http://www.bloodjournal.org/content/bloodjournal/100/5/1852.full.pdf?sso-checked%3Dtrue

From www.bloodjournal.org by guest on July 8, 2017. For personal use only.
PHAGOCYTES
SHP-1 regulates Fc␥ receptor–mediated phagocytosis and the activation of RAC
Anita M. Kant, Pradip De, Xiaodong Peng, Taolin Yi, David J. Rawlings, Jong Suk Kim, and Donald L. Durden
Fc␥ receptor–mediated phagocytosis is a
complex process involving the activation of
protein tyrosine kinases, events that are
potentially down-regulated by protein tyrosine phosphatases. We used the J774A.1
macrophage cell line to examine the roles
played by the protein tyrosine phosphatase
SHP-1 in the negative regulation of Fc␥
receptor–mediated phagocytosis. Stimulation with sensitized sheep red blood cells
(sRBCs) induced tyrosine phosphorylation
of CBL and association of CBL with CRKL.
These events were completely or partially
abrogated by PP1 or the heterologous expression of dominant-negative SYK, respectively. Heterologous expression of wild-type
but not catalytically inactive SHP-1 also completely abrogated the phagocytosis of IgGsensitized sRBCs. Most notably, overexpressed SHP-1 associates with CBL and
this association led to CBL dephosphorylation, loss of the CBL-CRKL interaction, and
the suppression of Rac activation. These
data represent the first direct evidence that
SHP-1 is involved in the regulation of Fc␥
receptor–mediated phagocytosis and suggest that activating signals mediated by
SRC family kinases SYK, CBL, phosphatidyl
inositol-3 (PI-3) kinase, and Rac are directly
opposed by inhibitory signals through
SHP-1. (Blood. 2002;100:1852-1859)
© 2002 by The American Society of Hematology
Introduction
Fc␥ receptor–mediated phagocytosis in macrophages is an important primary mode of defense in the immune system. Fc␥-receptor
engagement leads to the activation of nonreceptor tyrosine kinases
HCK, LYN, FGR,1,2 and SYK3,4; phosphorylation of adapter
proteins; and activation of effector molecules including Rac, Rho,
and Rab.5,6 Previous results from our laboratory established that
SYK is activated following Fc␥R stimulation and associates with
the Fc␥RI␥-receptor subunit.3 Hence, the role played by tyrosine
kinases in this phenomenon has been examined extensively.7-9 In
contrast, there is very limited information on the role of protein
phosphatases in the regulation of the Fc␥R pathway. Herein, we
present the first direct evidence that the protein tyrosine phosphatase SHP-1 negatively regulates Fc␥ receptor–mediated phagocytosis and controls the phosphorylation state of CBL and the activation
of the small guanosine triphosphatase (GTPase), Rac.
Mouse macrophages express 3 types of Fc gamma receptors—
Fc␥RI, Fc␥RII, and Fc␥RIII10-13—which can bind to the Fc portion of
IgG coating the surface of the foreign invaders. Of these receptors,
Fc␥RI and Fc␥RIIIA are known to transmit the signals through a
tyrosine phosphorylation activation motif (ITAM) contained within the
␥ subunit, while Fc␥RIIB has a tyrosine phosphorylation inhibitory
motif (ITIM) in its cytoplasmic domain. Multiple isoforms of Fc␥RIIB
are expressed in J774 cells emanating from alternative splice variants,
suggesting additional complexity of this receptor in macrophage signaling.12 Receptors containing ITIM can act as negative regulators of the
signals initiated by receptors containing ITAM.14 Fc␥RIIB is involved in
inhibition of cell activation by Fc␥R, Fc␥RIIA, and T-cell receptor upon
coaggregation.15 In B cells coligation of B-cell antigen receptor (BCR)
and Fc␥RIIB leads to inhibitory signaling.16 Similarly, ITIM is found in
other receptor systems, such as the gp49 family of proteins on mast cells
and natural killer (NK) cells, killer cell inhibitory receptor (KIR),17 and
inhibitory receptor SHPS-1, abundantly expressed in neurons.18 Upon
activation of these receptors the tyrosine residue in the ITIM gets
phosphorylated by LYN, a Src family kinase,19 to provide a site of
attachment for phosphatases such as SHP-1, SHIP,20 and SHP-2,19
which can start the negative regulatory pathway. Recently, Clynes et al
used the Fc␥RII knockout mouse to demonstrate a role for Fc␥RIIB in
the regulation of Fc␥ receptor–mediated phagocytosis.21 These observations strongly suggest a potential role for phosphatases in Fc␥R signal
transduction, which focused our attention on involvement of SHP-1
(also known as SH-PTP1, HCP, and PTP1C) in phagocytic signal
transduction.
SHP-1 is a nontransmembrane protein involved in multiple
signaling systems. It contains 2 tandem Src homology 2 (SH2)
domains. The N-terminal SH2 domain serves both a regulatory and
a recruiting function, while the C-terminal SH2 domain functions
predominantly as a recruiting domain.22 SHP-1 plays an important
role in regulating the macrophage proliferative pathway. Macrophages from motheaten viable (Mev) mice have a frameshift
mutation in SHP-123 and display hyperproliferation in response to
macrophage colony stimulating factor 1 (CSF-1). Studies from
these mice have indicated that CSF-1 receptor and SHP-1 are
phosphorylated upon growth factor stimulation and associate with
each other. It has been suggested that Grb2, an adapter molecule
From the Herman B. Wells Center for Pediatrics Research, Department of
Pediatrics, Biochemistry and Molecular Biology, Indiana University School of
Medicine, Indianapolis; the Childrens Hospital Los Angeles Research Institute,
University of Southern California School of Medicine, Los Angeles; the
Department of Pediatrics, Division of Immunology/Rheumatology, University of
Washington School of Medicine, Seattle; and the Department of Cancer
Biology, Cleveland Clinic Foundation Research Institute, OH.
Drake Grant for Excellence in Cancer Research. This work was supported in
part by National Institutes of Health grants HD37091and CA81140 and by the
American Cancer Society.
Submitted April 5, 2001; accepted April 23, 2002.
Supported by a grant from the American Cancer Society (RPG-98-24401-LBC) to D.L.D. A.M.K. is a recipient of the Childrens Hospital Los Angeles
Career Development Fellowship. D.J.R is the recipient of a McDonnell Scholar
Award, a Leukemia and Lymphoma Society Scholar Award, and the Joan J.
1852
A.M.K. and P.D. contributed equally to this work.
Reprints: Donald L. Durden, Herman B. Wells Center for Pediatric Research,
Indiana University School of Medicine, 1044 W Walnut St, Rm 468,
Indianapolis, IN 46202; e-mail: [email protected].
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2002 by The American Society of Hematology
BLOOD, 1 SEPTEMBER 2002 䡠 VOLUME 100, NUMBER 5
From www.bloodjournal.org by guest on July 8, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2002 䡠 VOLUME 100, NUMBER 5
with an SH2 domain, binds to SHP-1, possibly recruiting phosphotyrosine-containing proteins for dephosphorylation by SHP-1.24
SHP-1–mediated dephosphorylation is also involved in delivery of
the Fas apoptosis signal in lymphoid cells.25 SHP-1 is positively
involved in epidermal growth factor (EGF) and interferon-␥–
induced signal transducer and activator of transcription (STAT)
activation in HeLa cells.26 In macrophages, SHP-1 also selectively
regulates the tyrosine phosphorylation of Stat1 and Jak1 while
leaving Tyk2 and Stat2 unaffected.27 In contrast, Keilhack et al28
have described the binding of SHP-1 to the EGF receptor, leading
to dephosphorylation of the receptor and attenuation of receptor
signaling. In the motheaten mouse, Fc␥RIIB signaling is deficient,
suggesting a role of SHP-1 in control of ITIM function.29 In
contrast, Ono et al 30,31 have shown that inhibitory signaling by
Fc␥RIIB does not require SHP-1 but involves the 5⬘inositol phosphatase SHIP. Data from Sharlow et al32 have indicated that
SHP-1 acts as a negative regulator of erythropoietin-induced
differentiation of normal erythroid progenitor cells, preventing
their premature commitment to terminal differentiation. Hence
it has been suggested that tyrosine phosphatases exert both
positive and negative regulation of specific signals and integrate
these signals temporally and spatially within the cell.
