et al
publicité
THÈSE En vue de l'obtention du DOCTORAT DE L’UNIVERSITÉ DE TOULOUSE Délivré par l’Université Toulouse III – Paul Sabatier Discipline ou spécialité : Cancérologie Présentée et soutenue par Yuan Yuan WANG Le 25 September 2013 Titre : Deciphering the crosstalk between breast cancer cells and tumour-surrounding adipocytes : contribution of cell metabolic symbiosis JURY Pr Thierry LEVADE, Professeur des Universités Président Dr Fabienne FOUFELLE, Directeur de Recherche, INSERM Rapporteur Dr Frederic BOST, Directeur de Recherche, CNRS Rapporteur Pr Charles DUMONTET, Professeur des Universités Rapporteur Pr Guo-sheng Ren, Professeur de l`Universités Medicale de Chongqing Invités Pr Catherine Muller, Professeur des Universités Directeur de thèse Pr Philippe Valet, Professeur des Universités Directeur de thèse Ecole doctorale : Ecole doctorale Biologie Santé Biotechnologies Unité de recherche : IPBS CNRS UMR5089 Directeurs de Thèse : Pr Catherine Muller et Pr Philippe Valet Rapporteurs: Fabienne FOUFELLE, Frederic BOST, Charles DUMONTET 1 Acknowledgment First and foremost, I would like to express the deepest appreciation to my “science parents”: Prof. Catherine Muller and Prof. Philippe Valet for inspiring me and for providing such an interesting project for me to work during these four years. Thank you for your direction and your help in the development of my scientific mind: innovative concept, insistence, enthusiasm, strict for the science, and how to give a speech in front of people. I am honored to have worked with you and I have learned more from you than you will know. Thanks to the past members in MIKA team: thanks to Bea not only for teaching me many experiment skills from my very beginning and start this interesting project, but also teaching me how to make crêpe and Moelleux a l`ananas et noix de coco, and also all the “useful French words” . I am really happy to have you such a kind and straight “little boss” and French friend. Thanks to Lud for picking me at the train station when I first arrived in Toulouse and helping me a lot from the life to the work at the beginning. Thanks to Cathy Botanch for your welcome cake and your kindness. Thanks to the present members in our team, you are really helpful and friendly: Steph for teaching me how to use confocal microscopy and all the IF analysis; Laurence, for reviewing my thesis manuscript in spite of your very busy schedule and I am enjoying discussing with you; The “Prostate boys”: Victor and Adrien, the rest “Breast girls” Camille Lehood, hey chouette! and Delphine, “Melanoma princess” Ikrame and “Hypoxia queen” Fred, Your lively discussion at group meeting have made science come to life, I have truly valued our scientific interaction. I treasure all the fun we have made during these years and each time we got together, running, eating and drinking… and you are also very good French teacher “Ca roule ma poule” “c’est parti mon kiki” I will frequently repeat them in order to keep link with you Thanks to “Adipolab” members: especially, “Mice queen” Sophie for helping and teaching me the in vivo experiment, Camille for the β-oxidation detection and Cedric for providing me several antibodies. Thanks to Madama Escourrou Ghislaine for all Immunohistochemistry analysis and I learnt a lot about “the microcosmic world” of breast cancer. Thanks to other person in IPBS: Leyre, Guillaume, Piere, Emma, Ying, Jin, Zhong, Jiahui for you kind help. Thanks to my thesis committee members: for your encouragement, insightful comments and hard questions. I would like to acknowledge the financial support from CSC for 4 years that made my Ph.D work possible. I have been fortunate to come across many funny and good Chinese friends: SuSu, Liang, Tian, Xiaoqian, Jian, Hang, Han, Lijun,Mingchun et al. without you, life would be bleak. Thanks for the movies, dinners, sports, concerts and plays we enjoy together. My sincere thanks also go to Prof. Ren GuoSheng, for offering me this opportunity to study abroad. Lastly, I am profoundly thankful for the love, support and understanding from my parents, my grandma! Thank Toulouse! This sunny, lovely and peaceful city! Thank all of you! 2 Abbreviation ACC ACL ACS ADF ADRP ADSCs ANLS AMPK ANP APC AOX AT ATGL ARF Acetyl CoA carboxylase ATP citrate lyase Acyl-CoA synthase Adipocyte-Derived Fibroblast Adipocyte differentiation-related protein Adipocyte-Derived Stem cells Astrocyte-neuron shuttle AMP Activated Protein Kinase Atrial natriuretic peptide Adenomatous Polyposis Coli Acyl-CoA oxidase Adipose tissue Adipocyte Triglyceride Lipase ADP-ribosylation factor BMP7 BMAT BNP Bone morphogenetic protein 7 Bone marrow adipose tissue Brain natriuretic peptide CAA CAC CAF CACT C/EBP CNP CK1 CLS COLVI CPT CSF-1 CGI-58 Cancer-Associated Adipocyte Cancer associated cachexia Cancer-Associated Fibroblast Carnitine acylcarnitine translocase CAAT/Enhancer Binding Protein C-type natriuretic peptide Casein Kinase 1 Crown like structure Collagen VI Carnitine palmitoyltransferase Macrophage Colony-Stimulating Factor-1 Comparative gene identification-58 DFAT DC DGAT DG DLBCL Dedifferentiated Fat Cell Dendritic Cell Diacylglycerol acyltransferase Diacylglycerol Diffuse large B cell lymphoma EGF ER ECM EMT Epidermal Growth Factor Estrogen receptor Extracellular matrix epithelial-to-mesenchymal transition FABP FAP FAS FFA FGF FN FSP-1 Fatty acid binding protein Fibroblast Activated Protein Fatty Acid Synthase Free fatty acid Fibroblast Growth Factor Fibronectine Fibroblast-Specific Protein-1 3 GSK-3β Glycogene Synthase Kinase-3β HDAC-1 HER2/neu HFD HGF HIF HSL Histone deacetylase-1 Human epidermal growth factor receptor 2 High fat diet Hepatocyte Growth Factor Hypoxia-inducible factor Hormone sensitive lipase IFN IGF-1 iNOS IL IMC Interferon Insuline-like Growth Factor-1 Inducible nitric oxide synthase Interleukine Indice de masse corporelle KLF KG Kruppel-Like zinc finger transcription Factor Ketoglutarate LD LDH-A LEF/TCF LCAD LHYD LKAT LRP Lipid droplet Lactate dehydrogenase A Lymphoid-Enhancer-binding Factor/T-Cell-specific transcription Factor Long chain acyl-CoA dehydrogenase Long chain enoyl-CoA hydratase Long chain 3-ketoacyl-CoA thiolase Low-density lipoprotein Receptor-related protein MAGL MAPK MAT MCP MEC MMP MIC-1 MUFA mTOR MonoAcylGlycerol Lipase Mitogen Activated Protein Kinase Mammary adipose tissue Monocyte Chemoattractant Protein Matrice Extra-Cellulaire Matrix MetalloProtease Macrophage inhibitory cytokine 1 Monounsaturated fatty acid Mammalian target of rapamycin NG2 NK NPR Neuron-Glial Antigen-2 Natural Killer Natriuretic peptide receptor OB-R Leptin receptor PAI1 PDGF PI3K PPAR PGC1α PLD PKA PDH PDK Plasminogen activator inhibitor 1 Platelet-Derived Growth Factor PhosphoInositol-3-kinase Peroxisome Proliferator Activated Receptor PPARγ co-activator 1α Phospholipase D Protein kinase A Pyruvate dehydrogenase Pyruvate dehydrogenase kinase enzyme 4 PML Promyelocytic leukaemia ROS Reactive oxygen species SAT SCO2 SCD S1P SHBG αSMA SREBP STAT SETDB1 SVF Subcutaneous adipose tissue Synthesis of cytochrome C oxidase protein Stearoyl-CoA desaturase Sphingosine 1-Phosphate Sex Hormone Binding Globulin α-Smooth Muscle Actin Sterol Regulatory Element Binding Protein Signal Transducer and activators of transcription SET domain bifurcated 1 Stroma vascular fraction TADC TAM TCF TEC TAG TGF TNC TNF TFP TIP47 TIGAR TLR4 Tumor Associated Dendritic Cell Tumor Associated Macrophage T cell-specific transcription factor Tumor Associated endothelial cell Triacylglycerol Transforming Growth Factor Tenascine-c Tumor Necrosis Factor Trifunctional protein Tail-interacting protein of 47kDa TP53-Induced Glycolysis and Apoptosis Regulator Toll like receptor UCP1 USP2a Uncoupling protein 1 Ubiquitin-specific protease 2a VAT VEGF Visceral adipose tissue Vascular Endothelium Growth Factor Wnt Wingless-type MMTV integration site 5 Summary INTRODUCTION ........................................................................................................................................... 8 GENERAL INTRODUCTION ....................................................................................................................... 9 INTRODUCTION GENERALE .................................................................................................................. 11 PART I: THE TUMOR MICROENVIRONMENT. ................................................................................. 13 1. Abnormalities in the microenvironment during tumor progression ...................................................................13 2. Complex cellular components in solid tumors .....................................................................................................15 2.1 Vascular cells ......................................................................................................................................................... 15 2.2 Inflammatory/Immune cells ................................................................................................................................... 16 2.3 Fibroblasts .............................................................................................................................................................. 17 2.4 Adipocytes ............................................................................................................................................................. 22 PART II: ADIPOSE TISSUE AND CANCER INTERACTION.............................................................. 23 1. The adipose tissue (AT) overview .........................................................................................................................23 2. The adipocytes ......................................................................................................................................................25 2.1 The cellular origins of adipocytes and their differentiation ................................................................................... 27 2.2 Model systems used to study adipocyte in vitro .................................................................................................... 31 3. Physiological functions of adipose tissue ..............................................................................................................32 3.1 Lipid droplet biogenesis ......................................................................................................................................... 33 3.2 Fat mobilization from lipid droplets ...................................................................................................................... 35 3.3 Paracrine and endocrine role of adipose tissue ...................................................................................................... 39 4. Different depots of adipose tissue .........................................................................................................................42 4.1 Subcutaneous/Visceral Adipose Tissue (VAT/SAT) ............................................................................................. 42 4.2 Mammary adipose tissue (MAT) ........................................................................................................................... 42 4.3 Bone marrow adipose tissue (BMAT) ................................................................................................................... 43 5. Adipose tissue in the obese individual ..................................................................................................................44 6. Relationship between obesity and breast cancer ..................................................................................................47 6.1 Breast cancer at a glance ........................................................................................................................................ 48 6.2 How do adipocytes influence breast cancer biology? ............................................................................................ 49 7. Paracrine role of adipocytes in tumor progression ..............................................................................................55 7.1 Evidence of adipocytes participate in breast cancer progression ........................................................................... 55 7.2 Paracrine role of adipocytes ................................................................................................................................... 56 8. Contribution of ADSCs to breast cancer progression .........................................................................................59 9. Oncological risk after autologous lipofilling grafting in breast cancer patients ..................................................60 PART III: CANCER METABOLISM......................................................................................................... 