Les processus
de l'évolution
La vie grâce
aux mutations !
Laurent Duret
Laboratoire de Biométrie et Biologie Evolutive, CNRS, Université Lyon 1
Qu’est-ce que la vie?
Dépots sel cuivrique
Champignon
Carbure silicium
Algue rouge
Cristaux de glace
Corail
Qu’est-ce que la vie?
Diatomée (microalgue)
Lithoptera mulleri (plancton)
Cristaux de carbonate de
calcium
Fougère
Cristaux de glace
Propriétés fondamentales des
organismes vivants
 Reproduction: créer de façon autonome
d'autres entités similaires à soi-même.
 Evolution: reproduction PRESQUE à
l’identique
 Sans mutation, pas d’évolution
 Sans évolution, pas de vie
Les processus de l'évolution
 Diversité et unicité du vivant
 Nature et causes des mutations
 Les conséquences phénotypiques des mutations
 Le devenir des mutations:
 Sélection naturelle
 Dérive génétique
 Comment tirer parti de l'évolution pour déchiffrer les
génomes
La diversité du monde vivant
La diversité du monde vivant
Unicité du monde vivant
 La cellule: unité de base des organismes vivants
 Acides nucléiques (ADN, ARN): support de
l’information nécessaire au développement et
au fonctionnement des organismes
 Expression de l’information génétique:
 ADN 
ARN  protéine
 Code génétique universel (presque)
 Machinerie d’expression des gènes conservée
chez tous les organismes vivants (bactéries,
archées, eucaryotes)
Unicité du monde vivant
 Comparaison de séquences de génomes
 Génome de mammifère: ≈20,000 gènes
 Primates/carnivores: ≈19,000 gènes homologues
 Homologues chez insectes: ≈10,000 gènes
 Homologues chez champignons: ≈5,000 gènes
 Homologues chez plantes: ≈6,000 gènes
 Homologues chez bactéries ou archées: ≈3,800
gènes
Unicité et Diversité du monde
vivant
 Les organismes vivants ont évolué à
partir d’un même ancêtre commun
 LUCA: Last Universal Common
Ancestor (Cf exposé M. Gouy)
Le secret de l’hérédité
 Avery et al. (1944): l’ADN est le
support de l’information
génétique
 Watson, Crick, Franklin (1953):
structure en double hélice de la
molécule d’ADN
Le secret de l’hérédité
 ADN: structure en double hélice = reproduction
(réplication de l’information nécessaire au
développement d’un organisme)
Le secret de la vie:
réplication PRESQUE à
l’identique
 Mutation = modification du matériel génétique =
modification de la séquence d'ADN
 Mutations ponctuelles: modifications très locales
 Mutations larges: modifications de grands fragments
génomiques, réarrangements chromosomiques
 Erreurs de la machinerie cellulaire, action d'agents
mutagènes biotiques (parasites intragénomiques) ou
abiotiques (radiations, mutagènes chimiques, ...)
