D3791.PDF

Rev. sci. tech. Off. int. Epiz. , 2006, 25 (3), 1081-1095
Genetic characterisation of the Egyptian vaccinal
strain Abu-Hammad of bovine herpesvirus-1
A.A. El-Kholy (1) & K.A. Abdelrahman (2)
(1) Veterinary Serum and Vaccine Research Institute, Rinderpest-Like Diseases Research Department,
Abbasia, P.O. Box 131, Cairo, Egypt
(2) National Research Centre, Veterinary Medicine Division, Veterinary Medicine and Parasites Research
Department, Dokki, Giza, Egypt
Submitted for publication: 30 May 2006
Accepted for publication: 26 August 2006
Summary
The Egyptian Abu-Hammad vaccinal strain of bovine herpesvirus-1 (BHV-1) was
genetically characterised by comparing
Hind III endonuclease genomic
fingerprints of the Egyptian BHV-1 with reference strain Cooper 1 of BHV-1
subtype 1 (BHV-1.1). Analyses of nucleotide (nt) and deduced amino acid (aa)
sequences and phylogeny of the major viral immunogen, glycoprotein D (gD),
were used to compare the Egyptian BHV-1 with related alphaherpesviruses.
Hind III restriction digests revealed close identity between the Egyptian BHV-1
and reference BHV-1.1. Both nt and aa sequence alignments revealed variable
degrees of sequence similarity with other alphaherpesviruses. Possible
mutational frameshifts were observed at nt 509 and 615 of the Egyptian BHV-1
gD. The Egyptian vaccinal BHV-1 was grouped with BHV-1.1 in a distinct branch
of the phylogenetic tree. Conservation of five cysteine residues and
glycosylation domains emphasised the importance of the amino terminus for
immunological and biological function of alphaherpesvirus gD. The most
divergent domain of 17 residues at positions 168-184 and an additional cysteine
residue at position 178 distinguish the Egyptian BHV-1 from other herpesviruses.
This work demonstrated that
Hind III genomic fingerprinting and sequencing of
the gD gene are useful for genetic characterisation of BHV-1. They may also be
applied to epidemiological studies and development of BHV-1 vaccines.
Keywords
Alphaherpesviruses – Bovine herpesvirus – DNA sequence analysis – Egypt –
Glycoprotein gD – Phylogenetic analysis – Restriction endonuclease analysis –
Vaccine strain.
Introduction
Bovine herpesvirus-1 (BHV-1), an important contagious
viral pathogen of domestic and wild Bovidae, is distributed
worldwide and has a significant economic impact on the
livestock industry in many countries. It is associated with
a broad spectrum of disease manifestations including:
– severe respiratory infection (infectious bovine
rhinotracheitis)
– conjunctivitis
– vulvovaginitis
– balanoposthitis
– shipping fever (pleuropneumonia)
– systemic infection (11, 34, 43).
In Egypt, attention has been drawn to BHV-1 since the
1960s as a significant cause of losses in feedlot and dairy
cattle, mainly due to deaths from pneumoenteritis in cattle

and buffalo calves, and abortions (2, 3, 13, 20, 30). The
local Egyptian vaccinal strain of BHV-1, the Abu-Hammad
strain, was isolated during an outbreak in Sharqia (14).
BHV-1, an enveloped DNA virus, is a member of the genus
Varicellovirus of the sub-family Alphaherpesvirinae within
the family Herpesviridae (31). All herpesviruses share a
common overall genome structure, but differ in the fine
details of genome organisation, nucleotide (nt) sequence
and biological properties. The BHV-1 genome consists of a
linear double-stranded DNA molecule of about
136 kilobases (kb), which is subdivided into a unique long
segment (UL, 104 kb) and a short segment, containing a
unique short region (US, 10 kb) flanked by internal and
terminal inverted repeats (IRS& TRS, each one 11 kb long)
with alternative orientations of USrelative to the fixed UL
(29). Based on restriction endonuclease analysis of BHV-1
genomic DNA, virus strains have been classified into
subtypes 1, 2a and 2b (22). BHV-1 subtype
1 (BHV-1.1) is associated with respiratory infections,
whereas BHV-1.2 is associated with genital infections in
cattle (43). Recently, this classification has been extended,
based on the individual fragment numbers or sizes
produced by each restriction endonuclease. There are two
main groups, consisting of fragments A to I and J to L, and
subtypes with numeric codes, for example the 1.1.I, 1.1.II,
1.1.III, and 1.2.Iva obtained using the HindIII
endonuclease. Although subtype 1 is probably more
virulent than subtype 2b, only one antigenic type of
BHV-1 has been recognised to date (44).
