D3791.PDF

Rev. sci. tech. Off. int. Epiz., 2006, 25 (3), 1081-1095
Genetic characterisation of the Egyptian vaccinal
strain Abu-Hammad of bovine herpesvirus-1
A.A. El-Kholy (1) & K.A. Abdelrahman (2)
(1) Veterinary Serum and Vaccine Research Institute, Rinderpest-Like Diseases Research Department,
Abbasia, P.O. Box 131, Cairo, Egypt
(2) National Research Centre, Veterinary Medicine Division, Veterinary Medicine and Parasites Research
Department, Dokki, Giza, Egypt
Submitted for publication: 30 May 2006
Accepted for publication: 26 August 2006
Summary
The Egyptian Abu-Hammad vaccinal strain of bovine herpesvirus-1 (BHV-1) was
genetically characterised by comparing HindIII endonuclease genomic
fingerprints of the Egyptian BHV-1 with reference strain Cooper 1 of BHV-1
subtype 1 (BHV-1.1). Analyses of nucleotide (nt) and deduced amino acid (aa)
sequences and phylogeny of the major viral immunogen, glycoprotein D (gD),
were used to compare the Egyptian BHV-1 with related alphaherpesviruses.
HindIII restriction digests revealed close identity between the Egyptian BHV-1
and reference BHV-1.1. Both nt and aa sequence alignments revealed variable
degrees of sequence similarity with other alphaherpesviruses. Possible
mutational frameshifts were observed at nt 509 and 615 of the Egyptian BHV-1
gD. The Egyptian vaccinal BHV-1 was grouped with BHV-1.1 in a distinct branch
of the phylogenetic tree. Conservation of five cysteine residues and
glycosylation domains emphasised the importance of the amino terminus for
immunological and biological function of alphaherpesvirus gD. The most
divergent domain of 17 residues at positions 168-184 and an additional cysteine
residue at position 178 distinguish the Egyptian BHV-1 from other herpesviruses.
This work demonstrated that HindIII genomic fingerprinting and sequencing of
the gD gene are useful for genetic characterisation of BHV-1. They may also be
applied to epidemiological studies and development of BHV-1 vaccines.
Keywords
Alphaherpesviruses – Bovine herpesvirus – DNA sequence analysis – Egypt –
Glycoprotein gD – Phylogenetic analysis – Restriction endonuclease analysis –
Vaccine strain.
Introduction
– conjunctivitis
Bovine herpesvirus-1 (BHV-1), an important contagious
viral pathogen of domestic and wild Bovidae, is distributed
worldwide and has a significant economic impact on the
livestock industry in many countries. It is associated with
a broad spectrum of disease manifestations including:
– balanoposthitis
– severe respiratory
rhinotracheitis)
– vulvovaginitis
infection
(infectious
bovine
– shipping fever (pleuropneumonia)
– systemic infection (11, 34, 43).
In Egypt, attention has been drawn to BHV-1 since the
1960s as a significant cause of losses in feedlot and dairy
cattle, mainly due to deaths from pneumoenteritis in cattle
1082
and buffalo calves, and abortions (2, 3, 13, 20, 30). The
local Egyptian vaccinal strain of BHV-1, the Abu-Hammad
strain, was isolated during an outbreak in Sharqia (14).
Rev. sci. tech. Off. int. Epiz., 25 (3)
Materials and methods
Viruses and cells
BHV-1, an enveloped DNA virus, is a member of the genus
Varicellovirus of the sub-family Alphaherpesvirinae within
the family Herpesviridae (31). All herpesviruses share a
common overall genome structure, but differ in the fine
details of genome organisation, nucleotide (nt) sequence
and biological properties. The BHV-1 genome consists of a
linear double-stranded DNA molecule of about
136 kilobases (kb), which is subdivided into a unique long
segment (UL, 104 kb) and a short segment, containing a
unique short region (US, 10 kb) flanked by internal and
terminal inverted repeats (IRS & TRS, each one 11 kb long)
with alternative orientations of US relative to the fixed UL
(29). Based on restriction endonuclease analysis of BHV-1
genomic DNA, virus strains have been classified into
subtypes 1, 2a and 2b (22). BHV-1 subtype
1 (BHV-1.1) is associated with respiratory infections,
whereas BHV-1.2 is associated with genital infections in
cattle (43). Recently, this classification has been extended,
based on the individual fragment numbers or sizes
produced by each restriction endonuclease. There are two
main groups, consisting of fragments A to I and J to L, and
subtypes with numeric codes, for example the 1.1.I, 1.1.II,
1.1.III, and 1.2.Iva obtained using the HindIII
endonuclease. Although subtype 1 is probably more
virulent than subtype 2b, only one antigenic type of
BHV-1 has been recognised to date (44).
The Egyptian vaccinal BHV-1 Abu-Hammad strain (14)
and the reference Cooper 1 strain of BHV-1 (National
Veterinary Services Laboratory, Animal and Plant Health
Inspection Services, Ames, Iowa, United States of America
[USA]) were used in this study. Viral stocks were prepared
by infecting Madin Darby bovine kidney (MDBK) cells at a
multiplicity of infection of 0.1 (the ratio of input infectious
units to the number of cells available for infection) from
plaque-purified viruses, which were subsequently titrated
on MDBK cell cultures. The MDBK cells were grown and
maintained in minimum essential medium with Earle’s
salts supplemented with heat-inactivated 10% bovine calf
serum (BCS), 100 U/ml penicillin and 100 µg/ml
streptomycin.
Prior to experimental work, both MDBK cells and BCS
were attested to be free of BHV-1 by indirect
immunofluorescence. The viral identity of both the
Egyptian and reference strains of BHV-1 was proved by
their strong reactions with the appropriate Egyptian and
reference (Veterinary Laboratories Agency, Weybridge,
England) anti-BHV-1 polyclonal antibody, using indirect
immunofluorescence in MDBK cells (36).
