX:
Structure-based inhibitor design for an enzyme that binds different steroids: a
potent inhibitor for human type 5 17β-Hydroxysteroid dehydrogenase. J Biol
52
Chem 2006, 282:8368-79.
[20] Woolcott CG, Shvetsov YB, Stanczyk FZ, Wilkens LR, White KK, Caberto C,
Henderson BE, Le Marchand L, Kolonel LN, Goodman MT: Plasma sex hormone
concentrations and the risk of breast cancer in postmenopausal women: the
Multiethnic Cohort Study. Endocr Relat Cancer 2010, 17 (1): 125–134.
[21] Pasqualini JR, Chetrite GS: Estradiol as an anti-aromatase agent in human
breast cancer cells. J Steroid Biochem Mol Biol 2006, 98(1):12-17.
[22] Labrie, F: DHEA, important source of sex steroid in men and even more in
women. Progr Brain Res 2010, 182:97-148.
[23] Labrie, F: Intracrinology. Mol Cell Endocrinal 1991, 78:C113–C118.
[24] Bulun SE, Lin Z, Imir G, Amin S, Demura M, Yilmaz B, Martin R, Utsunomiya H,
Thung S, Gurates B, Tamura M, Langoi D, Deb S: Regulation of aromatase
expression in estrogen-responsive breast and uterine disease: from bench to
treatment. Pharmacol Rev 2005, 57(3): 359-383.
[25] Purohit A, Newman SP, Reed MJ: The role of cytokines in regulating estrogen
synthesis: implications for the etiology of breast cancer. Breast Cancer Res 2002,
4(2):65-69.
[26] Bulun SE, Lin Z, Zhao H, Lu M, Amin S, Reierstad S, Chen D: Regulation of
aromatase expression in breast cancer tissue. Ann N Y Acad Sci 2009, 1155:121-31.
[27] Agarwal VR, Bulun SE, Leitch M, Rohrich R, Simpson ER: Use of alternative
promoters to express the aromatase P450 (CYP19) gene in breast adipose tissues of
cancer-free and breast cancer patients. J Clin Endocrinol Metab 1996,
81(11):3843-3849.
[28] Harada N, Utsumi T, Takagi Y: Tissue-specific expression of the human
aromatase cytochrome P450 gene by alternative use of exons 1 and promoters, and
switching of tissue-specific exons 1 in carcinogenesis. Proc Natl Acad Sci USA 1993,
90 (23):11312-11316.
[29] Zhao Y, Agarwal VR, Mendelson CR, Simpson ER: Estrogen biosynthesis
proximal to a breast tumour is stimulated by PGE2 via cyclic AMP leading to
activation of promoter II of the CYP19 (aromatase) gene. Endocrinology 1996,
53
137(12):5739-5742.
[30] Dozier BL, Watanabe K, Duffy DM: Two pathway for prostaglandin F2α
(PGF2α) synthesis by the primate periovulatory follicle. Reproduction 2008,
136(1):53-63.
[31] Bulun SE, Lin Z, Imir G, Amin S, Demura M, Yilmaz B, Martin R, Utsunomiya H,
Thung S, Gurates B, Tamura M, Langoi D, Deb S: Regulation of Aromatase
Expression in EstrogenResponsive Breast and Uterine Disease: From Bench to
Treatment. Pharmacol Rev 2005, 57(3):359-383.
[32] Rolland PH, Martin PM, Jacquemier J, Rolland AM, Toga M: Prostaglandin in
human breast cancer: Evidence suggesting that an elevated prostaglandin
production is a marker of high metastatic potential for neoplastic cells. J Natl
Cancer Inst 1980, 64(5):1061-1070.
[33] Ma X, Kundu N, Rifat S, Walser T, Fulton AM: Prostaglandin E receptor EP4
antagonism inhibits breast cancer metastasis. Cancer Res 2006, 66(6):2923-2927.
54
Figures and Legends
Fig 2.1.
Figure 2. 1 AKR1C3 expression and siRNA knockdowm. (A) Quantitative real-time
PCR. AKR1C3 expression was significantly down regulated (80%, p=0.003) by
AKR1C3 siRNA compared with control siRNA. (B) Western blot. AKR1C3 expression
was silenced 60% by transfection with AKR1C3 siRNA compared with control siRNA
as determined by AKR1C3 antibody. Error bar, SD. *, p<0.05, by Student’s t test.
55
Fig. 2.2.
Figure 2. 2 Modulation of cell cycle, cell proliferation migration. (A) control siRNA;
(B) AKR1C3 siRNA(C) Cell cycle division assay by flow cytometry, G0/G1control
siRNA 84.5, siRNA 83.85 (p=0.04), S: control siRNA5.65, siRNA3.9, (p=0.01) G2/M:
control siRNA9.5, siRNA 11.7 (p=0.02). (D) Cell proliferation determined by Cyquant
cell proliferation kit. MCF-7 cells were cultured in medium containing 8nM, 20nM or
1µM DHEA: compared with control siRNA, cell proliferation increased 38% (p=0.018),
46% (p=0.007) and 46% (p=0.0005) respectively, 96h after transfection with AKR1C3
siRNA. (E) Cell migration determined by wound healing assay. Inhibition of AKR1C3
56
cells was associated with a 10% increase in cell migration (p=0.04), 12% (p=0.03),
12% (p=0.02) 24, 48, 72 h, respectively compared with ethanol-treated control cells. (F)
Migration images. All experiments were repeated at least three times. Error bar, SD. *,
p<0.05, by Student’s t-test.
57
Fig2.3.
Figure 2. 3 Relationship between the expression of AKR1C3 and aromatase. (A)
Western blot showing expression of aromatase in MCF-7 cells after transfection with
AKR1C3 siRNA or control siRNA. β-actin protein expression was used as the internal
control. (B) The western blot bands in (A) were quantified, and the ratios between the
protein signals of interest and β-actin were calculated to determine the relative protein
58
expression values obtained in the presence of control siRNA or AKR1C3 siRNA. (C)
Quantitative real-time PCR was performed using aromatase primers. Total RNA was
extracted from MCF-7 cells. Transfection with AKR1C3-siRNA significantly increased
CYP19A1 gene expression. (D) PGE2 levels determined by ELISA. PGE2 levels
increased from 47.8pg/ml to 69.75pg/ml (p=0.003) in medium supplemented with 8nM
DHEA, from 56.90pg/ml to 93.25pg/ml in medium supplemented with 100nM DHEA
(p=0.007), and from 126.03pg/ml to 190.25pg/ml in medium supplemented with 1μM
DHEA (p=0.02) in response to AKR1C3 knockdown. (E) The expression of aromatase
and AKRC13 in MCF-7 and MCF-7-ARO tested by RT-PCR. (F) The expression of
AKR1C3 in MCF-7 and MCF-7-ARO tested by western blot. Error bar, SD. *, p<0.05,
by Student’s t-test.
59
Fig2.4.
Figure 2. 4 Schematic representation of AKR1C3 knockdown. In breast cancer
epithelial cells, PGE2 increased after knocking down AKR1C3. PGE2 increases the
binding activity of the Jun and ATF groups of transcription factors to the aromatase
promoter I.3/II region. The up-regulated expression of aromatase promotes the
formation of estrogen, ultimately increasing E2 levels. E2 binds to the ligand-binding
domain of the receptor and the complex then diffuses into the cell nucleus and binds to
specific sequences of DNA called estrogen-response elements (EREs); the liganded ER
ligand-binding domain interacts with certain cofactors and co-activators to regualte
gene transcription and subsequently increase cell proliferation.
60
Fig2.5.
Figure 2. 5 AKR1C3 expression levels in breast cancer tissues. AKR1C3 expression
in breast cancer tissue is significantly lower than in normal breast tissue. The following
comparisons were made: (A) ER+ and ER−breast cancer patients, significantly lower in
ER+ patients than ER−, p=2.88E−06; (B) IDC and ILC in ER+ patients, significantly
lower in IDC than ILC, p=1.29E-07; (C) ERBB2+ and ERBB2− patients, significantly
lower in ERBB2+, p=0.0003; (D) without metastasis (M0) and with metastasis (M1),
significantly lower in metastasis, p=0.008; p=0.105.**, p<0.001, *p<0.05 by
Independent samples Student’s t test.
61
Tables
Table 2. 1 AKR1C3 siRNA sequences
siRNA
Sense sequence (5' to 3' )
Antisense sequence (5' to 3' )
GGAACUUUCACCAACAGAU[dT][dT]
AUCUGUUGGUGAAAGUUCC[dT][dT]
siRNA1
GAAUGUCAUCCGUAUUUCA[dT][dT]
UGAAAUACGGAUGACAUUC[dT][dT]
siRNA2
GGACAUGAAAGCCAUAGAU[dT][dT]
AUCUAUGGCUUUCAUGUCC[dT][dT]
siRNA3
name
63
Table 2. 1 Steroid hormone levels upon DHEA supplementation in MCF-7
DHEA
4-DIONE
TESTO
DHT
E1
E2
nM
nM
nM
nM
nM
nM
Mean±SD
Mean±SD
Mean±SD
Mean±SD
Mean±SD
Mean±SD
0nM DHEA control
2.13±0.89
1.59±0.65
No value
0.45±1E-3
0.19±0.01
0.27±0.10
0nM DHEA siRNA
2.60±1.11
1.82±0.77
No value
0.43±0.01
0.22±0.02
0.27±0.08
8nM DHEA control
30.62±14.01
9.28±3.94
0.01±7E-3
1.30±0.03
0.28±0.03
0.34±2E-3
8nM DHEA siRNA
38.44±17.60
10.86±4.75
No value
1.17±0.30
0.23±4E-3
0.37±0.02
20nM DHEA control
70.76±36.57
16.21±7.62
1.94±0.03
1.82±0.02
0.25±0.01
0.40±7E-3
20nM DHEA siRNA
53.91±22.7
13.63±5.69
0.98±0.01*
1.43±0.04*
0.24±0.03
0.43±0.05
100nM DHEA control
246.37±102.27
37.41±15.51
5.34±0.10
3.80±0.02
0.43±0.05
0.53±0.09
100nM DHEA siRNA
220.92±90.34
34.80±14.29
3.03±0.00*
3.10±0.11*
0.34±0.03
0.59±0.13
1000nM DHEA control
471.20±232.98
57.28±26.24
14.05±1.69
5.50±0.02
1.48±0.17
0.65±0.18
1000nM DHEA siRNA
516.15±215.55
61.15±25.45
7.50±1.07*
5.20±8E-3*
1.51±0.16
1.18±0.13*
Steroid hormone levels were obtained by ELISA analysis. *, with significant difference (p<0.05) compared siRNA to control. DHEA,
Dehydroepiandrosterone. 4-DIONE, Androsterone. TESTO, Testosterone. DHT, Dihydrotestosterone. E1, Estrone. E2, Estradiol.
64
Chapter Ⅲ
Proteomic study reveals that the knockdown of 17beta-hydroxysteroid
dehydrogenase type 5 in MCF-7 cells up-regulates proteins such as GRP78 and
enhances breast cancer cell development
3.1 Résumé en français
L’étude protéomique révèle que l’inhibition de l’expression du gène de la 17
bêta-hydroxystéroïde déshydrogénase de type 5 dans les cellules MCF-7 régule à
la hausse des protéines telles que la GRP78 et augmente le développement des
cellules cancéreuses.
Dans le chapitre II, nous avons trouvé qu’une des raisons du développement du cancer
du sein était l'expression régulée à la hausse de la transcription du gène de l'aromatase
après l’inhibition de l’expression du gène de la 17β-HSD5 par des siRNA spécifiques.
Basé sur cela, nous avons utilisé des siRNA pour éteindre l'expression de la 17β-HSD5
dans les cellules MCF-7. L’analyse protéomique a été réalisée pour comparer les profils
protéomiques des cellules MCF-7 avec les cellules MCF-7 modifiées par l’inhibition de
l’expression du gène de la 17β-HSD5. De plus, nous avons utilisé l’Ingenuity pathway
analysis (IPA) pour analyser la fonction des protéines et des voies d'interaction après la
réalisation gels bidimensionnels, de la spectrométrie de masse et de l'identification des
protéines exprimées différenciellement. Selon la présente étude, le rôle biologique de
ces protéines telles que le GRP78 est associe au développement de tumeurs agressives
solides. Il a été démontré que des réductions dans l'expression de la 17β-HSD5 ont été
significativement liées à un comportement agressif du cancer du sein. Ces résultats sont
compatibles avec la conclusion du chapitre Ⅱ.
67
3.2. Summary
17β-Hydroxysteroid dehydrogenase type 5 (17β-HSD5) is an essential enzyme
associated with sex steroid metabolism. Recent reports of its expression in BC and its
lower or higher expression related to poor prognostic are inconsistent. In chapter II, we
demonstrated lower expression of 17β-HSD5 in breast cancer tissue compared to
normal tissue. Moreover, we found that aromatase expression was up-regulated after
17β-HSD5 knockdown by specific siRNAs. The proteomic profiles of MCF-7 cells
were compared in the absence or presence of 17β-HSD5 knockdown to explore the
changes in BC cells with lower expression of 17β-HSD5. Ingenuity pathway analysis
(IPA) was used to analyze the function of proteins and their interaction pathways after
two-dimensional gel, mass spectrometry and protein identification. The present study
identifies proteins up-regulated in 17β-HSD5 knockdown MCF-7 cells, these proteins
being involved in 2 networks and ubiquitination pathway. The functions of the
up-regulated proteins enhance breast cancer development, such as GRP78, which is an
apoptosis inhibitor. The up-regulation of GRP78 which is an apoptosis inhibitor, will
counteract apoptosis and increase cell proliferation. This is consistent with the increase
in cell proliferation and viability after knockdown of 17β-HSD5. 17β-HSD5 may not
be a target for BC treatment but could represent a poor prognosis factor in lower
enzyme levels.
69
Proteomic study reveals that 17beta-hydroxysteroid dehydrogenase type 5
knockdown in MCF-7 cells up-regulates proteins such as GRP78 and enhances
breast cancer cell development
Dan Xu1 and Sheng-Xiang Lin1*
1
Centre de recherche du Centre hospitalier universitaire, CHUL Research Center
(CHUQ) and Laval University, Québec, Canada G1V 4G2
*
Corresponding author:
Sheng-Xiang Lin, CHULResearch Center, 2705 Blvd. Laurier, Ste-Foy, Québec G1V
4G2, Canada.
Tel.: 418 654 46377; Fax: 418 654 2761; E-mail: [email protected]
Abstract
17β-Hydroxysteroid dehydrogenase type 5 (17β-HSD5) is an essential enzyme
associated with sex steroid metabolism. The reports of the expression of 17β-HSD5 in
BC and of its prognostic value are inconsistent. In addition, the effect of 17β-HSD5
inhibition in BC is still controversial. Here, we used siRNA to silence 17β-HSD5
expression in MCF-7 cells. Proteomic profiles of MCF-7 cells with MCF-7 17β-HSD5
knockdown cells were studied by Ingenuity pathway analysis (IPA) to analyze the
function of regulated proteins and their interaction pathways after two-dimensional gel,
mass spectrometry, and identification of differentially expressed proteins. Our data
reveals that 21 proteins are upregulated in MCF-7 17β-HSD5 knockdown cells. These
proteins were involved in two networks revealed by IPA. The most significant is the
ubiquitination pathway with five proteins: HSPA5, HSPB1, PSMB4, PSMC6, and
HSCB. We also validated that with 17β-HSD5 knocking down, GRP78 and PGK1
expression were up-regulated. Conversely, 17β-HSD5 expression significantly
increased when knocking down GRP78. Activation of upstream regulator (c-Myc) was
predicted, which leads to PGK1 activation. PGK1 was overexpressed not only in
MCF-7 17β-HSD5 knockdown cells but also in invasive ductal breast carcinoma.
According to the present study, the biological function of these proteins in the tumor
and their higher expression are associated with the development of aggressive solid
tumors, consistent with the association between reductions in 17β-HSD5 expression
and aggressive behavior in breast cancer.
73
1. Introduction
Breast cancer is a common cancer diagnosed among women. In North America
(The United States and Canada), it is the second leading cause of cancer death in
women. It is evaluated that 23,800 women will be diagnosed with breast cancer, and
5,000 women will die from breast cancer in 2013[1].
Estrogens have a significant role in the development and progression of breast
cancer. 17β-hydroxysteroid dehydrogenase type 5 (17β-HSD5) is an essential enzyme
associated with sex steroid metabolism. It synthesizes 5-androstene-3β,17β-diol
(5-DIOL) from Dehydroepiandrosterone (DHEA) and catalyzes 4-androstenedione
(4-DIONE) reduction to testosterone (T). T then followed by aromatization by CYP19
aromatase provides a route for estradiol (E2) biosynthesis independent of 17β-HSD1
especially after menopause [2, 3, 4]. 17β-HSD5 is the only enzyme of 17β-HSDs
belonging to the ado-keto reductase (AKR) superfamily [5, 6]. It is also expressed in
human tissues like the prostate, endometrium and mammary gland [7]. Recently,
studies have shown that groups of cancer patients with 17β-HSD5 overexpression when
compared with groups of lower or no expression, have a worse prognosis [8]. Breast
carcinoma patients with estrogen receptor positive (ER+) and a high level of 17β-HSD5
showed a greater risk of developing recurrence in breast cancer after 5 years diagnosis
than low and intermediate level groups [9]. However, the relationship of 17β-HSD5
with recurrence was not confirmed by multivariate analysis in breast cancer [9]. Until
recently, it is revealed that inhibition of 17β-HSD1 was suitable for the treatment of
estrogen-dependent diseases, such as breast cancer, but the roles of 17β-HSD5,
17β-HSD7 and 17β-HSD12 are still controversial [10]. The critical importance of
17β-HSD5 expression in breast cancer is not clear, and further research is necessary.