61 1. A famous concept of cancer metabolism: The Warburg Effect ...........................................................................61 6 2. Diversity of energy production pathways of cancer cells .....................................................................................64 2.1 Glutamine metabolism ........................................................................................................................................... 64 2.2 Mitochondrial oxidative phosphorylation (OXPHOS) ........................................................................................... 67 3. Fatty acid metabolism in the limelight .................................................................................................................69 3.1 De novo fatty acid synthesis and the relationship with cancer ............................................................................... 69 3.2 Cellular uptake and transport of long-chain fatty acids ......................................................................................... 72 3.3 Fatty acid β-oxidation ............................................................................................................................................ 75 3.4 Mitochondrial fatty acid β-oxidation in cancer ...................................................................................................... 81 RESULTATS ................................................................................................................................................ 88 REVIEW I: .................................................................................................................................................... 89 REVIEW II: .................................................................................................................................................. 90 ARTICLE I: ................................................................................................................................................... 91 ARTICLE II: ................................................................................................................................................. 92 ARTICLE III: ................................................................................................................................................ 93 CONCLUSIONS AND PERSPECTIVES ................................................................................................... 94 BIBLIOGRAPHIE...................................................................................................................................... 104 ANNEX ........................................................................................................................................................ 125 7 INTRODUCTION 8 GENERAL INTRODUCTION It is increasingly being recognized that human cancers in vivo do not behave as homogeneous collections of neoplastic cells but as complex multicellular systems in which malignant cells establish bidirectional interactions with neighbouring non-malignant cells. This interplay between tumor cells and the stroma—which comprises non-malignant cells and extracellular components— has been recognized as constituting a ‘tumor microenvironment’, and is now considered to be a hallmark of cancer biology. Among the many different cell types in stroma, mature adipocyte received relatively little attention according to the view that it is merely an energy-storing cell, relatively inert to its surrounding. However, adipocyte has been identified as a highly endocrine cell that can secrete various adipokines which are potentially able to modulate tumor behavior through heterotypic signaling process (Review 1). Since current epidemiological evidence convincingly shows that obesity is associated with greater cancer specific mortality and poor prognosis outcome, the involvement of fat cells in the progression of cancer appears of major interest. The purpose of my PhD study is to shed in light the crosstalk between adipocytes and breast cancer cells and underscore the need to fully understand the role of this heterotypic signaling in modulating tumor behavior. First of all, I participated to the efforts of my team to demonstrate that invasive cancer cells have a dramatic impact on surrounding adipocytes. Both in vitro and in vivo, these adipocytes exhibit a decrease of lipid content, a decreased expression of adipocyte markers and an activated state by the overexpression of proinflammatory cytokines. We named them “Cancer-Associated Adipocytes” (CAAs) (Experimental article 1). Then, using combined in vitro and in vivo approaches, we identified for the first time that part of the cancer-associated fibroblasts (CAFs) which actively participate in tumor progression originate from the “dedifferentiation” of mature adipocytes. We named this new stromal cell population “AdiposeDerived Fibroblasts” (ADFs). They could participate in the desmoplastic reaction composed of several fibroblasts embedded in a rich extracellular matrix, commonly found in breast cancer and promote tumor dissemination (Experimental article 2). Finally, we noticed that one of the key features of CAAs is the loss of lipid content observed both in vitro and in human breast tumors. Given that tumor cells possess variety of metabolic transformation according to their energy demand and the tumor microenvironment, CAAs may play a role in determining the metabolic phenotype of tumor cells. My work is to characterize a new metabolic crosstalk between breast cancer cells and tumor-surrounding adipocytes. During our investigation, we observed that part of this delipidation is due to the ability of tumor, but not normal 9 breast epithelial cells to induce lipolysis in adipocytes. We showed that the FFAs released during the lipolysis process by adipocytes are transferred, processed and stored in tumor cells as triglycerides (TG), contained in lipid droplets. When needed, these TG can be released as FFAs by an ATGL-dependent lipolytic pathway specifically present in tumor cells as shown both in vitro and in human tumors. These released FFAs are used for fatty acid β-oxidation (FAO), an activity present in cancer, but not normal, breast epithelial cells and regulated by coculture with adipocytes. Inhibition of these lipolytic/FAO coupled pathways either by pharmacological or gene repression strategies strongly decreases the invasive abilities of tumor cells that have been cocultivated with adipocytes (Experimental article 3). Therefore, our results strongly reinforced the concept of a metabolic crosstalk is established between adipocyte and tumor cells. For the first time, we showed ATGL, an enzyme that plays a key role in regulating lipid network and invasiveness of breast cancer cells in an adipocyte-rich microenvironment. In conclusion, such results provide an important concept in the understanding of the poor prognosis of breast cancer in the increasing obese population and warning about the oncological risk after autologous lipoaspirate grafting in breast cancer patients (Review 2) as well. Understanding the mechanisms of symbiosis between cancer cells and adipocytes should reveal new therapeutic possibilities. 10 INTRODUCTION GENERALE Il est maintenant établi que les tumeurs humaines ne se comportent pas comme un ensemble homogène de cellules néoplasiques, mais comme des systèmes complexes pluricellulaires où les cellules malignes établissent des interactions bidirectionnelles avec les cellules qui les entourent. Ces interactions entre les cellules tumorales et les cellules du stroma (microenvironnement) sont désormais considérées comme des facteurs majeurs impliqués dans la biologie du cancer. Parmi les nombreux types cellulaires du stroma, les adipocytes matures ont à ce jour reçu relativement peu d'attention, en effet ces derniers ont longtemps étaient considérés comme de simples cellules de stockage d'énergie, relativement inertes à leur environnement. Cependant, l’adipocyte a été identifié comme une cellule à fortes capacités endocrines sécrétant diverses adipokines pouvant potentiellement moduler le comportement de la tumeur via un processus de signalisation hétérotopique (voir la revue Wang et al, 2012). Les données épidémiologiques actuelles montrent de façon convaincante que l'obésité est associée à une plus grande mortalité par cancer ainsi qu’à une faible survie sans progression. L'implication des cellules graisseuses dans la progression du cancer apparaît donc d'un intérêt majeur. Le but de mon travail de thèse a été de mettre en lumière le dialogue bidirectionnel entre les adipocytes et les cellules cancéreuses mammaires et de souligner la nécessité de bien comprendre le rôle de cette signalisation hétérotopique dans la modulation du comportement de la tumeur. Tout d'abord, nous avons démontré que les cellules cancéreuses invasives ont un impact important sur les adipocytes environnants la tumeur. Aussi bien in vitro qu’in vivo, ces adipocytes présentent une diminution de leur contenu lipidique, une diminution de l'expression des marqueurs adipocytaires et un état activé par la surexpression de cytokines pro-inflammatoires. Nous les avons appelé les "adipocytes associés au cancer» (CAA) (voir le document Dirat et al, 2011). Par la suite, en combinant des approches in vitro et in vivo, nous avons identifié pour la première fois qu'une partie des fibroblastes associés au cancer (CAF) qui participent activement à la progression tumorale proviennent de la «dédifférenciation» d’adipocytes matures. Nous avons nommé cette nouvelle population de cellules stromales "fibroblastes du tissu adipeux» (ADF). Ces derniers pourraient participer à la réaction desmoplastique composée de fibroblastes intégrés dans une matrice extracellulaire riche, communément trouvées dans le cancer du sein et pourraient ainsi promouvoir la dissémination tumorale (voir le document Bochet et al, 2013). Enfin, nous avons remarqué que l'une des caractéristiques clés des CAA est la perte de leur contenu en lipides observée à la fois in vitro et dans des tumeurs mammaires humaines. Étant donné que les cellules tumorales possèdent une grande plasticité métabolique en fonction de leur besoin énergétique et du microenvironnement tumoral, les CAA pourraient jouer un rôle dans la détermination du phénotype 11 métabolique des cellules tumorales. Mon travail se porte sur la caractérisation d’un nouveau dialogue métabolique entre les cellules du cancer du sein et les adipocytes environnants. Au cours de nos recherches, nous avons constaté qu’une partie de cette délipidation est due à la capacité de la tumeur (mais pas des cellules épithéliales mammaires normales) à induire la lipolyse dans les adipocytes. Les acides gras libres (FFA) libérés au cours du processus de lipolyse sont ensuite transférés, modifiés et stockées dans les cellules tumorales sous la forme de triglycérides (TG), contenu dans les gouttelettes lipidiques. En cas de besoin, ces TG peuvent être libérés sous forme de FFA par une voie lipolytique spécifiquement présente dans les cellules tumorales. Ces FFA libérés peuvent être utilisés pour la β-oxydation mitochondriale, une activité présente dans les cancers, mais pas dans les cellules épithéliales mammaires saines. De manière intéressante, cette βoxydation des lipides est positivement régulée dans les cellules tumorales co-cultivées avec des adipocytes et son inhibition, par des approches pharmacologiques ou de répression d’expression, diminue fortement, à la fois in vitro et in vivo, les capacités invasives des cellules tumorales qui ont été co-cultivées avec des adipocytes. Pour la première fois, dans des tumeurs primaires du sein, nos résultats ont identifié l'une des principales lipases, ATGL, comme étant fortement exprimée dans les cellules tumorales en contact des adipocytes comparé aux cellules situées à distance de la tumeur. Cette surexpression est intimement corrélée à un mauvais pronostic pour les patientes atteintes d’un cancer du sein. Ainsi, cette forte expression d’ATGL dans les cellules cancéreuses agressives leur confère une activité lipolytique élevée leur permettant d’utiliser les FFA dérivés des adipocytes pour augmenter leurs propriétés malignes via la β-oxydation des lipides (voir manuscrit Wang et al, 2013). En conclusion, notre travail a permis de fournir un concept important dans la compréhension du mauvais pronostic du cancer du sein dans la population grandissante de sujets obèses, mais également d'alerter sur le risque oncologique lié à une autogreffe de tissu adipeux (lipoaspiration) (voir la revue Wang, 2013). La compréhension des mécanismes symbiotiques entre les cellules cancéreuses et les adipocytes devrait révéler de nouvelles possibilités thérapeutiques. 