To investigate the role played by SHP-1 in phagocytic signal
transduction, we overexpressed wild-type SHP-1 in J774A.1 cells,
using a recombinant vaccinia virus expression system. SHP-1
overexpression led to a complete abrogation of phagocytosis of
sensitized sheep red blood cells (sRBCs) by J774A.1 cells. This is
the first evidence that SHP-1, a tyrosine phosphatase, regulates Fc␥
receptor–mediated phagocytosis. Most notably, SHP-1 associated
with the CBL adapter protein, and this association led to loss of
CBL phosphorylation and the suppression of Rac. These data
support a role for SHP-1 in the control of phagocytosis and suggest
that CBL dephosphorylation mediates, at least in part, negative
control of Fc␥R-dependent phagocytosis.
Materials and methods
Antibodies
Anti-CBL (SC170) and anti-CRKL antibodies (SC-319) were obtained from
Santa Cruz Biotechnology, (Santa Cruz, CA). Plasmids encoding enhanced green
fluorescent protein (EGFP)–tagged SYK kinase and Fc␥RIIA were prepared by
standard subcloning methods in pEGFP and pcDNA3.1, respectively. DNA
constructs encoding SHP-1, SHP-2, catalytically dead SHP-1 (C453S), or
catalytically dead SHP-2 (C486S) were subcloned into the pcDNA3.1 vector.
Anti-SYK antibody was provided by Dr Tamara Hurley (Salk Institute, San
Diego, CA), and anti–SHP-1 antibody was generated in our laboratory. For
detection of Fc␥RIIA expression in COS7 cells, we used an allophycocyanin
(APC) conjugate anti-CD32 monoclonal antibody (FL18.26).
Cell lines and vaccinia virus expression system
J774A.1, a macrophagelike cell line, was obtained from ATCC (Manassas,
VA; catalog no. 67-TIB). The cells were grown in Dulbecco Modified Eagle
Medium (DMEM) containing 10% fetal calf serum (FCS). Recombinant
vaccinia virus vectors were provided by Dr Bernard Moss (Bethesda, MD).
The dominant-negative SYK vaccinia construct (encoding the N terminus
of SYK, residues 1-255) was provided by Dr A. Scharenberg, as previously
described.33 Recombinant vaccinia viruses containing SHP-1 and dominantnegative SYK were prepared as described. Briefly, recombinant vaccinia
virus was propagated in 149B cells grown in RPMI containing 10% FCS. A
confluent culture of cells was infected with recombinant vaccinia virus at a
concentration of 0.5 plaque-forming units (pfu) per cell for 48 hours. The
cells were scraped in the same medium, pelleted down, and resuspended in
SHP-1 REGULATES PHAGOCYTOSIS
1853
5 mL of 10 mM Tris-HCl pH 9. The cells were disintegrated by freezing in
liquid nitrogen and thawing at 37°C 3 times, after which the volume was
made up to 20 mL with 10 mM Tris-HCl pH 9 and the cells were subjected
to 40 strokes in a homogenizer. Nuclei and cell debris were separated from
the cell lysate by centrifugation at 1000 rpm for 5 minutes. The cell lysate
containing the recombinant vaccinia virus was then subjected to sonication
for 1 minute. The cell lysate was loaded on a cushion of 36% sucrose
solution and centrifuged at 13 000 rpm for 80 minutes at 4°C in an
ultracentrifuge (Beckman, Palo Alto, CA) using an SW.28 rotor. Viral pellet
obtained at the bottom was suspended in 1 mL of 10 mM Tris-HCl pH 9 and
loaded on a sucrose gradient composed of 6.6 mL each of 40%, 36%, 32%,
28%, and 24% sucrose solutions made in 10 mM Tris-HCl pH 9 to be
centrifuged at 12 500 rpm for 50 minutes at 4°C in an ultracentrifuge
(Beckman) using an SW.28 rotor. A bluish white ring containing purified
virus was collected, diluted with 10 mM Tris-HCl pH 9, and recentrifuged
at 13 000 rpm for 60 minutes at 4°C in an ultracentrifuge (Beckman) using
an SW.28 rotor to pellet the virus down. Purified recombinant vaccinia virus
thus obtained was suspended in 10 mM Tris-HCl pH 9 and titered as
follows. An aliquot was used for making serial dilutions of the viral
suspension. These were used to infect a confluent lawn of 149B cells grown
in a 6-well plate for 2 hours at 37°C in 1 mL RPMI containing 10% FCS.
The medium was then replaced with 3 mL of fresh RPMI containing 10%
FCS. After 24 hours the medium was discarded and the plaques were
visualized by staining with crystal violet to determine the titer.
Preparation of recombinant vaccinia virus containing
catalytically inactive mutant
A construct (C2mSHP-1S453KT3) containing catalytically inactive SHP-1
mutant was kindly provided by Dr Taolin Yi. The insert was amplified by
polymerase chain reaction (PCR), using the following 5⬘ and 3⬘ primers:
CTCGTCGACAGGATGGTGAGGTGGTTTCAC and AGTCCCGGGAGATCACTTCCTCTTGAGAGAA, respectively. The amplified product was subcloned into PCR2.1 vector with a TA cloning kit (Invitrogen, San Diego, CA),
isolated by using SmaI and SalI restriction digest, and ligated to the recombinant
vaccinia vector pSC65. The construct C2pSC65 was used to make a recombinant
vaccinia virus using packaging cell line CV1 and the wild-type vaccinia virus.
Recombinant virus was purified from the wild-type virus by single-plaque
purification. It was amplified, purified, and titered as described above.
Phagocytic assays
J774A.1 cells were plated at a density of 2 ⫻ 105 cells per well in a 12-well
plate (Costar, Corning, NY) overnight. Cells were infected with recombinant vaccinia virus pSC65 or pSC65-SHP-1 at a density of 2 pfu/cell for 4
hours at 37°C in 5% CO2. After 4 hours the medium was changed and the
cells were subjected to sRBCs coated with IgG at subagglutinating
concentration. The target-to-effector ratio was kept at 100:1. The cells were
scraped after 2 hours; cytospins were prepared, fixed, and stained with
Wright Giemsa stain (Dade, AG, Switzerland); and the slides were observed
under a microscope for rosette formation. The rest of the cells were
subjected to water shock to lyse the uningested sRBCs. The cells were
suspended in DMEM containing 20% FCS. The cells were spun down on
glass slides and fixed and stained with Wright Giemsa stain. A minimum of
150 cells were counted for each slide and the phagocytic index was
calculated as follows: phagocytic index (PI) ⫽ number of sRBCs internalized by 100 J774 cells counted in 10 random fields of slide. In the case of
the inhibitors the cells were subjected to treatment with the inhibitor at
different concentrations along with an appropriate dimethyl sulfoxide
(DMSO) control for 1 hour in DMEM with 10% FCS before the
phagocytosis assay was carried out as described previously.