The purpose of the present study was to investigate the impact of 17β-HSD5
knock down on protein profiles in MCF-7 breast cancer cell. MCF-7 cell line is widely
75
used in breast cancer research because of the expression of both estrogen receptor and
androgen receptor and high 17β-HSD5 expression [11-13]. Small interfering RNAs
(siRNAs) were used to silence 17β-HSD5 expression in MCF-7 for proteomic analysis.
Differentially expressed proteins were identified by two-dimensional electrophoresis
and MS/MS. We selected the differences in protein expression by more than 2-fold.
Our results conformed the increased expression of candidate proteins in 17β-HSD5
gene knockdown cells. These proteins were involved in the functions such as inhibition
of apoptosis, regulation of cell growth and cell differentiation. They also participate in
signal transduction. Their up-regulation is consistent with a link between reduction in
17β-HSD5 expression and aggressive behavior in MCF-7 cell line.
2. Materials and methods
2.1. Cell Culture
MCF-7 cells were bought from the American Type Culture Collection (ATCC) and
were maintained in phenol red-free DMEM low glucose medium supplemented with
10% fetal bovine serum (FBS). Cells were cultured at 37oC in a humidified atmosphere
of 95% air and 5% CO2. When plating cells, charcoal-treated medium was used to
eliminate exogenous hormones, and 1µM DHEA was applied to mimic the
physiological conditions of post-menopausal women.
2.2. siRNA synthesis and transfection
Based on the mRNA sequence of 17β-HSD5 (gene AKR1C3, Genebank accession #
NM_003739) the sense and antisense sequences of three 17β-HSD5 siRNAs (Table 3.1:
siRNA1, siRNA2 and siRNA3) were selected by using the program BLOCK-iT RNAi
Designer (Invitrogen). The specificity of siRNA sequences was checked by a BLAST
search of the GenBank database. Duplex siRNAs of 17β-HSD5 were synthesized and
purified by HPLC by GenePharma (Shanghai, China). Transfection of MCF-7 cells
with siRNAs was carried out in 10 cm dishes using Lipofectamine 2000 (Invitrogen),
76
1×106 cells/dish, and 200nM mixed 17β-HSD5-specific siRNAs. The GRP78 siRNAs
were used 100nM. The siRNA sequences of 17β-HSD5 and GRP78 specific siRNAs
were showed in Table 3.1.
2.3. Protein extracts for proteomics analysis
MCF-7 cells were seeded in 10 cm diameter dishes with 1×106 cells/dish overnight. On
the second day, they were transfected with 17β-HSD5-specific siRNA 200nM. Control
siRNAs were transfected as a control. Each condition included four independent
biological replicates, coming from four independent cell culture experiments. Proteins
were extracted after transfection with siRNA 200nM during 4 days. For protein sample
preparation, cells were firstly washed twice with 5ml cold phosphate buffered saline
(PBS 1×). Secondly, 300µl lysis buffer T8 (7M urea, 2M thiourea, 3% CHAPS, 20mM
DTT, 5mM TCEP, 0.5% IPG pH 4-7, 0,25% IPG pH 3-10) were added. Cells were
scraped with a rubber policeman in 300µl lysis buffer T8. Liquids were collected in an
eppendorf tube, then it was added 10.02µl Tris-HCL 1.5mM and 1% protease inhibitors
cocktail (EMD Chemical, Gibbs-town, NJ, USA). Protein samples were mixed gently
for 2 hours at room temperature, then spinned at 13000 rpm for 5 minutes and the
supernatant was collected. Each protein sample was precipitated using the
two-dimensional Clean-Up kit (GE Healthcare, USA) and solubilized in T8 buffer.
Protein in the supernatant was quantified with the 2D quant kit from Amersham.
2.4. Two-dimensional gel electrophoresis
Protein (200µg) were loaded onto 24 cm Immobiline Dry Strip (GE Healthcare) pH 4-7
on IPGPhor isoelectric focusing system (GE Healthcare) for first gel dimension as
recommended by the manufacturer. Then, strips were equilibrated in equilibration buffer
(50mM Tris-Cl, pH 8.8, 6M urea, 30% glycerol, 2%SDS, trace of bromphenol blue)
which contained 10 mg/ml dithiothreitol for 15 min and then in equilibration buffer
containing 25 mg/ml iodoacetamide for 15 min. The second dimension was run on 2D
77
gel 12% acrylamide gel using Ettan Dalt twelve (GE Healthcare).
2.5. Two-dimensional gel image analysis
Gels were stained with Sypro Ruby (Invitrogen) and scanned with the ProXpress scanner
(Perkin Elmer). Comparative analysis of the combination of 4 replicates of MCF-7 cells
and 4 replicates MCF-7-17β-HSD5-specific siRNA was done using Progenesis Same
Spots software (Nonlinear Dynamics).
2.6. Mass spectrometry and protein identification
Spots of interest were excised from the gel using a ProXcision_Spot cutter (Perkin
Elmer), conserved in 1% acetic acid and submitted to trypsin digestion before mass
spectrometry analysis. Tryptic digestion was performed on a MassPrep liquid handling
robot (Waters, Milford, USA) following the manufacturer’s specifications and the
protocol of Shevchenko et al [14] with the modifications suggested by Havlis et al [15].
Peptide samples were separated by online reversed-phase (RP) nanoscale capillary
liquid chromatography (nanoLC) and analyzed by electrospray mass spectrometry (ES
MS/MS). The experiments were carried out with an Agilent 1200 nano pump connected
to a 5600 mass spectrometer (AB Sciex, Framingham, MA, USA) furnished with a
nanoelectrospray ion source. Peptide separation took place on a self-packed PicoFrit
column (New Objective, Woburn, MA) packed with Jupiter (Phenomenex) 5u, 300A
C18, 15 cm x 0.075 mm internal diameter. Peptides were eluted with a linear gradient
from 2-50% solvent B (acetonitrile, 0.1% formic acid) in 30 minutes, at 300 nL/min.
Mass spectra were acquired using a data-dependent acquisition mode using Analyst
software version 1.6. Each full scan mass spectrum (400 to 1250 m/z) was followed by
collision-induced dissociation of the twenty most intense ions. Dynamic exclusion was
fix for 3 sec and a tolerance of 100 ppm.
78
All MS/MS peak lists (MGF files) were produced using ProteinPilot (AB Sciex,
Framingham, MA, USA, Version 4.5) with the Paragon algorithm. MGF sample files
were then analyzed by Mascot (Matrix Science, London, UK; version 2.4.0). MGF
peak list files were brought out using Protein Pilot version 4.5 software (ABSciex)
utilizing the Paragon and Pro group algorithms (Shilov). MGF sample data were then
analyzed by Mascot (Matrix Science, London, UK; version 2.4.0).
Scaffold 4 (proteomics of software) was used to validate MS/MS-based peptide and
protein identifications. The protein identification cut-off was set at a confidence level
of 95% (Mascot score >33) with at least two peptides matching to a protein. Proteins
that contained similar peptides and could not be differentiated based on MS/MS
analysis alone were grouped to satisfy the principles of parsimony.
2.7. Ingenuity pathway analysis
Ingenuity pathway analysis (IPA) (www.ingenuity.com) was used to gain insights into
the biological pathway and network in knocking down 17β-HSD5-MCF-7 cells. IPA
analysis also predicted upstream regulators related to 17β-HSD5 gene silence.
Analyzes were performed by the Proteomics Platform of the Quebec Genomic Centre
(Quebec City, Quebec, Canada). The networks and pathway were represented
graphically. The nodes represented proteins, and the biological interaction between two
nodes was represented as lines. We selected networks and upstream regulatory scoring
≥ 2.
2.8. Western blot
Total proteins were extracted from cells with RIPA buffer (Invitrogen) supplemented
with 1% protease inhibitors cocktail (EMD Chemicals, Gibbstown, NJ), RIPA buffer
and protease inhibitors ratio 100:1. Bradford method was used to quantify Proteins, 30
79
μg total proteins from each sample were separated on a 12% SDS-PAGE and then
electroblotted onto nitrocellulose membrane overnight. The membranes were blocked
with 5% skimmed milk in TBS-Tween 20 for 1h at room temperature. Thereafter, the
membranes were hybridized to a polyclonal antibody directed against rabbit AKR1C3
(Abcam) at dilutions of 1:1000, GRP78 (Abcam) 1:500, PGK1 (Santa Cruz
Biotechnology) 1:500, 1.5-2 hours at room temperature respectively. Subsequently,
membranes were incubated with a goat anti-rabbit IgG peroxidase-conjugated
secondary antibody (Santa Cruz Biotechnology) at a dilution of 1:10000. For loading
control, a 1:5000 dilution of monoclonal anti-β-actin antibody produced in mouse
(Sigma) was used. Membranes were washed by TBST, proteins were visualized using
the western lighting™ Plus ECL (Perkin Elmer), followed by exposure of the
membranes to X-ray films for 1s, 5s, 30s, 1min and 10min. The radiographic films
were scanned and the Image program (Molecular Dynamics, Sunnyvale, CA) was used
to quantify the density of the bands.
2.9. Cell proliferation
Cell proliferation was determined by CyQuant cell proliferation kit. MCF-7 cells
(3×103) were plated into 96-well plates containing 100μl hormone-free culture medium.
After 24h cells were transfected with 100nM siRNA and the culture medium was
replaced with medium containing different concentrations of DHEA. Cells were grown
for 4 days, and then the culture medium was removed. Cells were washed with PBS
and frozen overnight in 96-well plates at −80℃. The plates were thawed at room
temperature for 15 min then 200μl of CyQuant GR dye/cell lysis buffer were added.
The sample was protected from light in dark and incubated for 2–5 min at room
temperature. Sample fluorescence was measured using a fluorescence microplate reader
at 480nm excitation and 520nm emission.
2.10. Cell viability assay
80
Cell viability was evaluated by using MTT test. 3000 cells were seeded in 96-well
plates, GRP78-specific-siRNA was transfected or an inhibitor of 17β-HSD5 was mixed
to the culture medium after 24 hours. Four days after transfected with siRNA or treated
with an inhibitor, 10ul MTT reagent added to each well, including blank control. 2-4
hours later until purple precipitates were visible, 100ul detergent reagent were added.
Plate with the cover was left in the dark overnight at room temperature. Absorbance
was recorded at 570nm.
2.11. E2 concentration
Cells were seeded into 24-well plates at a density of 5 × 104cells/well in 500μl
hormone-free culture medium. Cells were transfected with 100nM GRP78 specific
siRNA or control siRNA as the negative control after 24 hours. Each condition was
performed in duplicate. The culture medium was replaced with hormone-free medium
containing 1μM DHEA five hours after transfection. The medium was collected from
wells 4 days after transfection and immediately frozen at −80 o C until analysis. The
levels of E2 in the medium were determined by commercial ELISA kit (Cayman
Chemical, USA). All measurements were according to the supplier’s protocols. The
media were thawed and mixed before testing. Duplicate wells were prepared for each
conditaion to be measured. E2 plates were read at 420nm in a plate reader (Spectra
Max 340PC; Molecular Devices, Sunnyvale, CA). The EIA Double software calculated
E2 concentrations.
3. Results
3.1. Knocking down 17β-HSD5 expression modify the protein profile of MCF-7
cells
To investigate the proteomic modifications of MCF-7 cells in response to 17β-HSD5
knockdown, we performed two-dimensional gel (2-D gel) analysis using total protein
lysates of the MCF-7 cells and MCF-7 cells transfected with 17β-HSD5-specific
81
siRNA cultured 4 days in medium containing 1µM DHEA. Before 2-D gel analysis,
Western blot was carried out to make sure 17β-HSD5 was reliably knocked down
(Fig3.6A).
Proteomic
analysis
were
performed
on
eight
two-dimensional
electrophoresis gel made from four independent biological repetitions of protein
samples from MCF-7 and MCF-7-17β-HSD5-specific siRNA cells (all the four
independent biological repetitions were validated in Fig3.6A). In two conditions, cells
displayed similar spot patterns (Fig3.1), which allowed good spot alignment for the
proteome comparison. The proteomic analysis used the Progenesis software and a t-test
(with a P-value<0.05). Four significant differential protein spots were identified
between MCF-7 and MCF-7-17β-HSD5 siRNA cells. All spots were up-regulated in
MCF-7-17β-HSD5 siRNA, which were selected among the differentially expressed
spots and were analyzed by mass spectrum (MS). A total of 21 proteins were identified
with a known UniProt accession numbers among all the spots. Using the Uniprot
database [16] and Scafford software, we determined the functions or biological
processes of each of the 21 proteins identified by MS analysis (Table 3.2). From the
results, we observed that proteins associated with cell cycle, cell proliferation, and
metastasis were up-regulated after the 17β-HSD5 knockdown in MCF-7 cells. The
largest proportion of functional category was metabolic process (28%). Followed by
response to stress (12%), signal transduction (11%), transport (11%), cell cycle (8),
biosynthesis process (7%), mRNA process, cell proliferation and apoptosis. (Fig3.2).
these results reveal that 17β-HSD5 plays an important role in MCF-7 breast cancer
cells and that proteins involved in metabolic pathways are induced when 17β-HSD5
was knockdown in MCF-7 cells.
3.2. Pathway analysis and protein interaction network generation by IPA
The list of 21 identified proteins in Table 3.2 has been associated with 2 networks. The
first and the highest score (34) corresponds to a network comprising a list of 13
proteins and 22 partner proteins added by IPA to the completed system. The 13 proteins
list in Table 3.2 includes ANXA7, CAND1, CFL1, HNRNPH1, HSCB, HSPA5,
82
HSPB1, KRT19, MCM7, NME1, PCBP2, PGK1, PSMB4. The three associated
functions include network signaling and interaction between cells (cell to cell signaling
and communication), tissue development or certain hereditary disorders. The most
interesting are the ERK1/2 and JUK NF-kB complex (Fig3.3). The second network
consists of 8 proteins from the list of table 3.2 and 27 partner proteins. The 8 proteins
from the list are ATIC, DDX39B, OBFC1, PCYT1A, PPME1, PSMC6, RAB11A,
SEPHS1. The three functions that are associated include molecular network transport,
RNA trafficking, and developmental disorder (Fig3.4). A critical and common part of
interactions of the two networks is mainly with Ubiquitin C. The most significant is the
pathway of the ubiquitination of proteins (Protein Ubiquitination Pathway) with five
proteins: HSPA5, HSPB1, PSMB4, PSMC6 and HSCB (Fig3.5). These proteins are
involved in two successive steps of the ubiquitination. Two HSPs, the HSPA5, and
HSPB1 are part of the process control and collapsing protein polyubiquitination. Both
mechanisms are associated with cellular stress. Standard functions of sHSPs are
chaperone activity, thermotolerance, inhibition of apoptosis, regulation of cell growth,
and cell differentiation. They also participate in signal transduction.
3.3. Correlation between 17β-HSD5 and HSPA5 expression
From the above proteomics results, we could observe that after knocking down
17β-HSD5, HSPA5 (GRP78) expression was up-regulated which represents a critical
protein in ubiquitination pathway and apoptosis. Therefore, Western blot was carried
out to verify if GRP78 expression was up-regulated when 17β-HSD5 was depleted.
Results show that GRP78 expression increased (39%) after 17β-HSD5 knocking down
compared to control siRNA (Fig3.6B and C). We were interested to know if GRP78
knockdown would increase 17β-HSD5 expression. Therefore, GRP78 specific siRNA
was added to the experiments. Cells were transfected with GRP78 specific siRNA and
control siRNA respectively. Total proteins were extracted after 48 hours of treatment.
GRP78 and AKR1C3 proteins expression levels were semi-quantitative by western blot
(Fig3.6D), It was shown that GRP78 levels were decreased to 15% after GRP78
83
specific siRNA transfection compared to control siRNA(Fig3.6E), and AKR1C3
protein expression was elevated 4-fold when GRP78 was knocked down compared to
control after image analysis (Fig3.6D and F). Thus, GRP78 and 17β-HSD5 exert a
negative regulation on each other in MCF-7 cells.
3.4. Knocking down 17β-HSD5 stimulates cell proliferation, knocking down
GRP78 in contrast
Due to the negative regulation between 17β-HSD5 and GRP78, GRP78 was
up-regulated after the 17β-HSD5 knockdown. As GRP78 has an anti-apoptotic function
[17], cell proliferation and cell viability measures were carried out. To determine the
MCF-7 cell growth after knocking down 17β-HSD5, cell proliferation was measured by
Cyquant cell proliferation kit. Four days after transfection, cell proliferation increased
35% (p=0.01) in 17β-HSD5 silenced cells compared to control (Fig3.7A). Cells treated
with a 17β-HSD5 inhibitor (EM1404, 2 fold IC50, 6.4nM) for 4 days showed that cell
viability increased 26% (p=0.01) when compared to control (Fig3.7B). To determine
the role that GRP78 silence plays in cell viability and hormone steroid changes in
MCF-7 cells, MTT test and ELISA measurement were performed. Results showed that
after the GRP78 knockdown, cell viability significantly decreased (27%) compared to
control siRNA (p=0.003) (Fig3.7C). E2 average levels from 229.55pg/ml in control
siRNA decreased to 132.9pg/ml in GRP78 siRNA treatment (p=0.01) (Fig3.7D).