12 PART I: THE TUMOR MICROENVIRONMENT. 1. Abnormalities in the microenvironment during tumor progression In the past four decades, many researchers have focused their work primarily on tumor cells. Mutations either on oncogenes or tumor suppressor genes are important for tumor initiation. However, the concept of “seed and soil” that an appropriate host microenvironment (the soil) is needed for the optimal growth of tumor cells (the seed) has been also proposed long time ago [1]. Evidences now indicate that solid tumors comprise not only neoplastic cells but also normal stromal cells that have been recognized as constituting a ‘tumor microenvironment’. The crosstalk between cancer cells and stromal cells plays an important role in tumor survival, growth, metastasis, and response to antitumor therapy by secreting growth factors, chemokines, extracellular matrix (ECM) components [2];[3];[4]. The surrounding and interwoven stroma provides a connective-tissue framework to the tumor tissue. This framework includes a specific type of Extracellular matrix (ECM)—the tumor matrix—as well as cellular components such as fibroblasts, immune and inflammatory cells, and blood-vessel cells. As its constitution resembles that of the granulation tissue formed during wound healing, Hal Dvorak even defined a tumor as “a wound that never heals” [5]. Cancer cells themselves can alter their adjacent stroma to form a permissive and supportive environment for tumor progression by secreting growth factors and proteases, which can act in autocrine and paracrine manners. Concomitantly, cancer cells initiate the secretion of specific promigratory and –invasive ECM components, along with their respective receptors, and reduce the expression of protease inhibitors. The imbalance between proteases and their inhibitors then lead to the degradation of ECM components, resulting in the mobilization of matrix-bound growth factors and the generation of reactive ECM fragments. Together with the tumor-derived growth factors, these factors then induce angiogenesis as well as recruit and activate stromal inflammatory cells, fibroblasts and adipocytes, leading to the secretion of additional growth factors and proteases to amplify these signals. This cascade results in the establishment of an activated stroma that promotes malignant tumor progression (Figure 1). The relative amount of stroma and its composition vary considerably from tumor to tumor and do not correlate with the degree of tumor malignancy [6]. But the interactive signaling between tumor and stroma contributes to the formation of a complex multicellular organ. In a manner similar to the development and function of normal organs, which occurs through reciprocal communication between different cell types, the interaction between cancer cells and their microenvironment can largely determine the phenotype of the tumor. For example, recent studies have shown that the establishment of human breast tumor xenografts in mice depends on the presence of human tumor13 derived stromal fibroblasts [7]. We will then first describe the main cellular component of the cancer stromal (vascular cells, inflammatory cells and fibroblasts) and their relative contribution in tumor progression. Figure 1. Crosstalk between tumor cells and their activated stromal surroundings. Tumor cells initiate the secretion of growth factors, ECM components, along with the imbalance between proteases and their inhibitors induce angiogenesis as well as recruit and activate stromal inflammatory cells, fibroblasts and adipocytes, leading to the secretion of additional growth factors and proteases to amplify these signals. (Mueller MM and Fusenig NE, 2004, Nat Rev Cancer). 14 2. Complex cellular components in solid tumors 2.1 Vascular cells Like normal vessels, tumor blood vessels are composed of endothelial cells, mural cells (pericytes or smooth muscle cells) and basement membrane. However, all of these components are morphologically and/ or functional different from their normal counterparts [8]. Tumor-associated endothelial cells (TECs) are the major player in the formation of tumor vasculature through sprouting from existing blood vessels (a process called ‘angiogenesis’). During blood vessel formation, endothelial cells proliferate, migrate and form the inner layer of a lumen, followed by basement membrane formation and pericyte attachment. Angiogenesis is stimulated by excessive pro-angiogenic factors secreted by tumor or stromal cells in an oxygen-depleted microenvironment. Hypoxia stabilizes the hypoxia-inducible transcription factors (HIF), one of the key roles of HIF in hypoxia is the induction of pro-angiogenic factors, including VEGF, angiopoietin-2, PDGF and FGF, and downregulation of anti-angiogenic factors, such as thrombospondin [9];[10];[11]. New blood vessel formation is critical for tumor development and progression, as it delivers nutrients and oxygen to growing tumor and removes metabolic wastes. In addition, vascular endothelial cells form a barrier between circulating blood cells, tumor cells and the extracellular matrix (ECM), thus playing a central role in regulating the trafficking of leukocytes and tumor cells [12]. In this regard, endothelial cells are critical for boosting a host immune defense against cancer cells and for controlling tumor metastasis. However, the ‘gatekeeping’ function of endothelial cells in tumors is heavily compromised. TECs are not tightly associated with each other, resulting in wider interendothelial junctions that cause plasma leakage and hemorrhage [13]. Consequently, tumor vasculature is often leaky and less efficient in blood perfusion, leading to increase interstitial fluid pressure, hypoxia and acidic extracellular pH that may significantly affect the delivery and efficiency of chemotherapeutic drugs. The leaky blood vessels also facilitate the intravasation of tumor cells and promote tumor metastasis. Several experiments have shown the difference between “normal” endothelial cells and endothelial cells within a tumor-context. For example, it has been reported that human hepatocellular carcinoma-derived endothelial cells, when compared to the ones from adjacent normal liver tissue, show increased apoptosis resistance, enhanced angiogenic activity and acquire more resistance to the combination of angiogenesis inhibitor with chemotherapeutic drugs [14]. Studies have also revealed distinct gene expression profiles of TECs and identified cell-surface markers distinguishing tumor versus normal endothelial cells [15]. In blood vessels, pericytes are smooth muscle cell-like cells that cover the vascular tube. They are intimately associated with endothelial cells and embedded within the vascular basement membrane, and play an important role in the maintenance of blood vessel integrity. Pericytes in tumors are 15 different from normal ones: in tumors, pericytes are often less abundant and more loosely attached to the endothelial layer [16];[17]. The abnormality in pericytes weakens the vessel wall and increases vessel leakiness. Thus, angiogenesis is the first compartment that as a good target for cancer therapies [18]. 2.2 Inflammatory/Immune cells Tumors are often infiltrated by inflammatory cells, such as macrophages, neutrophils, lymphocytes, mast cells, and myeloid progenitors. This phenomenon was initially observed by Rudolf Virchow more than a century ago and thought to be an immunological response attempting to eliminate cancer cells. Whereas immune cells play a role in recognizing and eradicating early cancer cells [19], mounting evidence has also shown that inflammatory cells within tumors can enhance tumor initiation and progression by helping cancer cells to acquire hallmark capabilities [4]. Epidemiologic and clinical studies show that approximately 25% of all human cancers in adults result from chronic inflammation [20]. For example, chronic viral or bacterial infection in stomach, liver and cervical, repeated solar irradiation of the skin, and prolonged exposure to tobacco smoke or other environmental chemicals in lung, contribute significantly to the chronic tissue injury and subsequently oncogenesis of these organs [21]. During this oncogenic event, persistent tissue injury result in changes in the cellular architecture of the epithelium and the surrounding stromal elements and promote genetic mutations and epigenetic alterations of epithelia cells. This change in tissue homeostasis can in turn lead to a chronic inflammatory response that never fades away, which then further promotes tumor growth, angiogenesis, invasion and metastasis through the activation of surrounding stromal cells and recruitment of different inflammatory cells. Among the abundant inflammatory cells, macrophages form a major inflammatory population in most tumors and are important determinants of the inflammatory milieu. Broadly speaking, macrophages can be defined as classically (M1) or alternatively (M2) activated. M1 macrophages are involved in Type 1 reactions and are classically activated by microbial products, killing microorganisms and producing reactive oxygen and nitrogen intermediates. In contrast, M2 cells (Tumor associated macrophages; TAMs) are important component of infiltrated leukocytes in most malignant tumors, M2 macrophages can be identified using a number of markers, since they express arginase, mannose receptor, high-level IL-10, low level MHC II and IL-12. They produce many tumor-promoting factors, like EGF and VEGF, release cytokines and enzymes that promote angiogenesis and local and distant invasion, like VEGF and MMP9 and down-regulate expression of anti-angiogenic factors, like IL-12 to facilitate tumor progression [22];[23];[24]. Macrophages are derived from CD34+ bone marrow progenitors that continually proliferate and shed for their progeny into the bloodstream as pro-monocytes. In breast cancer, infiltrating TAMs correlate with 16 poor prognostic features, higher tumor grade, high vascular grade, increased necrosis and decreased disease-free survival [25]. Recently, one study found that CCL18 was highly expressed in TAMs and promoted the invasion and metastasis of cancer cells by triggering integrin clustering and enhancing their adherence to the ECM [26]. Other components of the inflammatory infiltrate also modulate tumor behavior. T-regulatory (Treg) cells were first identified in 1971 by Gershon and Kondo [27], followed by reports of T cells suppressing the anti-tumor immune response, and then by identification of CD4+ T cells that suppressed autologous cytotoxic anti-tumor immune response [28]. These T cells are now classified as CD4+, CD25+, FoxP3+ and are thought to protect the host from autoimmune disease by suppressing self-reactive cells and therefore also blocking anti-tumor responses. Neutrophils also generate ECM degrading enzymes, reactive oxygen and nitrogen species. These bioactive factors promote cancer cell proliferation, invasion and resistance to apoptosis through, for instance, the interleukin-JAK/STAT pathway [29], and induce new blood vessel formation in the tumor. Extracellular matrix-degrading enzymes promote cancer cell invasion and metastasis, whereas accumulation of reactive oxygen and nitrogen species can cause DNA mutations, suppress DNA repair enzymes, increase genomic instability, and aggravate cancer progression. While the tumor-promoting effects of infiltrating inflammatory cells have been well documented, certain types of immune cells, particularly cytotoxic T cells and natural killer cells, exhibit antitumor activities. The high numbers of these cells within a tumor predict a favorable prognosis [30];[31]. Immune surveillance is considered as an important mechanism to inhibit carcinogenesis and maintain tumor dormancy [19]. Evading immune destruction by downregulating tumor antigens, suppressing immune cell function and other means is an emerging hallmark of cancer cells and plays important roles in cancer progression and metastasis [4]. 