␤-Galactosidase and rosette formation assays
As a control for effects of recombinant vaccinia virus, J774A.1 cells were
tested for equal viral load by quantitation of ␤-galactosidase activity
measured with X-gal. The plasmid pSC65, used for cloning of dominantnegative SYK, contains the gene ␤-galactosidase, which cleaves X-gal to
give a color product that can be quantitated colorimetrically. In every
From www.bloodjournal.org by guest on July 8, 2017. For personal use only.
1854
KANT et al
experiment, we quantitated recombinant viral load for control (cells
infected with empty vector recombinant vaccinia virus) compared with
experimental sample (cells infected with vaccinia virus containing dominantnegative SYK) and they were equivalent (data not shown). The capacity of
J774A.1 cells to form rosettes via Fc␥ receptor was not altered by vaccinia
virus. Cells infected with empty vector recombinant vaccinia virus or cells
infected with vaccinia virus containing dominant-negative SYK showed
100% rosette formation within 1 minute of addition of sensitized sRBCs,
indicating that the surface expression of Fc␥ receptors and the extracellular
function of the Fc␥Rs as it relates to binding of sRBC targets was not
affected by recombinant vaccinia virus alone (data not shown). Rosette
formation and phagocytosis did not occur in absence of sensitizing antibody
against sRBCs, which establishes the Fc␥R specificity of this response.
Cells equivalent to 1⫻ 105 were suspended in 400 ␮L of DMEM containing
10% FCS to which 50 ␮L of 1% X-gal (Sigma, St Louis, MO) was added.
After incubation at 37°C the color of the medium turns blue. The
supernatant was diluted 1:10 and the optical density was measured at 595
nm in a spectrophotometer (Molecular Devices, Menlo Park, CA).
Overexpression of SHP-1 and dominant-negative SYK in
J774A.1 cells
Cells (2 ⫻ 105) infected with different viruses were lysed with 50 ␮L of sample
buffer. The lysates were resolved on acrylamide gels and probed for appropriate
protein expression with corresponding antibodies as described above.
Heterologous COS7 cell phagocytosis system
COS7 cells were plated at 1 ⫻ 105 cells per well on a 6-well plate overnight. Cells
were transfected with plasmids using lipofectamine reagent for 4 hours followed
by a washing step and further incubation for 24 or 48 hours. The phagocytosis
assay was carried out as described above for J774 cells. Phagocytic index ⫽
number of sRBCs internalized by 100 COS7 cells randomly sampled. During all
transfections total plasmid DNA concentration and composition were equilibrated using empty vector plasmids. All transfected proteins, EGFP-SYK,
Fc␥RIIA, SHP-1, and C2-SHP-1, were quantitated by Western blot analysis or
flow cytometry. Thus it can be interpreted that the effect on phagocytic response
(PR) is causally linked to SHP-1 transfection. In all experiments performed, all
transfected proteins were quantitated in parallel populations of COS7 cells to
ensure that the effects observed with transfection of SHP-1 vs SHP-2 were
attributable to this variable and not levels of Fc␥RIIA or SYK kinase. The
determination of conversion of guanosine diphosphate (GDP)–Rac to GTP-Rac
was as described.34
BLOOD, 1 SEPTEMBER 2002 䡠 VOLUME 100, NUMBER 5
negative SYK exhibit minimal phagocytosis. Dominant-negative
SYK expression is confirmed by Western blot (Figure 1B, lane 3).
The data we obtained using dominant-negative SYK are consistent
with other data in the literature, including data from SYK knockout
mice,8 strongly supporting a role for SYK in propagating signals
required for IgG-mediated phagocytosis in this J774 system.
Src and phosphatidyl inositol-3 (PI-3) kinase are required for
phagocytosis of IgG coated sRBCs by J774A.1 cells
Recent evidence from HCK/LYN/FGR knockout mice suggests that
members of the Src family of nonreceptor protein tyrosine kinases are
upstream of SYK and PI-3 kinase in myeloid ITAM signaling.8 To
examine the role of Src family kinases and PI-3 kinase in Fc␥R
phagocytosis in our system, we treated J774 cells with PP1 (Calbiochem, La Jolla, CA), an inhibitor of Src family tyrosine kinases at 10, 5,
and 1 ␮M concentration, or wortmannin, an inhibitor of PI-3 kinase at a
concentration of 10, 1, and 0.1 nM, with appropriate DMSO controls for
1 hour in DMEM with 10% FCS and then added sensitized sRBCs at a
target-to-effector ratio equal to 100:1. Figure 2A shows that PP1
abrogates phagocytosis at 10 and 1 ␮M concentration and the effect is
dose dependent. Figure 2B demonstrates that wortmannin blocks
phagocytosis significantly at 10 and 1 nM concentrations. These
observations are consistent with other reports in the literature, from
studies performed in other cell lines, which strongly suggest that Src
family kinase activity and PI-3 kinase are required for phagocytosis of
IgG-coated sRBCs by J774A.1 cells.
Dominant-negative SYK and PP1 inhibit Fc␥-induced CBL
phosphorylation
Previous reports from our laboratory and others have demonstrated
that Fc␥-receptor cross-linking induces the tyrosine phosphorylation of the complex adapter protein CBL.36,37 These observations
prompted us to determine whether a phagocytic signaling event
would induce the phosphorylation of CBL. To further understand
the role of specific kinases in this phosphorylation event, we used
dominant-negative SYK and a Src family kinase inhibitor, PP1, to
determine a role for these kinases in CBL tyrosine phosphorylation.
Immunoprecipitation
J774A.1 cells were infected with recombinant vaccinia virus at a concentration of 2 pfu/mL for 4 hours. The cells were then collected and suspended at
a concentration of 2 ⫻106 cells per mL of DMEM and stimulated with
IgG-coated sRBCs at 37°C for 5 minutes. The samples were centrifuged at
500g in a refrigerated centrifuge and the supernatant was aspirated. The cell
pellet was used for immunoprecipitation as described earlier.35
Results
Dominant-negative SYK inhibits phagocytosis
In order to investigate the role played by nonreceptor tyrosine
kinase SYK in IgG-mediated phagocytosis, we expressed the
dominant-negative form of SYK in J774A.1 cells with recombinant
vaccinia virus. The SYK mutant encodes a truncated form of SYK
containing only the tandem SH2 domains with no catalytic domain
and is expected to dock with the ITAM, thereby preventing the
endogenous catalytically active SYK kinase from interacting with
the Fc␥R␥ subunit. Expression of dominant-negative SYK in
J774A.1 cells strongly inhibits phagocytosis of IgG-coated sRBCs
(Figure 1A). Normal phagocytosis occurs in J774A.1 cells infected
with empty vector recombinant vaccinia virus. In comparison,
J774A.1 cells infected with vaccinia virus containing dominant-
Figure 1. Dominant-negative SYK inhibits phagocytosis. (A) Phagocytosis of
IgG-sensitized sRBCs by noninfected J774A.1 cells (control), cells infected with
recombinant vaccinia virus containing empty vector (pSC65-vector), or cells infected
with dominant-negative SYK (pSC65-D/N SYK). The cells were infected with vaccinia
viruses or empty vector for 4 hours at 37°C with 5% CO2, after which they were
subjected to IgG-sensitized sRBCs in fresh medium at a target-to-effector ratio equal
to 100:1 for 2 hours at 37°C. Nonengulfed sRBCs were lysed by water shock and the
cells were fixed and stained with Wright Giemsa staining before the phagocytic index
was counted. Columns indicate phagocytic index of J774A.1 (mean ⫾ SD). (B)
Western blot analysis shows expression of dominant-negative SYK in J774A.1 cells
infected with different recombinant vaccinia viruses: lane 1, no vector; lane 2, empty
vector; lane 3, dominant-negative SYK.