The BHV-1 nt sequence comprises at least ten genes with
the potential to encode glycoproteins, namely gB, gC, gD,
gE, gG, gH, gI, gK, gL and gM, that share important roles
in pathogenicity, virulence and replication in host cells.
Glycoprotein D (gD), a major viral immunogen, is essential
for virus replication and is responsible for inducing the
strongest immune response, reducing virus replication and
shedding by the host (34). The gD gene is well studied and
highly conserved among herpesviruses. It is located in the
USregion between map units 0.892 and 0.902 of the BHV-
1 genome, encoding a 71 kilodalton (kda) glycoprotein of
417 amino acids (aa), containing both N- and O-linked
oligosaccharides (29, 33). These properties of gD make it
an excellent candidate for genetic characterisation of the
Egyptian vaccinal strain (Abu-Hammad) of BHV-1.
The key objective of the current study was to genetically
characterise the Egyptian vaccinal BHV-1 strain (Abu-
Hammad) at the genomic level, by restriction
endonuclease fingerprinting of the whole viral genome,
and comparative sequence analysis of its major
immunogen, gD, versus its counterparts in the genomes of
related herpesviruses.
Materials and methods
Viruses and cells
The Egyptian vaccinal BHV-1 Abu-Hammad strain (14)
and the reference Cooper 1 strain of BHV-1 (National
Veterinary Services Laboratory, Animal and Plant Health
Inspection Services, Ames, Iowa, United States of America
[USA]) were used in this study. Viral stocks were prepared
by infecting Madin Darby bovine kidney (MDBK) cells at a
multiplicity of infection of 0.1 (the ratio of input infectious
units to the number of cells available for infection) from
plaque-purified viruses, which were subsequently titrated
on MDBK cell cultures. The MDBK cells were grown and
maintained in minimum essential medium with Earle’s
salts supplemented with heat-inactivated 10% bovine calf
serum (BCS), 100 U/ml penicillin and 100 µg/ml
streptomycin.
Prior to experimental work, both MDBK cells and BCS
were attested to be free of BHV-1 by indirect
immunofluorescence. The viral identity of both the
Egyptian and reference strains of BHV-1 was proved by
their strong reactions with the appropriate Egyptian and
reference (Veterinary Laboratories Agency, Weybridge,
England) anti-BHV-1 polyclonal antibody, using indirect
immunofluorescence in MDBK cells (36).
Extraction of viral DNA
Viral DNA was extracted following the procedure
described by Vilcek et al. (39), with some modifications.
Briefly, a 25 ml aliquot of each crude virus in culture
supernatant from the BHV-1 (Abu-Hammad or Cooper 1)
infected MDBK cells was clarified by centrifugation at
6,000 rpm/4ºC for 20 min. The clarified virus samples
were then ultracentrifuged at 40,000 rpm/4ºC for 2 h, then
the supernatants were discarded. The virus pellets were
dissolved in 0.5 ml of 2% sodium dodecyl sulphate (SDS),
then mixed with 0.4 mg/ml proteinase K and incubated at
56ºC for 1 h with intermittent shaking. The mixture was
then extracted with an equal volume of
phenol:chloroform:isoamyl alcohol reagent (25:24:1,
vol/vol/vol, equilibrated to pH 8.0 with 10 mM Tris HCl).
DNA in the aqueous phase was precipitated with
2 volumes of cold absolute ethanol and 1/10 volume of
3M sodium acetate. The DNA was pelleted by
centrifugation at 14,000 rpm/4ºC for 30 min. The DNA
pellets were washed in cold 70% ethanol, re-precipitated
by centrifugation, dried, dissolved in 25 µl of nuclease-free
water and stored – 20ºC until used. The concentration and
purity of the BHV-1 genomic DNA were measured as
described previously (27).
Rev. sci. tech. Off. int. Epiz., 25 (3)
1082

Restriction endonuclease analysis
The restriction endonucleases HindIII and BamHI were
used to cleave the genomic DNA of both Egyptian Abu-
Hammad and reference Cooper 1 strains of BHV-1,
following standard protocols (27). Electrophoretic patterns
of the resulting viral genomic DNA fragments were
analysed by 0.7% agarose gel electrophoresis as previously
described (27). The DNA bands were visualised using
ultraviolet transillumination after gel staining with
ethidium bromide (0.5 µg/ml).