2.3 Fibroblasts 2.3.1 Origin and markers of cancer-associated fibroblasts (CAFs) Fibroblasts are elongated cells that show a fusiform or spindle-like shape in profile. Fibroblasts were first described in the late 19th century. They are the non-vascular, non-epithelial and noninflammatory cells of the connective tissue and are its principal cellular component [32]. They are embedded within the fibrillar matrix of the connective tissue and are, to a large extent, responsible for its synthesis. Fibroblasts in mammals are highly heterogeneous, a recent study comparing the genome-wide expression patterns of 50 human fibroblast cultures isolated from 16 different sites showed that gene-expression patterns among fibroblast populations from distinct anatomical sites are as divergent as the gene-expression patterns observed among distinct lineages of white blood cells [33]. The major functions of fibroblasts include the deposition of ECM, the regulation of 17 epithelial differentiation, and the inflammatory responses [34]. Such increased activity is referred to as ‘activation’ (figure 2). Once the wound is repaired, the number of activated fibroblasts decreases significantly and the resting phenotype is thought to be restored. Unlike wound healing, but similar to organ fibrosis, the fibroblasts at the site of a tumor remain perpetually activated. This leads to tumor desmoplasia through excessive ECM deposition. It has been demonstrated that cancer-associated fibroblasts (CAFs) are extremely abundant in the stroma of many tumors, including breast, prostate and pancreatic carcinomas [35];[36]. Of note is that CAFs are heterogeneous populations and their relative composition is greatly different among different tumors. The main activation markers are α-Smooth Muscle Actin (α-SMA), FibroblastSpecific Protein (FSP), Platelet-Derived Growth Factor (PDGF) receptor-β and Fibroblast Activation Protein (FAP) [37];[35]. This large heterogeneity in marker expression for CAF subpopulations or in CAFs originating from different tumors may be explained by their possible miscellaneous origin. Indeed, CAFs are variously reported to stem from resident fibroblasts, bone marrow-derived progenitor cells, or from endothelial or cancer cells through endothelialmesenchymal transition or epithelial-mensenchymal transition (EMT) [38] or a brand new origination from adipocytes (see article 2). At present, neither the origin of these cells, nor the extent to which their origin determines their contribution to tumor progression can be unanimously agreed upon. The normal stroma in most organs contains a minimal number of fibroblasts in association with a physiological ECM whereas the reactive stroma is associated with an increased number of fibroblasts, enhanced capillary density and type-I-collagen and fibrin deposition. To date, transforming growth factor-β (TGFβ) and CXCL12/SDF-1 are regarded as the major tumor cellderived factors affecting CAF activation through a TGFβ and CXCL12/SDF-1 autocrine signaling loop. Other profibrotic factors releases by cancer cells like epidermal growth factor (EGF), plateletderived growth factor (PDGF) and fibroblast growth factor 2 (FGF2) can also act on resident fibroblasts and induce their activation [39]. Another important mechanism in the activation of CAFs is the downregulation of tumor suppressor genes such as p53, p21, PTEN, and caveolin-1 (CAV-1) [25]. 2.3.2 The role of CAFs in cancer progression: Secretion of soluble factors CAFs produce growth factors, cytokines, chemokines and ECM proteases to stimulate angiogenesis and cancer cell proliferation and invasion (figure 3) [40]. The existence of a large number of CAFs in tumors is often associated with poor prognosis [41]. Hepatocyte growth factor (HGF), EGF, bFGF, as well as cytokines such as SDF-1 and IL-6, are all substantially expressed by CAFs upon 18 contact with different tumor histotypes. For example, CAFs secret elevated levels of stromal cellderived factor 1 (SDF-1; also called CXCL12) that facilitates angiogenesis by recruiting endothelial progenitor cells into the tumor [42]. SDF-1 can also interact with the CXCR4 receptor expressed on the surface of cancer cells, thus stimulating tumor cell growth and promoting tumor progression in vivo [43]. Furthermore, in breast adenocarcinoma, SDF-1 secreted by CAFs has been found driven by hypoxia-inducible factor-1 (HIF-1), which is in turn activated by hypoxia-mediated oxidative stress [44]. CAFs might contribute to epithelial-to-mesenchymal transition (EMT) in nearby cancer cells and promote their invasiveness [40]. TGFβ, another factor produced by CAFs, is a critical mediator of the EMT; IL-6 has been found to be 100-fold increased expression in CAFs compared with non-cancer-associated fibroblasts and also induces EMT in ER-positive breast cancer cell lines (MCF7, T47D) [45]. CAFs are also able to secrete several members of the MMP family as well as plasminogen activators. These enzymes may act mainly through 3 pathways below: 1) direct degradation of ECM; 2) cleavage of membrane-bound growth factors or cytokines as well as their receptors; 3) cleavage of cell adhesion molecules like cadherins, leading to an increased motility and EMT [46]. The expression of tumor (MMP1, MMP2 and MMP14) and stromal (MMP9, MMP13 and MMP14) matrix metalloproteinases is mandatory for squamous cell carcinoma progression [47]. MMP9 directly cleaves the extra-cellular domain of E-cadherin, promoting normal mammary epithelial cells to disaggregate and undergo EMT, promoting cancer-cell invasiveness [48]. MMP13 secreted by CAFs promotes tumor angiogenesis by releasing VEGF from the ECM, thereby leading to the increased invasion of squamous cell carcinoma or melanoma [49]. MMP1 also shows such a tumorpromoting effect. The protease-activated receptor PAR1, which is a tethered-ligand receptor, is activated by proteolytic cleavage of the extracellular domain by MMP1, promoting cancer cell migration and invasion through PAR1-dependent Ca2+ signals [50]. Alongside MMPs, CAFs from colon and breast carcinoma also express uPA and its receptor uPAR [51]. Cancer cells engage with their stromal fibroblasts a specific feed-forward loop mediated by paracrine bFGF and EGF, which induce uPA transcription in the fibroblasts. In turn, the serine protease system helps in activating these paracrine factors from the tumor cell surface/ECM [52]. 19 Figure 2. Activated fibroblasts. a. Normal fibroblasts are embedded within the fibrillar ECM of connective tissue, which consists largely of type I collagen and fibronectin. b. Fibroblasts can acquire an activated phenotype, which is associated with an increased proliferatvie activity and enhanced secretion of ECM protein such as type I collagen and tenascin C, and also fibronectin that contains the extra domain a (EDAfibronectin) and SPARC (secreted protein acidic and rich in cysteine) (Kalluri and Zeisberg, 2006, Nat Rev Cancer). Figure 3. Origins and functions of CAFs. A number of origins have been proposed for CAFs, including bone marrow-derived cells (BDMC), response of normal fibroblasts to tumor-derived signals, genetic and epigenetic alterations in normal fibroblasts, or epithelial-mesenchymal transition (EMT) of normal or tumor epithelial cells. They have many effects on tumor cells (Allen M and Louise Jones J, 2011, J Pathol). 20 ECM remodelling CAFs also generate an altered ECM environment. Most solid tumors exhibit a very different profile of ECM proteins in the stroma compared to their normal counterparts, and many of these proteins interact directly with tumor cells, via integrins and other cell surface receptors, to influence functions such as proliferation, apoptosis, migration and differentiation [53]. CAFs retain a major role in ECM remodeling since they are mainly responsible for the production of ECM proteins (i.e. collagens, fibronectin) as well as proteases and other enzymes involved in the posttranslational modification of ECM proteins themselves. Invasive carcinoma is often associated with expansion of the tumor stroma and increased deposition of ECM. Such increased deposition of ECM in tumors is known as desmoplasia. Indeed, many cancers are associated with desmoplasia, a fibrotic state characterized by an accumulation of type I and III collagens and by a degradation of type IV collagen [54];[55]. Tumor desmoplasia has been associated with the poor prognosis of cancers and it has also been observed in metastatic sites [56]. One way in which tensile strength can be modulated is via lysyl oxidase (LOX), an enzyme secreted primarily by fibroblasts that serves to cross-link collagens and elastin, increasing the insoluble matrix and contributing to tensile strength [57]. Recently, in a mouse model of breast carcinoma, treatment with LOX inhibitors led to a decrease of ECM cross links, preventing ECM stiffening and delaying tumor progression [58]. LOX pre-conditioning and stiffening of the mouse mammary fat pad also resulted in growth and invasion of premalignant mammary cells, suggesting that increased ECM stiffness can promote tumorigenesis as well as alter established tumor behavior [58]. In addition, ECM rigidity in tumor contributes together with impaired vascular and lymphatic mesh, to increase interstitial fluid pressure, leading to a reduced chemotherapeutics delivery inside tumors [59]. Together with ECM stiffness, interstitial flow is an important mechanical stress in the tumor stroma. It drives TGF-β1 and MMP-dependent fibroblast tissue invasion which, in turn, enhances tumor cell invasion by ECM remodeling [60]. These findings confirm that CAFs may serve as guidance structures that direct the migration of epithelial cancer cells by inducing proteasemediated ECM remodeling. Fibronectin (FN) and hyaluronan—two other ECM components, mostly produced by CAFs, have been shown to play a role in tumor microenvironment. In tumors, there is frequent up-regulation of the ‘oncofetal’ forms of FN that contain extra-domain (ED)A, (ED)B, and IIICS sequences [61]. FN-EDA is required for the transduction of TGFβ signals, and the conversion of fibroblasts to myofibroblasts [62], whereas FN-EDB is particularly associated with neovascular structures in many different tumor types [63]. Stromal FN is positively associated with human tumor metastatic potential and MMP secretion [56], in addition, FN regulates ovarian cancer metastatic potential by promoting a ligand-independent activation of the c-Met proto-oncogene through binding to α5β1 21 receptor [64]. Vascular endothelial growth factor (VEGF) can be released by cancer cells themselves, but fibroblasts and inflammatory cells are also the principal source of host-derived VEGF. It induces microvascular permeability, which leads to the extravasation of plasma proteins such as fibrin, which in turn attract an influx of fibroblasts, inflammatory cells and endothelial cells. These cells produce ECM that is rich in fibronectin and type I collagen, both of which are conducive to initiating tumor angiogenesis [65]. CAFs mediated the overexpression of hyaluronan within the tumor microenvironment, and it has been shown to have a role in the recruitment of tumor-associated macrophages, which are key regulatory cells involved in tumor neovascularization through endothelial cell recruitment [66]. Tumor metabolism remodeling Cancer cells mainly use glucose by glycolysis, producing lactate even in the presence of oxygen, a metabolic phenomenon called: Warburg Effect or Aerobic Glycolysis, whilst normal cells fully exploit glucose by oxidative phosphorylation. Recently, accumulating evidence showed that CAFs participate in the complex metabolism of tumors, engaging a bidirectional liaison with tumor cells, prompting them to overcome energy depletion due to the Warburg effect (This specific role of CAFs will be described in the third part of my thesis). 2.4 Adipocytes Among the different cell types frequently found at close proximity of evolving tumors, little attention has been given to cells that compose the adipose tissue although a growing interest can be noted in recent years. Adipose tissue (AT) is consisting of mainly mature adipocytes and progenitors (preadipocytes and adipose-derived stem cells, ADSCs) that are contained in stroma vascular fraction (SVF). The role of adipose tissue, and more specifically adipocytes, in tumor initiation, growth, and metastasis, is a relatively new area of investigation. Emerging studies including our results clearly indicate that a bidirectional crosstalk is established between cellular components of AT and cancer cells and that the tumor-surrounding AT contributes to inflammation [67];[68], ECM remodeling [69];[70] as well as energy supply within the tumors [71]. Moreover, obesity is an epidemic problem nowadays in the world and is associated with several healthy problems including cancer. In next part, we will make an overall description of AT composition and function with special emphasis on the specificity of adipose depots, key aspects that need to be taken in account when paracrine effects of AT on tumor progression is considered. Try to deciphering the cellular and molecular mechanisms involved in it and to better understand the link between obesity and the poor prognosis of some cancers. 