From www.bloodjournal.org by guest on July 8, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2002 䡠 VOLUME 100, NUMBER 5
Figure 2. SRC and PI-3 kinases are required for Fc␥ receptor–mediated
phagocytosis. J774A.1 cells were treated with (A) PP1 or (B) wortmannin at the
indicated concentrations along with an appropriate DMSO control for 1 hour in DMEM
with 10% FCS and then IgG-sensitized sRBCs were added at a target-to-effector ratio
equal to 100:1. Columns indicate phagocytic index of J774A.1 cells treated with
DMSO (control), PP1, or wortmannin (mean ⫾ SD).
The expression of dominant-negative SYK kinase representing
the N-terminal SH2 domains completely abrogates the phagocytic
response but has a modest effect on the tyrosine phosphorylation
status of CBL in vivo (Figure 3A). We demonstrated that CBL
tyrosine phosphorylation is induced under conditions of phagocytosis and that PP1 abrogates the tyrosine phosphorylation of CBL
(Figure 3B). This effect is dose dependent (data not shown), as is
the effect of PP1 on Fc␥-receptor phagocytosis (Figure 2A).
Interestingly, dominant-negative SYK inhibited CBL tyrosine
phosphorylation to a lesser extent but completely abrogated the
phagocytic response. Both PP1 and D/N SYK suppressed the basal
tyrosine phosphorylation state of CBL in vivo. These data suggest
that both the Src family kinase catalytic activity and the capacity of
SYK to dock with the ITAM receptor are required for the induction
of the CBL phosphorylation in response to stimulation with
sensitized sRBCs and that these 2 events are required for phagocytosis in vivo. The dominant-negative SYK would not be expected
to alter the upstream activity of SRC kinases, hence SRC-mediated
phosphorylation of CBL is not altered to the same extent. The data
are consistent with the model that SRC and SYK are both involved
in Fc␥R-mediated phagocytosis, likely mediated by the downstream activation of PI-3 kinase (Figure 2B), and set the stage for a
biochemical analysis of the negative regulation of this ITAM
receptor by the intracellular phosphatase SHP-1. Hence, we
conclude that the SRC/SYK/CBL signaling axis is a likely target
for protein tyrosine phosphatase (PTPase) action as it relates to the
negative regulation of phagocytosis.
SHP-1 REGULATES PHAGOCYTOSIS
1855
protein (C2, Figure 4). In contrast, overexpression of wild-type SHP-1 in
J774 cells markedly inhibited phagocytosis of IgG-coated sRBCs
(Figure 4, left lower panel). Figure 4A shows phagocytosis of sensitized
sRBCs by J774A.1 infected with empty vector recombinant vaccinia
virus, vaccinia virus containing catalytically dead SHP-1 C2 mutant, or
vaccinia virus expressing wild-type SHP-1. Quantitation of the phagocytic index in the different groups is shown in Figure 4B and Western
blot analysis for expression of SHP-1 and catalytically dead SHP-1
mutant in these cells is shown in Figure 4C. As a control for effects of
recombinant vaccinia virus, J774A.1 cells were exposed to an equal
multiplicity of infection (MOI) of virus and then quantitated ␤-galactosidase activity was measured with X-gal. There was no effect of SHP-1 or
other protein constructs on the capacity of cells to form rosettes (data not
shown), an assay that assesses the capacity of J774 cells to form
sRBC-J774 cell conjugates. These findings indicate that SHP-1 negatively regulates intracellular events required for the IgG-mediated
phagocytic response in macrophages, and the catalytic activity of SHP-1
is required for this suppression.
To determine whether the CBL adapter protein is a potential
substrate for SHP-1 in vivo, we expressed SHP-1 or the C2 mutant
of SHP-1 in J774 cells and then stimulated the cells with sensitized
sRBCs followed by immunoprecipitation of CBL. Both the wildtype and mutant SHP-1 coimmunoprecipitated with CBL. Most
notably, only the expression of wild-type SHP-1 resulted in the
dephosphorylation of CBL in vivo (Figure 5). We next evaluated
whether changes in CBL phosphorylation led to alterations in
downstream CBL-dependent signaling events, including the formation of the CBL-CRKL signaling complex. The CBL-CRKL
interaction has been implicated previously in ITAM and Fc␥
receptor signaling.38 In the presence of SHP-1 (but not C2 SHP-1),
phosphorylation decreased markedly and the interaction of CBLCRKL was abrogated (Figure 5). Upon dephosphorylation of CBL,
the CBL-CRKL adapter protein interaction is lost. The expression
of C2 (catalytically dead SHP-1) is noted to associate with CBL to
a lesser extent and not to induce the dephosphorylation of CBL or
to disengage the CBL-CRKL interaction in vivo. From these data
we conclude that CBL is an in vivo substrate for SHP-1 under
conditions of Fc␥-receptor engagement in myeloid cells and that
dephosphorylation of CBL alters the generation of phospho-CBLdependent downstream signaling complexes in vivo.
Overexpression of SHP-1 in J774A.1 cells results in the
dephosphorylation of CBL and inhibits phagocytosis
The data presented here as well as in other published work clearly
demonstrate a requirement for tyrosine kinases in phagocytosis1-4,7-9 (Figures 1 and 2). These findings therefore also suggest that
dephosphorylation of specific sites of tyrosine phosphorylation may
negatively regulate this response. To begin to address this question we
overexpressed SHP-1 in J774A.1 cells. Phagocytosis of sensitized
sRBCs was unaltered in cells infected with empty vector recombinant
vaccinia virus or vaccinia expressing a catalytically inactive SHP-1
Figure 3. Effect of dominant-negative SYK and PP1 on tyrosine phosphorylation of CBL in response to stimulation with IgG-sensitized sRBCs. (A-B)
Western blot analysis of CBL immunoprecipitates to assay the phosphorylation of
CBL following treatment of IgG-sensitized sRBCs in J774A.1 cells expressed by
dominant-negative SYK, treated with Src family kinase inhibitor, PP1 (10 ␮M).
J774A.1 lysates prepared from resting cells or cells stimulated with sensitized sRBCs
for 5 minutes were immunoprecipitated with polyclonal anti-CBL antibody and
immunoblotted with monoclonal antiphosphotyrosine antibody to determine phosphorylation of CBL or immunoblotted with polyclonal anti-CBL antibody to determine total
protein amounts of CBL under the same nitrocellulose membrane.
From www.bloodjournal.org by guest on July 8, 2017. For personal use only.
1856
KANT et al
BLOOD, 1 SEPTEMBER 2002 䡠 VOLUME 100, NUMBER 5
Rac must be converted from a GDP-bound state to GTP-Rac in
order to activate downstream effectors required for cytoskeletal
reorganization and polymerization of actin. Data from a Rac2
knockout model developed in our laboratory39 provide direct
evidence that Rac2 is required for macrophage-mediated phagocytosis (D.L.D., unpublished observation, August 2001). Prior reports
have also implicated Rac in Fc␥R-mediated phagocytosis.5 To
provide further biochemical evidence for SHP-1 in the regulation
of phagocytosis, we determined the effect of SHP-1 on the
Fc␥RIIA-induced conversion of GDP-Rac to GTP-Rac (Figure 7).
Using the heterologous COS7 cell system, we observed that SHP-1
and not the C2 mutant of SHP-1 blocked Fc␥RIIA phagocytosis
(Figure 4). SHP-1 overexpression suppressed the Fc␥RIIA-induced
conversion of GDP-Rac to GTP-Rac (Figure 7; compare lanes 3
and 6). In the absence of Fc␥RIIA or SYK, Rac is not activated
(Figure 7, lanes 7-9). The transfection of SHP-2 had no effect on
phagocytosis (Figure 6A), Rac activation (data not shown), or CBL
phosphorylation state (Figure 8). These data are internally consistent with the observed effect of SHP-1 on CBL phosphorylation
and the CBL-CRKL interaction and provide confirmatory evidence
that SHP-1 regulates this signaling axis required for ITAM signaling.