Processus mutationnels:
l’exemple du génome humain
 Un génome animal ordinaire (mais bien connu)
 Variabilité phénotypique très bien étudiée
(maladies)
 Taille du génome haploïde: 3 109 pb
 22 paires d’autosomes + une paire de
chromosomes sexuels (X, Y)
 20,000 gènes protéiques
 Les régions codantes de ces gènes représentent
1% du génome
Les mutations ponctuelles
AGCTGTCTC -> AGCCGTCTC
 Génome humain:
 2 à 3 10-8 mutations ponctuelles/pb/génération
 Principalement dues à des erreurs de la machinerie de
réplication
 => 60 à 90 mutations ponctuelles par gamète
 => chaque individu (2n) est porteur d'environ 120 à
180 mutations nouvelles (i.e. qui n'existaient pas dans
les génomes de ses parents)
 La plupart des maladies génétiques humaines
répertoriées à ce jour sont la conséquence de
mutations ponctuelles (dans des régions régulatrices
Taux de mutation / pb /
génération
 Comparaison de différents groupes
taxonomiques
Taux de mutation / pb / an
 Homme vs. Escherichia coli:
 Taux de mutation / pb / génération: environ x100
 Temps de génération: environ x 105 (20 ans vs. 1-
2 h)
 Taux de mutation / pb / an : de l'ordre de 1/1000
Taux de mutation
 HIV: virus du SIDA:
 5 10-6 mutations / pb / génération (environ 100x
mammifères)
 Evolution mesurable au cours de l'infection d'un
individu
 Résistance au système immunitaire, au traitements
antiviraux
Mutations ponctuelles: l’effet du
sexe
 Nombre de divisions cellulaires dans la lignée
germinale à chaque génération (zygote ->
gamète)
 Femme: ≈ 33 divisions cellulaires
 Homme: ≈ 200 divisions cellulaires (à 20 ans)
 Plus de réplications dans la lignée mâle => plus
d’opportunités de mutations
 Quantification de l’effet du sexe: comparaison
des vitesses d’évolutions des chromosomes
sexuels et des autosomes
Temps passé dans
les lignées mâles
et femelle au fil
des générations:
Autosomes 50%
50%
X
33%
66%
Y
100%
0%
Divergence
homme/chimpanzé
(nombre de substitutions/pb)
Taux de mutations ponctuelles
dans l’espèce humaine: 6 fois plus
élevé chez les mâles
Chromosome
Parmi les ≈150 mutations nouvelles dont chaque individu
est porteur, environ 20 proviennent de sa mère, 130 de
Mutations induites par l’activité
de parasites intragénomiques
 Rétrovirus: virus intégrant son propre génome
dans le génome de son hôte
 Eléments transposables: éléments capables de
se dupliquer et de se déplacer dans les
génomes:
 Via un intermédiaire ADN (transposons)
 Via un intermédaire ARN (rétrotransposons)
Rétrovirus et éléments
transposables
Rétrovirus
 Rétrovirus:
Transcription
inverse
transmission
horizontale
(infection)
ADN
intégration
ARN
transcription
 Rétrotransposon:
Cellule
transmission
verticale
Noyau
Transcriptase inverse:
Rétrovirus
Rétrotransposon
LTR gag
pol
env LTR
Rétrovirus endogène
Rétroposon
Rétrotransposon non-autonome
Eléments transposables: 44% du
génome humain
SINE (rétrotransposon non-autonome)
LINE (rétroposon)
Rétrovirus endogènes
Transposons
Autres séquences répétées
Séquences non-répétées
Principales classes d’éléments transposables dans le génome huma
LINE
ORF1
gag
(gag)
transposase
Transposon
s
AAAA
AAAA
SINE
Rétrovirus
endogènes
ORF2 (pol)
pol
autonome
Nombre de
Fraction
Taille
copies du génome
6-8 kb
850 000
20%
non-autonome
100-300 pb 1 500 000
(env)
autonome
6-11 kb
13%
450 000
8%
300 000
3%
non-autonome 1,5-3 kb
autonome
2-3 kb
non-autonome
80-3000 pb
Eléments transposables:
dispersés dans tout le génome
Fragment du chromosome Y bovin
Eléments transposables dans le
génome humain
 Dispersés dans tout le génome: à l’intérieur des gènes
(dans les introns) et entre les gènes
 La plupart des copies présentes dans notre génome
sont des "fossiles moléculaires": éléments transposables
défectifs, incapables de transposer
 Environ 80-100 copies de LINEs et quelques milliers de
SINEs encore actifs:
 À chaque génération, 1 individu sur 20 porteur d'une
nouvelle insertion
Conséquences de l'activité des
éléments transposables
 Insertion dans les régions codantes d'un gène =>
inactivation du gène
 Insertion à proximité d'un gène => perturbation
de la régulation de l’expression du gène
 Environ 50 cas décrits de maladies génétiques
humaines causées par des insertions d'éléments
transposables
 Faible activité chez les primates par rapport à
d'autres taxons (e.g. maïs, drosophiles, …)
Mutations par duplication ou
délétion de fragments
génomiques (1):
à
Lespetite
duplications
ou délétions(quelques