Extraction of viral DNA
The BHV-1 nt sequence comprises at least ten genes with
the potential to encode glycoproteins, namely gB, gC, gD,
gE, gG, gH, gI, gK, gL and gM, that share important roles
in pathogenicity, virulence and replication in host cells.
Glycoprotein D (gD), a major viral immunogen, is essential
for virus replication and is responsible for inducing the
strongest immune response, reducing virus replication and
shedding by the host (34). The gD gene is well studied and
highly conserved among herpesviruses. It is located in the
US region between map units 0.892 and 0.902 of the BHV1 genome, encoding a 71 kilodalton (kda) glycoprotein of
417 amino acids (aa), containing both N- and O-linked
oligosaccharides (29, 33). These properties of gD make it
an excellent candidate for genetic characterisation of the
Egyptian vaccinal strain (Abu-Hammad) of BHV-1.
The key objective of the current study was to genetically
characterise the Egyptian vaccinal BHV-1 strain (AbuHammad) at the genomic level, by restriction
endonuclease fingerprinting of the whole viral genome,
and comparative sequence analysis of its major
immunogen, gD, versus its counterparts in the genomes of
related herpesviruses.
Viral DNA was extracted following the procedure
described by Vilcek et al. (39), with some modifications.
Briefly, a 25 ml aliquot of each crude virus in culture
supernatant from the BHV-1 (Abu-Hammad or Cooper 1)
infected MDBK cells was clarified by centrifugation at
6,000 rpm/4ºC for 20 min. The clarified virus samples
were then ultracentrifuged at 40,000 rpm/4ºC for 2 h, then
the supernatants were discarded. The virus pellets were
dissolved in 0.5 ml of 2% sodium dodecyl sulphate (SDS),
then mixed with 0.4 mg/ml proteinase K and incubated at
56ºC for 1 h with intermittent shaking. The mixture was
then extracted with an equal volume of
phenol:chloroform:isoamyl alcohol reagent (25:24:1,
vol/vol/vol, equilibrated to pH 8.0 with 10 mM Tris HCl).
DNA in the aqueous phase was precipitated with
2 volumes of cold absolute ethanol and 1/10 volume of
3M sodium acetate. The DNA was pelleted by
centrifugation at 14,000 rpm/4ºC for 30 min. The DNA
pellets were washed in cold 70% ethanol, re-precipitated
by centrifugation, dried, dissolved in 25 µl of nuclease-free
water and stored – 20ºC until used. The concentration and
purity of the BHV-1 genomic DNA were measured as
described previously (27).
1083
Rev. sci. tech. Off. int. Epiz., 25 (3)
Restriction endonuclease analysis
The restriction endonucleases HindIII and BamHI were
used to cleave the genomic DNA of both Egyptian AbuHammad and reference Cooper 1 strains of BHV-1,
following standard protocols (27). Electrophoretic patterns
of the resulting viral genomic DNA fragments were
analysed by 0.7% agarose gel electrophoresis as previously
described (27). The DNA bands were visualised using
ultraviolet transillumination after gel staining with
ethidium bromide (0.5 µg/ml).
Direct sequencing of polymerase
chain reaction amplicons
The PCR DNA amplicons of the Egyptian vaccinal AbuHammad strain of BHV-1 were purified using microcon
columns (Amicon, USA) and directly sequenced in both
directions with the same primers as those used to generate
the PCR amplicons. Sequencing was carried out in an ABI
PRISM system using the dideoxy chain-termination
method (28), which is based on the incorporation of
fluorescent-labelled dideoxynucleotide terminators. The
primer walking strategy was used and the identity of each
nt was verified at least twice.
Polymerase chain reaction assay
The oligonucleotide primers used in this study were
selected from highly conserved sequences encoding the gD
gene of the Cooper 1.1 strain of BHV-1 (GenBank
Accession No. NC_001847).
Sense
5’- GCGAACATGCAAGGGCCGACATTG -3’
Anti-sense 5’- CACGGCGTCGGGGGCCGCGGGCGT -3’
This primer set was used in the polymerase chain reaction
(PCR) assay to partially amplify the gD gene (a full-length
gene lacking only a fragment of approximately 0.2 kb
encoding the transmembrane anchor) of the BHV-1
genome. The PCR reaction was carried out in a total
volume of 50 µl containing: 1X PCR buffer (20 mM Tris
HCl pH 8.4 and 50 mM KCl); 1.5 mM MgCl2; 0.2 mM
deoxynucleotide triphosphate mixture (dATP, dCTP, dGTP
and dTTP); 100 pmol of each primer; 2.5 units (U)
Thermus aquaticus (Taq) polymerase; 0.1 µg of extracted
viral DNA and nuclease-free sterile double distilled water
up to 50 µl. The resulting mixture was subjected to a
precise thermal profile in a programmable thermocycler as
follows:
– one cycle: 96°C for 2 min
– 35 cycles: 96°C for 50 s – 58°C for 50 s – 72°C for
1 min
– one cycle: 72°C for 10 min.
Analysis of polymerase chain
reaction amplification products (amplicons)
The resulting PCR amplicons (10 µl to 15 µl) were
analysed by 1.5% agarose gel electrophoresis (27). The
DNA bands were visualised using ultraviolet
transillumination after gel staining with ethidium bromide
(0.5 µg/ml). PCR amplicons of the predicted size
(approximately 1.1 kb) were gel purified using a DNA gel
purification kit (ABgene, Germany) and quantified
according to standard procedures (27).