Discussion
Figure 4. Overexpression of SHP-1 in J774A.1 cells inhibits phagocytosis. (A)
Composite photomicrographs of Wright Giemsa–stained J774 cells undergoing
phagocytosis of sRBCs. Original magnification, ⫻ 100. We show noninfected J774
A.1 cells (control); cells infected with recombinant vaccinia virus containing empty
vector (pSC65-vector); J774 cells infected with recombinant vaccinia virus encoding
wild-type SHP-1 (pSC65-SHP-1); cells containing catalytically dead SHP-1 mutant
(pSC65-C2). The cells were infected with vaccinia viruses or empty vectorfor 4 hours
at 37°C with 5% CO2, after which they were subjected to IgG-sensitized sRBCs in
fresh medium at a target-to-effector ratio equal to 100:1 for 2 hours at 37°C. (B)
Quantitation of phagocytosis of IgG-sensitized sRBCs by J774A.1 cells. Columns
indicate phagocytic index of J774A.1 cells (mean ⫾ SD). (C) Western blot analysis
shows expression of SHP-1 protein in J774A.1 cells infected with recombinant
vaccinia virus: lane 1, no vector; lane 2, empty vector; lane 3, catalytically dead
C2-SHP-1 mutant; lane 4, wild-type SHP-1 .
Because of overlapping binding affinities, Fc␥ receptors must
function in concert during the process of phagocytosis. During Fc␥
receptor–mediated phagocytosis by macrophages, all the 3 types of
Fc␥ receptors are cocrosslinked by the Fc portion of IgG coating
the surface of the foreign invaders. Of these receptors, Fc␥RI and
Fc␥RIII are involved in activation of nonreceptor tyrosine kinases
such as HCK, LYN, and SYK. In contrast, Fc␥RIIB has an ITIM in
its cytoplasmic domain, which is known to play an inhibitory role
during signal transduction by virtue of its association with protein
and lipid phosphatases such as SHP-1 and SHIP. These phosphatases are recruited directly to the signalsomes generated by
Specificity of SHP-1 in control of phagocytosis
To begin to address the specificity of SHP-1 in these signaling events,
we compared the effects of SHP-1 transfection and SHP-2 transfection
on Fc␥RIIA phagocytosis (Figure 6A). A heterologous COS7 cell
system reconstituted with the Fc␥RIIA receptor and SYK kinase was
used to ask the question, Is the effect of SHP-1 on Fc␥ receptor ITAM
signaling specific?34 Equivalent levels of Fc␥RIIA and EGFP-SYK
were confirmed in COS7 cell transfectants (Figure 6B) and levels of
SHP-1 and SHP-2 expression were quantitated in cells analyzed for
phagocytosis and by flow cytometry (Figure 6C). The data clearly
suggest that SHP-2 has no significant effect on the Fc␥RIIA-induced
phagocytic response. This result provides evidence that the effect of
SHP-1 on ITAM signaling seen in our study is specific for this
blood-specific phosphatase.
SHP-1 regulates RAC activation in response to
Fc␥RIIA engagement
It is clear that small GTPases of the Rho family play an important
role in the modulation of the actin-cytoskeletal network of proteins
required for Fc␥ receptor–mediated phagocytosis. The small GTPase
Figure 5. CBL is a substrate for SHP-1. (A-B) Western blot analysis of CBL
immunoprecipitates to assay the tyrosine phosphorylation of CBL and to determine
protein-protein interactions between CBL and SHP-1 or CRKL following treatment of
IgG-sensitized sRBCs in J774A.1 cells expressed by wild-type SHP-1 and catalytically
dead mutant SHP-1. J774A.1 lysates prepared from resting cells or cells stimulated with
sensitized sRBCs for 5 and 10 minutes were immunoprecipitated with polyclonal anti-CBL
antibody and immunoblotted with antiphosphotyrosine antibody (PY-CBL blot), anti-CBL
antibody (CBL blot), anti–SHP-1 antibody (SHP-1 blot), and anti-CRKL antibody (CRKL
blot). (C) Western blot analysis shows expression of SHP-1 proteins in J774A.1 cells
infected with recombinant vaccinia virus: lane 1, no vector; lane 2, empty vector; lane 3,
catalytically dead SHP-1 mutant; lane 4, wild-type SHP-1 phosphatase.
From www.bloodjournal.org by guest on July 8, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2002 䡠 VOLUME 100, NUMBER 5
SHP-1 REGULATES PHAGOCYTOSIS
1857
Figure 7. SHP-1 regulates Rac. We used a heterologous COS-7 cell system and p21
activated kinase (PAK) binding domain pull-down assay to evaluate ITAM receptor–
induced activation of Rac34 in the presence or absence of SHP-1 cotransfection. The
transfection condition for each group is shown above the lanes. Lanes 1, 4, and 7 show no
stimulation (NS); lanes 2, 5, and 8, sRBC stimulation for 1 minute at 37°C; lanes 3, 6, and 9,
stimulation of transfected COS7 cells for 5 minutes with sRBC. Lane 10 shows a positive
control for GTP-Rac, a COS7 cell lysate incubated with GTP␥S. (A) SHP-1 blocks
Fc␥RIIA-induced conversion of GDP-Rac to its GTP-bound state. Western blot was
performed with anti-Rac1 antiserum on glutathione-S transferase PAK binding domain
(GST-PBD) fusion protein pull-down to detect levels of GTP-Rac1 in COS7 cell lysates
following sRBC stimulation. (B) Anti–SHP-1 Western blot analysis of cell lysates shown in
panel A. Lane 1, no transfection; lane 2, transfection with Fc␥RIIA and EGFP-SYK; lane 3,
transfected with empty vector plasmids; lane 4, transfected with Fc␥RIIA, EGFP-SYK, and
SHP-1.
Figure 6. Specificity for SHP-1 effect on ITAM signaling. (A) Effect of SHP-1 vs
SHP-2 on Fc␥RIIA-induced phagocytosis using a COS7 cell heterologous system.34
Bars represent SD. COS7 cells were transiently transfected with Fc␥RIIA and
EGFP-tagged SYK kinase in the presence of SHP-1 or SHP-2. Phagocytic index was
determined as defined in “Materials and methods.” (B) Flow cytometry is used to
document that cotransfection conditions result in equal amounts of EGFP-tagged
SYK kinase and Fc␥RIIA expression in all transfectant populations. (C) Western blot
analysis of SHP-1 or SHP-2 expression in COS7 cells evaluated in panels A and B.
We performed immunoblot analysis of all COS7 cell transfectants used in the above
analysis of phagocytosis.
activating receptors. In this work we have focused on the potential
role for one key protein tyrosine phosphatase, SHP-1, in the
complex process of phagocytic signal transduction.