sont favorisées par
la
échelle
pb)
présence de petits motifs répétées (généralement 1
à 5 pb)
 Dérapage de l'ADN polymérase:
5'-CA->
5'-CACACACAC->
5'-CACACACACACACACACACA-3'
5'-CACACACAC->
5'3'-GTGTGTGTGTGTGTGTGT 5'
3'-GTGTGTGTGTGTGTGTGT-5'
Mutations par duplication ou
délétion de fragments
génomiques (1):
à
Environ
20 à échelle
30 maladies génétiques
humaines
petite
(quelques
pb)
causées par des expansions de motifs répétés
 e.g. chorée de Huntington (dégénérescence
neuronale):
 Le gène JPH3 contient des répétitions de la séquence CAG
 La nombre de répétitions est variable dans la population
normale (6 à 26 fois)
 Le nombre de copies peut augmenter ou diminuer au fil des
générations en raison des erreurs de réplication au cours de
la gamétogénèse
 Si le trinucléotide est répété plus de 36 fois, la personne a un
fort risque de développer la maladie
Mutations par duplication ou
délétion de fragments
génomiques (2):
 Recombinaison
entre séquences
homologues
à grande
échelle
présentes à des locus différents (e.g. éléments
transposables)
Recombinaison normale:
alignement de
chromosomes homologues
Recombinaison inégale
Mutations par duplication ou
délétion de fragments
génomiques (2):
 L'abondance
des éléments
transposables dispersés
à grande
échelle
dans le génome favorise les évènements de
recombinaison inégale
Gène
 Duplications ou perte de
gènes:
Recombinaison inégale
Gène
Gène
Mutations par duplication ou
délétion de fragments
génomiques (2):
grande
 Duplication deà
gènes:
opportunitééchelle
d'évoluer vers de nouvelles
fonctions
 Génome humain: la majorité des 20,000 gènes font partie de
familles multigéniques (duplication = processus majeur
d'innovation génique chez les eucaryotes)
Mutations par duplication ou
délétion de fragments
génomiques (2):
à grande échelle
Evolution de la
famille de gènes
de globines
Mutations par duplication ou
délétion de fragments
génomiques (2):
grande
 Conséquencesà
fonctionnelles
deséchelle
duplications:
 Long terme (dizaines de millions d'années): innovations fonctionnelles
 Court terme: dosage génique => niveau d'expression
 Ces évènements de duplication/délétion font que les génomes
de 2 individus présentent en moyenne 24 à 70 Mb de différence
(1% à 2%)
 Répertoire génique de 2 individus: ± 200 à 600 gènes !
Réarrangements
chromosomiques
 Inversions,
translocations chromosomiques, fusion
or fissions chromosomiques ...
 Réarrangements favorisés par la présence
d'éléments transposables
 Problèmes de ségrégation des chromosomes à la
méiose suivante
 Cause de stérilité
Polyploïdisation: duplication globale du
génome
 Evènements rares mais récurrents au cours de
l'évolution des eucaryotes (plantes, animaux,
champignons, protistes)
 Mécanismes méconnus:
 Problème de ségrégation des chromosomes à la méiose
 Hybridation entre espèces proches (e.g. blé, colza)
 Favorisé par autofécondation
 Doublement du répertoire génique, suivi de pertes
massives de gènes (re-diploïdisation) sur le long terme
(dizaines de millions d'années)
 Une fraction des gènes dupliqués impliqués dans
l'évolution de nouvelles fonctions
Origine des nouveaux gènes
 Duplication:
 Recombinaison inégale, duplication de génome
Cluster de gènes Hox
Origine des nouveaux gènes
 Duplication:
 Recombinaison inégale, duplication de génome
 Rétrotransposition (rétrogène)
 Formation de gènes chimères (réarrangements de
gènes pré-existants)
 Acquisition de gènes par transfert horizontal
 e.g. HERVW1 (placentation): dérivé d'un rétrovirus
 Recrutement de gènes de parasites intragénomiques
(domestication, exaptation)
 e.g. Gènes impliqués dans les réarrangement du locus
des immunoglobulines
Conséquences fonctionnelles
des mutations
 Mutations => diversité génétique => diversité
phénotypique
Conséquences fonctionnelles
des mutations
 Mutations délétères (nocives)
 E.g.: maladies génétiques
 Mutations avantageuses:
 Contribuent à l'adaptation des espèces
 Mutations neutres: sans effet significatif sur le
phénotype
 NB: les régions fonctionnelles (régions codantes,
régulatrices) constituent moins de 10% du génome
humain
 Même dans les régions fonctionnelles, de nombreuses
mutations sont sans conséquence
Conséquences évolutives des
mutations
 Mutations => diversité génétique : de nouveaux
allèles (i.e. de nouveaux variants d'un même gène)
apparaissent dans la population
 Comment cette diversité conduit-elle à l'évolution
de l'espèce?