Computer-assisted sequence
and phylogenetic analyses
The resulting nt and deduced aa sequence data of the
selected region of the gD gene of the Egyptian vaccinal
Abu-Hammad strain of BHV-1 were compiled and
submitted to GenBank (Accession No. AY690484). These
sequence data were compared with those of related
alphaherpesviruses accessed via GenBank, including:
BHV-1.1 Cooper 1 (Accession No. NC_001847),
BHV-1.2 ST (Accession No. AY437088), BHV-5 (TX89;
Accession No. U14656), caprine herpesvirus-1
(CHV-1, E/CH; Accession No. AY437088), suid
herpesvirus-1 Kaplan (pseudorabies virus; Accession
No. AJ271966), human herpesvirus-1 KHS2 (HHV-1,
herpes simplex virus type 1; Accession No. AF487902),
and HHV-2 CAM4B (HHV-2, herpes simplex virus type 2;
Accession No. U12180). The nt sequences were aligned
using the Clustal W (1.82) program from the European
Bioinformatics Institute (a part of the European Molecular
Biology Laboratory). Clustal W is a fully automated
program for global multiple alignment of DNA and protein
sequences (http://www.ebi.ac.uk/services/ index.html).
Phylogenetic correlation and tree construction were carried
out using the PHYLIP and Treeview 32 (1.6.6) programs.
All software used in this study was accessed through the
appropriate interactive web services (http://www.
evolution.gs.washington.edu/phylip.html and http://www.
taxonomy.zoology.gla.ac.uk/ rod/rod.html).
Results
Restriction endonuclease analysis
(fingerprinting)
The electrophoretic profiles of BHV-1 genomic DNA
digested with restriction endonuclease HindIII revealed
identical DNA fingerprints for both the Egyptian (AbuHammad) and reference (Cooper 1) strains of BHV-1
1084
Rev. sci. tech. Off. int. Epiz., 25 (3)
kb
1
2
3
A
kb
1
2
3
4
B
12.2
11.1
10.1
C
12.2
D
EF
9.0
GH
I
8.0
J
7.0
K
5.0
L
4.0
M
2.0
1.6
1.0
1.1 kb
3.0
0.5
Lanes:
1: 1 kilobase (kb) DNA ladder (GIBCO-BRL)
2: Egyptian Abu-Hammad strain of bovine herpesvirus-1 (BHV-1) cut
with HindIII
3: Reference Cooper 1 strain of BHV-1.1 cut with HindIII
Lines indicate the BHV genomic DNA fragments from A to M
Fig. 1
Agarose gel electrophoresis of genomic viral DNA cut with
restriction endonucleases, separated on 0.7% agarose gel and
stained with ethidium bromide
(Fig. 1). However, no fingerprints could be obtained on
repeated cutting of genomic DNA of either BHV-1 strain
using BamHI (data not shown).
Analysis of polymerase chain reaction
amplification products (amplicons)
Agarose gel electrophoretic analysis of the PCR amplicons
indicated that the amplified DNA fragments encoding the
gD from the Egyptian (Abu-Hammad) and reference
(Cooper 1) strains of BHV-1 corresponded to the expected
size of about 1.1 kb. The amplified DNA bands were of the
same size for both BHV-1 strains (Fig. 2).
Sequence and phylogenetic analyses of the
bovine herpesvirus-1 glycoprotein D gene
Analysis of the nt sequence (Fig. 3) of PCR amplicons from
the Egyptian vaccinal strain Abu-Hammad of BHV-1
revealed a single open reading frame (ORF). This ORF was
1,083 nt long, starting from the first ATG at nt 7 and
Lanes:
1: 100 base pair (bp) DNA ladder (consists of repeats of 100 bp
fragment size, GIBCO-BRL)
2: PCR amplicons of the Egyptian Abu-Hammad strain of BHV-1
3: PCR amplicons of the reference Cooper 1 strain of BHV-1
4: Non-infected Madin Darby bovine kidney (MDBK) cell control
Amplicons are approximately 1,100 bp in size
Fig. 2
Agarose gel electrophoresis of the polymerase chain
reaction (PCR)-derived amplicons of the bovine
herpesvirus-1 (BHV-1) glycoprotein D gene, separated
on 1.5% agarose gel and stained with ethidium bromide
extending upstream to nt 1,089 in the sequence. A search
for homologous sequences revealed sequence similarity
between this ORF and the published gD gene of
alphaherpesviruses. Therefore, the sequenced gene
fragment of the Abu-Hammad strain was identified as a
BHV-1 gD gene. Since the location of the gD gene is
conserved throughout the sub-family (Alphaherpesvirinae),
there was no need to further locate consensus sequences of
other transcriptional regulatory elements, specifically the
endogenous promoter (TATA) box or polyadenylation
signal. The nucleotide composition of the ORF sequence
was calculated to be A 17.26%, T 13.13%, C 35.26% and
G 34.16%, with a G + C content of 69.42%.