Activation of macrophages through Fc␥ receptors leads to
activation of protein tyrosine kinases from the Src and SYK
families.1,3 SYK, with its 2 amino terminal SH2 domains, becomes
associated with phosphorylated ITAM present in the signaling
subunit of the activated Fc receptors.3,4 Consistent with this model,
immunofluorescence studies have demonstrated translocation of
SYK to regions where Fc␥R-mediated phagocytosis40 and the
essential role of SYK in phagocytosis have been demonstrated by
failure of SYK-deficient macrophages to engulf IgG-coated particles.8 These macrophages exhibited normal response to complement and lipopolysaccharide. Furthermore, chimeric transmembrane Fc receptors bearing SYK tyrosine kinase domains can
autonomously trigger phagocytosis and redistribution of filamentous actin in COS cells.9 SYK is not required for actin polymerization but is involved in closure of the phagosome.8 To determine the
role of SYK J774A.1 cells, we overexpressed a construct containing the 2 SH2 domains of SYK (Figure 1A). This SYK mutant acts
as a dominant-negative mutant by blocking the signal mediated by
endogenous SYK and ITAM. Expression of dominant-negative
SYK abrogated phagocytosis of sensitized sRBCs. Our results
support the role of SYK and SRC tyrosine kinases in positive
modulation of Fc␥ receptor–mediated phagocytosis.
In order to determine the role played by Src family kinases in
phagocytosis, we treated J774A.1 cells with PP1,41 a selective inhibitor
of Src kinases, before and during stimulation with sensitized sRBCs
(Figure 2A). The data demonstrated that PP1 abrogates the Fc␥
receptor–mediated phagocytosis and CBL tyrosine phosphorylation in a
Figure 8. CBL is dephosphorylated by SHP-1 and not SHP-2. CBL immunoprecipitated
from COS7 cells transfected with plasmids encoding the expression of Fc␥RIIA, CBL, SYK,
SHP-1, or SHP-2 followed by Fc␥RIIA stimulation. (A) CBL immunoprecipitated from
transfected COS7 cells was resolved by sodium dodecyl sulfate–polyacrylamide gel
electrophoresis (SDS-PAGE) and immunoblotted with antiphosphotyrosine-specific antibodies (upper panel) and anti-CBL antisera (lower panel). Plasmid transfection conditions are
shown above lanes. Transfected COS7 cells were either not stimulated (NS) or stimulated
with IgG-opsonized sRBCs for times indicated. VC indicates cell lysates prepared from
empty vector–transfected COS7 cells. (B) Anti-CBL, anti–SHP-1, and –SHP-2 immunoblot
analysis of lysates prepared from resting COS7 cells shown in panel A. Lane 1, no
transfection; lane 2, empty vector–transfected cells (control); lane 3, CBL transfected in the
absence of SHP-1 or SHP-2; lane 4, CBL cotransfected with SHP-1; lane 5, CBL
cotransfected with SHP-2.
From www.bloodjournal.org by guest on July 8, 2017. For personal use only.
1858
KANT et al
concentration-dependent manner. Crowley et al8 have shown that
macrophages derived from mice deficient for HCK, FGR, and LYN
exhibit a delay in the Fc␥ receptor–mediated phagocytosis as compared
with the inhibition of the phenomenon with PP1 treatment as observed
by us. Other workers42 have implicated Hck in the process of degranulation related to phagocytosis, as HCK translocates toward the phagosome
from secretory granules during neutrophil activation. Our results strongly
suggest the involvement of Src family kinases in the tyrosine phosphorylation of CBL, an event that is essential for the formation of the
ITAM/SYK/CBL complex to initiate the phagocytic response. Our
current hypothesis is that SYK and/or SRC mediates the tyrosine
phosphorylation of CBL at positions 774 and 731, which is essential for
the recruitment of CRKL and the p85 subunit of PI-3 kinase, respectively, to the receptor complex. Preliminary data from our laboratory
obtained by using a CBL (Y731F) mutant strongly supports this model
(P.D., D.L.D., unpublished observation, June 2001). We are currently
using this model to implicate specific substrates for SRC and SYK
family kinases involved in phagocytosis.
PI-3 kinase has also been clearly implicated in Fc receptor–
dependent signaling. Stimulation of Fc receptors leads to the association
of PI-3 kinase with the receptor complexes43 and to an increase in its
kinase activity.44 Araki et al45 reported that wortmannin, a potent
inhibitor of PI 3-kinase, allowed formation of pseudopodia around the
sRBCs but prevented the closure of phagosomes around the sheep
erythrocytes in macrophages. Chimeric receptors composed of Fc␥R
extracellular and transmembrane domains fused to p85 subunit of PI-3
kinase, when transfected into COS cells, are sufficient to trigger the
process of phagocytosis upon activation. In our system, wortmannin
inhibited the Fc␥R-mediated phagocytosis in a concentration-dependent
manner, supporting a role for PI-3 kinase in J774 phagocytosis (Figure
2B). More recent data from our laboratory have directly addressed a
specific role for PI-3 kinase in Fc␥ receptor–mediated phagocytosis.34
The Fc receptor–dependent signaling events downstream of
tyrosine kinases are predicted to involve recruitment of a platform
of adapter proteins, nucleotide exchange proteins, and GTPases.
Results from these experiments (Figure 3A-D) indicate that CBL is
tyrosine-phosphorylated in J774A.1 cells in response to stimulation
with sensitized sRBCs. This event is significantly inhibited with
PP1, an inhibitor of Src family kinases (Figure 3A, compare lanes 3
and 6), and to a lesser extent by dominant-negative SYK (Figure
3C), in parallel to the inhibition of phagocytosis by these agents
(Figures 1A,2A). This suggest a potential role for CBL phosphorylation in phagocytosis. CBL is phosphorylated on stimulation of
Fc␥R in myeloid cells.36,37,46,47 Notably, by virtue of its association
with adapter proteins such as CRKL38 and Grb2,36 it can mediate
the signal downstream to nucleotide exchange factors such as C3G
and Sos and then to GTPases such as RAP, RAS, and RAC. There is
also significant evidence that48 CBL is a negative regulator for
SYK. These observations suggest that CBL can act as a central
molecule to control traffic along the Fc␥R signaling pathway.
Recent data from Sato et al49 have implicated CBL in the control of
phagocytosis in myeloid cells in a PI-3 kinase–dependent manner.
Our data are consistent with results of Beitz et al,50 indicating that
dominant-negative SYK blocks CBL tyrosine phosphorylation in B
cells, altering the CBL-p85 interaction and PI-3 kinase activation.
Importantly, many of these regulatory interactions involve phosphotyrosine-dependent interactions between CBL and other effectors
of signal relay (eg, PI-3 kinase binding to residue Y731 in CBL),
raising the idea that tyrosine phosphatases may regulate the
interaction between SYK, CBL, and PI-3 kinase via the p85
regulatory subunit. Because CBL regulatory interactions involve
phosphotyrosine-dependent interactions between CBL and other
effectors of signal relay (eg, CRKL, PI-3 kinase binding to
BLOOD, 1 SEPTEMBER 2002 䡠 VOLUME 100, NUMBER 5
residue Y731 in CBL), these data suggest that tyrosine phosphatases may directly regulate the interaction between CBL and its
associated effectors.
To begin to address this possibility, we evaluated the potential
consequences of overexpression of SHP-1 in the J774A.1 macrophage cell line (Figure 4A-D). Strikingly, overexpression of SHP-1
led to abrogation of phagocytosis, association of SHP-1 with CBL,
dephosphorylation of CBL, and abrogation of CBL-CRKL interaction only in cells expressing catalytically active SHP-1. In contrast,
the phosphatase SHP-2 has no effect on ITAM-induced phagocytosis (Figure 6A) and was not associated with the dephosphorylation
of CBL (Figure 8). These findings clearly indicate a selective
inhibitory role for SHP-1 in the regulation of IgG-mediated
phagocytosis separate from SHP-2 function.