Polymerase chain reaction assay
The oligonucleotide primers used in this study were
selected from highly conserved sequences encoding the gD
gene of the Cooper 1.1 strain of BHV-1 (GenBank
Accession No. NC_001847).
Sense 5’- GCGAACATGCAAGGGCCGACATTG -3’
Anti-sense 5’- CACGGCGTCGGGGGCCGCGGGCGT -3’
This primer set was used in the polymerase chain reaction
(PCR) assay to partially amplify the gD gene (a full-length
gene lacking only a fragment of approximately 0.2 kb
encoding the transmembrane anchor) of the BHV-1
genome. The PCR reaction was carried out in a total
volume of 50 µl containing: 1X PCR buffer (20 mM Tris
HCl pH 8.4 and 50 mM KCl); 1.5 mM MgCl2; 0.2 mM
deoxynucleotide triphosphate mixture (dATP, dCTP, dGTP
and dTTP); 100 pmol of each primer; 2.5 units (U)
Thermus aquaticus (Taq) polymerase; 0.1 µg of extracted
viral DNA and nuclease-free sterile double distilled water
up to 50 µl. The resulting mixture was subjected to a
precise thermal profile in a programmable thermocycler as
follows:
– one cycle: 96°C for 2 min
– 35 cycles: 96°C for 50 s – 58°C for 50 s – 72°C for
1 min
– one cycle: 72°C for 10 min.
Analysis of polymerase chain
reaction amplification products (amplicons)
The resulting PCR amplicons (10 µl to 15 µl) were
analysed by 1.5% agarose gel electrophoresis (27). The
DNA bands were visualised using ultraviolet
transillumination after gel staining with ethidium bromide
(0.5 µg/ml). PCR amplicons of the predicted size
(approximately 1.1 kb) were gel purified using a DNA gel
purification kit (ABgene, Germany) and quantified
according to standard procedures (27).
Direct sequencing of polymerase
chain reaction amplicons
The PCR DNA amplicons of the Egyptian vaccinal Abu-
Hammad strain of BHV-1 were purified using microcon
columns (Amicon, USA) and directly sequenced in both
directions with the same primers as those used to generate
the PCR amplicons. Sequencing was carried out in an ABI
PRISM system using the dideoxy chain-termination
method (28), which is based on the incorporation of
fluorescent-labelled dideoxynucleotide terminators. The
primer walking strategy was used and the identity of each
nt was verified at least twice.
Computer-assisted sequence
and phylogenetic analyses
The resulting nt and deduced aa sequence data of the
selected region of the gD gene of the Egyptian vaccinal
Abu-Hammad strain of BHV-1 were compiled and
submitted to GenBank (Accession No. AY690484). These
sequence data were compared with those of related
alphaherpesviruses accessed via GenBank, including:
BHV-1.1 Cooper 1 (Accession No. NC_001847),
BHV-1.2 ST (Accession No. AY437088), BHV-5 (TX89;
Accession No. U14656), caprine herpesvirus-1
(CHV-1, E/CH; Accession No. AY437088), suid
herpesvirus-1 Kaplan (pseudorabies virus; Accession
No. AJ271966), human herpesvirus-1 KHS2 (HHV-1,
herpes simplex virus type 1; Accession No. AF487902),
and HHV-2 CAM4B (HHV-2, herpes simplex virus type 2;
Accession No. U12180). The nt sequences were aligned
using the Clustal W (1.82) program from the European
Bioinformatics Institute (a part of the European Molecular
Biology Laboratory). Clustal W is a fully automated
program for global multiple alignment of DNA and protein
sequences (http://www.ebi.ac.uk/services/ index.html).
Phylogenetic correlation and tree construction were carried
out using the PHYLIP and Treeview 32 (1.6.6) programs.
All software used in this study was accessed through the
appropriate interactive web services (http://www.
evolution.gs.washington.edu/phylip.html and http://www.
taxonomy.zoology.gla.ac.uk/ rod/rod.html).