Nucleotide sequence alignment of the Egyptian BHV-1 gD
and related alphaherpesviruses showed variable
percentages of homology (7% to 98%), as illustrated in
Table I. The highest gD sequence identity was recorded
with the reference Cooper 1 strain of BHV-1.1 (98%),
followed by the ST strain of BHV-1.2 (97%), the TX89
strain of BHV-5 (84%), the E/CH strain of CHV-1 (69%),
and the Kaplan strain of suid herpesviruses
1085
Rev. sci. tech. Off. int. Epiz., 25 (3)
-1-
Egyptian vaccinal bovine herpesvirus-1 BHV-1 (Abu-Hammad), reference BHV-1.1 (Cooper 1), BHV-1.2 (ST), BHV-5 (TX89), caprine herpesvirus (E/CH),
suid herpesvirus (Kaplan), human herpesvirus-1 (KHS2), and human herpesvirus-2 (CAM4B). Numbers on the sequence indicate nucleotide positions in
the glycoprotein D gene relative to the GenBank data for each virus. Stars indicate that nucleotides in that column are identical in all sequences in
the alignment
Fig. 3
Nucleotide sequence alignment of related alphaherpesvirus genomes
1086
Rev. sci. tech. Off. int. Epiz., 25 (3)
-2-
Fig. 3
Nucleotide sequence alignment of related alphaherpesvirus genomes (contd)
1087
Rev. sci. tech. Off. int. Epiz., 25 (3)
-3-
Fig. 3
Nucleotide sequence alignment of related alphaherpesvirus genomes (contd)
1088
Rev. sci. tech. Off. int. Epiz., 25 (3)
-4-
Fig. 3
Nucleotide sequence alignment of related alphaherpesvirus genomes (contd)
Table I
Score table of multiple nucleotide sequence alignment of the
Egyptian vaccinal bovine herpesvirus-1 Abu-Hammad strain
(1,089 nucleotides) versus related alphaherpesviruses using the
CLUSTAL W (1.82) program
Alphaherpesvirus
Length
Sequence homology
(nucleotides)
percent
BHV-1.1 Cooper 1 strain
1,254
98
BHV-1.2 ST strain
1,254
97
BHV-5 TX89 strain
1,254
84
CHV-1 E/CH strain
1,230
69
Suid HV-1 (pseudorabies virus) Kaplan strain 1,203
59
HHV-1 (herpes simplex 1) KHS2 strain
1,125
7
HHV-2 (herpes simplex 2) CAM4B strain
1,274
16
(bovine pseudorabies virus, 59%). In contrast, HHV-1 and
HHV-2 scored extreme gD sequence divergences of 7% and
16%, respectively, from the Egyptian BHV-1 gD (Table I,
Figs 3 and 4). Comparison of the Egyptian BHV-1 gD
sequence with those of other alphaherpesviruses showed
single or triplet mismatches or substitutions, mainly at nt
476, 509, 557, 567-569, 588, 598 and 615 (Fig. 3). The
phylogenetic analysis of aligned gD sequences of these
alphaherpesviruses (Fig. 4) revealed close ancestral genetic
relationships.
Amino acid sequence analysis
and comparison of the Egyptian bovine
herpesvirus-1 glycoprotein D
The deduced aa sequence of the BHV-1 gD of the AbuHammad strain was compared with those of related
glycoproteins of reference BHV-1.1 Cooper 1 (12),
BHV-1.2 ST (18), BHV-5 TX89 (1), CHV-1 E/CH (16), suid
HV-1 Kaplan (4), HHV-1 KHS2 (17), and HHV-2 CAM4B
(40). As shown in Table II and Figure 5, the reference
Cooper 1 strain of BHV-1.1 scored the highest gD sequence
identity (90%) with the Egyptian BHV-1 gD, followed by
BHV-1.2 (88%), BHV-5 (73%), CHV-1 (51%) and suid HV1 (27%). Little gD aa sequence identity could be recorded
with the gD of either HHV-1 or HHV-2 (Table II, Fig. 5).
All cysteine residues but one in the gD sequence of the
Egyptian BHV-1 were conserved without deletions or
substitution at residue position 75, 114, 126, 135 and 215.
Only one cysteine residue (at position 178) of the Egyptian
BHV-1 gD had no match in all other gD sequences in the
current alignment (Fig. 5). In particular, the amino (N-)
terminus, including the N-linked glycosylation domains at
positions 40-42 and 102-104, was highly conserved in the
gD of BHV-1 Abu-Hammad, BHV-1 Cooper 1, BHV-1.2 ST,
CHV-1 E/CH and BHV-5 TX89 (Fig. 5). The major aa
mismatches or substitutions in the Egyptian BHV-1 gD
sequence were observed in aa residues at positions
157, 158, 160-164, 168-184, 188, 195, 196 and 198-202
(Fig. 5). The most divergent domain was at
Rev. sci. tech. Off. int. Epiz., 25 (3)
1089
Reference BHV-1.1 (Cooper 1), BHV-5 (TX89), caprine herpesvirus (E/CH), suid herpesvirus (Kaplan strain of pseudorabies virus), human herpesvirus-1
(KHS2 strain of herpes simplex type 1), and human herpesvirus-2 (CAM4B strain of herpes simplex type 2). Numbers on the sequence indicate
positions of amino acids in the glycoprotein D protein relative to the GenBank data for each virus. Dots mean that conserved (:) or semi-conserved (.)
substitutions are observed, whereas stars (*) indicate that amino acid residues in that column are identical in all aligned sequences
Fig. 4
Deduced amino acid sequence alignment of the Egyptian vaccinal bovine herpesvirus-1 (BHV-1) (Abu-Hammad) strain versus other
related alphaherpesviruses
1090
Rev. sci. tech. Off. int. Epiz., 25 (3)
Table II
Score table for the deduced amino acid sequence identity of the
Egyptian vaccinal bovine herpesvirus-1 Abu-Hammad strain (361
amino acids) versus related alphaherpesviruses using the
CLUSTAL W (1.82) program
Alphaherpesvirus
Length
Sequence homology
(amino acid)
percent
BHV-1.1 Cooper 1 strain
417
90
BHV-1.2 ST strain
417
88
BHV-5 TX89 strain
417
73
CHV-1 E/CH strain
407
51
Suid HV-1 (pseudorabies virus) Kaplan strain 400
27
HHV-1 (herpes simplex 1) KHS2 strain
394
17
HHV-2 (herpes simplex 2) CAM4B strain
393
14
BHV-1.2 ST
BHV-1 Abu-Hammad
BHV-1.1 Cooperl
BHV-5 TX89
CHV-1 E/CH
Suid HV-1 Kaplan
HHV-1 KHS2
HHV-2 CAM4B
BHV-1.1 (Cooper 1), BHV-1.2 (ST), BHV-5 (TX89), caprine herpesvirus
(E/CH), suid herpesvirus (Kaplan strain of pseudorabies virus), human
herpesvirus-1 (KHS2 strain of herpes simplex type 1), and human
herpesvirus-2 (CAM4B strain of herpes simplex type 2), generated from
nucleotide sequences encoding for glycoprotein D of the analysed viral
genomes. The sequences were first aligned using the Clustal W (1.82)
programme and the phylogenetic analyses were performed using the
PHYLIP package
Fig. 5
Phylogenetic tree of the Egyptian vaccinal bovine herpesvirus-1
(BHV-1) (Abu-Hammad) strain and related alphaherpesviruses
segment 168-184 in the Egyptian gD consensus aa
sequence; this region might be relevant to the gD
specificity of each alphaherpesvirus. However, the
resulting translation contains a possible frameshift at nt
508 and 614 compared with other BHV gD genes.