3.5. MYC was predicted as an upstream regulator that leads to PGK1 activation.
Upstream regulators were analyzed by IPA analysis. One significant (Z score=2,
p-value of overlap 1.64E-03) upstream regulator is MYC, which is a transcription
regulator. The target molecules from the list are DDX39B, HSPB1, MCM7, PGK
(Fig3.8A). DDX39B, MCM7, PGK1 were predicted to be activated by MYC.
phosphoglycerate kinase (PGK1) is an ATP-generating glycolytic enzyme that is
associate with hypoxia of many solid tumors [18]. Therefore, Western blot was carried
84
out to verify if PGK1 expression was up-regulated when 17β-HSD5 was depleted.
Results showed that PGK1 expression increased 2.13 fold (p=0.04) after 17β-HSD5
knockdown compared to control siRNA (Fig3.8B and C). We used the ONCOMINE
database [19] to compare PGK1 gene expression in normal breast and invasive ductal
breast carcinoma tissue. Results showed that invasive ductal breast carcinoma tissue
significantly over-expressed PGK1 gene compared to normal breast (2 fold changes,
p=1E-4).
4. Discussion
17β-HSD5 participated in estradiol synthesis of hormone steroid pathway [2-4].
However, its role in breast cancer is still controversial [10]. Due to proteins being the
actual effectors driving cell behavior and proteomics technology advance [20], we then
used proteomics to clarify 17β-HSD5 role in BC. MCF-7 cell line is an ideal model and
it has been extensively used to study ER+ BC. MCF-7 cells show estrogen-dependent
growth and ERα activation and regulation, as well as an accurate response to hormone
therapies observed in clinical research [21]. Additionally, MCF-7 cell line was found to
have a greater expression of 17β-HSD5 as determined by the mRNA copy number
revealed by Q-RT-PCR [12-13]. Therefore, we chose MCF-7 cell line to knock down
17β-HSD5 and to perform proteomic analysis in order to understand more clearly the
role of 17β-HSD5.
The 2-D gel images of normal MCF-7 and MCF-7 17β-HSD5 knockdown showed
only four significantly different spots (fold change >2). However, MS analysis
indicated that 21 proteins (Table 1) were present in total. After classifying all the
proteins, we found the largest proportion to have metabolism processing as functional
category (28%). Followed by response to stress (12%), signal transduction (11%), cell
cycle (8), and biosynthesis process (7%). It was demonstrated that 17β-HSD5 plays a
significant role in these fields and is mainly involved in cell metabolism processing.
85
IPA analysis results showed that 2 networks were generated. The typical interaction of
the 2 network is protein ubiquitin C. Ubiquitin C is involved in protein ubiquitination
pathway. The proteins involved in this pathway include HSPA5 (GRP78). The GRP78
is a member of the heat shock protein70 (HSP70) family [22]. Recently, the research of
GRP78 has helped to understand better this protein. GRP78 is implicated in genomic
instability and gene mutation, cancer-associated inflammation, tumor immune escape,
tumor cell growth and death resistance, regulation of cell metabolism, tumor
angiogenesis, tumor cell invasion and metastasis, tumor cell replicative immortality,
and has implications for cancer treatment [23]. GRP78 regulate the protein B-cell
lymphoma 2 (BCL-2) sequestered by BCL-2-interacting Killer (Bik) at endoplasmic
reticulum, thus uncoving a new mechanism by which GRP78 confers endocrine
resistance in breast cancer [17, 24]. Apoptosis is a programmed cell death, and several
mechanisms are involved in the regulation of apoptosis. GRP78 was shown to have a
regulatory role in some of these mechanisms [24]. In the present study, we found that
the expression of GRP78 and 17β-HSD5 had a negative correlation. GRP78 expression
was up-regulated when 17β-HSD5 was knocked down while 17β-HSD5 expression
significantly increased after the GRP78 knockdown. Furthermore, we measured cell
viability and cell proliferation after inhibiting or destroying 17β-HSD5; both were
significantly increased. One reason for the cell growth increase may be due to the
up-regulation of GRP78, The later reduced apoptosis thus promoting cell growth. In
reverse, cell viability and E2 concentration significantly decreased after GRP78
knockdown. These results can be explained by the fact that GRP78 knockdown induces
cell apoptosis, based on the function and mechanism of GRP78 and apoptosis [23-26].
Elevated GRP78 level correlated with higher pathologic grade, recurrence, and poor
patient survival in breast cancer [27]. GRP78 will be a novel target for BC treatment.
Therefore, 17β-HSD5 should not be inhibited in breast cancer, because the lower
expression of 17β-HSD5 enhance the development of breast cancer, one reason being
the GRP78 up-regulation when 17β-HSD5 has a lower expression in breast cancer
cells.
86
IPA analysis found that MYC (c-Myc) is an upstream regulator. c-Myc may be an
important transcriptional repressor, and the central role of c-myc is the promotion of
cell replication [28]. Many studies show that c-Myc proteins are increased in most of
BC cases [29-33]. Many experiments have shown that estrogens could stimulate the
expression of c-Myc mRNA [34-36]. In our IPA analysis, results showed that c-myc
leads to phosphoglycerate kinase 1 (PGK1) activation. PGK1 was up-regulated
2.13-fold in MCF-7 17β-HSD5 knockdown cells compared to regular MCF-7 cells.
PGK1 is a glycolytic enzyme, first generating ATP from the glycolytic pathway. Solid
tumor cells employ glycolytic enzymes such as PGK1 to produce ATP when tumor
cells are in hypoxia [37]. Recently, PGK1 has been found in some cancers, such as
prostate cancer, where it regulates angiogenesis [18]. In gastric cancer, PGK1 is a
promoting enzyme in the process of peritoneal dissemination [38]. In our research, we
used ONCOMINE database and found that the PGK1 gene had a higher expression
(2.03-fold) in invasive ductal breast carcinoma. PGK1 expression in breast cancer was
also up-regulated, and knock down of 17β-HSD5 was associated with PGK1 having a
higher expression. These results also revealed that 17β-HSD5 knockdown will promote
breast cancer development, that PGK1 may act as a prognostic marker and /or be a
potential therapeutic target in BC in future studies. Some genes activation (such as
PGK1) by c-myc may be needed for the survival or growth of the tumor cells in a
hostile environment of hypoxia that often occurs if the tumor is large enough to lack
sufficient blood and oxygen supplies. This hypothesis needs further validation.
5. Conclusion
The present study reveals that proteins up-regulated in 17β-HSD5 knockdown
MCF-7 cells are involved in 2 networks and ubiquitination pathway. The functions of
the up-regulated proteins can enhance breast cancer development, such as GRP78,
which is an apoptosis inhibitor. The up-regulation of this will counterwork apoptosis. It
was verified that cell proliferation and viability increased after the 17β-HSD5
knockdown. Thus, knockdown of 17β-HSD5 in breast cancer cells up-regulated
87
proteins that can enhance breast cancer development. 17β-HSD5 may not be a potent
target for breast cancer treatment, but perhaps it could serve as a poor prognosis factor
when associated to its lower level.
Conflict of interest
The authors have no conflicts of interest to declare.
Funding
This work was supported by Canadian Institutes of Health Research (CIHR) (MOP
O9719) to SXL and colleagues
Acknowledgment
Thank you to Gina for the 2-D gel image analysis. Thank you, Dr. Ezequiel Calvo, for
the IPA analysis. Dan Xu is grateful to the China Scholarship Council (CSC) for its
support.
88
References
[1]Breast
Cancer
statistics.
Canadian
Cancer
Society
(2013).
http://
www.cancer.ca/cancer.
[2]V. Luu-The, F. Labrie. The intracrine sex steroid biosynthesis pathways. Program.
Brain. Res. 181 (2010) 177-192.
[3]TM. Penning, Y. Jin, S. Steckelbroeck, T. Lanisnik Rizner, M. Lewis.
Structure-function of human 3α-hydroxysteroid dehydrogenases: genes and proteins.
Mol. Cell. Endocrinol. 215 (2004) 63-72.
[4]F. Labrie. Intracrinology. Mol. Cell. Endocrinol. 78 (1991) 113–118.
[5]JM. Jez, MJ. Bennett, BP. Schlegel, M. Lewis and TM. Penning. Biochem. J. 326
(1997) 625-636.
[6]JM. Jez, TG. Flynn, TM. Penning. A new nomenclature for the aldo-keto reductase
superfamily. Biochem. Pharmacol. 54(1997)639-647.
[7]TM. Penning, ME. Burczynski, JM. Jez, CF. Hung, HK. Lin, H. Ma, M. Moore, N.
Palackal,
K.
Ratnam. Human 3alpha-hydroxysteroid
dehydrogenase isoforms
(AKR1C1-AKR1C4) of the aldo-keto reducatse superfamily: functional plasticity and
tissues distribution reveals roles in the inactivation and formation of male and female sex
hormones. Biochem. J. 351(2000): 67-77.
[8]OO. Oduwole, Y. Li, VV. Isomaa, A. Mäntyniemi, AE. Pulkka, Y. Soini, PT. Vihko.
17β-Hydroxysteroid Dehydrogenase type 1 is an independent prognostic marker in
breast cancer. Cancer Res. 64(2004) 7604-7609.
[9]AK. Jansson, C. Gunnarsson, M. Cohen, T. Sivik, O. Stål. 17β-Hydroxysteroid
Dehydrogenase 14 affects estradiol levels in Breast Cancer and Is a prognostic maker
in estrogen receptor-Positive Breast Cancer. Cancer Res 66 (2006) 11471-11477.
[10]D. Poirier. 17beta-Hydroxysteroid dehydrogenase inhibitors: a patent review.
Expert Opin. Ther. Pat. 20 (2010) 1123-1145.
[11]RM. Neve , K. Chin, J. Fridlyand, J. Yeh, FL. Baehner, T. Fevr, L. Clark, N.
Bayani, JP. Coppe, F. Tong, T. Speed, PT. Spellman, S. DeVries, A. Lapuk, NJ.
Wang, WL. Kuo, JL. Stilwell, D. Pinkel, DG. Albertson, FM. Waldman, F.
McCormick, RB. Dickson, MD. Johnson, M. Lippman, S. Ethier, A. Gazdar, JW. Gray.
89
A collection of breast cancer cell lines for the study of functionally distinct cancer
subtypes. Cancer Cell. 10 (2006) 515–527.
[12]JA. Aka, SX. Lin. Comparison of functional proteomic analyses of human breast
cancer cell lines T47D and MCF-7. PLOS ONE 7 (2012) e31532.
[13]Y Laplante, C Rancourt, D Poirier. Relative involvement of three 17β-HSDs (types
1, 7 and 12) in the formation of estradiol in various breast cancer cell lines using
selective inhibitors. Mol Cell Endocrinol. 25 (2009) 146-153.
[14]M. Shevchenko, O .Wilm, Vorm, and M. Mann. Mass spectrometric sequencing of
proteins from silver-stained polyacrylamide gels. Anal. Chem. 68 (1996) 850-858.
[15]J. Havlis, H.Thomas, M. Sebela, A. Shevchenko. Fast-Response Proteomics by
Accelerated In-Gel Digestion of Proteins. Anal. Chem. 75 (2003) 1300-1306.
[16]Uniprot database. [ http://www.uniprot.org]
[17]Z. Hui, Z. Yi, F. Yong, C. Lauren and S.L. Amy. A novel mechanism of
anti-apoptotic function of 78 kDa glucose-regulated protein (GRP78), an endocrine
resistance factor in breast cancer, thrpugh release of B-cell lymphoma 2 (BCL-2) from
BCL-2-interfacting
killer
(BIK).
J.Bio.Chem.
26
(2011).
doi:
10.1074/jbc.M110.212944.
[18]J. Wang, J. Wang, J. Dai, Y. Jung, CL. Wei, Y. Wang, AM. Havens, PJ. Hogg, ET.
Keller, KJ. Pienta, JE. Nor, CY. Wang, RS. Taichman. A glycolytic mechanism
regulating an angiogenic switch in prostate cancer. Cancer Res. 67 (2007) 149-159.
[19]Oncomine [https://www.oncomine.org]
[20]AD.Weston, L. Hood. Systems Biology, Proteomics, and the Future of Health Care:
Toward Predictive, Preventative, and Personalized Medicine". J. Proteome Res. 3
(2004) 179–196.
[21]D.L Jessica, M.B Scott, L.P Ginny, J.B David and T.A Elaine. Hormonally
responsive breast cancer cells in a microfluidic coculture model as a sensor of
microenvironmental activity. Integr. Biol. (Camb) 5 (2013):807-816.
[22]M. Daugaard, M. Rohde, M. Jäättelä. The heat shock protein 70 family: Highly
homologous proteins with overlapping and distinct functions. FEBS Lett. 581 (2007)
3702-10.
90
[23]Z Li and Z Li. Glucose regulated protein 78: A critical link between tumor
microenvironment and cancer hallmarks. Biochim. Biophys. Acta1826 (2012) 13-22.
[24]KL. Cook, PA. Clarke, R. Clarke. Targeting GRP78 and antiestrogen resistance in
breast cancer. Future Med. Chem. 5 (2013) 1047-1057.
[25]P. Baumeister, D. Dong, Y. Fu, AS. Lee. Transcriptional induction of GRP78/BiP
by
histone
deacetylase
inhibitors
and
resistance
to
histone
deacetylase
inhibitor–induced apoptosis. Mol. Cancer Ther. 8 (2009) 1086–1094.
[26]RV Rao, A Peel, A Logvinova, G del Rio, E Hermel, T Yokota, PC Goldsmith, LM
Ellerby, HM Ellerby, DE Bredesen. Coupling endoplasmic reticulum stress to the cell
death program: role of the ER chaperone GRP78. FEBS Lett. 514 (2002) 122-8.
[27]S.L.Amy. GRP78 induction in cancer: therapeutic and prognostic implications.
Cancer Res. 67 (2007) 3496-3499.
[28]DJ Liao and R B Dickson. c-Myc in breast cancer. Endocrine-related Cancer 7
(2007) 143-164.
[29]NJ Agnantis, H Mahera, N Maounis & DA Spandidos. Immunohistochemical study
of ras and myc oncoproteins in apocrine breast lesions with and without papillomatosis.
Eur. J. Gynaecol. Oncol. 13 (1992) 309–315.
[30]ZP Pavelic, L Pavelic, EE Lower, M Gapany, S Gapany, EA Barker & HD Preisler.
c-myc, c-erbB–2, and Ki–67 expression in normal breast tissue and in invasive and
noninvasive breast carcinoma. Cancer Res. 52 (1992) 2597–2602.
[31]JG Saccani, M Fontanesi, E Bombardieri, M Gabrielli, P Veronesi, M Bianchi, G
Becchi, A Bogni & A Tardini. Preliminary study on oncogene product
immunohistochemistry (c-erbB–2, c-myc, ras p21, EGFR) in breast pathology. Int. J.
Biol. Markers. 7 (1992) 35–42.
[32]DJ Hehir, G McGreal, WO Kirwan, W Kealy & MP Brady. c-myc oncogene
expression: a marker for females at risk of breast carcinoma. J. Surg. Oncol. 54 (1993)
207–209.
[33]T. Pietilainen, P. Lipponen, S. Aaltomaa, M. Eskelinen, VM. Kosma & K.
Syrjanen Expression of c-myc proteins in breast cancer as related to established
prognostic factors and survival. Anticancer Res. 15 (1995) 959–964.
91
[34]M. Schuchard, JP. Landers, NP. Sandhu & TC. Spelsberg. Steroid hormone
regulation of nuclear proto-oncogenes. Endocr. Rev. 14 (1993) 659–669.
[35]RP. Shiu, PH. Watson & D. Dubik c-myc oncogene expression in
estrogen-dependent and -independent breast cancer. Clin. Chem. 39 (1993) 353–355.
[36]SM. Hyder, GM. Stancel & DS. Loose-Mitchell. Steroid hormone-induced
expression of oncogene encoded nuclear proteins. Crit. Rev. Eukaryot. Gene Expr. 4
(1994) 55–116.
[37]EB. Daly, T. Wind, XM. Jian, L. Sun, PJ. Hong. Secretion of phosphoglycerate
kinase from tumour cells is controlled by oxygensensing hydroxylases. Biochim.
Biophys. Acta 1691 (2004) 17-22.
[38]D. Zieker, I. Königsrainer, I. Tritschler, M. Löffler, S. Beckert, F. Traub, K. Nieselt,
S. Bühler, M. Weller, J. Gaedcke, RS. Taichman, H. Northoff, BL. Brücher, A.
Königsrainer. Phosphoglycerate kinase 1 a promoting enzyme for peritoneal
dissemination in gastric cancer. Int. J. Cancer. 126 (2010) 1513-1520.
92
Figures and legends
Fig3.1.
