senescence
publicité
Dynamics and plasticity of telomeres : consequences in cancer and aging Véronique Gire CRBM-CNRS, Montpellier [email protected] Cancer incidence rise exponentially with age human incidence mice 0 1.5 3 60 age Age is the largest simple risk factor 120 Cellular transformation is a multi-step process I N I T I A T I O N T R A N S F O R M A T I O N UV radiation chemical carcinogens viral infection chronic inflammation inherited genetic mutations ADN mutations oncogenes tumor suppressor genes DNA Repair ADN apoptosis mutations telomerase ADN « tumoral » Hallmarks of cancer comprise eight biological capabilities acquired during the multistep development of human tumors Hanahan& Weinberg, Cell 2000, 2011 Organisms with renewable tissues had to evolve mechanisms to prevent cancer One such mechanism is cellular senescence, which irreversibly arrest the growth of cells at risk of neoplastic transformation Tumour suppressor mechanism prevent cancer by acting on mitotic cells that are at risk for neoplastic transformation Oncogenic damage Gatekeepers genes Caretakers genes Apoptosis/Cellular senescence DNA repair mutations Malignant phenotypes Cellular senescence is caused by potentially oncogenic stimuli Strong/mitogenic stress signals Short/dysfunctional telomeres (replicative senescence) Irreversible cell cycle arrest Non-telomeric DNA damage (ROS) Chromatininstability Oncogenes/ oncogenic mutations Replicative potential Replicative senescence or Hayflick limit Normal cell Cancer cell lines immortal limited growth potential Senescence 40 80 Cell divisions √ Human cells could undergo only a limited number of cell divisions when cultured in vitro Hayflick & Moorhead Exp Cell Res 1961; 25:585-621 Senescent phenotype of human primary fibroblasts phase BrdU (proliferation marker) SA-βgal (senescence biomarker) Young Senescents Morphology remodeling Cell Cycle arrest Metabolic changes Features of cellular senescence Normal fibroblasts . Morphological changes -cells become larger and flatten out -cells display increased granularity -cytoplasms become more vacuole-rich young +70-80 doublings . Biochemical changes -perinuclear activity of SA-β galactosidase -cells are irreversibly arrested in G1 phase -increased protein levels of senescence markers (p21, p16Ink4a, PML, markers of DNA damage, MMP3, PAI-1 etc..) . Chromatin changes -associated heterochromatic foci (SAHFs) -histone H3 lysine 9 trimethylation -HP1 recruitment senescent Senescence versus quiescence Feature Senescence Growth arrest Permanent Transient (mitogen reponsive) DNA content 2N or 4N 2N Metabolism High Low (reduced ribosomal RNA and protein synthesis) Molecular effectors p16Ink4a, p21Waf1, ARF, p53 and Rb p21Waf1, p27Kip1, p107, p130 and repressive E2Fs Markers Short or dysfunctional telomeres None SAβ-gal p16Ink4a DNA damage response SASP (senescence-associated secretory phenotype) SAHFs (senescence-associated heterochromatic foci) Quiescence Sharpless & Sherr Nature Reviews Cancer 2015 Olovnikov’s theory Olovnikov J Theor Biol 1973; 41:181-90 -linked the Hayflick limit to the replication of telomeric DNA -proposed that telomere length determines the number of cell divisions that a cell can undertake Telomere have the essential role of protecting chromosome ends Telomere PNA-FISH of metaphase chromosomes (telomeres (yellow) and chromosomes (blue) Telomere function replication chromosome capping recombinaison end-to-end fusion enzymatic degradation Muller The Collecting Net 1938; 13:181-95 McClintock B. PNAS 1939; 25:405-16 Schematic representation of telomere structure in a T-loop configuration 5-15kb TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-3’ AATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCC-5’ 3’G-rich overhang (~150bp) telomere proteins T-loop Strand invasion of the 3’ overhang Electron micrograph of a telomere (Griffith et al., Cell 1999) -Telomeric DNA consists of tandemly repeated, short nucleotide sequence motifs (TTAGGG in humans) -Composed of double-stranded TTAGGG repeats (5-15kb) and a 3’ single-stranded G-rich overhang (50-150bp) -Telomeric repeats are covered by telomere binding proteins -Telomere is folded back into a telomeric loop (T-loop) The Nobel Prize in Physiology