Frequent mutations within the coding region may result in
frameshifts or premature stop codons.
Discussion
Herpesviruses are a major cause of pneumoenteritis,
abortion and death among livestock, especially cattle and
buffalo calves (2, 11, 30, 33, 43). The study of the
molecular virology of ruminant herpesviruses has recently
made considerable progress in terms of genomic sequence
analyses, laying a good foundation for further studies of
BHV-1 and related viruses (29).
This report describes the genetic characterisation of the
Egyptian vaccinal strain Abu-Hammad of BHV-1, based on
the application of two main approaches. The first utilised
comparison of the genomic fingerprints of the Egyptian
BHV-1 with that of reference strain Cooper 1 of BHV-1.1.
The second approach relied on analysis of the nt
sequences, deduced aa sequences and phylogeny of the
major viral immunogen, gD, of the Egyptian BHV-1 and
related herpesviruses. This was carried out to compare the
genetic type of the Egyptian vaccinal strain with other
reference and vaccinal strains of BHV-1 and reveal
potential targets for BHV-1 diagnosis, development of
new vaccines, epidemiological studies and improved
control programmes.
Genomic fingerprinting, based on the sizes and
electrophoretic patterns of the viral DNA fragments (A to
M) observed after HindIII endonuclease cleavage revealed
close identity between the Abu-Hammad BHV-1 and the
reference Cooper 1 BHV-1.1. The size and pattern of
HindIII fragments K and L in both strains were
characteristic of BHV-1.1 viral genomes (21, 22, 44). It has
been reported that the endonuclease HindIII is the enzyme
of choice to most clearly reflect differences among BHV-1
strains or isolates (22). According to the results of the
current study, the Egyptian vaccinal BHV-1 Abu-Hammad
strain fits clearly into the BHV-1.1 group.
The Egyptian BHV-1 gD gene content exhibited similar
GC-rich content to the gD-like glycoproteins of other
alphaherpesviruses (1, 4, 16, 25, 33, 40). In spite of high
gD nt sequence identity (98%) between BHV-1 AbuHammad and reference BHV-1.1 Cooper 1, a lower
deduced aa homology (90%) was observed. Similarly,
lower aa homology percentages were recorded between the
Egyptian BHV-1 gD and the other alphaherpesviruses
studied, compared with the observed nt sequence
Rev. sci. tech. Off. int. Epiz., 25 (3)
homology. This could be attributed to the occurrence of a
possible mutational frameshift at nt 509 and 615, which
was biased toward the carboxy-terminus of BHV-1 gD. Like
BHV-1, the other herpesviruses selected for comparison in
this
study
are
all
neurotropic
mammalian
alphaherpesviruses (31). For example, BHV-5 is the
causative agent of a fatal meningo-encephalitis in calves
and is closely related to BHV-1 (41).
Both nt and deduced aa sequence alignments revealed
variable degrees of sequence homology with the Egyptian
BHV-1 gD: homology was high with BHV-1.1 Cooper 1
and BHV-1.2, moderate with BHV-5, low with CHV-1 and
suid HV-1 (pseudorabies virus), and very low with HHV-1
and HHV-2. It has been established that the BHV-1 gD
gene is located in the US region of the viral genome
between map units 0.892 and 0.902 (33), which is
approximately collinear with the gD-like glycoproteins of
other alphaherpesviruses (1, 4, 16, 25), but inverted
relative to the genomic map locations of HHV-1 gD and
HHV-2 gD (40).
The first five cysteine residues were conserved among the
gD (aa) sequences in this study. It has been suggested that
these residues may be disulphide bonded, and they are
possibly important in maintaining the proper
conformational structure and function of alphaherpesvirus
gD. Nevertheless, occurrence of these conserved cysteine
residues and glycosylation domains (particularly in BHV-5)
in the highly conserved amino- (N-) terminal half of gD
emphasises the importance of the N-terminus for the
immunological and biological function of gD. These results
are in accordance with earlier studies (1, 33). The presence
of the most divergent domain of 17 aa residues at positions
168-184 and the additional cysteine residue at position
178 could be used as a tool to distinguish the Egyptian
BHV-1 Abu-Hammad strain from related herpesviruses.
The gD nt and deduced aa sequence data enabled
phylogenetic characterisation of the Egyptian BHV-1 AbuHammad strain and correlated with the results of genomic
fingerprinting after restriction endonuclease cleavage.
Phylogenetic trees based on either gD nt sequences or
deduced aa sequences were similar. Three major branches
were apparent in the constructed trees, revealing a range of
genetic
differences
among
alphaherpesviruses.
Importantly, the Egyptian Abu-Hammad and reference
BHV-1.1 Cooper 1 strains represented two close lineages
1091
lying in the same branch of the phylogenetic tree,
suggesting a unique antigenic subtype, BHV-1.1, for both
strains. Phylogenetic reconstruction of herpesvirus
evolution is generally founded on aa sequence
comparisons of specific proteins (15). It has been
established that nt substitution, insertion, deletion or
duplication events are manifested in aa sequences as
differences in branch lengths or absence of branches in the
phylogenetic tree, proportional to the genetic change (8).