Figure 3. 1 Representative 2-D gel images for MCF-7 cells and 17β-HSD5
knock-down MCF-7 cells showing some differentially expressed spots. The 2-D
gels were scanned and 4 differentially expressed (2-fold or higher, p<0.05) proteins in
loops were selected using Progenesis software and picked for MS analysis.
93
Fig3.2.
Figure 3. 2 Functions of the proteins differentially expressed in 17β-HSD5 knock
down and parental MCF-7 cells.
94
Fig3.3.
Figure 3. 3 The first network: IPA highlights interaction between several proteins
functionally associated directly and indirectly to 13 proteins (ANXA7, CAND1, CFL1,
HNRNPH1, HSCB, HSPA5, HSPB1, KRT19, MCM7, NME1, PCBP2, PGK1,
PSMB4.). Most interesting are the ERK1/2 and JNK NF-kB complex.
95
Fig3.4.
Figure 3. 4 The second interaction network generated by IPA analysis consists of 8
proteins from the list (ATIC, DDX39B, OBFC1, PCYT1A, PPME1, PSMC6, RAB11A,
SEPHS1). A crucial part of the interactions network is the ubiquitin C (UBC) node.
96
Fig3.5.
Figure 3. 5 Protein ubiquitination pathway generated by the ingenuity pathway
analysis (IPA) software. Protein ubiquitination is associated with apoptosis, DNA
repair and endocytosis of cell surface receptors regulation of the process. Proteins in
shaded nodes were found to be highly expressed in 17β-HSD5 knockdown MCF-7
cells.
97
Fig3.6.
Figure 3. 6 Negative crosstalk between expression of 17β-HSD5 and GRP78. (A)
Western blot of 17β-HSD5 knock down effect assay before proteomic was carried out.
This indicates that 17β-HSD5 was successfully silenced in all the four different
samples. (B) The GRP78 expression was measured by western blot after knock down
of 17β-HSD5. (C) Images analysis of (B) indicating that GRP78 expression was
up-regulated by 39% (D) Western blot showed GRP78 silenced during upregulation of
17β-HSD5 expression. (E, F) images analysis of D.
98
Fig3.7.
Figure 3. 7 MCF-7 cell growth and E2 production. (A and B) Cell proliferation and
cell viability significantly increased after knockdown or inhibition of 17β-HSD5. (C
and D) Cell viability and E2 levels significantly decreased after the knockdown of
GRP78.
99
Fig3.8.
Figure 3. 8 The expression of PGK1 was up-regulated in 17β-HSD5 knockdown
MCF-7 cells. (A) IPA analysis predicts activation of upstream regulator MYC. Target
molecules in the dataset include: DDX39B, HSPB1, MCMF, NME1, PGK1. (B)
Western blot analysis showing PGK1 up-regulation after knock down of 17β-HSD5 in
100
MCF-7 cells. (C). Image analysis of B. (D). Oncomine clinical database analysis of
samples from the TCGA cohort indicating that PGK1 is more highly expressed in
invasive ductal breast carcinoma compared to normal breast tissue.
101
Tables
Table 3. 1 Sequences of 17β-HSD5 and GRP78 specific siRNA
siRNA
Sense sequence(5’ to 3’)
Anti-sense sequence (5’ to3’)
siRNA 1
GGAACUUUCACCAACAGAUTT
AUCUGUUGGUGAAAGUUCCTT
siRNA 2
GAAUGUCAUCCGUAUUUCATT
UGAAAUACGGAUGACAUUCTT
siRNA 3
GGACAUGAAAGCCAUAGAUTT
AUCUAUGGCUUUCAUGUCCTT
siRNA 1
GGUUACCCAUGCAGUUGUUTT
AACAACUGCAUGGGUAACCTT
siRNA 2
GGAGCGCAUUGAUACUAGATT
UCUAGUAUCAAUGCGCUCCTT
siRNA 3
GGGCAAAGAUGUCAGGAAATT
UUUCCUGACAUCUUUGCCCTT
UUCUCCGAACGUGUCACGUTT
ACGUGACACGUUCGGAGAATT
name
17β-HSD 5
GRP78
NC
103
Table 3.2 Mass spectrometry identification of proteins spot upregulated in
MCF-7-17β-HSD5 siRNA as compare to MCF-7 control siRNA *
Spo
t
F
C
211
2
Uniprot
number
Description
MW
exp/pre
d
pe
p
PI
Function and/or biological process
Heterogeneous
nuclear
ribonucleoprotein H (HRNPH)
P31943
49/35
4
mRNA metabolism and transport
spliceosome
helicase
Q13838
49/35
4
Nuclear export of spliced and unspliced
mRNA
DDX39B
Nucleoside diphosphate kinase
A (NME1,NM23)
P15531
17/20
3
cofilin-1
P23528
19/20
2
9
286
2.
0
6
249
2.
7
1
RNA
Phosphoglycerate
1(PGK1)
kinase
P00558
45/28
11
Over-expression in many cancer, down
regulation PGK1 initiating apoptosis
and suppressing cancer metabolism
heat
shock
beta-1(HSP27)
protein
P04792
23/28
5
beta
P28070
29/28
4
Phosphorylated in MCF-7 cells on
exposure to protein kinase C activators
and heat shock
BRCA1 up-regulated genes in MCF-7
breast carcinoma cells
Ras-related protein Rab-11A
P62491
27/28
2
EGFR recycling, enhances proliferation,
and prevents motility of an immortal
breast cell line (MCF 10A)
Iron−Sulfur
Cochaperone HscB
Q8IWL3
24/28
2
A co-chaperone in iron-sulfur cluster
assembly in mitochondria
bifunctional purine biosythesis
protein PURH
P31939
65/45
12
Bifunctional enzyme that catalyzes 2
steps in purine biosynthesis
CST complex subunit STN1
Q9H668
42/45
7
Binds to single-stranded DNA and is
required to protect telomeres from DNA
degradation.
Protein
Q9Y570
42/45
7
Demethylates proteins
methylesterase 1
DNA replation licensing factor
MCM7
P33993
81/45
5
Cell proliferation, DNA
initiation and elongation
Poly(rC)-binding
Q15366
39/45
5
Binds to oligo dC
Keratin, type1 cytoskeletal 19
P08727
44/45
5
the organization of myofibers
26S
protease
subunit 10B
P62333
44/45
4
ATP-dependent
degradation
ubiquitinated proteins
choline-phosphate
cytidylytransferase A
P49585
42/45
4
Controls phosphatidylcholine synthesis
78kDa
glucose-regulated
protein (GRP78, HSPA5)
P11021
72/45
3
overexpression of GRP78 suppresses
apoptosis
Gullin-associated
NEDD8-dissociated protein 1
(CAND1)
Q86VP6
136/45
2
assembly factor of SCF E3 ubiquitin
ligase complexes
selenide, water dikinase 1
P49903
43/45
2
Synthesizes
proteasome
subunit
type-4(PSMB4)
332
2.
6
5
Cell proliferation, differentiation and
development, signal transduction, G
protein-coupled receptor endocytosis, and
gene expression. Associate with tumor
metastasis.
Normal progress through mitosis and
normal cytokinesis.
Cluster
phosphatase
protein
replication
2(PCBP2)
regulatory
selenophosphate
of
from
selenide and ATP
Annexin A7
P20073
53/45
2
membrane fusion and exocytosis
(*) The function description and/or biological process were quoted from the Scafford 4
software functionally classification. Spot, spot number; FC, fold change; MW,
molecular weight; PI, isoelectric point as determined from 2-D gel experiments; Pep,
105
number of unique peptides; Description, the name of the protein, the symbol in the
brackets.
106
Chapter Ⅳ
Mimicking postmenopausal steroid metabolism in breast cancer cell culture:
differences in response to DHEA or other steroids as hormone sources
107
4.1. Résumé en français
Imitant l'état post-ménopausique chez le métabolisme des stéroïdes dans la culture
de cellules de cancer du sein: différences entre la DHEA et d'autres stéroïdes
comme source d'hormone
Après la ménopause, près de 100% des œstrogènes sont synthétisés dans les tissus
cibles périphériques à partir de précurseurs stéroïdiens d'origine surrénalienne qui sont
la source unique de stéroïdes sexuels chez ces femmes selon la théorie de
l’intracrinologie. Toutefois, des recherches antérieures sur les enzymes de conversion
des stéroïdes ont utilisé leur substrat immédiat en tant que source d'hormone en raison
de la facilité d'effectuer l’étude et des signaux plus forts. Dans cet article, nous
suggérons de fournir du DHEA comme source d'hormone intracrinologique et de
comparer le rôle des enzymes de conversion de stéroïdes en utilisant la DHEA et leurs
substrats directs. Nous avons utilisé trois enzymes cibles humaines, soit la
17β-hydroxystéroïde déshydrogénase de type 1 (17β-HSD1) et de type 7 (17β-HSD7)
et la 3-alpha type hydroxystéroïde déshydrogénase de type 3 (3α-HSD3) pour
démontrer les différences entre la DHEA et d'autres stéroïdes comme la source
d’hormone. Les résultats n’ont montré aucune différence dans la fonction biologique de
la 17β-HSD1 et de la 17β-HSD7 lorsqu'elles sont cultivées avec différents stéroïdes.
Cependant, la supplémentation du milieu de culture se révèle avoir un impact marqué
sur l'étude de la 3α-HSD3. Nous avons démontré que la fourniture de différents
stéroïdes comme substrat ou source d’hormones est susceptible de promouvoir des
effets biologiques modifiés. En outre, la DHEA est un bon choix pour imiter un état
post-ménopausique dans le métabolisme des stéroïdes en culture cellulaire.
109
4.2. Summary
After menopause, close to 100% estrogens are synthesized in peripheral target
tissues from precursor steroids of adrenal origin, which are the unique source of sex
steroids in these women. This positions some steroid metabolizing enzymes as primary
targets for novel therapies for estrogen receptor-positive (ER+) breast cancer. However,
previous research on the steroid-converting enzymes has been performed using their
direct substrate as a hormone source, due to the facility of studying them and the larger
signal produced. These experiments may not always provide an accurate reflection of
physiological and post-menopausal conditions. When an extensive understanding of the
mechanism is necessary, suggest to provide DHEA as intracrinological hormone source
to compare the role of steroid-converting enzymes using DHEA and their direct
substrates In this chapter, we used three target enzymes, human 17β-hydroxysteroid
dehydrogenases type 1 (17β-HSD1) and type 7 (17β-HSD7) and 3α-Hydroxysteroid
dehydrogenase type 3 (3α-HSD3), to demonstrate the differences among providing
DHEA and other steroids as hormone source. Knock down of the enzymes by their
respective specific siRNAs and their differences on biological function were studied in
detail. Cell biology study showed no difference in biological function for 17β-HSD1
and 17β-HSD7 when cultured with different steroid hormones. However, the culture
medium supplementation was found to have a marked impact on the study of 3α-HSD3.
We demonstrated that provision of different steroids as substrates or hormone sources
may promote modified biological effects. Therefore, provision of DHEA is a good
choice to mimic postmenopausal condition in steroid metabolism in cell culture.
111
Mimicking postmenopausal steroid metabolism in breast cancer cell culture:
differences in response to DHEA or other steroids as hormone sources
Dan Xu 1 and Sheng-Xiang Lin1*
* Correspondence: [email protected]
1 Centre Hospitalier Universitaire de Québec Research Center (CHUQ - CHUL) and
Department of Molecular Medicine, Laval University, 2705 boulevard Laurier, Québec
G1V4G2, Canada
Highlights

Steroid enzymes may lead to different biological effects depending on the hormone
source

17β-HSD1, 17β-HSD7, and 3α-HSD3 are potent targets for ER+-breast cancer

DHEA provision rationally mimics postmenopausal condition in steroid
metabolism
Abstract
Following menopause virtually 100% of estrogens are synthesized in peripheral
target tissues from precursor steroids of adrenal origin. These steroids are the unique
source of sex steroids in these women. This positions some steroid metabolizing
enzymes as primary targets for novel therapies for estrogen receptor-positive (ER+)
breast cancer. However, previous research on the steroid-converting enzymes has been
performed using their direct substrate as a hormone source, depending on the facility
where studied and the robust signal obtained. These experiments may not always
provide an accurate reflection of physiological and post-menopausal conditions. We
suggest providing dehydroepiandrosterone (DHEA) as an intracrinological hormone
source, and comparing the role of steroid-converting enzymes using DHEA and their
direct substrates when an extensive mechanistic understanding is required. Here, we
present a comparative study of these enzymes with the provision of DHEA and the
direct substrates, estrone (E1) or dihydrotestosterone (DHT), or additional steroids as
hormone sources, in breast cancer cells. Enzyme knockdown by respective specific
siRNAs and observations on the resulting differences in biological function were
carried out. Cell biology studies showed no difference in biological function for
17β-HSD1 and 17β-HSD7 when cultured with different steroid hormones: cell
proliferation and estradiol levels decreased, whereas DHT accumulated; cyclinD1,
PCNA, and pS2 were down-regulated after knocking down these two enzymes,
although the quantitative results varied. However, culture medium supplementation was
found to have a marked impact on the study of 3α-HSD3. We demonstrated that
provision of different steroids as a substrate or hormone sources may promote modified
biological effects: provision of DHEA is the preferred choice to mimic postmenopausal
steroid metabolism in cell culture.
Key words: breast cancer, 17β-HSD1, 17β-HSD7, 3α-HSD3, siRNA knockdown,
DHEA, E2, DHT.
115
1.1. Introduction
There is evidence that sex hormones play a significant role in the etiology of breast
cancer [1–2]. The concentration of estradiol is significantly higher in malignant
compared with nonmalignant human breast tissue from pre- and postmenopausal
women [3]. Estradiol (E2) can enhance risk by stimulating proliferation of breast
epithelial cells through a nuclear receptor-mediated signaling pathway involving the
estrogen receptor (ER) [4].
Estrogens are derived from both ovaries and adipose tissue in premenopausal
women: E2 is the dominant circulating estrogen and is principally secreted by the
ovaries [5]. The ovaries atrophy in postmenopausal women and cease function to such
an extent that nearly all estrogen is synthesized in peripheral target tissues from
precursor steroids originating from the adrenal glands (75% before menopause) [6–7].
Dehydroepiandrosterone (DHEA) is an important precursor for steroid metabolism in
the breast [8]. Human steroidogenic enzymes in peripheral intracrine tissue play
important roles in the main biosynthetic and inactivating pathway of androgens and
estrogens
(Fig.
1.
Simplified
pathway showing
human
steroidogenic
and
steroid-inactivating enzymes involved in the steroid metabolism pathway in peripheral
intracrine tissues). Therefore, these enzymes are positioned as major targets for novel
therapies for steroid-sensitive diseases, particularly breast and prostate cancers [6–7].
The reductive 17β-hydroxysteroid dehydrogenase (17β-HSD) family comprises key
enzymes involved in the formation of estradiol [9]. The reductive 17β-HSD1 and
17β-HSD7 enzymes have critical roles in the regulation of estradiol (E2) synthesis from
estrone (E1) and a role in DHT inactivation in mammalian cells [10–12]. The
importance of 17β-HSD1 stems from its efficient synthesis of the most potent estrogen,
E2, in addition to other estrogens such as 5-androstene-3β, 17β-diol and
5α-androstane-3β, 17β-diol, and inactivation of the most active androgen, DHT. All
117
these contribute to the stimulation and development of breast cancers and demonstrate
a dual function in the promotion of breast cancer cell proliferation [13–14].
17β-Hydroxysteroid dehydrogenase 7 also converts E1 to E2 and possesses a
3-keto-reductase
activity,
which
inactivates
DHT
[9,15].
Human
3-alpha
hydroxysteroid dehydrogenase type 3 (3α-HSD3, AKR1C2) also inactivates DHT
[16–17]. The expression of 3α-HSD3 was inversely correlated to apoptosis-inducing
factor (AIF) in non-small cell lung cancer (NSCLC) cells [18]. Apoptosis-inducing
factor is also expressed in MCF-7 cells [19] and may be under negative regulation by
3α-HSD3 in this cell type. The function of these three enzymes is of great importance
for the development and aggression of breast cancer. Thus, 17β-HSD1 and 17β-HSD7
were identified as interesting therapeutic targets for estrogen receptor-positive
(ER+)-breast cancer and for the development of potent selective inhibitors. The
function of 3α-HSD3 is currently under study.
In studies addressing 17β-HSD1 and 17β-HSD7 function and inhibition, E1 is
primarily used as the substrate. However, E2 synthesis can involve multiple pathways
in addition to synthesis from E1, and the origins of estrogen differ before and after
menopause. In order to validate the effects of 17β-HSD1 and 17β-HSD7 inhibitors,
DHEA and E1S are supplied as representative substrates. The majority of recent studies
used direct substrates as the hormone source (E1 for 17β-HSD1 and 17β-HSD7, DHT
for 3α-HSD3); therefore, our study aims to compare the effects of providing DHEA and
the direct substrates E1 or DHT as hormone sources in order to reveal the mechanism
of steroid synthesis in postmenopausal breast cancer.
2. Materials and methods
2.1 Cell culture
MCF-7 cells were from the American Type Culture Collection (ATCC) and were
maintained in phenol red-free DMEM low glucose medium supplemented with 10%
118
fetal bovine serum (FBS). Cells were cultured at 37oC in a humidified atmosphere of
95% air and 5% CO2. Charcoal-treated medium was used to plate cells to eliminate
exogenous hormones and to permit application of alternative hormone sources.
2.2 siRNA synthesis and transfection
The sense and antisense sequences of three 17β-HSD1 siRNAs, two 17β-HSD7
siRNAs, and one 3α-HSD3 siRNA sequence were selected and synthesized as
previously described in Table 1. Transfection of MCF-7 cells with siRNA was carried
out in 6-well plates using Lipofectamine 2000 (Invitrogen), 2.5 × 105 cells per well and
100 nM mixed 17β-HSD1-specific siRNAs (siRNA1 + siRNA2 + siRNA3), 100 nM
mixed 17β-HSD7-specific siRNAs （siRNA1 + siRNA2), or 100 nM 3α-HSD3 siRNA.
Control cells were transfected with control siRNA (Table 4.1).
2.3 Semi-quantitative RT-PCR
Total RNA was isolated from cells using the RNeasy Plus mini kit (Qiagen): 1 μg of
total RNA was subjected to a one-step semiquantitative reverse transcription (RT)
-PCR using the Titanium One-Step RT-PCR kit (Clontech). The primer sets used
included four primers for human 18S (used as an internal control) and the following:
17β-HSD1 primers, 17β-HSD7 primers or 3α-HSD3 primers as listed in Table 4.2. The
RT-PCR program was carried out in an Eppendorf Mastercycler Gradient (Eppendorf,
Mississauga, Ontario, Canada). The RT was performed at 50℃ for 60 min followed by
initial denaturation at 94℃ for 5 min. The PCR program was as follows: 30 s at 94℃
for denaturation, 30 s at 65℃ for annealing, and 1 min at 68℃ for elongation,
followed by a 2-min final elongation. The number of cycles was 35. The PCR products
were separated on a 1% agarose gel with RedSafe Nucleic Acid Staining Solution
(20,000 ×). Bands were viewed and photographed under UV light.
119
2.4 Western Blot
Total proteins were extracted from cells with RIPA buffer (Invitrogen) supplemented
with a 1% protease inhibitor cocktail (EMD Chemicals, Gibbstown, NJ). Proteins
were quantified by the Bradford method and 40 μg total proteins from each sample
were separated on a 12% SDS-polyacrylamide gel and then electroblotted onto
nitrocellulose membrane overnight. The membranes were blocked with 5% skimmed
milk in TBS-Tween (TBST) 20 for 1 h at room temperature. Thereafter, the membranes
were hybridized to a polyclonal antibody directed against rabbit cyclinD1 (Abcam
1:10,000 dilution), pS2 (Santa Cruz 1:500 dilution), PCNA (Santa Cruz 1:500 dilution),
Bcl-2 (Abcam 1:1,000 dilution), and AIF (Abcam 1:1,000 dilution) for 2 h at room
temperature. The membranes were subsequently incubated with a goat anti-rabbit IgG
peroxidase conjugated secondary antibody (Santa Cruz Biotechnology) at a dilution of
1:2,000. A 1:5,000 dilution of monoclonal anti-β-actin antibody produced in mouse
(Sigma) was used as the loading control. Membranes were washed with TBST and
proteins were visualized using Western Lightning™ Plus ECL (Perkin Elmer),
followed by exposure of the membranes to X-ray films for 1 s, 5 s, 1 min and 10 min.
The radiographic films were scanned and the Image program (Molecular Dynamics,
Sunnyvale, CA) was used to quantify band density.
2.5 Cell proliferation
Cell proliferation was determined by CyQuant cell proliferation kit. MCF-7 cells (3,000)
were plated into 96-well plates containing 100 μl hormone-free culture medium and
were transfected with 100 nM 17β-HSD1- or 17β-HSD7-specific siRNA after 24 h.
The culture medium was changed 5 h after transfection and different hormones were
added: DHEA 1 μM, E1 0.1 nM, and E1S 0.5 nM. Cells were cultured for 4 days, the
culture medium was drained and cells were washed with PBS. The 96-well plates were
frozen overnight at −80℃. The cell plate was thawed at room temperature for 15 min
before addition of 200 μl CyQuant GR dye/cell-lysis buffer. The sample was protected
from light and incubated for 2–5 min at room temperature. The sample fluorescence
120
was determined using a fluorescence microplate reader at 480 nm for excitation and
520 nm for emission.
2.6 Cell viability
Cell viability was evaluated by MTT test. Cells were seeded in 96-well plates at a
density of 3,000 cells/well; 3α-HSD3-specific-siRNA was transfected into the cells
after 24 h. After a 3-day incubation period, 10 μl MTT reagents were added to each
well, including a blank control. One hundred microliters detergent reagents were added
after 2–4 h when a purple precipitate became visible. The plate was covered and left in
the dark overnight at room temperature. Absorbance was recorded at 570 nm.
2.7 Determination of E2 and DHT levels
Estradiol and DHT levels were determined using the E2 and DHT ELISA kits. Cells
were seeded at a density of 5 × 104 cells/well in 24-well plates. Transfection with
siRNA and treatment time was as described for cell proliferation. The levels of E2 in
MCF-7 cell supernatants were determined using a commercial E2 enzyme
immunoassay kit (Cayman Chemical, Ann Arbor, MI). Dihydrotestosterone levels were
determined using a commercial DHT ELISA Kit (Alpha Diagnostic International),
according to the supplier’s protocols. The media samples were defrosted and mixed
before the test. Duplicate wells were prepared for each medium condition under test,
and E2 and DHT plates were read at wavelengths of 420 nm and 450 nm respectively,
in a plate reader (Spectra Max 340PC; Molecular Devices, Sunnyyale, CA). The final
concentrations of E2 and DHT were calculated using EIADouble software with
reference to their respective standard curves.
2.8 Cell cycle
121
MCF-7 cells were seeded in 6-well plates at a density of 5 × 104 cells/well in
hormone-free medium; siRNA was transfected as described above and each condition
was performed in duplicate. Cells were incubated for an additional 4 days, after which
time the cells were washed, collected and fixed at −20℃ by 70% ethanol. The cells
were stained with PI and read by flow cytometry.
2.9 Statistical analysis
All data were expressed as the mean ± SD of at least three independent experiments.
Statistical significances were determined by Student’s t-test.
3
Results
3.1 Effect of 17β-HSD1 and 17β-HSD7 on MCF-7 cell proliferation
The effect of 17β-HSD1 or 17β-HSD7 knockdown in MCF-7 cells was evaluated.
Reverse transcription-PCR was carried out 48 hours after transfecting specific
17β-HSD1 siRNA or 17β-HSD7 siRNA. Results showed an almost complete
knockdown of each enzyme (Fig4.2). Cell proliferation was measured by Cyquant cell
proliferation kit. MCF-7 cells were seeded in steroid-deprived medium (dextran-coated
charcoal-treated medium). After transfection with specific 17β-HSD1 and 17β-HSD7
siRNA, cell culture media were changed and replaced with steroid-deprived media
supplemented with 8 nM, 20 nM or 1 μM DHEA, 0.1 nM E1 or 0.5 nM E1S, and then
cultured for 4 days. Results showed that the use of DHEA as a hormone source had a
weaker estrogen modification than either E1 or E1S. Addition of DHEA 20 nM and 1
μM produced significant decreases in cell proliferation of 11% (p = 0.04) and 16% (p =
0.04), respectively in 17β-HSD1 knockdown cells compared with control siRNA (Fig.
4.3A). In contrast, application of 0.1 nM E1 or 0.5 nM E1S as hormone sources
decreased cell proliferation by 28% (p = 0.01) and 29.5% (p = 0.01), respectively in
17β-HSD1 knockdown cells compared with control siRNA (Fig4.3A). Similarly in
17β-HSD7 knockdown cells, cell proliferation was significantly decreased by 13% (p =
122
0.02), 24% (p = 0.02), and 16% (p = 0.004) in 1 μM DHEA, 0.1 nM E1 or 0.5 nM E1S
compared with control siRNA respectively (Fig4.3B). Therefore, application of DHEA
as a hormone source had a reduced effect on estrogen activation compared with either
E1 or E1S. Under these conditions, the most marked response was produced by E1.
3.2. Effect of 17β-HSD1 and 17β-HSD7 knockdown on the concentration of E2 and
DHT
The direct impact of different hormone sources on E2 and DHT levels in MCF-7 cells
by 17β-HSD1 or 17β-HSD7 knockdown was determined by ELISA using cell culture
supernatants. The E2 concentrations in media from MCF-7 cells and MCF-7 cells
transfected with 17β-HSD1- and 17β-HSD7-specific siRNAs, with different hormone
sources (1 μM DHEA, 0.1 nM E1 and 0.5 nM E1S) were first compared. The levels of
E2 in 17β-HSD1-knockdown cells were significantly decreased compared with native
MCF-7 cells in media containing 1 μM DHEA (from 265.70 pg/ml decreased to 165.70
pg/ml p = 0.03), 0.1 nM E1 (from 513.00 pg/ml to 338.25 pg/ml p = 0.05), or 0.5 nM
E1S (from 82.65 pg/ml to 34.60 pg/ml p = 0.03). However, a larger decrease was
observed in the 0.1 nM E1-supplemented medium (Fig4.4A). The levels of DHT in
17β-HSD1-knockdown cells were significantly increased compared with native MCF-7
cells in the 1 μM DHEA (increased 0.1 nM, p = 0.02) and 0.1 nM E1 media (increased
0.05 nM, p = 0.01), but showed no significant modification in the 0.5 nM E1S medium.
However, a larger increase was observed in the 1 μM DHEA medium (Fig4.4B and C).
The levels of E2 in 17β-HSD7-knockdown cells in 1 μM DHEA medium tended to
decrease, but the differences were not statistically significant (from 389.00 pg/ml to
328.90 pg/ml, p = 0.56) compared with native MCF-7 cells. Estradiol levels were
significantly decreased in media containing 0.1 nM E1 (from 878.70 pg/ml to 790.20
pg/ml, p = 0.01) or 0.5 nM E1S (from 151.95 pg/nl to 129.85 pg/ml, p = 0.04) with the
former
showing
most
significance
(Fig4.4D).
The
DHT
levels
in
17β-HSD7-knockdown cells were significantly increased compared with native MCF-7
cells in media containing 1 μM DHEA (increased 0.6 nM, p = 0.04), 0.1 nM E1
123
(increased 0.74 nM, p = 0.02), or 0.5 nM E1S (increased 0.36 nM, p = 0.0001)
(Fig4.4E and F). From these results, it can be seen that knockdown of 17β-HSD1
resulted in a significant decrease in E2, whereas, knockdown of 17β-HSD7 produced a
significant increase in DHT. Provision of E1 yielded the most marked modification
among all hormones tested in this study. However, graphs C and F in Fig. 4. show DHT
levels that were obtained in medium supplemented with E1 or E1S. We compared DHT
levels in hormone-free medium with that supplemented with E1 or E1S. We found a
DHT concentration of 0.03 nM in hormone-free medium, whereas the levels showed a
significant increase after treatment with E1 or E1S for 4 days, 0.27 nM and 0.35 nM
respectively (Fig4.4G)
3.3. Effect of 17β-HSD1 and 17β-HSD7 on cell cycle
To compare the direct impact of supplementation of different hormone sources with
17β-HSD1 or 17β-HSD7 knockdown, a flow cytometry assay was carried out.
Knockdown of 17β-HSD1 produced a significant arrest of the cell cycle in the G0/G1
phase and DNA synthesis significantly decreased in response to 1 μM DHEA-, 0.1 nM
E1-, and 0.5 nM E1S-supplemented media in MCF-7 cells (Fig4.5A, B and C). Results
showed cell arrest in the G0/G1 phase after knocking down 17β-HSD1: the G0/G1
phase increased by 11.7% (p = 0.007), 10.35% (p = 0.02), and 16.9% (p = 0.01); the S
phase decreased by 2.3% (p = 0.009), 3.65% (p = 0.04), and 7.3% (p = 0.004); and the
G2/M phase decreased by 9.25% (p = 0.004), 6.5% (p = 0.01), and 9.55% (p = 0.02)
compared with control siRNA in response to 1 μM DHEA, 0.1 nM E1, or 0.5 nM E1S,
respectively (Fig4.5G). Meanwhile, knockdown of 17β-HSD7 significantly changed
cell cycle division in MCF-7 cells irrespective of the source hormone (Fig4.5D, E and
F). The results showed significant cell arrest in the G0/G1 phase after knocking down
17β-HSD7 cells: the G0/G1 phase increased by 7.25% (p = 0.01), 10% (p = 0.006), and
8.5% (p = 0.005), the G2/M phase decreased by 9.05% (p = 0.002), 6.15% (p = 0.01),
and 4.65% (p = 0.003) compared with control siRNA in response to 1 μM DHEA, 0.1
nM E1 or 0.5 nM E1S, respectively. The DNA synthesis phase (S phase) only
124
decreased in medium containing 0.1 nM E1 or 0.5 nM E1S, showing a reduction of
3.35% (p = 0.04) and 3.85% (p = 0.007) in the S phase (Fig4.5H). Thus, knocking
down 17β-HSD1 or 17β-HSD7 expression significantly changed cell cycle division in
MCF-7 cells irrespective of the source hormone used and knockdown of each enzyme
produced cell cycle arrest in the G0/G1 phase.
3.4 Effect of 17β-HSD1 and 17β-HSD7 on cyclinD1, pS2, and PCNA
The previously described results showed a decrease in cell proliferation and cell cycle
arrest in the G0/G1 phase after knockdown of 17β-HSD1 or 17β-HSD7 with different
hormone
sources.
We
investigated
whether
17β-HSD1
or
17β-HSD7
knockdown-induced cell cycle arrest might be concomitant with the modulation of
cyclinD1 expression; induction of the latter represents a critical role in mitogenic
signaling leading to S-phase entry. Thus, we performed a Western blot to determine
cell cycle cyclinD1 expression under similar conditions to the previous experiments.
Results showed that the expression of cyclinD1 decreased by 40%, 69%, and 18% in
response to 1 μM DHEA, 0.5 nM E1S, or 0.1 nM E1 respectively, after knocking down
17β-HSD1. Expression of cyclinD1 decreased to 26%, 38%, and 61% respectively,
after knocking down 17β-HSD7. Deoxyribonucleic acid synthesis decreased with cell
cycle arrest in the G0/G1 phase; therefore, we measured cell cycle-related antigen
proliferation cell nuclear antigen (PCNA) that is essential for DNA synthesis and the
estrogen-responsive pS2 gene. Both were expressed at lower levels in response to
17β-HSD1 or 17β-HSD7 knockdown compared with the control in response to each
hormone source. Proliferation cell nuclear antigen decreased by 21%, 29%, and 52%,
respectively after knocking down 17β-HSD1, and by 46%, 35%, and 36%, respectively
after knocking down 17β-HSD7 in medium containing 1 μM DHEA, 0.5 nM E1S, or
0.1 nM E1. Expression of pS2 decreased by 71%, 68%, and 56% respectively, after
knocking down 17β-HSD1, and by 20%, 71%, and 13% respectively, after knocking
down 17β-HSD7 in medium containing 1 μM DHEA, 0.5 nM E1S, or 0.1 nM E1
(Fig4.6). Although the extent of cyclinD1, PCNA and pS2 decreases varied, the trends
125
were the same. Thus, knocking down 17β-HSD1 and 17β-HSD7 can cause the
down-regulation of the cell cycle-regulated protein cyclinD1, DNA replication
regulated-protein PCNA, and estradiol-associated protein pS2, irrespective of the
hormone source.
3.5. 3α-HSD3 associated with apoptosis.
Transfection of 3α-HSD3-specific siRNA into MCF-7 cells to knock down the
expression of 3α-HSD3 was verified by semi-quantitative RT-PCR (Fig4.7A). A
Western blot was carried out to determine the expression of the anti-apoptosis
protein
B-cell lymphoma 2 (Bcl-2) and apoptosis inducing factor（AIF）after successfully
knocking down 3α-HSD3 in MCF-7 cells (Fig4.7B and C). Expression of Bcl-2
underwent a significant 60% down-regulation, whereas, AIF expression was
upregulated (2.67-fold change) when DHEA was provided as the hormone source.
Dihydrotestosterone produced a marked down-regulation of Bcl-2 protein in MCF-7
cells: expression of Bcl-2 was lower in response to DHT than DHEA or hormone-free
culture media. Expression of AIF was lower in response to DHEA than DHT or
hormone-free culture media. The expression changes of AIF and Bcl-2 caused changes
in cell viability, which underwent a significant 40% decrease after knocking down
3α-HSD3 compared with the control in DHEA culture medium and a 17% decrease in
hormone-free medium. However, the cell viability was unchanged after knockdown in
culture medium containing DHT. Significant biological differences were observed in
response to different hormones with 3α-HSD3 knockdown, and it was concluded that
DHEA should be used to mimic postmenopausal conditions in this case.
4. Discussion
Intracrinology describes the local formation, action and inactivation of sex steroids
from the inactive sex hormone precursor DHEA [20–21]. Large amounts of DHEA are
secreted by the adrenals, and the former serves as a precursor to all estrogens and
126
androgens by the action of the steroid-forming enzymes expressed in peripheral tissues
[22]. Adipose tissue is the primary source of endogenous estrogens in postmenopausal
women. Thus, androgens become an important source of estrogen through their
aromatization to estradiol and estrone in breast tissue [23]. Estradiol derived from
DHEA is an important steroid entity and may predominate in human breast cancer [24].