There are very few reports describing putative substrates for
SHP-1. Recently Brockdorff et al51 have proposed that activated
SHP-1 is involved in dephosphorylation of Zap-70 and SYK and
in subsequent inhibition of T-cell receptor signaling. Earlier
reports from our laboratory52 have shown the involvement of
SLP-76 in Fc␥RI–mediated signal transduction. To date, our
data suggest that SLP-76 is not a major substrate for SHP-1 in
this system. In contrast, our findings indicate that CBL is a key
substrate for SHP-1 and that dephosphorylation of CBL abrogates the CBL-CRKL interaction. The CBL-CRKL interaction is
mediated through YxxP motifs within the CBL C terminus at
tyrosine 774.38 The data suggest that SHP-1 targets the tyrosine
at position 774 for dephosphorylation under conditions following receptor activation, resulting in loss of CBL-CRKL interaction. This observation is consistent with the observation that
SHP-1 abrogates the ITAM-induced activation of Rac, a biochemical event that has been implicated in control of actin
polymerization events and phagocytosis.5 Moreover, our results
establish a specificity for SHP-1 in the regulation of Fc␥
receptor ITAM signaling, in that SHP-2 does not suppress
signaling through the myeloid ITAM signalsome. The SHP-2
phosphatase has been confirmed to play a role in gp130 cytokine
receptor (eg, IL-6 receptor) signaling.53 Moreover, these data
suggest a specific role for SHP-1 (vs SHP-2) in the regulation of
the small GTPase Rac and strengthens the biochemical link
between SHP-1 and ITAM signal relay. The data argue for a
divergence of phosphatase action between ITAM receptors and
other receptors such as gp130 linked receptor cytokine signaling
that involves the SHP-2 phosphatase.
Taken together, our data are consistent with the model that
during Fc␥ receptor–mediated phagocytosis, Fc␥RI and Fc␥RIII
receptors use ITAM, SYK, Src family kinases, and PI-3-kinase to
generate activating signals that mediate phagocytosis. SHP-1
constitutes a negative feedback loop for this response, mediated
either through Fc␥RII or through direct recruitment to the signalsome. These data provide the first direct evidence that SHP-1
negatively regulates phagocytosis, which it accomplishes at least in
part by altering the phosphorylation state of CBL and by inhibiting
conversion of GDP-Rac to its activated GTP-bound state.
Acknowledgments
We would like to thank Drs Bernard Moss, Andrew Scharenberg,
J. P. Kinet, Rebecca Chan, and G. S. Feng for reagents provided,
and Dr Robert C. Seeger for his considerable support of A.M.K.
during the performance of this work.
From www.bloodjournal.org by guest on July 8, 2017. For personal use only.
BLOOD, 1 SEPTEMBER 2002 䡠 VOLUME 100, NUMBER 5
SHP-1 REGULATES PHAGOCYTOSIS
1859
References
1. Durden DL, Kim HM, Calore B, Liu Y. The Fc
gamma RI receptor signals through the activation
of hck and MAP kinase. J Immunol. 1995;154:
4039-4047.
2. Wang AV, Scholl PR, Geha RS. Physical and functional association of the high affinity immunoglobulin
G receptor (Fc gamma RI) with the kinases Hck and
Lyn. J Exp Med. 1994;180:1165-1170.
3. Durden DL, Liu YB. Protein-tyrosine kinase
p72syk in Fc gamma RI receptor signaling.
Blood. 1994;84:2102-2108.
4. Kiener PA, Rankin BM, Burkhardt AL, et al.
Cross-linking of Fc gamma receptor I (Fc gamma
RI) and receptor II (Fc gamma RII) on monocytic
cells activates a signal transduction pathway
common to both Fc receptors that involves the
stimulation of p72 Syk protein tyrosine kinase.
J Biol Chem. 1993;268:24442-24448.
5. Caron E, Hall A. Identification of two distinct mechanisms of phagocytosis controlled by different Rho
GTPases. Science. 1998;282:1717-1721.
6. Bokoch GM, Knaus UG. Ras-related GTP-binding proteins and leukocyte signal transduction.
Curr Opin Hematol. 1994;1:53-60.
7. Indik ZK, Park JG, Pan XQ, Schreiber AD. Induction of phagocytosis by a protein tyrosine kinase.
Blood. 1995;85:1175-1180.
8. Crowley MT, Costello PS, Fitzer-Attas CJ, et al. A
critical role for Syk in signal transduction and phagocytosis mediated by Fcgamma receptors on macrophages. J Exp Med. 1997;186:1027-1039.
9. Greenberg S, Chang P, Wang DC, Xavier R,
Seed B. Clustered syk tyrosine kinase domains
trigger phagocytosis. Proc Natl Acad Sci U S A.
1996;93:1103-1107.
10. Ravetch JV, Kinet JP. Fc receptors. Annu Rev
Immunol. 1991;9:457-492.
11. Daeron M. Fc receptor biology. Annu Rev Immunol.1997;15:203-234.
12. Latour S, Fridman WH, Daeron M. Identification,
molecular cloning, biologic properties, and tissue
distribution of a novel isoform of murine low-affinity IgG receptor homologous to human Fc gamma
RIIB1. J Immunol. 1996;157:189-197.
13. Hogarth PM, Witort E, Hulett MD, et al. Structure
of the mouse beta Fc gamma receptor II gene.
J Immunol. 1991;146:369-376.
14. Vivier E, Daeron M. Immunoreceptor tyrosinebased inhibition motifs. Immunol Today. 1997;18:
286-291.
15. Daeron M, Latour S, Malbec O, et al. The same
tyrosine-based inhibition motif, in the intracytoplasmic domain of Fc gamma RIIB, regulates
negatively BCR-, TCR-, and FcR-dependent cell
activation. Immunity. 1995;3:635-646.
16. D’Ambrosio D, Hippen KL, Minskoff SA, et al. Recruitment and activation of PTP1C in negative
regulation of antigen receptor signaling by Fc
gamma RIIB1 [see comments]. Science. 1995;
268:293-297.
17. Dupont B, Selvakumar A, Steffens U. The killer
cell inhibitory receptor genomic region on human
chromosome 19q13.4. Tissue Antigens. 1997;49:
557-563.
18. Veillette A, Thibaudeau E, Latour S. High expression
of inhibitory receptor SHPS-1 and its association with
protein-tyrosine phosphatase SHP-1 in macrophages. J Biol Chem. 1998;273:22719-22728.
19. Sarmay G, Koncz G, Pecht I, Gergely J. Fc
gamma receptor type IIb induced recruitment of
inositol and protein phosphatases to the signal
transductory complex of human B-cell. Immunol
Lett. 1997;57:159-164.
20. D’Ambrosio D, Fong DC, Cambier JC. The SHIP
phosphatase becomes associated with Fc gam-
maRIIB1 and is tyrosine phosphorylated during
’negative’ signaling. Immunol Lett. 1996;54:77-82.
21. Clynes R, Maizes JS, Guinamard R, Ono M, Takai T, Ravetch JV. Modulation of immune complex-induced inflammation in vivo by the coordinate expression of activation and inhibitory Fc
receptors. J Exp Med. 1999;189:179-185.
22. Pei D, Wang J, Walsh CT. Differential functions of
the two Src homology 2 domains in protein tyrosine phosphatase SH-PTP1. Proc Natl Acad
Sci U S A. 1996;93:1141-1145.
23. Shultz LD, Schweitzer PA, Rajan TV, et al. Mutations at the murine motheaten locus are within the
hematopoietic cell protein-tyrosine phosphatase
(Hcph) gene. Cell. 1993;73:1445-1454.
nase substrate in signaling complexes formed
after engagement of Fc gamma receptors. J Biol
Chem. 1995;270:9115-9120.