The results obtained in this study correlate with the
reported antigenic differences among alphaherpesviruses,
particularly in viral glycoproteins gB, gC, gD and gH (6, 9,
15, 19, 23, 24, 33, 41). Moreover, these results agree with
recent reports regarding the importance of gD gene-based
molecular assays for pathogenetic and epidemiological
studies of BHV-1 infections (5, 10, 26, 33, 37, 39, 42, 44).
Similar positive reactions with the local and reference antiBHV-1 polyclonal antiserum in the virus neutralistion test
indicated high antigenic identity between the Egyptian
(Abu-Hammad) and reference (Cooper 1) strains of BHV1. In spite of the considerable degree of sequence
conservation among antigenically related ruminant
alphaherpesviruses (7, 31, 35), some herpesviruses react
poorly with antibodies raised against antigenically
heterologous viral strains (31, 38). Several microbial
genome sequences have been published that indicate the
value of comparisons at the genomic level for studies of
pathogenesis, host range and cross-immunity among
related pathogens (32, 38).
In conclusion, the findings of the current study showed
that genomic fingerprinting, based on endonuclease
HindIII cleavage, and direct sequencing of gD gene-derived
PCR amplicons were relevant tools for genetic
characterisation of BHV-1 strains. Phylogenetic analyses
indicated that the Egyptian vaccinal strain (Abu-Hammad)
was grouped as a BHV-1.1 in a distinct branch within the
phylogenetic tree, together with the reference (Cooper 1)
strain of BHV-1.1. The comparative genetic analyses
conducted in this study were useful not only to trace
conservation of the Egyptian BHV-1 among related
alphaherpesviruses but also to establish genetic tools for
nationwide epidemiological studies. It is highly
recommended to use locally isolated viruses for vaccine
preparation, to prevent viruses escaping neutralisation by
antibody raised against heterologous variants, and thus to
obtain efficient BHV-1 vaccines.
1092
Rev. sci. tech. Off. int. Epiz., 25 (3)
Caractérisation génétique de la souche vaccinale
égyptienne Abu-Hammad de l’herpèsvirus bovin 1
A.A. El-Kholy & K.A. Abdelrahman
Résumé
Les auteurs décrivent la caractérisation génétique de la souche vaccinale AbuHammad de l’herpèsvirus bovin 1 (BHV-1), réalisée en comparant les empreintes
génétiques obtenues par digestion avec l’endonucléase HindIII du BHV-1
égyptien, d’une part, et de la souche de référence Cooper 1 du BHV-1 sous-type
1 (BHV-1.1), d’autre part. L’analyse des nucléotides et des séquences d’acides
aminés qui en résultent, ainsi que de la phylogenèse du principal immunogène
viral, la gycoprotéine D, a ensuite permis de comparer la souche égyptienne
avec d’autres alpha-herpèsvirus. La digestion par l’enzyme de restriction HindIII
a révélé un lien de parenté étroit entre la souche BHV-1 égyptienne et la souche
de référence BHV-1.1. L’alignement des séquences de nucléotides et d’acides
aminés a révélé une certaine parenté, à des degrés divers, avec d’autres alphaherpèsvirus. Un décalage du cadre de lecture a été constaté sur les nucléotides
509 et 615 de la glycoprotéine D de la souche égyptienne BHV-1. La souche
vaccinale égyptienne BHV-1 a été classée avec la souche BHV-1.1 sur une
branche distincte de l’arbre phylogénétique. La persistance de cinq résidus de
cystéine et domaines de glycosylation met en relief l’importance des acides
aminés en position terminale pour les fonctions immunologiques et biologiques
de la glycoprotéine D des alpha-herpèsvirus. Le domaine extrêmement divergent
de 17 résidus en position 168 et 184 et la présence d’un résidu supplémentaire de
cystéine en position 178 permettent de distinguer la souche égyptienne BHV-1
des autres herpèsvirus. Cette recherche démontre que le marquage génomique
au moyen de HindIII et le séquençage du gène de la glycoprotéine D sont des
techniques utiles pour la caractérisation génique du BHV-1, pouvant également
s’appliquer aux études épidémiologiques et à la mise au point de vaccins contre
le BHV-1.
Mots-clés
Alpha-herpèsvirus – Analyse par restriction de l’endonucléase – Analyse par séquençage
de l’ADN – Égypte – Herpèsvirus bovin – Souche vaccinale.
Caracterización genética de la cepa de vacuna
egipcia Abu-Hammad del herpesvirus bovino 1
A.A. El-Kholy & K.A. Abdelrahman
Resumen
Los autores describen la caracterización genética de la cepa de vacuna egipcia
Abu-Hammad del herpesvirus bovino 1 (BHV-1). Para ello se compararon entre sí
las huellas genéticas obtenidas por digestión con la endonucleasa HindIII del
genoma del BHV-1 egipcio, por un lado, y de la cepa de referencia Cooper 1 del
subtipo 1 del herpesvirus bovino 1 (BHV-1.1), por el otro. Después, utilizando el
análisis de nucleótidos, así como las secuencias aminoacídicas y la filogenia del
principal inmunógeno del virus, la glicoproteína D (gD), deducidas a partir de ahí,
1093
Rev. sci. tech. Off. int. Epiz., 25 (3)
se comparó el BHV-1 egipcio con otros alfa-herpesvirus afines. La digestión con
HindIII puso de manifiesto un estrecho parentesco entre el BHV-1 y la cepa de
referencia BHV-1.1. La yuxtaposición de las secuencias de nucleótidos y de
aminoácidos reveló diversos grados de semejanza con las secuencias de otros
alfa-herpesvirus. En los nucleótidos 509 y 615 de la glicoproteína del BHV-1
egipcio se observaron posibles desfases del marco de lectura. La cepa de
vacuna egipcia fue clasificada, junto con el BHV-1.1, en una rama independiente
del árbol filogenético. La conservación de cinco residuos de cisteína y regiones
de glicosilación ponía de relieve la importancia del extremo amino-terminal para
la función inmunológica y biológica de la gD de los alfa-herpesvirus. La región
extremadamente divergente de 17 residuos en las posiciones 168 a 184, así como
un residuo adicional de cisteína en la posición 178, son los rasgos que distinguen
al BHV-1 egipcio de otros herpesvirus. El trabajo de los autores demostró que la
obtención de la huella genómica con HindIII y la secuenciación del gen de la
glicoproteína D son procedimientos útiles para la caracterización genética del
BHV-1, procedimientos que también pueden aplicarse a estudios
epidemiológicos y a la fabricación de vacunas contra el BHV-1.