22 PART II: ADIPOSE TISSUE AND CANCER INTERACTION 1. The adipose tissue (AT) overview For decades, adipose tissue was considered an inert mass of stored energy with some advantageous properties, such as its function as an insulating substance and as a mechanical support for more important structures. However, over the last two decades has seen a surge of interest in the study of adipose tissue, from its developmental biology to its physiology. What accounts for this new found respect for adipocytes? The discovery of leptin in 1994 presaged a growing awareness that adipocytes are essential regulators of whole-body energy homeostasis. These cells have been established as a dynamic organ that carries out several important physiological processes as diverse as haemostasis, blood pressure, immune function, angiogenesis and energy balance [72]. Another reason for the surge in interest in adipocytes is the awareness of abnormal fat accumulation is associated with healthy problems. For example, it is well known that overweight and obese individuals have a substantially greater risk of developing chronic diseases, such as cardiovascular disease (mainly ischemic heart disease and stroke), diabetes, respiratory failure, musculoskeletal disorders (especially osteoarthritis), and also cancer (endometrial, breast, kidney and colon) [73]. Hence, it is clear that a better understanding of the mechanisms linking adipose tissue development, function and expansion is required to improve our chances of identifying the most successful therapeutic approaches. Adipose tissues are organized to form a large organ with discrete anatomy, specific vascular and nerve supplies, complex cytology, and high physiological plasticity [74];[75]. There are two main types of adipocyte, brown and white, which differ in several important properties (as discuss below). Even among white adipocytes, cells from different locations can have distinct molecular and physiological properties. The various adipose depots are the subcutaneous depots (inguinal, femoral, abdominal) which present in the deep layer of the skin, the visceral depots (mesenteric, omental, retroperitoneal, epididymal, gonadal, perivascular, and pericardial depots) [76], mammary depots and the bone marrow depots (Figure 4). All these specific regional depots exhibit differences in structure, function, composition, and secretion profiles. This is more evidently demonstrated by the links revealed between increased deep abdominal or visceral, but not peripheral, fat extent, and the metabolic disturbances associated with obesity [77]. 23 Figure 4. Distribution of adipose tissue in human body. White adipose tissue, mainly composed of adipocytes, is located in subcutaneous (inguinal femoral in women) and in abdomen where it surrounds the internal organs (visceral adipose tissue). The adipose tissue is also found in bone, women-breast and around the men`s prostate (Laurent V et al, 2013, Médecine/sciences) Figure 5. Components of adipose tissue. Adipocytes are the main cellular component of adipose tissue, the other cell types that are present are precursor cells (including pre-adipocytes), fibroblasts, vascular cells and immune cells and these cells constitute the stromal vascular fraction of adipose tissue (SVF). (Ouchi N et al., 2011, Nat Rev Immunol) 24 2. The adipocytes Adipose tissue is largely composed of adipocytes, but also contains a stromal vascular fraction made up of pericytes, endothelial cells, monocytes, macrophages, and pluripotent stem cells (Figure 5) [78];[79]. Two main types of adipocytes are easy to distinguish by morphology: white adipocytes are spherical cells with ~90% of their volume comprising a single cytoplasmic lipid droplet and a ‘squeezed’ nucleus, whereas brown adipocytes are polygonal cells with a roundish nucleus and several cytoplasmic lipid droplets (Figure 6). Brown adipocytes are also characterized by numerous large mitochondria packed with cristae. Mitochondria in brown adipocytes are marked by the expression of uncoupling protein 1 (UCP1), a unique protein that uncouples oxidative phosphorylation from ATP synthesis and thereby results in the production of heat (thermogenesis) [80];[81];[82]. Thus, white and brown adipocytes are quite different in their morphology and physiology: white adipocytes store energy for the metabolic needs of the organism, whereas brown adipocytes burn energy for thermogenesis. Both cell types are contained in the multiple depots of the adipose organ [83];[84]. White adipocytes are considered the dominant adipocyte subtype in adult humans with different sizes present in subcutaneous depots (mainly large adipocytes) and visceral depots (mainly small adipocytes) [85];[86]. Most brown adipose tissue in rodents is localized to the interscapular region. In human fetuses and newborns, BAT is found in axillary, cervical, perirenal, and periadrenal regions [80] but decreases shortly after birth and has traditionally been considered insignificant in adults, except perhaps in patients with pheochromocytoma, where adrenergic activity is extremely high [87], or in outdoor workers in northern climes subject to prolonged cold exposure [88]. A third type of adipocyte, the ‘beige’ or ‘brite’ (brown in white) adipocyte, has recently been identified which are the cells with intermediate morphology between that of white and brown adipocytes and has characteristics of both white and brown adipocytes. Like white adipocytes, basal UCP1 expression is low in beige adipocytes. However, like brown adipocytes, beige adipocytes respond to cyclic AMP (cAMP) stimulation by an increase of UCP1 expression [89];[90];[91]. 25 Figure 6. Left, Electron microscopy of murine white adipose tissue. The small and elongated mitochondria in the perinuclear area and in the thin rim of cytoplasm surrounding the large unilocular lipid droplet. F, fibroblast; CAP, capillary lumen; Ma, macrophage; M, mitochondria; N, nucleus; L, liquid droplet. Bar = 2 μm Right, Light microscopy of human brown adipose tissue. The characteristic multilocular lipid organization of the cytoplasm of adipocytes. Bar = 15 μm (Saverio Cinti, 1999, The Adipose Organ). 26 2.1 The cellular origins of adipocytes and their differentiation In the recent past, it was largely accepted that both brown and white adipocytes arose from resident mesenchymal progenitor cells that were present in adipose tissue. This idea was supported by evidence indicating that both brown and white adipocytes require PPARγ for development. However, the notion that brown and white cells arise from a similar origin is outdated. Brown adipocytes instead share a common MYF5+PAX7+ precursor with muscle cells [92]. The MYF5+PAX7+ precursor is driven to brown adipocyte terminal differentiation by bone morphogenetic protein 7 (BMP7), peroxisome proliferator activated receptor-γ (PPARγ) and CCAAT/enhancer-binding proteins (C/EBPs) cooperating with the transcriptional co-regulator PR domain-containing 16 (PRDM16). By contrast, PRDM16 does not affect white adipogenesis. White adipocytes can also be stimulated to display characteristics of brown adipocytes by β-adrenergic signaling, cold exposure and thiazolidinediones, which seem to function through the indicated factors (Figure 7). These results suggest that brown cells in BAT and brown fat-like cells in WAT have different cellular origins, and the transcriptional modulator PRDM16 plays an important role in both of these cell types to regulate genes required for thermogenesis [93]. There is also evidence to indicate that bone marrow progenitor-derived adipocytes and adipocyte progenitors can arise from hematopoietic cells via the myeloid lineage [94]. Collectively, these recent studies suggest that our understanding of the origin of adipocytes is rapidly changing, and additional studies will be necessary to clarify our understanding of this emerging area of biology. Despite the functional, developmental and locational differences between white and brown adipocytes, these two cell types share many common differentiation features. All adipocytes, along with osteoblasts, myocytes and chondrocytes, differentiate from mesenchymal stem cells (MSCs) [95] in a process known as adipogenesis. Adipogenesis can be divided into two main phases: determination and terminal differentiation. The first phase involves the commitment of a pluripotent stem cell to the adipocyte lineage. Determination results in the conversion of the stem cell to a preadipoctye, which cannot be distinguished morphologically from its precursor cell but has lost the potential to differentiate into other cell types. In the second phase, the pre-adipocyte takes on the characteristics of the mature adipocyte—it acquires the machinery that is necessary for lipid transport and synthesis, insulin sensitivity and the secretion of adipocyte-specific proteins. Over the past two decades, attention has centred on the role of the nuclear receptor PPARγ and members of the C/EBP family in adipogenesis. We briefly discuss the important functions of these factors in adipogenesis. 27 Figure 7. Relationship between white and brown adipogenesis. Historically, white and brown adipocytes were thought to derive from the same precursor cell. However, brown adipocytes instead share a common MYF+PAX7+ precursor with muscle cells. MYF+PAXA7+ precursor is driven to brown adipocyte terminal differentiation by BMP7, PPARγ and C/EBPs with PRDM16. White adipocytes can also be stimulated to display characteristics of brown adipocytes by β-adrenergic signaling, cold exposure and thiazolidinediones. MSC, mesenchymal stem cell; MYF5, myogenic factor 5; PAX7, paired-box 7; PGC1α, PPARγ co-activator 1α (Ana G. Cristancho and Mitchell A. Lazar, 2011, Nat Rev Mol Cell Biol). 28 PPARγ: the master regulator of adipogenesis. PPARγ is a member of the nuclear-receptor superfamily, and is both necessary and sufficient for adipogenesis. Forced expression of PPARγ is sufficient to induce adipocyte differentiation in fibroblasts [96], and no factor has been discovered that promotes adipogenesis in the absence of PPARγ. These findings are consistent with the observation that most pro-adipogenic factors seem to function at least in part by activating PPARγ expression or activity. Studies using in vitro models of adipogenesis have consistently shown that PPARγ mRNA is induced by several transcription factors, including C/EBPβ, C/EBPδ, EBF1, and KLF5. Repressors of adipogenesis such as GATA2, KLF2, and CHOP have been shown to attenuate PPARγ expression [97]. Moreover, crucial signaling pathways in adipogenesis converge on the regulation of PPARγ expression or activity. PPARγ proteins are expressed in two forms, PPARγ1 and PPARγ2, which are produced by a combination of differential promoter usage and alternative splicing [98]. PPARγ1 is expressed at low levels in multiple tissues, whereas PPARγ2 is highly expressed in fat cells and differs from PPARγ1 by an amino-terminal extension of 30 amino acids [99]. Two studies have addressed the relative adipogenic activity of the PPARγ isoforms without coming to a consensus. Ren et al have shown that ectopic expression of PPARγ2 rescues adipogenesis, whereas expression of PPARγ1 does not [100]. By contrast, Mueller et al showed that both PPARγ1 and PPARγ2 can promote differentiation in Pparγ-/-fibroblasts; however, PPARγ2 is slightly more efficient at promoting adipogenesis [101]. In vivo studies have shown that mice with adipose tissue-specific loss of PPARγ display decreased fat pad size and insulin resistance in adipose tissue and liver [102]. Although PPARγ is required for adipogenesis, there is evidence to suggest that this nuclear receptor may not be needed to maintain the differentiated state of the cell after adipogenesis [103]. The importance of PPARγ in human adipose tissue has also been established, and subjects with mutations in the PPARγ gene can develop severe insulin resistance and lipodystrophy [104];[105]. Taken together, these studies show the requirement for PPARγ in adipocyte differentiation and whole-body insulin sensitivity. C/EBPs C/EBPs comprise another family of basic leucine zipper transcription factors. There are six C/EBP isoforms, all of which possess a highly conserved bZIP domain that serves as a point of interaction for homodimerization or heterodimerization with other family members [106]. The most common nomenclature for the members is C/EBPs α, β, δ, γ, ε and ζ. The temporal expression of these factors during adipocyte differentiation indicates a cascade whereby early induction of C/EBPβ and C/EBPδ leads to induction of C/EBPα. The notion is further supported by sequential binding of these transcription factors to several adipocyte promoters during differentiation. Loss of function 29 experiments in 3T3-L1 and NIH-3T3 cell lines confirmed the importance of C/EBPβ and –δ, as inhibition of either of these C/EBPs resulted in the attenuation of adipogenesis [107]. C/EBPβ and C/EBPδ promote adipogenesis at least in part by inducing C/EBPα and PPARγ. The amounts of C/ebpa and Pparg mRNA are normal in the remaining adipocytes of these double-knockout mice in contrast to C/EBPβ- and C/EBPδ- deficient MEFs, which do not express C/EBPα and PPARγ [108]. Despite the importance of C/EBPs in adipogenesis, these transcription factors can`t function efficiently in the absence of PPARγ. For example, C/EBPβ cannot induce expression of C/EBPα in the absence of PPARγ, which is required to release histone deacetylase-1 (HDAC1) form the C/ebpa promoter [109]. Furthermore, the ectopic expression of C/EBPα cannot rescue adipogenesis in Pparg-/- fibroblasts [110]. However, C/EBPα has an important role in differentiated adipocytes. Expression of exogenous PPARγ in C/EBPα-deficient cells showed that, although C/EBPα is not required for accumulation of lipid and the expression of many adipocyte genes, it is necessary for the acquisition of insulin sensitivity [111]. WNT signaling WNT family members are secreted glycoproteins that have key roles during development. Canonical WNT signaling is activated following the binding of WNT ligands to the heterodimeric cell surface receptors low-density lipoprotein receptor-related 5 (LRP5), LRP6 and Frizzled. This induces the family of T cell-specific transcription factors (TCFs) to recruit a β-catenin-dependent co-activator complex to activate target gene transcription. Canonical WNT signaling has been shown to inhibit adipogenesis [112]. Mice expressing WNT10B, the main WNT ligand expressed by preadipocytes, in adipocytes show a decrease in WAT and BAT mass [113]. WNT10B promotes osteogenesis in MSCs, indicating that canonical WNT signaling also regulates brown adipogenesis and MSC cell fate [114]. WNT signaling maintains preadipocytes in an undifferentiated state through inhibition of the adipogenic transcription factors C/EBPα and PPARγ [115]. Repression of WNT10B in white primary preadipocytes is required for adipocyte differentiation [116].However, there is evidence that the canonical WNT pathway is essential for the survival of pre-adipocyte. WNT10B levels increase in confluent cultures of 3T3-L1 cells [115], and WNT1 can protect preadipocytes from apoptosis [117]. WNT ligands can also signal through β-catenin-independent pathways, a process known as noncanonical signaling, by signaling through alternative cell surface receptors and activating different intracellular pathways. The non-canonical WNT ligand WNT5A activates the histone methyltransferase SET domain bifurcated 1 (SETDB1) which involve in inhibiting the ability of PPARγ. Thus, WNT5A inhibit the adipogenesis and it can promote osteogenesis in MSCs [118]. By 30 contrast, the non-canonical WNT ligand WNT5B through preventing nuclear translocation of βcatenin to inhibit the canonical WNT pathway, thereby promoting adipocyte differentiation [119]. Despite these main factors gave the field a starting point, other new factors like signal transducers and activators of transcription (STATs), Kruppel-like factor (KLF) proteins, TGFβ superfamily signaling, the composition and stiffness of the ECM and cell-cell contact and cell shape also play a key role to promote preadipocyte differentiation into mature adipocytes [120]; [92]. 2.2 Model systems used to study adipocyte in vitro A variety of cellular model systems are used to study the molecular pathways of adipogenesis and adipocyte function in vitro. These models can mainly be separated in two categories. The first group includes pluripotent fibroblasts that have the ability to differentiate into several cell types, including myocytes, chondrocytes, and adipocytes. This group includes the 10T1/2, BALB/c-3T3, RCJ3.1, and CHEF/18 fibroblast cell lines. The second group of model systems comprises fibroblast like preadipocytes that are committed to differentiating into adipocytes and includes 3T3-L1, 3T3F442A, 1246, Ob1771, TA1, and 30A5 preadipocytes. The latter group represents the cells used most frequently to study adipogenesis [120]. 3T3-L1 and 3T3-F442A are the two most extensively characterized and used preadipocyte cell lines. Both of these lines were derived from disaggregated 17- to 19-day-old Swiss 3T3 mouse embryos [121];[122]. However, unlike 3T3-L1 cells, 3T3-F442A preadipocytes do not require glucocorticoid-supplemented differentiation cocktail to induce adipogenesis [123];[124];[125]. It is commonly believed that 3T3-F442A precursors are at a more advanced stage of commitment than 3T3-L1`s. Implantation of 3T3-F442A, but not 3T3-L1, preadipocytes into athymic mice results in the generation of ectopic fat that is histologically [126] and biochemically [127] indistinguishable from adipose tissue. An original 2D coculture system setup in our laboratory using human breast cancer cell lines and in vitro differentiated 3T3-F442A adipocytes mimics the adipocytes changes observed at the invasive front of breast tumors [68], underscoring the validity of these mouse models in cancer studies. Mature adipocytes can also be obtained from the in vitro differentiation of the SVF of adipose tissue (that contains ADSCs) from human and rodents in defined culture conditions either in 2D or 3D culture systems [128];[129]. A clear limitation of the use of these human and murine pre-adipocyte cell lines and primary precursors present in the SVF fraction is that they are not suitable models to study obesity-related condition due to their inability to undergo hypertrophy in vitro. Therefore, the use of mature adipocytes isolated from AT of lean and obese subjects should be considered. Indeed, the isolation of adipocytes from the extracellular matrix and the SVF fraction is a technique available in many laboratories whatever the AT considered including MAT [68].Briefly, collagenase treatment of AT 31 release the fat cells from extra-cellular matrix. Fat cells, owing to their own fat content are floating and the SVF fraction remains in the pellet [128]. Coculture system using this source of cells to obtain insight into the crosstalk with tumor cell population is clearly limited by the fact that these isolated mature adipocytes cannot be used for long terms culture. Isolated adipocytes in suspension in an appropriate culture medium remain viable for approximately 24 h but after this period both survival and function are profoundly altered [128]. Primary culture of AT explants represents a useful alternative to both improve adipocyte viability and preserve the entire tissue environment and structure. Several laboratories have been using adipose tissue explants culture to study the influence of various pharmacological or nutritional factors. Adipocytes can also be isolated from the explants after the treatment in order to focus on the fat cell itself [130]. However, such a tri-dimensional structure in vitro do not allow an accurate oxygen and nutrients supply during long term periods leading to hypoxia-induced alterations of adipocyte function such as for example an increased anaerobic glycolysis or TNFα accumulation [131]. Therefore, adipose tissue explants must thus be considered as useful over less than 48h period after culture. Again, 3D culture of isolated adipocytes from lean and obese subjects on various scaffolds remains the most promising alternative for long-term coculture, model which is currently largely untapped with the exception of some studies using isolated adipocytes from rat and mice AT [132];[133]. 3. Physiological functions of adipose tissue In mammalian cells, lipid droplets (LDs) consist of a core of neutral lipids, predominantly triacylglycerols (TAGs) or cholesterol ester, surrounded by a phospholipid monolayer and separated from the hydrophilic cytosolic environment by a coat of structural proteins. Several types of proteins decorate LDs, including structural proteins which are characterized by the presence of a conserved N terminal motif defined as a PAT domain, named after perilipin, adipophilin (also called adipocyte differentiation-related protein, ADRP), and tail-interacting protein of 47kDa (TIP47) but also including OXPAT/MLDP and S3-12 [134]; Lipid-synthesis enzymes (acetyl coenzyme A carboxylase, acyl-CoA synthetase and acyl-CoA: diacylglycerol acyltransferase 2, DGAT2) [135]; lipase and membrane-trafficking proteins (Rab5, Rab18 and ARF1) [136]. Different LDs in a cell can contain different proteins suggests that cells contain distinct types of LDs with specialized functions. The neutral lipids that are stored in LDs are used for metabolism, membrane synthesis (phospholipids and cholesterol) and steroid synthesis. In addition, LDs have a crucial role in storing cholesterol in the form of cholesterol esters, as part of the complex homeostatic mechanisms that are involved in regulating the level of intracellular free cholesterol. Indeed, during times of increased food intake and/or decreased energy expenditure, surplus energy is deposited efficiently 32 in adipose tissue in the form of neutral triglycerides. This process is mediated by key lipogenic enzymes. However, when food is scarce and/or energy expenditure requirements increase, lipid reserves are released to provide fuel for energy generation. Therefore, adipocytes also contain “lipases” that break down triglycerides into glycerol and fatty acids that can then be transported in the blood to the liver, muscle, and BAT, where they are used in fatty acid oxidation. There is also evidence that glycerol and FFA can be reesterified in adipocytes, thereby allowing FFA flux to be acutely regulated. Therefore, the principal functions of WAT are to store excess energy as triglycerides, in large unilocular droplets, to release it in the form of FFA and to secrete large panel of adipokines that critical to regulate physiology process. 3.1 Lipid droplet biogenesis Despite recent progress in lipid droplet biology (Figure 8), first, we need to solve several fundamental questions. 1) How and where are lipid droplets formed? While several theories on lipid droplet biogenesis exist, the most widely accepted model states that neutral lipids are synthesized between the leaflets of the ER membrane. Fatty acids can be released from TAGs or be synthesized de novo from carbohydrates in many cell types, they are carried extracellularly by albumin and lipoproteins enter cells to a bioactive pool through conjugation to CoA, forming fatty acyl-CoA, in an energy requiring reaction. Fatty acyl-CoA is used by glycerolipid-synthesis enzymes in the ER to ultimately generate diacylglycerols (DGs). DGs are either converted to neutral lipids (TGs) by DGAT enzymes or enter phospholipid-synthesis pathways. The mature LD is then thought to bud from the ER membrane to form an independent organelle that is contained within a limiting monolayer of phospholipids and associated LD proteins [137]. Members of both the Rab and ADPribosylation factor (ARF) families of small GTPases, caveolins and phospholipase D (PLD) are proteins that intimately linked to vesicular transport, membrane fusion and cytoskeletal motility. 2) How lipid droplets growth? One possibility is that LDs, like balloons, expand as single organelles. Proteins and newly synthesized lipids could diffuse laterally to the LDs when LDs attached to the ER; It is also postulated that smaller LDs from newly formed TAG could fuse together to form larger lipid droplets [138]. 3) Does LDs have intimate interaction with other cellular organelles? In particular, LDs are often found in close approximation with the ER, mitochondria, endosomes, peroxisomes and the plasma membrane [139]. These organelle associations might facilitate the exchange of lipids, either for anabolic growth of LDs or for their catabolic breakdown. In addition, to help adipocytes deal with large amounts of incoming FAs it has been suggested that both lipid droplet biogenesis and growth may occur at the plasma membrane [140]. 