or Medicine 2009 jointly to Elizabeth H. Blackburn, Carol W. Greider and Jack W. Szostak for the discovery of "how chromosomes are protected by telomeres and the enzyme telomerase" The end-replication problem 5’ 3’ Complete synthesis TTAGGG parental (template) strand parental (template) strand 5’ 3’ AATCCC 3’ Leading strand 5’ 3’ 5’ Okazaki fragment synthesis Lagging strand RNA primers 5’-3’ exonuclease Ligation of Okasaki fragments Removal of the last RNA primer 5’ 3’ TTAGGG 3’ 5’ 3’G-rich extension C-strand degradation by a 5’-3’ exonuclease 5’ 3’ AATCCC 3’ 5’ Incomplete synthesis Lagging strand Extreme 5’end is not replicated Telomerase enzyme solves the end replication problem • Germ cells (along with cancer cells) but not somatic cells have an enzyme, telomerase, which elongates shortened telomere •The telomerase ribonucleoprotein complex contains hTERT (telomerase reverse transcriptase; the protein catalytic subunit) and hTR (the internal RNA template) which acts as a template for synthesizing telomere DNA • hTR is present in somatic cells •Telomerase levels are regulated at multiple levels -transcription, -alternative splicing, -assembly and folding, -subcellular localization, -post-translational modification hsp90 p23 3’ hTERT hTR VPARP dyskerin Lingner et al, Science 1997; Meyerson et al., Cell 1997; Nakamura et al., Science 1997; Blasco et al, Science 1995; 5’ Biological activity of telomerase TERT Six newly added telomere repeat Telomerase Telomere 5’-GGTTAGGGTTAGGGTTAGGGTTAG-3’ 3’-CCAATCCCAATC CAAUCCCAAUC 5’-GGTTAGGGTTAGGGTTAGGGTTAGGGTTAG GGTTAG 3’-CCAATCCCAATC CAAUCCCAAUC hTR 3’ 5’ 3’ Recruitment of telomerase to 3’ end of DNA hTR bind to 3’ end of telomere repeats 5’ Nucleotides added to 3’ end of telomeric DNA 5’-GGTTAGGGTTAGGGTTAGGGTTAGGGTTAG GGTTAG-3’ 3’-CCAATCCCAATC CCAATCCCAAUC RNA primer DNA polymerase Standard replication machinery extends the complementary DNA strand Measuring the activity of telomerase : Telomeric Repeat Amplification Protocol (TRAP) assay Principle The assay involves two steps Rnase : 1•Cell extracts 2•Step 1 :Elongation by telomerase of a forward primer added in the extract 3•Step 2 Amplification of the elongated products by PCR with a reverse primer complementary to the elongated telomeric repeats - + - + - + - . . . . . . 68bp 62bp Six-base products ladder amplified by the telomerase 56bp 50bp 4•Native polyacrylamide gel migration stained with SYBR-Green I stain Internal control (36bp) Telomere erosion controls the proliferative capacity of somatic cells Germ cells : 10-12 active telomerase • Telomere length is maintained in germ cells by active telomerase Telomere length (kb) Somatic cells : telomerase negative +hTERT active telomerase immortalisation senescence 6 •Most somatic cells are telomerase negative •Somatic cells experience progressive telomere shortening with proliferative time •Critically shortened telomere signal cells to enter a permanent growth arrest known as senescence •Ectopic expression of hTERT allows to bypass senescence and become immortal M1 or Hayflick limit Cell divisions Nakamura et al., Science 1997; 277:955 Bodnar et al, Science 1998; 279:349-52 Role of telomeres in the immortalization of epithelial cells Short telomeres Fibroblasts 5-20 d Keratinocytes ngs oubli short telomeres p53 activated +hTERT +HPV-E7 other senescence senescence immortalisation pRb/p16 Kiyono et al Nature 1998; 396: 84-8 Telomere independent senescence : « mitotic clock or culture shock ?» Sherr&DePinho Cell 2000; 102:407-10 5-20 doublings no feeder layers Keratinocytes Stress p16INK4a ↑ pRb activated senescence feeder layers 50-70 doublings short telomeres p53 activated senescence Telomere independent senescence can be explained by an inadequate culture environment Ramirez et al Genes&Dev 2001; 15: 398-403 Telomere length measurements Terminal Restriction Fragments (TRFs) Length Analysis : first methodology devised to estimate the average telomere length of a cell population Primary human fibroblasts Genomic DNA extraction Genomic DNA digested with restriction enzymes (HinfI and RsaI) Kb 23- DNA fragments resolved by gel electrophoresis (calibration) 9.4- Southern blotted and probed with a radioactive labeled probe to reveal a telomere