Palabras clave
Alfa-herpesvirus – Análisis de la secuencia de ADN – Análisis por endonucleasas de
restricción – Cepa de vacuna – Egipto – Herpesvirus bovino.
References
1. Abdelmagid O.Y., Minocha H.C., Collins J.K. &
Chowdhury S.I. (1995). – Fine mapping of bovine
herpesvirus-1 (BHV-1) glycoprotein D (gD) neutralizing
epitopes by type-specific monoclonal antibodies and
sequence comparison with BHV-5 gD. Virology,
206 (1), 242-253.
2. Aly N.M., Shehab G.G. & Abd El-Rahim I.H.A. (2003). –
Bovine viral diarrhoea, bovine herpesvirus and parainfluenza3 virus infection in three cattle herds in Egypt in 2000.
Rev. sci. tech. Off. int. Epiz., 22 (3), 879-892.
3. Baz T., Taha M.M., Zahran M., Monira H. & El-Dobeigy A.I.
(1982). – Respiratory viral newborn calf diseases in Egypt:
I- studies on the role of IBR infection. Egypt. J. agricult. Res.,
60 (7), 105-122.
4. Brack A.R., Klupp B.G., Granzow H., Tirabassi R., Enquist
L.W. & Mettenleiter T.C. (2000). – Role of the cytoplasmic
tail of pseudorabies virus glycoprotein E in virion formation.
J. Virol., 74 (9), 4004-4016.
5. Collins J.K., Butcher A.C. & Riegel C.A. (1985). – Immune
response to bovine herpesvirus type 1 infections: virusspecific antibodies in sera from infected animals. J. clin.
Microbiol., 21, 546-552.
6. Collins J.K., Ayers V.K., Whetstone C.A. &
van Drunen Littel-van den Hurk S. (1993). – Antigenic
differences between the major glycoproteins of bovine
herpesvirus type 1.1 and bovine encephalitis herpesvirus type
1.3. J. gen. Virol., 74, 1509-1517.
7. Engels M., Loepfe E., Wild P., Schraner E. & Wyler R. (1987).
– The genome of caprine herpesvirus 1: genome structure and
relatedness to bovine herpesvirus 1. J. gen. Virol.,
68, 2019-2023.
8. Felsenstein J. (2001). – Taking variation of evolutionary rates
between sites into account in inferring phylogenies. J. molec.
Evol., 53, 447-455.
9. Friedli K. & Metzler A.E. (1987). – Reactivity of monoclonal
antibodies to proteins of a neurotropic bovine herpesvirus 1
(BHV-1) strain and to proteins of representative
BHV-1 strains. Arch. Virol., 94, 109-122.
10. Fuchs M., Hubert P., Detterer J. & Rziha H.-J. (1999). –
Detection of bovine herpesvirus type 1 in blood
from naturally infected cattle by using a sensitive
PCR that discriminates between wild-type virus
and virus lacking glycoprotein E. J. clin. Microbiol.,
37, 2498-2507.
1094
Rev. sci. tech. Off. int. Epiz., 25 (3)
11. Gibbs E.P.J. & Rweyemamu M.M. (1977). – Bovine
herpesviruses. I. Bovine herpesvirus-1. Vet. Bull., 47, 317343.
24. Meyer G., Bare O. & Thiry E. (1999). – Identification and
characterization of bovine herpesvirus type 5 glycoprotein H
gene and gene products. J. gen. Virol., 80, 2849-2859.
12. Goltz M., Buhk H.J., Broll H., Lewin M., Mankertz A.,
Boerner B., Borchers K. & Weigelt W. (2006). – Nucleotide
sequence of the HindIII O and K fragments located in the US
region of the bovine herpesvirus 1 genome. Unpublished
GenBank accession number: NC_001847.
25. Petrovskis E.A., Meyer A.L. & Post L.E. (1988). – Reduced
yield of infectious pseudorabies and herpes simplex virus
from cell lines producing viral glycoprotein gp50. J. Virol.,
62, 2196-2199.
13. Hafez S.M. & Frey H.Y. (1973). – Serological evidence of
bovine viral diarrhea-mucosal disease and infectious bovine
rhinotracheitis in Egypt. Bull. epiz. Dis. Afr., 21, 5-10.
14. Hafez S.M., Thanna I. Baz, Mohsen A.Y. & Monira H. (1976).
– Infectious bovine rhinotracheitis in Egypt: isolation and
serological identification of the virus. J. Egypt. vet. med. Assoc.,
36 (1), 129-139.
15. Karlin S., Mocarski E.S. & Schachtel G.A. (1994). –
Molecular evolution of herpesviruses: genomic and protein
sequence comparisons. J. Virol., 68 (3), 1886-1902.
16. Keuser V., Detry B., Thiry J., Fays K., Schynts F.,
Pastoret P.-P., Vanderplasschen A. & Thiry E. (2006). –
Characterization of caprine herpesvirus 1 glycoprotein D
gene and its translation product. Virus Res., 115 (2), 112-121.
17. Kim J.K., Kim Y.K., Hong J.B., Kim S.Y. & Ahn J.K. (2002). –
Isolation of the enhanced neurovirulent HSV-1 strains from
Korean patients. Unpublished GenBank accession number:
AF487902.