All of these theories support the use of DHEA as a hormone source for cell culture to
study the contribution of steroid-converting enzymes to sex-hormone metabolism while
mimicking postmenopausal conditions.
However, the use of upstream steroids may increase model complexity. The
research community tends to use cell culture as a reductionist model as a means to
understand specific enzyme–substrate interactions [25]. Reductionism analyses a larger
system by breaking it down into pieces and determining the connections between
phenomena, or theories etc., 'reducing' one to another, and these are usually considered
'simpler' or more 'basic' [25–26]. The value of methodological reductionism has been
particularly evident in molecular biology. This theory is inconsistent with our idea with
respect to the upstream steroid hormone DHEA. In fact, the reductionist approach has
some failures; Marc H.V. Van R summarized some examples of failure, and put
forward his own viewpoint [26]. It has become popular to criticize the reductionist
approach used in biological systems [26, 27].
In order to investigate the difference by providing DHEA or the enzyme substrates,
we studied the function of three enzymes (17β-HSD1, 17β-HSD7, and 3α-HSD3). We
used different hormone sources: hormone-free medium (charcoal-treated media to
eliminate endogenous hormones) or hormone-free medium supplemented with DHEA,
DHT, E1, or E1S. Dehydroepiandrosterone provision mimics the aromatase pathway,
E1S mimics the sulfatase pathway, and E1 represents the step common to both the
aromatase and sulfatase pathways. The physiological concentration of DHEA found in
127
blood from postmenopausal women is approximately 8 nM, but its concentration in
breast cancer tissue is approximately 34.7 nM. The concentration of E1 is close to 0.1
nM in plasma, which was used in a previous study [16]. A concentration of 0.5 nM E1S
falls between that found in the plasma (0.37 nM) and breast cancer tissue (1.25 nM)
[28–29]. Taking into account the fact that the metabolic response of cultured cells is
weaker than those of human tissues, and that DHEA conversion to E2 requires multiple
steps, we employed a higher concentration of DHEA than the physiological
concentration of DHEA (1 μM DHEA-supplemented medium) in order to amplify the
signal. This method correspondingly increased the complexity.
However, real differences existed in response to the provision of different
hormones in the culture medium. The study of 17β-HSD1 and 7 did not reveal a
significant difference in cell proliferation, cell cycle and cell cycle-regulated proteins or
E2 levels; however, DHT levels did show a difference. Specifically, in the graphs
shown in Figs. 4C and F, DHT levels are shown in serum that has been supplemented
with E1 or E1S. However, given that in human cells the aromatase reaction is
irreversible, it is unclear how supplementation of media with estrogens, and estrogens
only, can result in the presence of DHT or changes in DHT metabolism.
Dihydrotestosterone levels were measured in hormone-free medium, E1- and E1Ssupplemented media. We found that DHT levels were significantly increased in
response to E1 or E1S treatment. E. Price Stover used equilibrium binding studies to
show that the [3H]-DHT binding decrease after estradiol treatment was due to an
absolute decrease in the number of cytoplasmic androgen receptors (AR) per MCF-7
cell [30]. Under our conditions, addition of E1 or E1S resulted in the metabolic
production of estradiol that decreased the number of androgen receptors in MCF-7 cells;
a reduction in DHT binding to AR resulted in an increase in DHT. The ELISA kit we
used to measure DHT concentration measured free DHT. Therefore, the DHT level
may be even higher.
128
The choice of culture medium conditions resulted in a more marked difference
with regard to the study of 3α-HSD3 knockdown compared with the control.
Dehydroepiandrosterone and direct substrates were supplied during the 3α-HSD3
knockdown study, in addition to hormone-free medium as a negative control. The
expression of apoptosis-regulated proteins, AIF and Bcl-2 differed in response to the
provision of different steroids. First, the level of AIF expression was lower in response
to DHEA provision than DHT, and the latter was similar to that of hormone-free media.
Second, Bcl-2 expression was lower in DHT medium than in DHEA-supplemented and
hormone-free media. Dihydrotestosterone produced a marked downregulation of Bcl-2
expression in MCF-7 cells. The same result was found in ZR-75-1 human breast cancer
cells [31]. The Bcl-2 gene promotes hemopoietic cell survival [33]. 17β-Estradiol
inhibits apoptosis in MCF-7 cells, thereby inducing Bcl-2 expression [33]. Our data
showed that DHEA provision produced a certain amount of estradiol. Therefore, Bcl-2
expression in DHEA medium was higher than in hormone-free medium, which was in
turn higher than observed in response to supplementation with DHT. Apoptosis
inducing factor induces apoptosis, and its expression contrasts that of Bcl-2 (Fig4.7B
and C). The DHT-mediated inhibition of Bcl-2 expression should be reduced by
3α-HSD3 knockdown coupled with provision of DHT as a hormone source. However,
apoptosis was triggered, and there was no observation of DHT accumulation instead of
cell death. Therefore, cell viability decreased in response to DHT-supplemented culture
medium compared with DHEA-supplemented and hormone-free media (Fig4.7D).
Only the provision of DHEA resulted in changes to AIF, Bcl-2, and cell viability after
knocking down 3α-HSD3.
Using the three enzymes as examples, we illustrated that the provision of different
steroids as substrate or hormone sources may promote modified biological effects.
Through extensive study, it was demonstrated that direct provision of a high
concentration of estrogen or androgen like DHT, E2 or E1 may not always be suitable
129
for mechanism studies. We found that for the latter, particularly for conversions not
directly from the precursors, it is necessary to use DHEAS or DHEA, from which all
sex-steroids are derived under postmenopausal conditions. Once the role of a particular
enzyme is defined, we may then use its direct substrate for enzyme kinetic and
inhibition studies resulting in a simpler analysis. Reductionism is valid in the latter
study type.
130
References
[1]DB Thomas. Do hormones cause cancer? Cancer 53(1997) 595-604.
[2] SX Lin,J Chen, M Mazumdar , D Poirier, C Wang, A Azzi , M Zhou. Molecular
therapy of breast cancer: progress and future directions. Nat. Rev. Endocrinol. 6 (2010)
485-493.
[3]A. A. J. van Landeghem, J. Poortman, M. Nabuurs, et al. endogenous concentrations
and subcellular distribution of estrogens in normal and malignant human breast tissue.
Cancer Res 45 (1985) 2900-2906.
[4]MW Beckman, BA Gusterson. Multistep carcinogenesis of breast cancer and tumor
heterogeneity. J Mol Med 75 (1997) 429-439.
[5]J Kotsopulos, SA Narod. Androgens and breast.J.Steroids.77 (2012) 1-9.
[6]F Labrie, V Luu-The, S X Lin, J Simard, C Labrie, M EI-Alfy, G Pelletier and A
Belanger. Intracrinology: role of the family of 17β-hydroxysteroid dehydrogenases in
human physiology and disease. J Mol Endocrinol 25 (2000) 1-16.
[7]F Labrie. Intracrinology. Mol Cell Endocrinol 78 (1991) C113–C118.
[8]T Nakata, S Takashima , Y Shiotsu , C Murakata, H Ishida, S Akinaga , P–K Li, H
Sasano, T Suzuki, T Saeki. Role of steroid sulfatase in local formation of estrogen in
post-menopausal breast cancer patients. J. Steroid Biochem. Mol. Bio 86 (2003)
455–460.
[9]CY Zhang, WQ Wang, J Chen, SX Lin. Reductive 17 beta-hydroxysteroid
dehydrogenases which synthesize estradiol and inactive dihydrotesterone constitute
major and concerted players in ER+ breast cancer cells. J.Steroid Biochem. Mol. Biol
150 (2015) 24-34.
[10]V Luu-The. Analysis and characteristics of multiple types of human
17β-hydroxysteroid dehydrogenase. J.Steroid Biochem. Mol. Biol. 76 (2001) 143-151.
[11] BL Nguyen, G Chetrite, JR Pasqualini. Transformation of estrone and estradiol in
hormone-independent human breast cancer cells. Effects of the antiestrogen ICI
164,384, danazol, and promegestone (R-5020). Breast Cancer Res Treat 34 (1995)
139-146.
131
[12]JR Pasqualini. The selective estrogen enzyme modulators in breast cancer: a review.
Biochim Biophys Acta 1654 (2004) 123-143.
[13]J.A.
Aka,
M
Mausumi,
S
X,
Lin.
Reductive
17β-hydroxysteroid
dehydrogenases in the sulfatase pathway: Critical in the cell proliferation of
breast cancer. Mol Cell Endocrinol. 301 (2009) 183-190.
[14]J.A. Aka, M Mazumdar, C-Q Chen, D Poirier, S X Lin. 17β-hydroxysteroid
dehydrogenase Type 1 stimulates breast cancer by dihydrotestosterone inactivation in
addition to estradiol production. Mol Endocrinol. 24 (2010) 832-845.
[15]A Robert, P Rheault, F Labrie, V Luu-The. Identification and characterization of an
estrogen-activationg and androgen-inactivating (EHAL) enzyme, Reasons for hope:
Breast cancer Research National Scientific Conferenc, Toronto, Ont. June 82 (1999)
17-19.
[16]I. Dufort, F. Labrie, V. Luu-The Human types 1 and 3 3 alpha-hydroxysteroid
dehydrogenases: differential lability and tissue distribution. J. Clin. Endocrinol. Metab.
86 (2001), pp. 841–850.
[17]B Zhang, DW Zhu, XJ Hu, M Zhou, P Shang, SX Lin. Human 3-alpha
hydroxysteroid dehydrogenase type 3 (3α-HSD3): The V54L mutation restricting the
steroid alternative binding and enhancing the 20α-HSD activity. J. Steroid Biochem.
Mol. Bio 141 (2014) 135–143.
[18]HW Wang, CP Lin, JH Chiu, KC Chow, KT Kuo, CS Lin, LS Wang. Reversal of
inflammation-associated dihydrodiol dehydrogenases (AKR1C1 and AKR1C2)
overexpression and drug resistance in nonsmall cell lung cancer cells by wogonin and
chrysin. Int J Cancer. 120 (2007):2019-27.
[19] SW IP, SS Liao, SY Lin, JP Lin, JS Yang, ML Lin, GW Chen, HF Lu, MW Lin,
SM Han, JG Chung. The role of mitochondria in bee venom-induced apoptosis in
human breast cancer MCF-7 cells. In Vivo. 22 (2008):237-45.
[20] D Poirier. 17β-hydroxysteroid dehydrogenase inhibitors: a patent review. Expert
Opin.Ther. Patents 20 (2010) 1123-1145.
[21]F. Labrie. DHEA, important sources of sex steroids in men and even more in
women. Progr Brain Res 182 (2010) 97-148.
[22]F. Labrie and C. Labrie. DHEA and intracrinology at menopause, a positive choice
for evolution of the human specices. Climacteric. 16 (2013):205-13.
132
[23]J Kotsopoulos, S.A Narod. Androgens and breast cancer. Steroids.77(1-2)
(2012)1-9 [24]K.M.McNamara, H.Sasano. The intracrinoogy of breast cancer. J.
Steroid Biochem. Mol. Bio (2014).04.004.
[25]W Doniger, et al. "Reductionism". Merriam-Webster's Encyclopedia of World
Religions. Merriam-Webster (1999). p. 911. ISBN 9780877790440.
[26]M.H.V.Regenmortel. Reductionism and complexity in molecular biology. EMBO
reports (2004) 5(11) 1016-1020.
[27] R. Lewontin. The triple helix, gene, oraganism and environment. Harvard
University Press. Cambridge, MA,USA. 2000.
[28]G Christy, Y B Woolcott, et al. Plasma sex hormone concentrations and the risk of
breast cancerin postmenopausal women: the Multiethnic Cohort Study. Endocr Relat
Cancer.17 (2010): 125–134.
[29]J.R Pasqualini, G.S Chetrite. Estradiol as an anti-aromatase agent in human breast
cancer cells. J. Steroid Biochem. Mol. Bio 998 (2006) 12-17.
[30]E. Price Stover, Aruna V. Krishnan, and David Feldman. Estrogen down-regulation
of androgen receptors in cultured human mammary cancer cells (MCF-7).
Endocrinology. 120 (1987) 2597-2603.
[31]J Lapointe, A Fournier, V Richard, C Labrie. Androgens Down-Regulate bcl-2
Protooncogene Expression in ZR-75-1 Human Breast Cancer Cells. Endocrinology.
(1999) 140(1):416-21.
[32] DL Vaux , S Cory, JM Adams. Bcl-2 gene promotes haemopoietic cell survival
and cooperates with c-myc to immortalize pre-B cells. Nature. 335 (1988):440-2.
[33]B Perillo, A Sasso, C Abbondanza, G Palumbo. 17beta-estradiol inhibits apoptosis
in MCF-7 cells, inducing bcl-2 expression via two estrogen-responsive elements
present in the coding sequence. Mol Cell Biol. 20 (2000):2890-901.
133
Table 4. 1 Sequences of 17β-HSD1 and 17β-HSD7 specific siRNAs
siRNA
Sense sequence (5′ to 3′)
Anti-sense sequence (5′ to3′)
siRNA 1
GCUGGACGUGAAUGUAGUATT
UACUACAUUCACGUCCAGCTT
siRNA 2
GCCUUUCAAUGACGUUUAUTT
AUAAACGUCAUUGAAAGGCTT
siRNA 3
CCACAGCAAGCAAGUCUUUTT
AAAGACUUGCUUGCUGUGGTT
siRNA 1
GCAGGGUCUCUAUUCCAAUTT
AUUGGAAUAGAGACCCUGCTG
siRNA 2
CGUACAGCAUUGACCAAUUTT
AAUUGGUCAAUGCUGUACCTG
siRNA
AAGCUCUAGAGGCCGUCAAAUTT
AUUUGACGGCCUCUAGAGCUUTT
UUCUCCGAACGUGUCACGUTT
ACGUGACACGUUCGGAGAATT
name
17β-HSD 1
17β-HSD7
3α-HSD3
NC
Table 4. 2 Primers used in RT-PCR
Name
Forward
ACG
18S GAC CAG F-5′-AGC GAA AGC ATT-3′
Reverse
R-5′TCC GTC AAT TCC TTT AAG TTT CAG CT-3′
17β-HSD1
F-5′-TGGACGTGCTGGTGTGTAAC-3′
R-5′-ACTTGCTGGCGCAATAAACG-3′
17β-HSD7
F-5′-GCCAAGGCAGAAGGATCACTTGAGA-3′
R-5′-GGTGTCCAAGCAAGCACATTTTCTG-3′
3α-HSD3
F-5′-CCTAAAAGTAAAGCTCTAGAGGCCGT-3′
R-5′-CAACTCTGGTCGATGGGAATTGCT-3′
135
Figures and Legends
Fig4.1.
Figure
4.
1
Simplified
pathway
showing
human
steroidogenic
and
steroid-inactivating enzyme involved in the steroid metabolism pathway in
peripheral
intracrine
tissues.
DHEA:
dehydroepiandrosterone;
4-dione:
androstenedione; 5-diol: androst-5-ene-3 α, 17 β-diol; E1: estrone; E1-S: estrone sulfate;
E2: 17 β-estradiol; E2-S: estradiol sulfate; HSD: hydroxysteroid dehydrogenase; testo:
testosterone; DHT: Dihydrotestosterone; pdione,. 5α-Re: 5α-Reductase. (Modified
from F. Labrie and C. Labrie, CLIMACTERIC 2013:16:205-213).
137
Fig4.2.
Figure 4. 2 Expression of 17β-HSD1 and 17β-HSD7 and knockdown effect by
siRNA.
A. Semi-quantitative RT-PCR was performed using 17β-HSD1 and 18S primers. 100
nM of three mixed 17β-HSD1-specific siRNA and control siRNA were used.
B. Semi-quantitative RT-PCR was performed using 17β-HSD7 and 18S primers. Two
mixed 17β-HSD7-specific siRNA and control siRNA were used. Total RNA extracted
from MCF-7 breast cancer cells. Expression of 17β-HSD1 and 17β-HSD7 was
significantly downregulated after transfection with siRNA.
138
Fig4.3.
Figure 4. 3 Cell proliferation after transfection with siRNA. Abscissa, the different
hormone sources: DHEA (8 nM, 20 nM, and 1 μM) 0.1 nM E1 and 0.5 nM E1S with
either 17β-HSD1- or 17β-HSD7-specific siRNA compared with control siRNA.
Ordinate represents cell proliferation (OD value of DNA quantity).
A. 17β-HSD1 siRNA compared with control siRNA.
B. 17β-HSD7 siRNA compared with control siRNA. Error bars represent SD. *, p <
0.05 by Student’s t-test.
139
Fig4.4.
Figure 4. 4 Effect of 17β-HSD1 and 17β-HSD7 knockdown on E2 and DHT
production. MCF-7 cells (50,000) were cultured for 4 days after transfection with
17β-HSD1 or 17β-HSD7 siRNA in charcoal-treated media supplemented with 1 μM
DHEA, 0.1 nM E1 or 0.5 nM E1S medium. ELISA kits were used to determine the
concentrations of E2 and DHT. A, B and C show 17β-HSD1 knockdown cells
compared with control. D, E and F show 17β-HSD7 knockdown cells compared with
control. G, DHT levels in hormone-free medium, E1 medium and E1S medium
140
Fig4.5.