specific smear Autoradiography The median length of the telomere smear estimated by comparison with known size markers 6.6- 4.4- 2.3- 2- cell divisions The length of telomere repeats at individual chromosome ends is highly variable Quantitative Fluorescence in situ Hybridization (Q-FISH) : allows high resolution telomere length measurements at specific chromosome ends Chromosomes metaphase spread In situ hybridization with fluorescently-labeled peptide nucleic acid (PNA) probes that specifically hybridize to denatured telomere DNA Measurements of fluorescent signal relative to standards (also use to detect ends without detectable repeats and chromosome fusion events) Telomere length measurements Single Telomere Length Analysis (STELA): a PCR approach that determines telomere length distribution from single DNA molecules telomere- specific primer XpYpE2 G-rich 3’overhang 3’ TTAGGG telomere repeats variant 5’ 3’ subtelomeric sequence 5’ XpYpB2 telorette teltail ligate First Step : consists of annealing a linker or « telorette » comprising seven bases of TTAGGG homology followed by a 20nucleotide non-complementary tail to the G-rich 3’ overhang of the telomere. Second Step : the telorette is ligated to the 5’ end of the complementary C-rich strand of the chromosome, which effectively tags the end of the telomere with the non-complementary telorette tail. PCR can then be performed using a primer (‘teltail’) that is identical to this tail, together with a chromosome-specific upstream primer Baird et al, Nat. Genet. 2003 XpYp telomere-length distributions of young and immortal HF-E6/E7 using STELA MW HF-E6/E7 young +hTERT 24.6kb 14.6kb -around 4-20 telomeric molecules are amplified in each PCR reaction 9.6kb 6.6kb -each DNA sample is subjected to multiple separate telomere PCR reactions and different reactions are loaded in separate lanes (here 3 reactions are shown) 3.6kb -the fragments are resolved with agarose gel electrophoresis and detected by Southern hybridization with a telomere specific probe -each visible band is a single telomere 1.6kb Collaboration with Duncan Baird (Cardiff) XpYp telomere-length distributions of young and immortal HF-E6/E7 0,20 0,05 2 0 2 0 3.6kb 4 Telomere length (kb) 4 6 8 10 0,00 20 6.6kb 0,10 12 9.6kb 0,15 14 14.6kb 16 Frequency (%) 24.6kb HF-E6/E7 young n=158 s=0.621 l=13.21 18 young +hTERT MW HF-E6/E7 Frequency (%) HF-E6/E7+hT 1.6kb 0,20 0,15 n=166 s=0.612 l=13.688 0,10 0,05 6 8 10 12 14 16 18 20 0,00 Telomere length (kb) Mean telomere length SD (variance) Median 5.73 3.12 5.05 7.13 2.56 7.16 -telomere length distribution become tighter and more homogenous with telomerase expression Role of the p53/p21 pathway in replicative senescence Dysfunctional Telomeres HFF PD:! p Mdm2 p53 p activated 28! 73! 79! 85! <1 p-pRb! pRb! p16Ink4a p53! cycA! p21WAF1 p16! CycE Cdk2 Cdk4/6 CycDs p21! total! pRb E2F p pRb %BrdU :! %SA-βGal :! p E2F G1/S transition onset and maintenance of irreversible G1 cell cycle arrest 86 37 11 0 29 61 89 ! ! Schematic diagram of cell cycle arrest in senescent cells Dysfunctional Telomeres DNA damage Johmura et al Mol Cell 2014 Krenning et al Mol Cell 2014 p p p53 p p16Ink4a activated CycE p activated p21WAF1 Cdk2 p53 p21WAF1 Cdk4/6 CycDs pRb APC/Ccdh1 activated pRb Diploid senescent cells (G1 phase) G2 cells Tetraploid senescent cells (G1 phase) Mitosis skip Hypothèses de détection d’un défaut télomérique noyau « jeune » Trois modes possibles de détection d’un défaut télomérique ADN endommagé Excès de protéines télomériques « libres » Transition structurale d’un télomère Too short telomeres activate the DNA damage response γ-H2AX Too short telomeres p young senescents p p 53BP1 p BRCA1 p p p53 senescents p21WAF1 D’Adda Di Fagagna et al., Nature 2003 Gire et al., EMBO J 2004 Herbig et al., Mol Cell 2004 p CHK1 CHK2 young p ATRIP ATR ATM 53BP1/ADN γ-H2AX /ADN γ-H2AX Cell cycle arrest senescence Mdm2 Roles of the p53 and p16/Rb pathways in the senescence response eroded telomeres proteotoxic stress (protein aggregation) DNA damage reactive metabolites (ROS, high glucose ) oncogenic mutations Too short telomeres « DNA breaks » gene expression changes & chromatin remodeling p16/pRb p53/p21 Activation of cell-cycle checkpoints Premature