Evolution : de l'individu à la
population
Erreur de réplication, délétion,
insertion, ... = prémutation
Réparation de l'ADN
Substitution
Individu
Mutation
germen
soma
Transmission à la descendance
(polymorphisme)
Population (N)
Pas de transmission
à la descendance
Disparition du nouvel allèle
Fixation
Substitution = mutation fixée dans la population
Evolution = changement de
fréquences alléliques
Générations
0
Individus
1
2
3
4
5
…
G
Quels sont les processus qui
contribuent aux changements
de fréquences alléliques?
La sélection naturelle (1):
sélection positive
 Sélection positive (directionnelle): adaptation
 Mutation avantageuse = qui augmente le
succès reproducteur d'un individu (sa "fitness")
La sélection positive
Générations
Individus
1
2
3
4
5
…
G
La sélection naturelle (1):
sélection positive
 Le succès reproducteur d'un individu dépend
de:
 Sa survie
 Sa capacité à trouver un partenaire sexuel
 Sa capacité à favoriser le développement de sa
progéniture
La sélection naturelle (1):
sélection positive
 Pas uniquement la "lutte pour la survie",
 Exemple 1: Sélection sexuelle
 Compétition en vue d'être le plus attirant pour les
membres du sexe opposé
 Evolution de caractères qui peuvent s'avérer néfastes
pour la survie
La sélection naturelle (1):
sélection positive
 Pas uniquement la "lutte pour la survie",
 Exemple 2: Sélection de parentèle
 Un individu peut transmettre des copies de ses
propres gènes non seulement en se reproduisant,
mais aussi en favorisant la reproduction d'individus
apparentés
 Evolution de l'altruisme (i.e. comportement favorable
à d'autres individus, au détriment de ses propres
chances de survie) – grâce au gène égoïste ...
La sélection naturelle (1):
sélection positive
 Exemples de sélection positive dans la lignée
humaine: adaptation aux changements de mode
alimentaire (agriculture, domestication: < 10,000 ans)
La sélection naturelle (1):
sélection positive
 Digestion de l'amidon: Amylase (AMY1)
 Famille multigénique; chez l'homme, variabilité du
nombre de copies: entre 3 et 11 par génome
(moyenne = 6); seulement 2 copies chez le chimpanzé
 Concentration en amylase salivaire corrélée au
nombre de copies
 Nombre de copies significativement plus élevé dans les
populations où l'alimentation traditionnelle est riche en
amidon
La sélection naturelle (1):
sélection positive
 Digestion du lactose: Lactase (LCT)
 La capacité à digérer le lait diminue après le sevrage
(réduction de la concentration en lactase dans l'intestin)
 Intolérance au lactose fréquente parmi les adultes (douleurs
abdominales, diarrhées)
 Société traditionnelles pastorales: tolérance au lactose
 Mutation dans le promoteur du gène LCT: l'expression de LCT
se poursuit chez l'adulte
 La distribution géographique de cet allèle 'persistance de la
lactase' est corrélée au niveau historique de consommation de
lait
La sélection naturelle (2):
sélection négative
 Sélection négative (purificatrice): conservation
 Mutation délétère = qui diminue le succès
reproducteur d'un individu (sa "fitness")
 Les individus porteurs de cette mutation ont une
probabilité plus faible d'avoir une descendance
 Ces mutations tendent à disparaître de la
population
La sélection négative
Générations
Individus
1
2
3
4
5
…
G
La sélection naturelle (3):
sélection balancée
 Mutations avantageuses à l'état hétérozygotes
 La sélection naturelle favorise le maintien du
polymorphisme
 Situation rare
La sélection naturelle (3):
sélection balancée
 Exemple: drépanocytose (anémie à cellule
falciforme)
 Maladie relativement fréquente (notamment en
Mutation dans le gène de la beta-globine:
Afrique)
- hétérozygotes
- résistance partielle au paludisme
- fréquence de l'allèle muté peut atteindre 20%
- homozygotes - léthal
AA
AS
SS
Sains
2333 335 (0.14)
1
Malades
671
0
23 (0.03)
La sélection naturelle n'est pas
l'unique mécanisme de
l'évolution!!