33 Figure 8. Lipid droplets at a glance. (Yi Guo, et al, 2009, J Cell Sci) 34 3.2 Fat mobilization from lipid droplets The hydrolysis of the triglycerides stored in the fat cell is a complex phenomenon involving lipases, plasma membrane transporters, fatty acid binding proteins and proteins associated with the lipid droplet. Previously, hormone sensitive lipase (HSL) was considered to be the rate-limiting enzyme in TAG hydrolysis [141]. However, HSL knockout mice were not obese and accumulated diacylglycerol (DAG) in adipose tissue rather than that TAG, implicating HSL as primarily a DAG lipase and suggesting the presence of additional novel lipase in adipocytes. In 2004, a novel TAG lipase was reported by three groups and given three different names: desnutrin, adipocyte triglyceride lipase (ATGL), and phospholipase A2ζ [459]; [460]; [146], leading to re-evaluation of the classic model of lipolysis. ATGL knockout mice have increased fat pad size and accumulate excess TAG in most tissues [142]. These mice accumulate so much TAG in the heart that they die of congestive heart failure. Like HSL knockout mice, ATGL knockout mice demonstrate diminished mobilization of free fatty acids from adipose stores in response to catecholamine. It has been proposed that in the mouse, ATGL and HSL act coordinately such that ATGL is the primary lipase responsible for hydrolyzing the first fatty acid from TAG and that HSL is the primary DAG lipase. Whereas this model applies to lipolysis in humans has been questioned. A competing model has been proposed according to which HSL is the primary TAG lipase responsible for catecholamine-stimulated lipolysis from adipocytes and ATGL is the primary TAG lipase for basal lipolysis [143]. In the best-characterized lipolytic pathway, catecholamine binding to β-adrenergic G proteincoupled receptors on the plasma membrane generates a signaling cascade that activates cAMPdependent protein kinase A (PKA) (Figure 9). The anabolic hormone insulin inhibits lipolysis by stimulating a phosphodiesterase that breaks down cAMP. PKA activation ultimately leads to the hydrolysis of a fatty acids from TAG to yield DAG, from DAG to yield monoacylglycerol, and finally from monoacylglycerol to yield the glycerol backbone. The molecular events of this process have been under investigation for the past four decades. Lipolytic activation of cultured adipocytes is associated with movement of HSL from the cytosol to the surface of lipid droplets, where it acts on the neutral lipids within [144]. Perilipin has emerged as a critical organizing component of these changes, and serine phosphorylation of perilipin on one or more of six PKA consensus sites is a key mediator of this organization. During hormone-stimulated lipolysis in adipocytes, major rearrangements take place in the morphology of lipid droplets and in the distribution of lipid droplet-associated proteins. Activation of PKA over several hours results in fragmentation of lipid droplets, which greatly increases the surface area of droplets available for lipase action. This fragmentation is dependent upon phosphorylation of perilipin at serine 492 [145]. 35 In contrast to HSL, ATGL appears to reside on the lipid droplet surface independent of PKA activation [146]. Rather than its activation being controlled by phosphorylation and translocation, ATGL is activated at least 20-fold by interaction with CGI-58, a member of an esterase/lipase family of proteins [147]. Comparative Gene Identification-58 (CGI-58) is also known as α/βhydrolase domain-containing protein 5 (ABDH5). CGI-58 lacks lipase activity itself but activates the lipase activity of ATGL likely via protein-protein interaction. CGI-58 was shown to bind to lipid droplets by interaction with perilipin A in a hormone-dependent way [148]. In nonstimulated adipocytes, CGI-58 is tightly associated with the lipid droplet, whereas upon β-adrenergic stimulation and concomitant phosphorylation of perilipin, CGI-58 dissociates and becomes cytosolic. Once dissociated from perilipin, it colocalizes in close proximity to ATGL [149], suggesting the involvement of CGI-58/ATGL interaction in stimulated lipolysis. In summary, in the basal state, CGI-58 is closely associated with perilipin A on the lipid droplet where perlipin A has barrier function to lipolysis. Hormone sensitive lipase (HSL) is primarily located in the cytosol and ATGL is primarily localized to the lipid droplet but not in proximity CGI-58. Here, ATGL mediates basal triacylglycerol (TG) hydrolysis, which in the absence of further HSL-mediated diacylglycerol (DG) hydrolysis, allows for generation of glycerophospholipids and/or re-esterification into TG. In the stimulated state, phosphorylation of perilipin A promotes the release of CGI-58 which then translocates to ATGL to promote ATGL-mediated TG hydrolysis. At the same time phosphorylation of HSL promotes its translocation to the lipid droplet where it interacts with perilipin A to promote DG hydrolysis and hence complete lipolysis. Another hormonal lipolytic pathway has been discovered in human fat cells [150]. Atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) stimulate human fat cell lipolysis as much as isoproterenol while C-type natriuretic peptide (CNP) exerted weak effects. Real-time PCR revealed that large adipocytes expressed higher mRNA levels of natriuretic peptide receptor (NPR)-A than small adipocytes [151]. Cyclic GMP-dependent activation of protein kinase G and phosphorylation of HSL occur after ANP stimulation in human adipocytes [152]. In situ microdialysis experiments have confirmed the potent lipolytic effect of ANP in abdominal subcutaneous AT of healthy subjects and intravenous administration of ANP causes a striking increase in plasma NEFA and glycerol levels in normal and obese subjects [153]. While the endocrine regulation of lipolysis by catecholamine and insulin has been well characterized, much remains to be investigated regarding the local regulation of lipolysis in adipocytes by autocrine/paracrine factors, such as: TNF-α, adenosine, prostaglandins and adipocytespecific phospholipase A2 (AdPLA) [154];[155]. Other signaling pathways through cytokines, growth hormones, AMP-activated protein kinase and nicotinic acid have also been shown to 36 regulate lipolysis [156]. However, future investigation into these pathways will be required to establish their relative importance in regulating lipolysis. The products of TAG hydrolysis, diacylglycerol (DAG) and free fatty acids, may influence cell signaling either directly or via subsequent metabolism, for example to fatty acyl coenzyme A. Free fatty acids released from adipose tissue can enter the circulation and be taken up by other organs for β-oxidation and subsequent ATP generation. Liberated FAs and glycerol can also serve as substrates in the liver for ketogenesis and gluconeogenesis, respectively. Additionally, FFAs may influence gene expression by acting as ligands for nuclear receptors, such as the peroxisomeproliferator activated receptor (PPAR) family. Excess intracellular FFAs can disrupt phospholipid bilayer membrane integrity, alter lipid signaling pathways, and induce apoptosis [157]. Although, traditionally, mobilization of lipid droplet (LD) by lipolysis has been solely attributed to the LD-associated lipases, recent studies have revealed a role for autophagy in LD breakdown through a process now described as lipophagy. Lipophagy impacts the cellular energetic balance directly, through lipid breakdown and, indirectly, by regulating food intake. Each of the events of autophagic process is coordinated by a complex network of more than 32 genes and their protein products (autophagy-related genes (ATGs) and proteins (Atgs)). Atgs participate in activation, nucleation of the autophagosome membrane that forms de novo through conjugation of proteins and lipids from different cellular compartments, elongation of the membrane and sealing to form the autophagosome, trafficking toward the lysosomes and fusion of the two membranes [158]. Defective lipophagy has been already linked to important metabolic disorders such as fatty liver, obesity and atherosclerosis, and the age-dependent decrease in autophagy could underline the basis for the metabolic syndrome of aging [159]. 37 Figure 9. Major pathways involved in the stimulation of human fat cell lipolysis. Signal transduction pathways for catecholamines via adrenergic receptors, autacoids- and metabolite-driven inhibitory receptors and atrial natriuretic peptides via type A receptor (NPR-A). Protein kinases (PKA and PKG) are involved in target protein phosphorylation. HSL phosphorylation promotes its translocation from the cytosol to the surface of the lipid droplet. Perilipin phosphorylation induces an important physical alteration of the droplet surface that facilitates the action of HSL and the initiation of lipolysis. Docking of FABP4 to HSL favors the outflow from the cell of NEFAs released by the hydrolysis of triacylglycerols. Insulin, via stimulation of fat cell insulin receptors and phosphodiesterase-3B stimulation promotes cAMP degradation and antilipolytic effects while it is not active on cGMP-dependent pathways. ATGL, adipose triglyceride lipase; FABP4, adipocyte fatty acid binding protein; GC, guanylyl cyclase; Gi, inhibitory GTP-binding protein; Gs, stimulatory GTP-binding protein; HSL, hormone-sensitive lipase; MGL, monoacylglycerol lipase; NEFA, nonesterified fatty acid; NPR-A, type A natriuretic peptide receptor (M. Lafontan and Langin D, 2009, Prog Lipid Res). 38 3.3 Paracrine and endocrine role of adipose tissue Adipose tissue is an innervated connective tissue composed of a number of different cell types. Besides thought of as a tissue mass that stores excess energy and provides insulation and padding to the body, adipose tissue is now accepted to be an endocrine organ that secrets numerous hormones, growth factors, matrix proteins, enzymes, and complement factors. These factors are collectively referred to as “adipokines”. They play a role by paracrine signals (local effects) or endocrine signals (systemic effects) in fat mass regulation and regulation of adipocyte differentiation, vascular and blood flow regulation, lipid and cholesterol metabolism, and immune system function. With such varied biological functional role, it is likely that these adipokines have a significant role in disease processes known to be metabolic consequences of obesity, such as insulin resistance, cardiovascular disease, and altered lipid homeostasis. The total number of adipokines, both documented and putative, is now well over fifty. The earliest to be identified was in practice the enzyme lipoprotein lipase, responsible for the hydrolysis of circulating triacylglycerols to NEFA; this was followed in the mid of 1980s by adipsin, a serine protease and part of the alternative complement pathway [160]. In 1993, tumor necrosis factor (TNF) was identified as a pro-inflammatory product of adipose tissue that is induced in models of diabetes and obesity, providing evidence for a functional link between obesity and inflammation [161]. Subsequently, leptin was identified as an adipose tissue-specific secreted protein that regulates food intake and energy expenditure in an endocrine manner [162]. Similarly, the identification of plasminogen activator inhibitor 1 (PAI1), an inhibitor of fibrinolysis, as an adipokine that is strongly upregulated in visceral adipose depots in obesity suggested a mechanistic link between obesity and thrombotic disorders [163]. At about the same time, the other important adipokine adiponectin (also known as ACRP30 and ADIPOQ) was identified which is more expressed in SAT [164] ; [165]. Adiponectin expression was found to be decreased in obesity, and studies in experimental organisms showed that adiponectin protects against several metabolic and cardiovascular disorders that are associated with obesity. The recent discovery of the PGC1αdependent myokine FNDC5/irisin is not just a myokine liberated by muscle tissue but also an adipokine released by white and to a lesser extent, by brown adipose tissue that is able to stimulate brown-fat-like development and thermogenesis in white fat both in vitro and in vivo, it has created a new field of research and many expectations in recent months [166]; [167]; [168]. From the wide range of protein signals and factors already identified (Table 1, Figure 10) [169], it is evident that WAT is a secretory and endocrine organ of considerable complexity which is highly integrated into the overall physiological and metabolic control systems of mammals. These results were surprising as most adipokines stimulate inflammatory responses, are upregulated in obesity and promote obesity-induced metabolic and cardiovascular diseases. Collectively, these findings 39 have led to the notion that metabolic dysfunction that is due to excess adipose tissue mass may partly result from an imbalance in the expression of pro-and anti-inflammatory adipokines, thereby contributing to the development of obesity-linked complications. Accordingly, the concept that adipokines function as regulators of body homeostasis has received widespread attention from the research community [77]. 