Senescence Stasis (OIS, STIS) Replicative Senescence Similar senescent phenotype Serrano et al., Cell 2001 Molecular regulation of oncogene-induced senescence oncogenic Ras ROS signals DNA replication stress DNA damage p16/RB Chromatin reorganization (SAHF) ARF p53 Senescence growth arrest (irreversible) Mdm2 Narita et al., Cell 2003 Mallette et al., Genes&Dev 2007 Di Micco et al., Nature 2006 Chromatin remodeling in senescent cells senescence replicative quiescence DAPI stasis Apparition foyers de chromatine condensée dans les fibroblastes sénescents Proliferative normal human cells exhibit a diffuse nuclear DNA staining Senescent cells show bright punctuate DNA foci of compact chromatin Narita et al., Cell 2003 Molecular characteristics of SAHF SAHF contain markers of heterochromatin, including hypoacetylated histones, histone H3 methylated on lysine 9 (H3K9Me), and bound Heterochromatin Protein 1 (HP1) proteins DNA, blue HIRA chaperone protein, red PML bodies, Green Senescence-associated foci lack sites of active transcription Narita et al., Cell 2003 Zhang et al., Dev Cell2005 A Model for formation of SAHF in senescent human cells During proliferation, proliferation-promoting genes, including those regulated by E2F, are transcribed and their histones are acetylated (Ac). In response to senescence stimuli, the HIRA/ASF1a histone chaperones cooperates with the p16INK4a/pRB pathway to drive chromosome condensation. After chromosome condensation, HP1 proteins and histone variant macroH2A are incorporated into SAHF. Recruitment of HP1γ to SAHF depends on HP1γ phosphorylation. Repressive heterochromatin at loci containing E2F target genes leading to their expressionsilencing Transcriptional repression and the formation of SAHF require the Retinoblastoma (Rb) protein. Devenir des télomères et capacités réplicatives in vivo Corrélations taille des télomères, âge et capacité réplicative les cellules somatiques issus de donneurs jeunes possèdent des télomères plus longs que celles issues de donneurs âgés (Allsopp et al., PNAS 1992;89:10114-8) Maladies génétiques du vieillissement -les enfants nés avec le syndrome de la progéria de Hutchinson-Gilford ont des télomères plus courts que ceux d’enfants sains du même âge -les cellules issues de patients atteints du syndrome de Werner et d’ataxie télangiectasie perdent leurs télomères à un rythme plus élevé que les cellules témoins Corrélations stress réplicatif, taille des télomères et cancer les télomères de cellules hématopoïétiques de patients ayant subi une transplantation de la moelle osseuse sont plus courts que ceux des cellules donneurs Modèle souris transgénique pour étudier le rôle des télomères dans le vieillissement Souris Terc-/-, G1-G3, télomères longs, pas de pathologie visible Souris Terc-/-, G6, télomères courts provoquent des manifestations de vieillissement prématuré : -animaux mâles stériles -reduction de la prolifération dans les organes à index mitotique élevé (cellules germinales, hematopoiëtiques et épidermiques) -vieillissement prématuré (alopécie, cicatrisation laborieuse des lésions cutanées et poils grisonnants) Blasco et al, Cell 1997 Senescent cells accumulate in vivo SA-βGal staining of skin samples √ with increasing age -skin young -retina -liver, spleen etc… √ at sites of degenerative age-related pathology old -venous ulcers -atherosclerotic plaques -benign prostatic hyperplasia - pre-neoplastic lesions Dimri et al., PNAS 1995; 92:9363-7 Senescent cells do not simply stop dividing irreversible growth arrest resistance to apoptosis altered function/gene expression √ Senescent cells remain viable and metabolic active. √ They secrete biologically active molecules that can change tissue structure and function. This phenotype is referred to as the senescenceassociated secretory phenotype (SASP) Autocrine and paracrine activities of selected SASP factors Factor Amphiregulin Granulocyte-macrophage colony stimulating factor Growth-related oncogenes (CXC chemokines) Insulin-like Growth factor binding protein-7 Interleukin-6 Interleukin-8 Matrix metalloproteinases Monocyte chemoattractant proteins (CCL chemokines) Plasminogen activator inhibitor-1 Vascular endothelial growth factor Symbol Major activities AREG GM-CSF