 Même en absence de pression de sélection, il y
a évolution (des fréquences alléliques)
 Motoo Kimura: The Neutral Theory of Evolution
La dérive génétique aléatoire
Générations
Individus
1
2
3
4
5
…
G
Evolution des patronymes
Duret
Arndt
Galtier
EyreWalker
Arndt
Galtier
Arndt
EyreWalker
Galtier
Galtier
Galtier
Galtier
 Pas de sélection: tous les individus ont la même probabilité de se
reproduire
 Mais le nombre de descendants n'est pas illimité => à chaque
génération, tirage aléatoire des allèles qui seront présents à la génération
suivante
 A chaque génération, il existe une probabilité non-nulle qu'un allèle
La dérive génétique aléatoire
 L'impact de la dérive génétique aléatoire
dépend de la taille des populations: plus les
populations sont petites, plus les effets
stochastiques sont importants
 Importance des goulots d'étranglement (e.g. au
moment d'une colonisation): effet fondateur
 Exemple: patronymes les plus fréquents
 France: Durand, Petit, Dupont
 Québec: Roy, Gauthier, Gagnon
La dérive génétique interfère
avec la sélection naturelle
 Du fait de la dérive génétique, même les
mutations avantageuses ont une probabilité
assez faible de se fixer
 Du fait de la dérive génétique, les mutations
faiblement délétères ont une probabilité nonnulle de se fixer
Analyse comparative de
séquences génomiques:
la pierre de Rosette des
généticiens
Projets de séquençage de
génomes
 Objectif: faire l'inventaire de toute
l'information génétique nécessaire au
développement d'un organisme: génes,
régions régulatrices
 Développement rapide des techniques de
séquençage
 Séquençage d'un génome humain:
 2004: 6 ans,
300,000 k€
 2008: 8 semaines,
250 k€
 Des centaines de génomes séquencés,
dont une vingtaine de mammifères
Qu'y a-t-il dans un génome
de mammifère?
 3.1 109 bp
 Eléments transposables: ~50%
 20,000 gènes protéiques
 Régions codantes des gènes protéiques : 1%
 Autres éléments fonctionnels: ??
 Quelle fraction de notre génome est
fonctionnelle?
100%?
50%?
10%?
1%?