38. Kyono WT, de Jong R, Park RK, et al. Differential
interaction of Crkl with Cbl or C3G, Hef-1, and
gamma subunit immunoreceptor tyrosine-based
activation motif in signaling of myeloid high affinity Fc receptor for IgG (Fc gamma RI). J Immunol.
1998;161:5555-5563.
39. Roberts AW, Kim C, Zhen L, et al. Deficiency of
the hematopoietic cell-specific Rho family
GTPase Rac2 is characterized by abnormalities
in neutrophil function and host defense. Immunity.
1999;10:183-196.
24. Chen HE, Chang S, Trub T, Neel BG. Regulation of colony-stimulating factor 1 receptor signaling by the SH2 domain-containing tyrosine
phosphatase SHPTP1. Mol Cell Biol. 1996;16:
3685-3697.
40. Strzelecka A, Pyrzynska B, Kwiatkowska K, Sobota A. Syk kinase, tyrosine-phosphorylated proteins and actin filaments accumulate at forming
phagosomes during Fcgamma receptor-mediated
phagocytosis. Cell Motil Cytoskeleton. 1997;38:
287-296.
25. Su X, Zhou T, Wang Z, Yang P, Jope RS, Mountz
JD. Defective expression of hematopoietic cell
protein tyrosine phosphatase (HCP) in lymphoid
cells blocks Fas-mediated apoptosis. Immunity.
1995;2:353-362.
41. Hanke JH, Gardner JP, Dow RL, et al. Discovery
of a novel, potent, and Src family-selective tyrosine kinase inhibitor. Study of Lck- and FynTdependent T cell activation. J Biol Chem. 1996;
271:695-701.
26. You M, Zhao Z. Positive effects of SH2 domain-containing tyrosine phosphatase SHP-1 on epidermal
growth factor- and interferon-gamma-stimulated activation of STAT transcription factors in HeLa cells.
J Biol Chem. 1997;272:23376-23381.
42. Mohn H, Le Cabec V, Fischer S, MaridonneauParini I. The src-family protein-tyrosine kinase
p59hck is located on the secretory granules in
human neutrophils and translocates towards the
phagosome during cell activation. Biochem J.
1995;309:657-665.
27. David M, Chen HE, Goelz S, Larner AC, Neel BG.
Differential regulation of the alpha/beta interferonstimulated Jak/Stat pathway by the SH2 domaincontaining tyrosine phosphatase SHPTP1. Mol
Cell Biol. 1995;15:7050-7058.
28. Keilhack H, Tenev T, Nyakatura E, et al. Phosphotyrosine 1173 mediates binding of the protein-tyrosine phosphatase SHP-1 to the epidermal growth factor receptor and attenuation of
receptor signaling. J Biol Chem. 1998;273:
24839-24846.
29. Cyster JG, Goodnow CC. Protein tyrosine phosphatase 1C negatively regulates antigen receptor
signaling in B lymphocytes and determines
thresholds for negative selection. Immunity. 1995;
2:13-24.
30. Ono M, Bolland S, Tempst P, Ravetch JV. Role of
the inositol phosphatase SHIP in negative regulation of the immune system by the receptor Fc(gamma)RIIB. Nature. 1996;383:263-266.
31. Ono M, Okada H, Bolland S, Yanagi S, Kurosaki
T, Ravetch JV. Deletion of SHIP or SHP-1 reveals
two distinct pathways for inhibitory signaling. Cell.
1997;90:293-301.
32. Sharlow ER, Pacifici R, Crouse J, Batac J,
Todokoro K, Wojchowski DM. Hematopoietic cell
phosphatase negatively regulates erythropoietininduced hemoglobinization in erythroleukemic
SKT6 cells. Blood. 1997;90:2175-2187.
33. Scharenberg AM, Lin S, Cuenod B, Yamamura H,
Kinet JP. Reconstitution of interactions between
tyrosine kinases and the high affinity IgE receptor
which are controlled by receptor clustering. Embo
J. 1995;14:3385-3394.
34. Kim JS, Peng X, De PK, Geahlen RL, Durden DL.
PTEN controls immunoreceptor (immunoreceptor
tyrosine-based activation motif) signaling and the
activation of Rac. Blood. 2002;99:694-697.
35. Park RK, Liu Y, Durden DL. A role for Shc, Grb2,
and Raf-1 in FcgammaRI signal relay. J Biol
Chem. 1996;271:13342-13348.
36. Park RK, Kyono WT, Liu Y, Durden DL. CBLGRB2 interaction in myeloid immunoreceptor tyrosine activation motif signaling. J Immunol.
1998;160:5018-5027.
37. Marcilla A, Rivero-Lezcano OM, Agarwal A, Robbins KC. Identification of the major tyrosine ki-
43. Chacko GW, Brandt JT, Coggeshall KM, Anderson CL. Phosphoinositide 3-kinase and p72syk
noncovalently associate with the low affinity
Fc gamma receptor on human platelets through
an immunoreceptor tyrosine-based activation motif. Reconstitution with synthetic phosphopeptides. J Biol Chem. 1996;271:10775-10781.
44. Ninomiya N, Hazeki K, Fukui Y, et al. Involvement of
phosphatidylinositol 3-kinase in Fc gamma receptor
signaling. J Biol Chem. 1994;269:22732-22737.
45. Araki N, Johnson MT, Swanson JA. A role for
phosphoinositide 3-kinase in the completion of
macropinocytosis and phagocytosis by macrophages. J Cell Biol. 1996;135:1249-1260.
46. Matsuo T, Hazeki K, Hazeki O, Katada T, Ui M. Specific association of phosphatidylinositol 3-kinase with
the protooncogene product Cbl in Fc gamma receptor signaling. FEBS Lett. 1996;382:11-14.
47. Tanaka S, Neff L, Baron R, Levy JB. Tyrosine phosphorylation and translocation of the c-cbl protein after
activation of tyrosine kinase signaling pathways.
J Biol Chem. 1995;270:14347-14351.
48. Ota Y, Samelson LE. The product of the protooncogene c-cbl: a negative regulator of the
Syk tyrosine kinase. Science. 1997;276:418420.
49. Sato N, Kim MK, Schreiber AD. Enhancement of
Fcgamma receptor-mediated phagocytosis by
transforming mutants of Cbl. J Immunol. 1999;
163:6123-6131.
50. Beitz LO, Fruman DA, Kurosaki T, Cantley LC,
Scharenberg AM. SYK is upstream of phosphoinositide 3-kinase in B cell receptor signaling.
J Biol Chem. 1999;274:32662-32666.
51. Brockdorff J, Williams S, Couture C, Mustelin T.
Dephosphorylation of ZAP-70 and inhibition of T
cell activation by activated SHP1. Eur J Immunol.
1999;29:2539-2550.
52. Chu J, Liu Y, Koretzky GA, Durden DL. SLP-76Cbl-Grb2-Shc interactions in FcgammaRI signaling. Blood. 1998;92:1697-1706.
53. Stahl N, Farruggella TJ, Boulton TG, Zhong Z,
Darnell JE Jr, Yancopoulos GD. Choice of STATs
and other substrates specified by modular tyrosine-based motifs in cytokine receptors. Science. 1995;267:1349-1353.
From www.bloodjournal.org by guest on July 8, 2017. For personal use only.
2002 100: 1852-1859
SHP-1 regulates Fcγ receptor −mediated phagocytosis and the activation of
RAC
Anita M. Kant, Pradip De, Xiaodong Peng, Taolin Yi, David J. Rawlings, Jong Suk Kim and Donald L.
Durden
Updated information and services can be found at:
http://www.bloodjournal.org/content/100/5/1852.full.html
Articles on similar topics can be found in the following Blood collections
Phagocytes (969 articles)
Signal Transduction (1930 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.