GROs, CXCLs IGFBP-7 IL-6 IL-8 MMPs MCPs, CCLs Cell proliferation Hematopoietic stem cell, differentiation; PAI-1 VEGF Wound healing; autocrine growth arrest Endothelial cell migration/invasion; angiogenesis inflammation Cell proliferation, cell migration/invasion Apoptosis; autocrine growth arrest Epithelial-to-mesenchymal transition; cell migration/invasion; inflammation autocrine growth arrest Epithelial-to-mesenchymal transition; cell migration/invasion; inflammation autocrine growth arrest Tissue remodeling; cell migration/ invasion; wound healing (resolution of fibrosis) Inflammation; cell migration/invasion Senescent cells may disrupt normal tissues structure and function epithelial cell ST R O M A EPITHELIUM Young tissue Basement Membrane young fibroblasts aging senescent epithelial cell Old tissue E P I T H E L I U M ST R O M A Basement Membrane senescent fibroblasts Degradative enzymes (MMPs) Inflammatory cytokines As senescent cells accumulate with age, the produced degradative enzyme inflammatory cytokines, can disrupt the tissue structure and, consequently decrease tissue function Campisi Cell 2005 Senescent cells may promote cancer progression « initiated cell » epithelial cells ST R O M A EPITHELIUM Young tissue Basement Membrane young fibroblasts aging Senescent epithelial cell Old tissue Neoplastic growth E P I T H E L I U M ST R O M A Basement Membrane senescent fibroblasts Degradative enzymes (MMPs) Inflammatory cytokines Growth factors! (autocrine &paracrine) Molecules secreted by senescent cells may create a permissive microenvironment that allows the proliferation and malignant progression of preneoplastic cells Davalos Cancer Metastasis Rev 2010 Senescence-associated secretory phenotype in cancer Immune cell activation! Autocrine! senescence! Pro-tumor Pararine! senescence! Tumor invasiveness! Anti-tumor Angiogenesis! Cell proliferation! Di Mitri & Alimonti Trends Cell Biol 2016 Double visage des télomères promouvoir la sénescence cellulaire et le vieillissement de l’organisme encourager la prolifération désordonnée et la tumorigénicité Rôle de télomères et de la télomérase dans le développement tumoral Fibroblaste: télomérase négatif Taille des télomères (kb) 10-12 +hTERT immortalisation inactivation p53/pRb HPV-E6/E7 SV40-T cellules tumorales: télomérase positive 6 réactivation de la télomérase mort cellulaire crise des télomères M1 ou sénescence M2 ou crise divisions cellulaires Telomere length, telomerase and immortal transformation Telomere length Telomerase reactivation Normal duct Hyperplasia carcinoma in situ invasive cancer Genome instability Loss of telomere function Further evolution Genomic instability driven by progressive telomere shortening occurs early in tumour development after which the genome appears to stabilise with advancing malignancy, roughly coincident with the activation of telomerase Accumulation of karyotype abnormalities during cancer progression Normal cell Cancer cell 24-colors hybridization of metaphasic chromosomes (SKY ou M-FISH) Telomere attrition and perpetuation of the BFB cycle Too short telomere expose the ends DNA repair functions create chromosome fusion Anaphase bridging during segregation in mitosis Breakage-Fusion-Bridge (BFB) cycle Rearranged chromosome Cancer Modèle de souris transgéniques pour l’étude du rôle des télomères dans le cancer Souris Terc-/- issues de générations tardives (G6) présentent une augmentation globale des cancers spontanés et une activation anormale de p53 Souris Terc-/- et p53-/- très susceptibles au développement des cancers dans les générations tardives. Les souris Terc-/- et p53-/- sont fertiles. En G8, forte mortalité des cellules germinales correspondrait à la crise. Souris Terc-/- et Ink4a-/- présente une réduction de la fréquence d’apparition des cancers dans les générations tardives car déclenchement de barrières télomériques dépendante de p53 Schematic representation of telomere structure in a T-loop configuration 5-15kb TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-3’ AATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCC-5’ 3’G-rich overhang (~150bp) telomere proteins T-loop Strand invasion of the 3’ overhang Electron micrograph of a telomere (Griffith et al., Cell 