Figure 4. 5 Cell cycle was evaluated by flow cytometry. A, B and C represent control
and 17β-HSD1 siRNA cell cycle. G, cell cycle arrested in G0/G1 phase after
knockdown of 17β-HSD1 compared with control. In DHEA, E1 and E1S media the
G0/G1 phase significantly increased and the S and G2/M phases significantly decreased
(p < 0.05) after knockdown of 17β-HSD1. D, E and F, represent control and 17β-HSD7
siRNA cell cycle. H, cell cycle division in control and 17β-HSD7 knockdown cells. In
DHEA, E1 and E1S medium the G0/G1 phase significantly increases, in E1 and E1S
media and the S and G2/M phases significantly decrease (p < 0.05) after knockdown of
17β-HSD7.
141
Fig4.6.
Figure 4. 6 Cyclin D1, PCNA and pS2 expression in 17β-HSD1- or
17β-HSD7-knockdown cells compared with normal MCF-7 cells in response to 1
μM DHEA, 0.5 nM E1S, or 0.1 nM E1 as hormone sources in the culture medium.
A. CyclinD1, PCNA and pS2 expression after knocking down 17β-HSD1 in different
culture media. B. CyclinD1, PCNA and pS2 expression after knocking down
17β-HSD7 in different culture media. C. The ratios of proteins of interest to β-actin are
showed by percentage in C (1) and C (2). The control for each hormone source was set
as 100%.
142
Fig4.7.
Figure 4. 7 Apoptosis-regualted proteins and cell viability.
(A) Semi-quantitative RT-PCR verifies 3α-HSD3 knockdown effect. (B and C) AIF
and Bcl-2 expression after knocking down 3α-HSD3 compared with control when
cultured in DHEA, DHT or hormone-free (H–F) medium. (D) Cell viability
determination
after
knocking
down
3α-HSD3
compared
with
control.
Hormone-free medium set as 100%. * Significantly different compared with each
control siRNA.
143
Chapter V
DISCUSSION AND GENERAL CONCLUSION
5.1. Note to reader
The results presented in this thesis have been widely discussed earlier in Chapters II to
IV. In this chapter, we will highlight the main points of the previous discussions as well
as try to highlight the links between the different results that explain the roles of the
enzymes 17β-hydroxysteroid dehydrogenase type 5 (17β-HSD5, AKR1C3), 17β-HSD1
and 17β-HSD7. Moreover, we demonstrated that provision of upstream steroid
hormone DHEA as hormone source mimics postmenopausal condition in cell culture.
As well as, the prospects of the study are indicated.
5.2. Increased PGE2 stimulated aromatase expression when AKR1C3 gene
transcription was knocked down.
17β-HSD5 (AKR1C3) not only participates in steroid hormone metabolism [78] but
also plays a role in the arachidonic acid metabolism [79]. PGE2 is a primary product of
arachidonic acid (AA) metabolism and is synthesized by the cyclooxygenase (COX)
and prostaglandin synthesis pathways. PGE2 can be directly produced from PGH2
under the action of PGE synthase, and indirectly from PGH2 via AKR1C3 to form
PGF2α and from this to form PGE2 under the action of AKR1C1 and AKR1C2 [79]. In
our study, we knocked down AKR1C3 gene transcription, blocking the indirect
synthesis of PGE2. Then, AA directly converted to PGE2. Therefore, the PGE2 level
increased after the AKR1C3 knockdown. Recently, the COX-2/PGE2 pathway has
been widely accepted to play key roles in the hallmarks of cancer and adaption to the
tumor microenvironment [80]. Also, PGE2 is the most potent factor that stimulates
aromatase expression via cyclic AMP, leading to activation of promoter II of the
aromatase gene (CYP19) [81]. We found that aromatase expression was up-regulated
after knocking down AKR1C3 gene. Thus, COX-2 or PGE2 is a potential target for
breast cancer treatment.
5.3. Up-regulated aromatase increased estradiol production and breast cancer cell
147
proliferation
In our study, results showed that estradiol concentration, breast cancer cell proliferation,
and cell migration were increased after knocking down AKR1C3 gene. Meanwhile, we
found the expression of AKR1C3 gene was lower in ER+ breast carcinoma than normal
breast and the lower expression of AKR1C3 positive correlated with tumor metastasis.
All the results could be explained by the PGE2 level increase and aromatase expression
up-regulation when AKR1C3 was under expressed. When knocking down AKR1C3,
testosterone (T) and dihydrotestosterone （ DHT ） level decreased. However,
4-androstenedione (4-dione) had no significant changes. Under the action of
up-regulated aromatase, estrone (E1), which is the only intermediated steroid, remained
unchanged and estradiol (E2), the final product, significantly increased. Increased E2
stimulates breast cancer cell proliferation [82]. Estradiol diffuses into the cell, and
binds to the ligand-binding domain of the receptor forming complexes that then
diffuse into the cell nucleus. Moreover, these complexes bind to specific sequences of
DNA called estrogen-response elements (EREs), the liganded ER ligand-binding domain
interacts with certain cofactors and co-activators, target genes’ transcription increases
and cell proliferation increase [5]. Estrogen stimulates cell proliferation of human
breast cancer cell which expresses ERα through the activation of the cyclin D1
(CCND1) oncogene [83]. Cyclin D1 expression is induced by estrogen in mammary
epithelial cells [84]. Therefore, in chapter Ⅳ we showed the results of cell cycle and
cyclin D1 expression after knockdown of 17β-HSD1 or 17β-HSD7 compared to control
siRNA. Decrease in Cyclin D1 arrested the cell cycle in G0/G1 phase. Cyclin D1
expression can be down regulated, following 17β-HSD1 or 17β-HSD7 knockdown
and E2 reduction. AKR1C3 gene knockdown showed opposite results: E2 increased,
more cells enter into G2/M phase, promoting DNA replication and mitosis. Thus, the
biological effect of 17β-HSD5（AKR1C3）knockdown is different from that of
17β-HSD1 and 17β-HSD7.
In addition to the change of E2 production, T and DHT concentrations significantly
148
decreased after the AKR1C3 knockdown. T and DHT are the most important androgens,
which have apoptotic and anti-proliferation effects, according to predominant data in an
in vitro study [85, 39]. In Japan, one research demonstrated that salivary T levels are
significantly lower in women with breast cancer compared to age-matched control
women [86]. These findings support the protective role of T and DHT in resistance to
the proliferative effects on breast tissue. Here, stimulation of estrogen was enhanced
while counteracting T and DHT were lowered. Thus, all results supported that
AKR1C3 lower expression promotes breast cancer progression.
5.4. Modification of proteomics profile in MCF-7 breast cancer cells by 17β-HSD5
knockdown
Proteomics studies were performed in order to explain the protein profile after the
AKR1C3 knockdown. Detailed results are showed in chapter III. In this chapter, we
discuss the finding that the largest population of the functional category was
metabolism processes (28%), followed by response to stress (12%), signal transduction
(11%), cell cycle (8), and biosynthesis process (7%). All proteins were up-regulated
after the AKR1C3 knockdown. These results were consistent with the conclusion of
chapter II, which demonstrated that low expression of AKR1C3 was associated with
breast
cancer
progress.
Especially,
glucose-regulated
protein
(GRP78)
and
phosphoglycerate kinase 1 (PGK1) were significantly up-regulated after the AKR1C3
knockdown. This can explain that the lower expression of AKR1C3 positively
correlated with tumor cell proliferation, metastasis and increased cell migration after
the AKR1C3 knockdown. Overexpression of GRP78 suppresses apoptosis [87],
facilitating the unlimited proliferation of tumor cells. Moreover, we used ONCOMINE
Database to find out that PGK1 had a higher expression in breast carcinoma tissue than
in normal breast [88]. PGK1 was highly expressed in HER-2/neu-positive breast cancer,
as revealed by a proteomic study [89], and overexpression of PGK1 increases the
invasiveness of gastric cancer in vitro [90]. In our study, we also found that cell
migration was increased after knockdown of AKR1C3, PGK1 may contribute to this
149
promotion. PGK1 and GRP78 will have therapeutic and prognostic implications
[90-95].
Briefly, in chapters II and III we discussed that AKR1C3 was not a potential
therapeutic target for breast cancer treatment, since its knockdown and inhibition did
not decrease BC cell proliferation or enhance the apoptosis of the latter. In contrast,
breast cancer growth will progress if inhibition AKR1C3. The lower expression of
AKR1C3 will stimulate PGE2 levels and up-regulate aromatase expression. Some
proteins, such as PGK1, and GRP78, were up regulated by AKR1C3 inhibition,
resulting in the enhancement BC cell proliferation, migration and so on. Therefore, the
use of AKRC13 lower expression as a biomarker for breast cancer poor prognostic is
promising.
5.5. Differences in response to DHEA or other steroids as hormone sources
Previous research on the steroid-converting enzymes has been performed using
their direct substrates as hormone sources, due to their facility of use for these studies
and the robust signal obtained. These experiments may not always provide an accurate
information of physiological and post-menopausal conditions. We suggest providing
dehydroepiandrosterone (DHEA) as an intracrine logical hormone source and
comparing the role of steroid-converting enzymes using DHEA and their direct
substrates when an extensive mechanistic understanding is required. In Chapter Ⅳ we
present a comparative study of 17β-HSD1, 17β-HSD7 and 3α-HSD3 with the provision
of DHEA and the direct substrates, E1 or DHT. Cell biology studies showed no
significant difference in biological function for 17β-HSD1 and 17β-HSD7 when
cultured with different steroid hormones: cell proliferation and E2 levels decreased,
whereas DHT accumulated; cyclin D1, PCNA, and pS2 were down-regulated after
knocking down these two enzymes, although the quantitative results varied. However,
culture medium supplementation was found to have a marked impact on the study of
150
3α-HSD3. Using the three enzymes as examples, we illustrated that the provision of
different steroids as substrates or hormone sources may show modified biological
effects. Through extensive study, it was shown that direct provision of a high
concentration of estrogens or androgens like DHT, E2 or E1 may not always be suitable
for mechanism studies.
5.6 DHEA as hormone source in cell culture
Generally, in premenopausal women, estrogens derive from ovaries and adipose tissue,
E2 is the dominant type for circulating estrogen and is secreted mostly by ovaries [96].
For post-menopausal women, the ovary becomes atrophied and almost ceases function
such that nearly all estrogen is synthesized in the peripheral target tissue from precursor
steroids of the adrenal glands. The best estimation of the intracine formation of
estrogens in peripheral tissue in women is 75% before menopause and close to 100%
after menopause [7]. High amounts of DHEA are secreted by adrenals, which serves as
a precursor of estrogens and androgens by the action of the steroid-converting enzymes
expressed in peripheral tissue in the manner of intracrinology [11]. The importance of
intracrinology in hormonal synthesis supports our attempt to use DHEA as hormone
source to mimick postmenopausal condition in cell culture and studying the function of
metabolizing enzymes by inhibition or knockdown in BC cells.
In our study, we used the upstream hormone DHEA as a source to mimic the
postmenopausal condition in cell culture. The physiological concentration of DHEA
found in blood from postmenopausal women was approximately 8nM [97], and the
concentration in breast cancer tissue being approximately 34.7 nM [98]. The metabolic
response of cultured cells is weaker than those of human tissues. DHEA metabolism to
E2 needs multiple steps, thus supplementation of high DHEA concentration in the cell
culture may generate the physiology concentration of E2.
151
By this method, we studied four different steroid enzymes, 17β-HSD1, 17β-HSD5,
17β-HSD7 and 3α-HSD3 and compared DHEA to the direct substrates of these
enzymes. Through extensive study, it was demonstrated that direct provision of a high
concentration of estrogen or androgen like DHT, E2 or E1 may not always be suitable
for mechanism studies. DHEA is the best way to mimic postmenopausal condition in
cell culture condition.
In conclusion, knocking down the expression of 17β-HSD5 stimulates BC cell
proliferation. Some proteins such as aromatase and GRP78 were up-regulation after
knocking down 17β-HSD5. The lower expression of 17β-HSD5 may serve as a
biomarker for poor prognostic in BC. 17β-HSD1，17β-HSD7 and 3α-HSD3 were the
potential targets for BC treatment. Provision of DHEA contributes a reasonable method
for intracrinology study.
152
REFERENCES
(For introduction and general discussion)
[1]http://www.cancer.org/cancer/breastcancer/detailedguide/breast-cancer-key-statistics
[2]Canadian Cancer Society. [online] (http://www. cancer.ca)
[3]Cancer Research UK. [online] (http://www. cancerresearchuk.org)
[4]Beckmann MW, Gusterson BA. Multistep carcinogenesis of breast cancer and tumor
heterogeneity.J Mol Med 75: 429-439.1997.
[5]Kishor S K, Mahesh K. Antiestrogen therapy for Breast Cancer: An overview.
Cancer Therapy 6: 655-664. 2008.
[6]Muriel LR, Coralie P, Pascale C, Stephanie S, Kack-Michel R, and Laura C.
Cracking the estrogen receptor’s posttranslational code in breast tumors. Endocrine
Reviews. 32(5): 597-622. 2011.
[7] Hall JM, Couse JF, Korach KS. The multifaceted mechanisms of estradiol and
estrogen receptor signaling. J Biol Chem. 40:36869-36872.2001.
[8]Knochenhauer E, Azziz R. Ovarian hormones and adrenal androgens during a
woman’s life span. J Am Acad Dermatol 45(Suppl.3) S105-S115. 2001
[9]Labrie F. Intracrinology. Mol Cell Endocrinol 78:C113–C118, 1991
[10] Endoh A, Kristiansen SB, Casson PR, Buster JE, Hornsby PJ.. The zona reticularis
is the site of biosynthesis of dehydroepiandrosterone and dehydroepiandrosterone
sulfate in the adult human adrenal cortex resulting from its low expression of 3
beta-hydroxysteroid
dehydrogenase.
J
Clin
Endocrinol
Metab
81(10):3558-3565.1996
[11]Longcope C. Adrenal and gonadal androgen secretion in normal females. Clin
Endocrinol Metab 15(2):213-228. 1986.
[12]Labrie F. DHEA, important source of sex steroids in men and even in women.
Progr Brain Res 182: 97-148. 2010.
[13]Labrie F, Labrie C. DHEA and intracrinology at menopause, a positive choice for
evolution of the human specices. Climacteric 16: 205-213. 2013.
[14]Labrie F, Luu-The VH, Lin SX, Simard J, Labrie CH, El-Alfy M, Pelletier G,
153
Bélanger
A.
Intracrinology:
role
of
the
family of
17β-hydroxysteroid
dehydrogenases in human physiology and disease. J. Mol. Endocrinol.
25(1):1-16.2000.
[15]Nelson DR, Koymans L, Kamataki T, Stegeman JJ, Feyereisen R, et al. P450
superfamily: update on new sequences, gene mapping, accession numbers and
nomenclature. Pharmacogenetics 6: 1-42. 1996.
[16]Simpson ER, Mahendroo MS, Means GD, Kilgore MW, Hinshelwood MM,
Graham-Lorence S, Amarneh B, Ito Y, Fisher CR, Michael MD, et al. Aromatase
cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocr Rev 15:
342-355. 1994.
[17]Grodin JM, Siiteri PK, MacDonald PC. Source of estrogen production in
postmenopausal women. J Clin Endocrinol Metab 36: 207-214.1973.
[18]Bulun SE, Simpson ER. Competitive RT-PCR analysis indicates levels of
aromatase cytochrome P450 transcripts in adipose tissue of buttocks, thighs and
abdomen of women increase with advantage age. J Clin Endocrinol Metab 78:
428-432. 1994.
[19]Bulun SE. Regulation of aromatase expression in estrogen-responsive breast and
uterine disease: from bench to treatment. Pharmacol Rev57: 359-383. 2005
[20]Purohit A, Newman SP, Reed MJ. The role of cytokines in regulating estrogen
synthesis: implications for the etiology of breast cancer. Breast Cancer Res 4:
65-69. 2002.
[21]Bulun, S.E. Regulation of aromatase expression in breast cancer tissue. Steroid
Enzymes and Cancer 1155: 121-131. 2009.
[22]Agarwal V, Bulun SE, Leitch M, Rohrich R, Simpson ER Use of alternative
promoters to express the aromatase P450 (CYP19) gene in breast adipose tissues of
cancer-free and breast cancer patients. J Clin Endocrinol Metab 81: 3843-3849.
1996.
[23]Simpson ER, Clyne C, Rubin G, et al. Aromatase-A brief Overview. Annu. Rev.
Physiol. 64:93-127. 2002.
[24]Smith IE, Dowsett. Aromatase inhibitors in breast cancer. M. N Engl J
154
Med 348: 2431-2442. 2003.
[25]Reed MJ, Purohit A, Woo WL, Newman SP, Potter BVL. Steroid Sulfatase:
Molecular Biology, Regulation, and Inhibition. Endocrine Review 26(2): 171-202.
[26]Maltais R, Poirier D. Steroid Sulfatase inhibitors: A review covering the promising
2000-2010 decade. Steroid 76: 929-948. 2011.
[27]Burns GR. Purification and partial characterization of arysulphatase C from human
placental microsomes. Biochim Biophys Acta. 759: 199-204.1983.