18. Leung-Tack P., Audonnet J.C. & Riviere M. (1994). – The
complete DNA sequence and the genetic organization of the
short unique region (US) of the bovine herpesvirus
type 1 (ST strain). Virology, 199 (2), 409-421.
26. Rocha M.A., Barbosa E.F., Guimaraes S.E.F., Dias Neto E. &
Gouveia A.M.G. (1998). – A high sensitivity-nested PCR
assay for BHV-1 detection in semen of naturally infected
cattle. Vet. Microbiol., 63, 1-11.
27. Sambrook J. & Russell D.W. (2000). – Molecular cloning: a
laboratory manual. Cold Spring Harbour Laboratory Press,
Plainview, New York.
28. Sanger F., Nicklen S. & Coulson A.R. (1977). – DNA
sequencing with chain-terminating inhibitors. Proc. natl Acad.
Sci. USA, 74 (12), 5463-5467.
29. Schwyzer M. & Ackermann M. (1996). – Molecular virology
of ruminant herpesviruses. Vet. Microbiol., 53, 17-29.
30. Shehab G.J., Rawhia M.A.O., Hosny J.A. & Nawal M.A.
(1996). – An outbreak of pneumoenteritis in calves caused by
IBR and rotaviruses in Egypt: virological and
immunopathological aspects. Egypt. J. comp. Pathol. clin.
Pathol., 9 (2), 15-37.
31. Studdert M.J. (1999). – Bovine herpesvirus (Herpesviridae).
In Encyclopedia of virology, 2nd Ed. (A. Granoff &
R. Webster, eds). Academic Press, London, 183-184.
32. Thomson N., Sebaihia M., Ana C.-T., Bentley S., Lisa C. &
Julian P. (2003). – Genome watch: the value of comparison.
Nature Rev. Microbiol., 1, 11-12.
19. Lyaku J.R.S., Nettleton P.F. & Marsden H. (1992). – A
comparison of serological relationships among five ruminant
alphaherpesviruses by ELISA. Arch. Virol., 124, 333-341.
33. Tikoo S.K., Fitzpatrick D., Babiuk L.A. & Zamb T.J. (1990).
– Molecular cloning, sequencing and expression of functional
bovine herpesvirus-1 glycoprotein gIV in transfected bovine
cells. J. Virol., 64, 5132-5142.
20. Madbouly H.M. & Hussein M.M. (1997). – Isolation of BHV1 from a dairy herd showing genital form of infection.
Alex. J. vet. Sci., 13 (4), 439-446.
34. Tikoo S.K., Campos M. & Babiuk L.A. (1995). – Bovine
herpesvirus 1 (BHV-1): biology, pathogenesis, and control.
Adv. Virus Res., 45, 191-223.
21. Mayfield J.E., Good P.J., VanOort H.J., Campbell A.R. &
Reed D.E. (1983). – Cloning and cleavage site mapping of
DNA from bovine herpesvirus 1 (Cooper strain). J. Virol.,
47, 259-264.
22. Metzler A.E., Matile H., Gassmann U., Engels M. & Wyler R.
(1985). – European isolates of bovine herpesvirus 1:
a comparison of restriction endonuclease sites, polypeptides,
and reactivity with monoclonal antibodies. Arch. Virol.,
85, 57-69.
23. Metzler A.E., Schudel A.A. & Engels M. (1986). – Bovine
herpesvirus 1: molecular and antigenic characteristics
of variants isolated from calves with neurological disease.
Arch. Virol., 87, 205-217.
35. Vanderplaschen A., Bublot M., Pastoret P.-P. & Thiry E.
(1993). – Restriction maps of the DNA of cervid herpesvirus
1 and cervid herpesvirus 2, two viruses related to bovine
herpesvirus 1. Arch. Virol., 128, 379-388.
36. Van Donkersgoed J. & Babiuk L. (1991). – Diagnosis and
managing the respiratory form of infectious bovine
rhinotracheitis. Vet. Med., 1, 86-94.
37. Van Drunen Littel-van den Hurk S. & Babiuk L.A. (1986). –
Synthesis and processing of bovine herpesvirus
1 glycoproteins. J. Virol., 59 (2), 401-410.
38. Van Oirschot J.T. (1999). – Bovine viral vaccines, diagnostics,
and eradication. In Veterinary vaccines and diagnostics
(R.O. Schultz, ed.). Academic Press, London, 197-213.
Rev. sci. tech. Off. int. Epiz., 25 (3)
39. Vilcek S., Nettleton J.A., Herring J.A. & Herring A.J. (1994).
– Rapid detection of bovine herpesvirus 1 (BHV-1) using the
polymerase chain reaction. Vet. Microbiol., 42, 53-64.
40. Watson R.J. (1983). – DNA sequence of the Herpes simplex
virus type 2 glycoprotein D gene. Gene, 26 (2-3), 307-312.
41. Whitbeck J.C., Bello L.J. & Lawrence W.C. (1999). –
Comparison of the bovine herpesvirus 1 gI gene and the
herpes simplex virus type 1 gB gene. J. Virol.,
62 (9), 3319-3327.
42. Wiedmann M., Brandon R., Wanger P., Dubovi E.J. &
Batt C.A. (1993). – Detection of BHV-1 in bovine semen by a
nested PCR assay. J. virol. Meth., 44, 129-140.
1095
43. Wyler R., Engels M. & Schwyzer M. (1989). – Infectious
bovine rhinotracheitis/vulvovaginitis (BHV-1). In Herpesvirus
diseases of cattle, horses, and pigs (G. Witman, ed.). Kluwer
Academic Publishers, Boston, 1-72.
44. Wyss S., Engels M., Bruckner L., Regli W. & Ackermann M.
(2000). – Molecular epidemiological study with bovine
herpesvirus 1 isolates. In Proceedings of the 5th International
Congress of Veterinary Virology, 27-30 August 2000, The
European Society of Veterinary Virology (ESVV), Brescia,
Italy, 85-86.