1999) -Telomeric DNA consists of tandemly repeated, short nucleotide sequence motifs (TTAGGG in humans) -Composed of double-stranded TTAGGG repeats (5-15kb) and a 3’ single-stranded G-rich overhang (50-150bp) -Telomeric repeats are covered by telomere binding proteins -Telomere is folded back into a telomeric loop (T-loop) Schematic model of shelterin complex bound to a telomere in a T-loop configuration Shelterin is essential for telomere length control and telomere protection Repression of DNA-damage signaling pathways at telomeres Shelterin complex : TRF1, TRF2, Tin2, Pot1, TPP1, hRap1 ATM kinase pathway block ATR kinase pathway block Specific function associated with each shelterin protein and to the telomerase Martinez&Blasco Aging Cell 2010 Different components of shelterin are dedicated to different aspects of the endprotection problem T-loop opens Exposed 3’ overhang Palm & de Lange Annu. Rev. Genet. 2008 Repression of NHEJ at telomere by TRF2 by forming the T-loop NHEJ TRF2 loss NHEJ unprotected telomere recruitment ERCC1/XPF overhang cleavage End-joining Dicentric chromosome Palm & de Lange Annu. Rev. Genet. 2008 Telomere-associated proteins assist with proper chromatin structure, chromosome end protection, telomere length regulation and processing TRF2 complex TRF1 complex XPF-ERCC1 (Xeroderma pigmentosum) TANK TRF2 TRF1 WRN (-TTAGGG)n MRE11/NBS1/RAD50 (Nijmegen breakage syndrome) POT1 (altered in some tumours) (Werner syndrome) (altered in some tumours) BLM (Bloom syndrome) RAP1 ATM (Ataxia Telangiectasia syndrome) (altered in some tumours) PARP1/2 (altered in some tumours) Ku86 TPP1 RAP1 TRF2 (altered in some tumours) TIN2 (altered in some tumours) Déprotection spontanée des télomères au cours du cycle cellulaire Phase G1 : protection télomérique boucle télomérique TRF2 Phase S phase : réplication des télomères Voie de réponse au dommages de l’ADN Fusion chromosomique TRF1 Erreurs de réplication des télomères Fragilité télomèrique Hélicases Phases S et G2 : processivité et remodelage des extrémités télomériques γ-H2AX TRF2 / POT1 Activation transitoire de la voie de réponse aux dommages de l’ADN Protéines de recombinaison Télomères se réorganisent en structure protective Verdun et al, Mol Cell 2005 Verdun et al, Cell 2006 Maintien de la fonction des télomères 1- Le complexe protéique télomérique : protège et régule la structure des télomères 2- La télomérase Shelterin : TRF1, TRF2, Tin2, Pot1, TPP1, hRap1 Activation DDR bloquée accès télomérase bloqué Modèle de régulation de la télomérase par les protéines télomériques, Pot1 et TPP1 TPP1 interagit directement avec la télomérase et peut faciliter le recrutement de l’enzyme au télomère. Pot1 serait un régulateur négatif de la télomérase car entre en compétition avec la télomérase pour la liaison sur le brin 3’. Mouse models for shelterin components and their cancer and aging phenotype Genotype cancer phenotype TRF1-KO embryonic lethal rapid development of preneoplastic lesions at 1-3 days of age TRF1Δ/Δ K5-Cre (conditional) aging phenotype hyperpigmentation, epithelia degenerative pathology, defcetive hair follicle development TRF2-KO embryonic lethal K5-TRF2 increased susceptibility to spontaneous and induced skin cancer premature skin deterioration, hyperpigmentation, alopecia Pot1a-KO embryonic lethal Pot1b-KO not reported not reported hyperpigmentation and fatal bone marrow failure TIN2-KO embryonic lethal RAP1-KO not reported viable Pot1b-KO Terc+/- Martinez&Blasco Aging Cell 2010 Implication pour la clinique: Stratégies anti-tumorales visant à mimer les signaux télomériques 1•Bloquer l’activité catalytique de la télomérase -Inhibiteurs de hTERT -Inhibiteurs de chaperons Pot1 TPP1 PINX1 Tin2 TRF1 TRF2 Tankyrase WRN BLM Pot1 TPP1 ERCC1 Tin2 XPF TRF1 TRF2 hRAP1 3’ TEP1 hsp90 TERT VPARP dyskérine TERC 5’ 2•Bloquer l’ARN matrice TERC 3•Cibler l’ADN télomérique -Modification de la structure de l’ADN : G-quadruplex -Modification de la fixation des protéines télomériques Une approche de thérapie anti-tumorale ciblant le télomère instabilité génomique mimer la sénescence apoptose approche actuelle résistance télomérase Temps de traitement cellules cancéreuses approche alternative ? apoptose télomère Temps de traitement