[28]Dibbelt L, Kuss E. Human placental steryl-sulfatase. Enzyme purification,
production of antisera, and immunoblotting reactions with normal and sulfatase
deficient placentas. Biol. Chem. Hoppe-Seyler.367:1223-1229.1986.
[29]Chetrite GS, Cortes-Prieto J, Philippe J.C, Wright F, Pasqualini J.R. Comparison
of estrogen cpncentrations, estrone sulfatase and aromatase activities in normal,
and in cancerous, human breast tissues. J Steroid Biochem Mol Biol
72:23-27.2000.
[30]Marchais-Oberwinkler S, Henn Claudia, Adamski J. 17β-Hydroxysteroid
dehydrogenases (17β-HSDs) as therapeutic targets: protein structures, functions,
and recent progress in inhibitor development. Journal of Steroid Biochemistry and
Molecular Biology 125: 66-82. 2011.
[31]Moller G, Adamski J. Intergrated view on 17 beta-hydroxysteroid dehydrogenases.
Mol Cell Endocrionl 301: 7-9. 2009.
[32]Luu-The V. Analysis and characteristics of multiple types of human
17beta-hydroxysteroid dehydrogenase. J. Steroid Biochem. Mol. Biol. 76(1-5)
142-151.2001.
[33]Meier M, Moller G, Adamski J. Perspectives in understanding the role human
17beta-hydroxysteroid dehydrogenase in health and diseases. Ann. N.Y. Acad. Sci.
1155: 14-24. 2009.
[34]Penning TM, Byrns MC. Steroid hormone transforming aldo-keto reductases and
cancer. Ann N Y Acad Sci 1155: 33-42. 2009.
[35]Prehn C, Moller G, Adamski J. Recent advances in 17beta-hydroxysteroid
dehydrogenase. J Steroid Biochem Mol Biol 114(1-2): 72-74.2009.
155
[36]Labrie F, Luu-The V, S-X Lin, Simard J, Labrie C. Role of 17β-Hydroxysteroid
Dehydrogenases in Sex Steroid Formation in Peripheral Intracrine Tissues. Trends
in Endocrinology &metabolism. 11:421-427. 2000.
[37]Miyoshi Y, Ando A, Shiba E, Taguchi T, Tamaki Y and Noguchi S. Involvement
of up-regulation of 17β- hydroxysteroid dehydrogenase type 1 in maintenance of
intratumoral high estradiol levels in postmenopausal breast cancers. Int. J. Cancer
94: 685-689. 2001.
[38]Birrel SN, Hall RE, Tilley WD. Role of the androgen receptor in human breast
cancer. J.Mammary Gland Biol. Neoplasia. 3: 95-103. 1998
[39]Couture P, Theriault C, Simard J, Labrie F. Androgen receptor-mediated
stimulation
of
17beta-hydroxysteroid
dehydrogenase
activity
by
dihydrotestosterone and medroxysteroid acetate in ZR-75-1 human breast cancer
cells. Endocrinology 132: 246-249.1993.
[40]Greeve MA, Allan RK, Harvey JM, Bentel JM. Inhibition of MCF-7 breast cancer
cell proliferation by 5alpha-dihydrostestosterone: a role for P21 (Cip1/Waf1). J Mol
Endocrinol 32: 793-810. 2004.
[41]Aka JA, Mazumdar M, Chen CQ, Poirier D, Lin SX.. 17β- hydroxysteroid
dehydrogenase type1 stimulates breast cancer by dihydrostestosterone inactivation
in addition to estradiol production. Mol Endocrionl 24(4): 832-845.2010.
[42]Krazeisen A, Breitling R, Imai K, Fritz S, Moller G, Adamski J. Determination of
cDNA, gene structure and chromosomal localization of the novel human 17betahydroxysteroid dehydrogenase type 7 (1). FEBS Lett 460: 373-379.1999.
[43]Nokelainen P, Peltoketo H, Vihko R, Vihko P. Expression cloning of a novel
estrogenic mouse 17β-hydroxysteroid dehydrogenase/17β-ketosteroid reductase
(m17HSD7), previously described as a prolactin receptor-associated protein (PRAP)
in rat. Mol Endocrinol 12: 1048-1059.1998.
[44]Duan WR, Parmer TG, Albarracin CT, Zhong L, GiboriG. PRAP, a prolactin
receptor associated protein: its gene expression and regulation in the corpus luteum.
Endocrinology 138: 3216-3221. 1997.
156
[45]Breitling
R,
Krazeisen
A,
Moller
G,
Adamski
J.
17β-hydroxysteroid
dehydrogenase type7─an ancient 3-ketosteroid reductase of cholesterogenesis. Mol
Cell Endocrionl 171: 199-204.
[46]Mariganovic Z, Laubner D, Moller G, Gege C, Husen B, Adamski J, Breitling R.
Closing the gap: identification of human 3- ketosteroid reductase, the last unknown
enzyme of mammalian cholesterol biosynthesis. Mol Endocrinol 17: 1715-1725.
2003.
[47]Shehu A, Albarracin C, Devi YS, Luther K, Halperin J, Le J, Mao J, Duan RW,
Frasor J, Gibori G. The stimulation of HSD17B7 expression by estradiol provides a
powerful feed-forward mechanism for estradiol biosynthesis in breast cancer cells.
Mol Endocrinol 25 (5): 754-66.2011.
[48]Haynes BP, Straume AHH, Geisler J, A'Hern R, Helle H, Smith IE, Lønning PE,
Dowsett M. Intratumoral Estrogen Disposition in Breast Cancer. Clin Cancer Res 16:
1790-1801.2010.
[49]Jez JM, Flynn TG, Penning, TM. A new nomenclature for the aldo-keto reductase
superfamily. biochen. pharmacol. 54(6): 639-647. 1997.
[50]Penning TM，Burczynski ME, Ratnam K. Human 3alpha-hydroxysteroid dehydrogenase
isoforms (AKR1C1-AKR1C4) of the aldo-keto reducatse superfamily: functional
plasticity and tissues distribution reveals roles in the inactivation and formation of
male and female sex hormones, Biochem. J. 351(Pt 1): 67-77. 2000.
[51]Pelletier G, Luu-The V, Tetu B, Labrie F. Immunocytochemical localization of type5
17beta-hydroxysteroid dehydrogenasa in human reproductive tissues. Journal of
Histochemistry Cytochemistry 47: 731-738. 1999.
[52]Vihko P, Herrala A, Härkönen P, Isomaa V, Kaija H, Kurkela R, Li Y, Patrikainen
L, Pulkka A, Soronen P, Törn S. Enzymes as modulators in malignant
transformation. J Steroid Biochem Mol Biol. 93: 277-283. 2005.
[53]Jansson AK, Gunnarsson CH, Cohen M, Sivik T, Stål O. 17β-hydroxysteroid
Dehydrogenase 14 Affects Estradiol Levels in Breast Cancer Cells and Is a
Prognostic Marker in Estrogen Receptor-Positive Breast Cancer. Cancer Res.66:
11471- 11477. 2006.
157
[54]Byrns MC, Duan L, Lee SH, Blair IA, Penning TM. Aldo-Keto reductase
1C3expression in MCF-7 cells reveals roles in steroid hormone and prostaglandin
metabolism that may explain its over-expression in breast cancer. J Steroid
Biochem Mol Biol 118: 177-187. 2010.
[55]Byrns MC, Penning TM. Type 5 17β-hydroxysteroid dehydrogenase/prostaglandin
F synthase(AKR1C3): Role in breast cancer and inhibition by non-steroidal
anti-inflammatory drug analogs. Chemico-Biological Interactions. 178: 221-227.
2009.
[56]Han B, Li S, Song D, Poisson-Paré D, Liu G, Luu-The V, Ouellet J, Li S, Labrie F,
Pelletier G. Expression of 17β-hydroxysteroid dehydrogenase type2 and type 5 in
breast
cancer
and
adjacent
non-malignant
tissue:
A
correlation
to
clinicopathological parameters. J Steroid Biochem Mol Biol. 112: 194-200. 2008.
[57]Haynes BPH, Straume AH, Geisler J, A'Hern R, Helle H, Smith IE, Lønning PE,
Dowsett M. Intratumoral Estrogen Disposition in Breast Cancer. Clin Cancer Res 16:
1790-1801. 2010.
[58]Dufort I, Labrie F, Luu-The V. Human types 1 and 3 3 alpha-hydroxysteroid
dehydrogenases: differential lability and tissue distribution. J Clin Endocrinol
Metab 86: 841–850. 2001.
[59]Zhang B, Zhu DW, Hu XJ, Zhou M, Shang P, Lin SX. Human 3-alpha
hydroxysteroid dehydrogenase type 3 (3α-HSD3): The V54L mutation restricting
the steroid alternative binding and enhancing the 20α-HSD activity. J Steroid
Biochem Mol Bio 141: 135–143. 2014.
[60]Lewis J.S, Jordan V.C. Selective estrogen receptor modulators (SERMs):
Mechanisms of anticarcinogenesis and drug resistance. Mutation Research 591:
247-263.2005.
[61]http://www.breastcancer.org/treatment/hormonal/serms/tamoxifen
[62]Early Breast Cancer Trialists’ Collaborative Group (EBCTCG). Effects of
chemotherapy and hormonal therapy for early breast cancer on recurrence and
15-year survival: an overview of the randomized trials. Lancet 365:
1687-1717.2005.
158
[63]Serkalem D, Rebecca A, Silliman, Timothy L. Lash. Adjuvant Tamoxifen:
Predictors of Use, Side Effects, and Discontinuation in Older Women. J Clin Oncol
19 (2): 322-328. 2001.
[64]Ian E. Smith, Mitch Dowsett. Aromatase Inhibitors in Breast Cancer.N Engl J Med 348:
2431-42.2003
[65]Mouridsen H, Gershanovich M, Sun Y, Dugan M. Superior efficacy of letrozole
versus tamoxifen as first-line therapy for postmenopausal women with advanced
breast cancer:results of a phase III study of the International Letrozole Breast
Cancer Group. J Clin Oncol 19: 2596-2606. 2001
[66]Eiermann W, Paepke S, Appfelstaedt J,et al and V. Semiglazov" for the Letrozole
Neo-Adjuvant
Breast
Cancer
Study
Group
Preoperative
treatment
of
postmenopausal breast cancer patients with letrozole:a randomized double-blind
multicenter study. Ann Oncol 12: 1527-1532.2001
[67]Ellis MJ, Coop A, Singh B, Mieke BorgsH. Letrozole is more effective
neoadjuvant endocrine therapy than tamoxifen for ErbB-1- and/ory than tamoxifen
for ErbB-1- and/or ErbB-2-positive, estrogen receptor-positive primary breast
cancer: evidence from a phase III randomized trial. J Clin Oncol 19: 3808-3816.
2001
[68] [Online] http://en.wikipedia.org/wiki/Aromatase_inhibitor
[69]Kate M, Monique PC, Greg LP. Fulvestrant A review of its use in hormone
receptor-positive metastatic breast cancer in postmenopausal women with disease
progression following antiestrogen therapy. Drugs 64(6): 633-648. 2004.
[70]Addo S, Yates RA, Laight A. A phase I trial to assess the pharmacology of the new
oestrogen antagonist fulvestrant on the endometrium in healthy postmenopausal
volunteers. Br J Cancer 74: 300-308.1996.
[71]Osborne CK, Wakeling A, Nicholson RI. Fulvestrant: an oestrogen receptor
antagonist with a novel mechanism of action. Br J Cancer 90 (Suppl 1), S2 – S6,
2004.
[72]Maltais R, Poirier D. Steroid sulfatase inhibitors: A review covering the promising
2000-2010 decades. Steroids. 76: 929-948. 2011.
159
[73]Stanway SJ, Purohit A, Woo LWL, Sufi S, Vigushin D, Ward R, Wilson RH,
Stanczyk FZ, Dobbs N, Kulinskaya E et al. Phase Ⅰ study of STX64 (667
Coumate) in breast cancer patients: the first study of a steroid sulfatase inhibitor.
Clin Cancer Res 12: 1585-1592. 2006.
[74]Palmieri C, Januszewski A, Stanway S, Coombes RC. Irusostat: a first-generation
steroid fulfatase inhibitor in breast cancer. Expert Review of Anticancer Therapy 11:
179-183. 2011.
[75]Purohit
A,
Foster
PA. Steroid
sulfatase inhibitors for
estrogen-
and
androgen-dependent cancers. J Endocrinol 212: 99-110. 2012.
[76]Poirier D. Advances in development of inhibitors of 17β-hydrozysteroid
dehydrogenases. Anti-Cancer Agents in Med Chemi 9: 642-660. 2009.
[77]Poirier D. 17β-hydrozysteroid dehydrogenases inhibitors: a patent review. Expert
Opin Ther Patents 20(9): 1123-1145. 2010.
[78]Luu-The V, Labrie, F. The intracrine sex steroid biosynthesis pathways. Progr
Brain Res 181: 177-192. 2010.
[79]Dozier BL, Wantanbe K and Duffy DM. Two pathway for prostaglandin F2α
(PGF2α) synthesis by the primate periovulatory follicle. NIH 136(1): 53-63.2008.
[80]Greenhough A, Smartt HJ, Moore AE, Roberts HR, Williams AC, Paraskeva C,
Kaidi A. The COX-2/PGE2 pathway: key roles in the hallmarks of cancer and
adaption to the tumor microenvironment. Carcinogenesis. 30: 377-386. 2009.
[81]Zhao Y, Agarwal VR, Mendelson CR, Simpson ER. Estrogen biosynthesis
proximal to a breast tumor is stimulated by PGE2 via cyclic AMP, leading to
activation of promoter Ⅱ of the CYP19 (aromatase) gene. Endocrinology. 137:
5739-5742. 1996.
[82]Chalbos D, Vignon F, Keydar I, Richefort H. estrogens stimulate cell proliferation
and induce secretory proteins in a human breast cancer cell line (T47D). Clin
Endocrinol Metab 55: 276-283. 1982.
[83]Eeckhoute J, Carroll JS, Geistlinger TR. A cell-type-specific transcriptional network
required for estrogen regulation of cyclin D1 and cell cycle progression in breast
cancer. Genes Dev 20(18): 2513-2526. 2006.
160
[84]Sutherland R.L, Prall O.W, Watts C.K, Musgrove E.A. Estrogen and progestin
regulation of cell cycle progression. J Mammary Gland Biol. Neoplasia 3: 63-72.
1998.
[85]Shufelt CL, Braunstein GD. Testosterone and the breast. Menopause Int. 14(3):
117-122. 2008.
[86]Dimitrakakis C, Zava D, Marinopoulos S, Tsigginou A, Antsaklis A, Glaser R.
Low salivary testosterone levels in patients with breast cancer. BMC Cancer 10:
547.2010.
[87]Zhou H, Zhang Y, Fu Yong, Chan L and Lee A.S. Novel Mechanism of
anti-apoptotic function of 78-kDa glucose-regulated protein (GRP78): endocrine
resistance factor in breast cancer, through release of B-cell lymphoma 2 (BCl-2)
from BCL-2-interacting killer (BIK). J Biol Chem 286(29): 25687-25696. 2011.
[88]http//www.oncomine.org.
[89]Zhang D, Tai LK, Wong LL, Chiu LL, Sethi SK, Koay ES. Proteomic study
reveals that proteins involved in metabolic and detoxification pathways are highly
expressed in HER-2/neu-positive breast cancer. Mol Cell Proteomics 4(11):
1686-1696. 2005.
[90]Zieker D, Konigsrainer I, Tritschler I, Konigsrainer A. Phosphoglycerate kinase 1 a
promoting enzyme for peritoneal dissemination in gastric cancer. Int J Cancer. 126:
1513-1520. 2009.
[91]Lee E, Nichols P, Spicer D, Groshen S, Yu MC, Lee AS. GRP78 as a novel
predictor of responsiveness to chemotherapy in breast cancer. Cancer Res 66:
7849-7853. 2006.
[92]Lee AS. GRP78 induction in cancer: Therapeutic and prognostic implications.
Cancer Res 67: 3496-3499.2007.
[93]Lee E, Nichols P, Groshen S, Spicer D, Lee AS. GRP78 as potential predictor for
breast cancer response to adjuvant taxane therapy. Int J Cancer 128(3):
726-731.2011.
[94]Cook KL, Clarke PA, Clark R. Targeting GRP78 and antiestrogen resistance in
breast cancer. Future Med.Chem. 5(9): 1047-1057.2013.
161
[95]Lee AS. The glucose-regulated proteins: stress induction and clinical applications.
Trends Biochem Sci. 26(8): 504-10. 2001.
[96]Kotsopoulos J, Narod SA. Androgens and breast. Steroids 77: 1-9. 2012
[97]Woolcott CG, Shvetsov YB, Stanczyk FZ, Wilkens LR, White KK, Caberto C,
Henderson BE, Le Marchand L, Kolonel LN, Goodman MT. Plasma sex hormone
concentrations and the risk of breast cancerin postmenopausal women: the
Multiethnic Cohort Study. Endocr Relat Cancer 17(1): 125–134. 2010.
[98]Pasqualini JR, Chetrite GS. Estradiol as an anti-aromatase agent in human breast
cancer cells. J Steroid Biochem Mol Bio 998: 12-17. 2006.
162