Results
Restriction endonuclease analysis
(fingerprinting)
The electrophoretic profiles of BHV-1 genomic DNA
digested with restriction endonuclease HindIII revealed
identical DNA fingerprints for both the Egyptian (Abu-
Hammad) and reference (Cooper 1) strains of BHV-1
Rev. sci. tech. Off. int. Epiz., 25 (3) 1083

extending upstream to nt 1,089 in the sequence. A search
for homologous sequences revealed sequence similarity
between this ORF and the published gD gene of
alphaherpesviruses. Therefore, the sequenced gene
fragment of the Abu-Hammad strain was identified as a
BHV-1 gD gene. Since the location of the gD gene is
conserved throughout the sub-family (Alphaherpesvirinae),
there was no need to further locate consensus sequences of
other transcriptional regulatory elements, specifically the
endogenous promoter (TATA) box or polyadenylation
signal. The nucleotide composition of the ORF sequence
was calculated to be A 17.26%, T 13.13%, C 35.26% and
G 34.16%, with a G + C content of 69.42%.
Nucleotide sequence alignment of the Egyptian BHV-1 gD
and related alphaherpesviruses showed variable
percentages of homology (7% to 98%), as illustrated in
Table I. The highest gD sequence identity was recorded
with the reference Cooper 1 strain of BHV-1.1 (98%),
followed by the ST strain of BHV-1.2 (97%), the TX89
strain of BHV-5 (84%), the E/CH strain of CHV-1 (69%),
and the Kaplan strain of suid herpesviruses
Rev. sci. tech. Off. int. Epiz., 25 (3)
1084
kb
12.2
11.1
10.1
9.0
8.0
7.0
5.0
4.0
3.0
A
B
C
D
EF
GH
I
J
K
L
M
123 kb
12.2
2.0
1.6
1.0
0.5
1.1 kb
1234
Lanes:
1: 100 base pair (bp) DNA ladder (consists of repeats of 100 bp
fragment size, GIBCO-BRL)
2: PCR amplicons of the Egyptian Abu-Hammad strain of BHV-1
3: PCR amplicons of the reference Cooper 1 strain of BHV-1
4: Non-infected Madin Darby bovine kidney (MDBK) cell control
Amplicons are approximately 1,100 bp in size
Fig. 2
Agarose gel electrophoresis of the polymerase chain
reaction (PCR)-derived amplicons of the bovine
herpesvirus-1 (BHV-1) glycoprotein D gene, separated
on 1.5% agarose gel and stained with ethidium bromide
Lanes:
1: 1 kilobase (kb) DNA ladder (GIBCO-BRL)
2: Egyptian Abu-Hammad strain of bovine herpesvirus-1 (BHV-1) cut
with
Hind III
3: Reference Cooper 1 strain of BHV-1.1 cut with Hind III
Lines indicate the BHV genomic DNA fragments from A to M
Fig. 1
Agarose gel electrophoresis of genomic viral DNA cut with
restriction endonucleases, separated on 0.7% agarose gel and
stained with ethidium bromide
(Fig. 1). However, no fingerprints could be obtained on
repeated cutting of genomic DNA of either BHV-1 strain
using BamHI (data not shown).
Analysis of polymerase chain reaction
amplification products (amplicons)
Agarose gel electrophoretic analysis of the PCR amplicons
indicated that the amplified DNA fragments encoding the
gD from the Egyptian (Abu-Hammad) and reference
(Cooper 1) strains of BHV-1 corresponded to the expected
size of about 1.1 kb. The amplified DNA bands were of the
same size for both BHV-1 strains (Fig. 2).
Sequence and phylogenetic analyses of the
bovine herpesvirus-1 glycoprotein D gene
Analysis of the nt sequence (Fig. 3) of PCR amplicons from
the Egyptian vaccinal strain Abu-Hammad of BHV-1
revealed a single open reading frame (ORF). This ORF was
1,083 nt long, starting from the first ATG at nt 7 and

Rev. sci. tech. Off. int. Epiz., 25 (3) 1085
- 1 -
Egyptian vaccinal bovine herpesvirus-1 BHV-1 (Abu-Hammad), reference BHV-1.1 (Cooper 1), BHV-1.2 (ST), BHV-5 (TX89), caprine herpesvirus (E/CH),
suid herpesvirus (Kaplan), human herpesvirus-1 (KHS2), and human herpesvirus-2 (CAM4B). Numbers on the sequence indicate nucleotide positions in
the glycoprotein D gene relative to the GenBank data for each virus. Stars indicate that nucleotides in that column are identical in all sequences in
the alignment
Fig. 3
Nucleotide sequence alignment of related alphaherpesvirus genomes