agtgctaaccactgagccatcatgcctacgacactatttattacagtttattagttcattatag
tccatactacagtatgctggagcattcattaactaagagtagcaataatatgtacagtaaaaaa
cactagtatggttcaaaaacactaatatttactatacattacaataatatacagttgaagtcag
aattattagccccctttttattttttgtgccaatttctgtttaacggagagatttttttcaaca
catttctaatcataatagttttaataactcatttataatagctgatttattttatctttgccat
gatgacagtaaataatgttttactagatgtttttcaagacacttctatacagcttaaagtgaca
tttaaaggcttaactaggttaattaggttaactaggcaggttaggataactaggcaagttattg
tataatgatggtttgttctttagactatcaaaaaaataacttaaaggggctaaaaaatttttac
cttaaaatgtttttttttttttaattaaaaaactgcttttattctagccaaaaataaaacaaat
aagactatctccagaagaaacaatattatcagacatactgtgaaaatatctttggtcatttggg
aaatattttacaacgaaaacaaaatcctaaggggggctaatatgtctgacttcaactgtatata
tatattttttcatgtggatatgctaatgtgtaaaaatttcaatccccagtgaatgcaatggatg
gataattcgaataaacagagtagttttcctttattttattattcatttaggtatttacttttat
gtttttatattttgtttgtttctccagcatatagaagccaactgtattattgcagccaataatt
aatatatcagtaaggcttttatgatttaacatcaaactgcattaacattacccaatagttaaaa
gaataaaaaatttaaactcattaataattcttaacccttatgttgtttcaatcccctgagacat
tccttcataatctaaaatcaaatgaatatgttttagatgaaatccaacagcagctttcagacac
taatgatcacatacaaagctccatgaacatttactttttgtgcaaacgacaaaaaaatgtgtag
cttcaaatggttacagttgaaccactaaagtgatctggaatattttgacaaagtttttggtctt
ttttctggattttgaatgttgttgctgtctatggaggatgagagagctcttgggtttcttctaa
aatatctttattggcgttgtgaagataaacgaaggtgatctcaggggtttggaatgatgatgag
ctttcaattttcaatttcatggagaattttctttaatttcagtccatataaatcgtttgcaaac
acttaccttaaaaaaagatagtaaatgcaatgaatcatttttctgtgcatttcaatgcaacaca
actctctatagctgaaattattgtgggtgttaacaaagagcagaactgcaggtcagtgcatgaa
Comment trouver les
éléments fonctionnels ?
Qu'est-ce qui nous
distingue de notre
cousin?
30 106 substitutions ponctuelles +
délétions+ duplications
Quels sont les éléments
fonctionnels responsables des
adaptations spécifiques de
chaque lignée?
Génomique comparative:
la pierre de Rosette
 Principe de l'approche:
 Elément fonctionnel <=> contraint par la
sélection naturelle
 Rechercher les traces de l'action de la
sélection dans les séquences genomiques
 Sélection négative (conservation)
 Sélection positive (adaptation)
Analyser les vitesses d'évolution
des séquences pour détecter la
sélection
 Vitesse d'évolution
= taux de substitution
 Vitesse d'évolution des séquences: V
 u: Taux de mutation par génération
 p: Probabilité de fixation
 La probabilité de fixation d'une mutation
dépend de:
 N: taille des populations (dérive génétique)
 s: impact de le mutation sur le succès
reproducteur
 s < 0 : mutation désavantageuse
 s = 0 : mutation neutre
 s > 0 : mutation avantageuse
Vitesse d'évolution de
séquences neutres
Probabilité de Fixation
Duret
Arndt
Galtier
EyreWalker
Arndt
Galtier
Arndt
EyreWalker
Galtier
Galtier
Galtier
Galtier
Probabilité de fixation = 1/N = 1/4
Taux de mutation
Doret
Arndt
Galtiex
EyreWalker
Arnds
Galtiex
Arndt
EyreWalker
Galtiex
Galtier
Galtiex
Galtiex
Nombre de Mutations dans la Pop = uN = 1/5 x 4 = 0.8
Vitesse d'évolution de
séquences neutres
Taille de la population = N = 4
Taux de mutation/génération/individu = u = 1/5
Nombre de mutations à chaque génération= uN = 4/5
Probabilité de fixation = 1/N = 1/4
Taux de substitution dans la population:
uN x 1/N = u = 1/5
Démontrer l'action de la
sélection = rejeter l'hypothèse
d'évolution
neutre
 En absence de sélection, V = u
 Sélection négative: V < u
 Sélection positive: V > u
Eléments fonctionnels sous
pression de sélection négative
 Evoluent plus lentement que le reste du génome
 => conservés au cours de l'évolution
 => empreintes phylogénétique
Analyse comparative des gènes de
b-actine de l'homme et de la carpe
5’UTR
ATG
codon
stop
signal de
3’UTR polyadénylation
Carpe
Homme
promoteur
introns:
régions codantes:
éléments régulateurs:
enhancer
signaux d’adressage
intracytoplasmique
échelle de similarité:
pas de similarité significative
80 - 90% identité
70 - 80% identité
Comparaison des génomes de
l’homme et de la souris
 Alignement des génomes de l’homme et
de la souris: 40% du génome humain est
alignable avec le génome de la souris
Homme caggtggagctgggcgggggccctggtgcaggcagcctg
Souris caactggagctgggtgga---ccgggagcaggtgacctt
** ********** **
** ** *****
***
 Comparaison des taux de substitution dans
les éléments transposables défectifs
(marqueurs neutres) et dans le reste du
génome
Comparaison des génomes de l’homme et de la
souris
Distribution des taux de
substitution
Marqueurs neutres
Séquences non-répétées
Score de
conservation
 Plus de 5% du génome des mammifères est sous pression
de sélection négative
 NB: seulement 1% du génome est codant !! 4 fois plus
des regions non-codantes fonctionnelles que de régions
codantes !!
Quantifier les éléments
fonctionnels dans notre génome
 Problème: on ne détecte que les éléments
fonctionnels déjà présents chez l'ancêtre commun
aux rongeurs et aux primates – et non pas ceux qui
ont évolué spécifiquement dans l'une ou l'autre
lignée
 Comparaison entre primates proches (homme,
chimpanzé, macaque, ...): environ 10% de notre
génome est sous pression de sélection négative
 Ces régions non-codantes fonctionnelles sont
probablement impliquées dans la régulation de
l'expression des gènes
Contribution relative de la dérive
génétique et de la sélection
positive à l'évolution des
génomes
 Sélection négative = conservation (pas d'évolution)
 Evolution :
 Sélection positive
 Dérive génétique
 Comparaison homme/chimpanzé:
 1,2% de divergence
 34,000,000 substitutions nucleotidiques dans tout le génome
 290,000 substitutions d'amino-acides dans les protéines
 Quelle fraction de ces substitutions résultent de la
sélection?
100%?
50%?
10%?
1%?
Contribution relative de la dérive
génétique et de la sélection
positive à l'évolution des
génomes
 Comparaison homme/chimpanzé:
 Fraction des substitutions résultant de la sélection:
indétectable (i.e. très très faible par rapport aux
mutations fixées par dérive)
 Drosophiles: environ 50% des substitutions dans les gènes
protéiques résultent de la sélection
 Faible taille de population chez les mammifères par
rapport aux insectes => dérive plus importante, sélection
moins efficace
Importance de la dérive
 Dans les espèces à faible taille de population, la
sélection est moins efficace:
 Pour fixer les mutations avantageuses
 Pour purger les mutations faiblement délétères
 => accumulations de mutations faiblement
délétères
 => explique l'abondance des éléments
transposables (parasites intragénomiques) dans
certains groupes taxonomiques
Conclusions (1)
 "En biologie, rien n'a de sens si ce n'est à la
lumière de l'évolution" (T. Dobzhansky, 1973)
 Pour pouvoir déchiffrer (interpréter) les
génomes, il est nécessaire de comprendre les
processus évolutifs (mutation, sélection, dérive,
…) qui affectent les séquences ou qui les ont
affectées dans le passé (contingence)
 La connaissance des processus évolutifs à
l'échelle moléculaire (i.e. au niveau même du
support de l'information génétique) est cruciale
pour comprendre l'évolution des organismes (y
compris pour anticiper l'émergence de
pathogènes résistants aux traitements)
Conclusions (2)
 Les processus de l'évolution (à l'échelle
moléculaire) ... Seulement un des versants de la
question
 Evolution des écosystèmes: prendre en compte
le processus de co-évolution (mutualisme,
parasitisme, prédation)
 Processus de spéciation
 Sélection de second ordre: sélection sur la
capacité à évoluer (e.g. évolution de la
reprouction sexuée)
…