40 Apelin Figure 10. The secretory factors of human adipocytes sorted according to a more auto/paracrine or more endocrine mode of action (Hauner H, 2004, Physiol Behav). Table 1. Sources and functions of key adipokines 41 4. Different depots of adipose tissue 4.1 Subcutaneous/Visceral Adipose Tissue (VAT/SAT) Fat depots from different region of the body have different incidence in pathology because they display distinct functional and structural properties in terms of energy metabolism and bioactive molecule release as well. Increased intra-abdominal/visceral fat (central or apple-shaped obesity) promotes a high risk of metabolic disease, whereas increased subcutaneous fat in the thighs and hips (peripheral or pear-shaped obesity) exerts little or no risk [170]. Differences between white adipocytes from visceral and subcutaneous depots have been recognized for many years including their unique profiles of adipokines: visceral fat accumulation may induce oversecretion of offensive adipokines, such as PAI-1, TNF-α, IL-6, CCL2, and insufficient secretion of defensive adipokine, namely adiponectin [77];[171]. In line with these data, obese subjects were found to harbour increased AT macrophage content mainly in visceral depots (reviewed in [172];[77]) In addition, VAT adipocytes exhibit higher rates of fatty acid turnover and lipolysis and augmented plasma FFA and glycerol flux to the portal circulation, which is connected directly to the liver. Insulin resistance has been shown to be exacerbated by an increased supply of FFA to peripheral tissue and the liver [173]. Some studies indicate that microsomal triglyceride transfer protein plays a key role in the lipoprotein assembly of apolipoprotein B and lipids to form very-low-density lipoprotein in the liver. This process is considered to be a limiting factor for verylow-density lipoprotein secretion from the liver to plasma. Matsuzawa et al reported that increased FFA influx to the liver from visceral fat may contribute to increase very-low-density lipoprotein formation and secretion, and results in hyperlipidemia [174]. Excess glycerol influx to the liver may cause hyperglycemia also. VAT adipocytes are also less responsive to the antilipolytic effects of insulin and catecholamine than SAT adipocytes [175]. Moreover, it has been observed in obese subjects that endothelial cells isolated from visceral fat show a higher expression of genes related to angiogenesis and inflammation than endothelial cells from subcutaneous adipose tissue [176]. All together these results suggest that visceral fat is more clinically relevant than the subcutaneous fat with regard to chronic inflammation and metabolic complication in general. In fact, increase in VAT is particularly linked to obesity-related complication such as type 2 diabetes, cardiovascular disease and dyslipidemias whereas, storage of fat in subcutaneous adipose tissue (SAT) is linked to a lower risk for such conditions [77]. 4.2 Mammary adipose tissue (MAT) The differential impact of visceral versus subcutaneous fat on health during obesity conditions highlight an important concept in adipose tissue biology, namely, that fat in different body locations exhibits distinct features and functional characteristics. Regarding this latter point, what is the 42 specificity of MAT? A brief overview of the anatomy of the human adult mammary gland is given in order to better understand the particular place of the adipocyte in breast tissues. The mammary gland is comprised of myoepithelial and luminal epithelial cells embedded in a complex stroma termed mammary fat pad composed predominantly of fibroblasts, adipocytes, and cells of both the interspersed vasculature and lymphatic systems [177]. A long-standing line of evidence suggests that, at least in rodents, mammary fat pad is essential for the post-natal development of mammary epithelium by providing signals mediating ductal morphogenesis [177];[178]. Adipocytes within the mammary fat pad specifically participate to the development of the normal mammary gland. For example, it has been shown that the total absence of breast fat in transgenic mice prevents normal mammary gland development [179]. The mammary adipocytes are very active during the transitions from pregnancy to lactation and into involution (corresponding to the post-lactational regression of mammary epithelium) underlying their responsiveness to local signals from the epithelium [180]. Briefly, during lactation, mammary adipocytes in close proximity to epithelial cells exhibit rapid depletion of their lipid storage due to lipolysis. By contrast, the involution period is associated to a refilling of mammary adipocytes that is completed approximately within 4 days. Intimate and bidirectional interaction with adjacent epithelium is one of the hallmarks of mammary adipocytes, suggesting that this dialog might persist in physiopathological conditions such as cancer. It is also very important to underline that there is undoubtedly species differences concerning the composition and function of mammary fat pad between human and rodents that should be taken in account when results obtained in rodents are extrapolated to humans. In contrast to rodents where the mammary fat pad consists primarily of adipocytes, human mammary adipose tissue is extensively interlaced with a network of fibroblasts and associated connective tissue[178]. Therefore, in murine mammary glands, the adipocytes are immediately adjacent to the ductal epithelial cells, whereas in human mammary glands, a fibrous layer separates the 2 cell types. In addition, it has been clearly shown that human mammary epithelium transplanted into the mammary fat pad of mice did not grow out unless human stromal fibroblasts are incorporated into the cleared fat pad [181]. 4.3 Bone marrow adipose tissue (BMAT) This “nontypical” AT consists of smaller adipocytes loosely bound together when compared to the classical collagen-driven shape of those found elsewhere. BM mature adipocytes possess unique profiles and have been proposed to exhibit features of both WAT and BAT [182]. BM adipocytes might provide nutrients and secrete adipokines to support hematopoiesis when required [183]. However, the number of BM mature adipocytes correlates inversely with the hematopoietic activity 43 of the marrow (seen for example during aging) and a very elegant study has recently demonstrated that adipocytes act as negative regulators of normal hematopoiesis [184]. 5. Adipose tissue in the obese individual Obesity is a problem of epidemic proportions in many developed nations. Both fat mass and distribution can be measured by magnetic resonance imaging (MRI) and Dual-Energy X-Ray Absorptionmetry (DEXA), but for most purposes, simpler surrogate measurements such as body mass index (BMI=weight in kg/height in meters2) and waist-hip ratio (WHR) or waist circumference are used. The WHO classifications of BMI ranges are shown below [185]. BMI (kg/m2) WHO classification < 18.5 18.5–24.9 25.0–29.9 30.0–39.9 ≥ 40.0 Underweight Normal range ‘Healthy’ Grade 1 overweight Grade 2 overweight Grade 3 overweight Popular description Thin ‘normal’ or ‘acceptable’ weight Overweight Obesity Morbid obesity According to the World Health Organization (WHO), there are currently more than 1.6 billion overweight (BMI ≥ 25kg/m2) adults and at least 400 million of these are obese (BMI ≥ 30kg/m2). Moreover, they predict that by 2015 there will be 2.3 billion overweight and more than 700 million obese adults worldwide (http://www.who.int/mediacentre/factsheets/fs311/en/index.html). The prevalence of obesity and its associated disorders is increasing at an accelerating and alarming rate worldwide. The increase in adipose tissue (AT) mass is a result of an increase in adipocyte size (‘hypertrophy’) and/or number (‘hyperplasia’). Healthy adipose tissue expansion consists of an enlargement of adipose tissue through effective recruitment of adipose progenitors, along with adequate angiogenic response, appropriate induction of ECM remodeling as well as minimal inflammation. In contrast, during the progressive development of obesity, pathological expansion of adipose tissue consists of massive enlargement of existing adipocytes, limited angiogenesis followed by hypoxia, massive inflammation, oxidative stress and fibrosis [172]. The sequence of events might be that as the tissue expands, the vasculature (which is less extensive in WAT than in brown fat) is insufficient to maintain normoxia throughout the organ. Clusters of adipocytes then become relatively hypoxic, and an inflammatory response ensues which serves to increase blood flow and to stimulate angiogenesis. Immunoreactive HIF-1 has been reported in 3T3-F442A adipocytes and hypoxia results in an increase in the amount of this protein in the cultured cells. Furthermore, hypoxia leads to an induction of leptin and VEGF expression in these adipocytes, raising the likelihood that a low oxygen tension leads to the stimulation of angiogenesis in adipose tissue through the HIF-1 44 pathway [186]. This results in an increased rate of apoptosis, ultimately triggering the local accumulation of inflammatory cells into adipose tissue. In another way, in hyperplastic obesity, adipocytes secrete Monocyte Chemoattractant Protein-1 (MCP-1), which attracts macrophages regulating the inflammatory characteristics of AT [187]; [188]. Elevated levels of MCP-1 have been found in the plasma and AT of obese humans and animals [189]. Adipose tissue in obese individuals and in animal models of obesity is infiltrated by a large number of macrophages, and this recruitment is linked to systemic inflammation and insulin resistance. One hallmark of obesity-associated inflammation is the recruitment of macrophages into adipose tissue, where they form characteristic “crown-like” structures (CLSs) around apoptotic adipocytes (Figure 11) [190]. Because a key function of macrophages is to remove apoptotic cells in an immunologically silent manner to prevent the release of noxious substances, it is reasonable to speculate that the presence of crown-like structures in adipose tissue reflects a pro-inflammatory state that is due, in part, to an impairment of the macrophage-mediated phagocytic process. CLSs are 30 times more numerous in obese fat than in lean fat both in mice and human [191]. CLS density is positively correlated with adipocyte size in both the subcutaneous and visceral fats of obese mice. However, in adipocytes of the same size, CLS density is higher in visceral fat, suggesting that visceral adipocytes are more fragile and reach a critical size that triggers death, termed the ‘critical death size’ (CDS), earlier than subcutaneous adipocytes [85]. Adipocytes in most visceral depots are smaller than subcutaneous adipocytes. Brown adipocytes that have been converted into white adipocytes are smaller; thus, one possible explanation of the differences in size, expandability and, consequently, CDS, is that visceral adipocytes may be brown adipocytes that have been converted to white adipocytes [192]. This theory could offer an explanation of the well known higher morbidity potential of visceral fat [193]. Different subsets of macrophage are involved in obesity-induced adipose tissue inflammation. Macrophages that accumulate in the adipose tissue of obese mice mainly express genes associated with an M1 or ‘classically activated’ macrophage phenotype, whereas adipose tissue macrophages from lean mice express genes associated with an M2 or ‘alternatively activated’ macrophage phenotype [194]. Stimulation with T helper 1 (TH1)-type cytokines, including interferon-γ (IFNγ), or with bacterial products leads to the generation of M1 macrophages, which produce proinflammatory cytokines (including TNF and IL-6), express inducible nitric oxide synthase (iNOS) and produce reactive oxygen species (ROS) and nitrogen intermediates [195]. By contrast, macrophages are polarized to the M2 phenotype by TH2-type cytokines such as IL-4 and IL-13. M2 macrophages can upregulate production of the anti-inflammatory cytokine IL-10 and downregulate synthesis of pro-inflammatory cytokines. Functionally, M2 macrophages are associated with the repair of injured tissues and the resolution of inflammation. So, it has been suggested that M1 45 macrophages promote insulin resistance and M2 macrophages protect against obesity-induced insulin resistance [196]. Figure 11. Phenotypic modulation of adipose tissue. Adipose tissue can be described by at least three structural and functional classification: lean with normal metabolic function, obese with mild metabolic dysfunction and obese with full metabolic dysfunction. In states of obesity, adipose tissue generates large amounts of pro-inflammatory factors. Metabolically dysfunctional adipose tissue can be associated with higher levels of adipocyte necrosis, and M1 macrophages are arranged around these dead cells in crown-like structures (Ouchi N et al., 2011, Nat Rev Immunol). 46 6. Relationship between obesity and breast cancer Obesity leads to dysfunctional adipose tissue. Dysfunctional adipocytes are less efficient at fulfilling their primary functions: lipid storage and secretion of a complement of beneficial secretory products, fulfilling their important endocrine role [171]. Dysfunctional adipose tissue has been widely appreciated as a major cause of obesity-related metabolic disorders, including insulin resistance, type 2 diabetes and cardiovascular disease and it plays a pivotal role in obesity-related carcinogenesis due to inappropriate release of mitogenic and proinflammatory factors [171]. Several epidemiological studies demonstrate positive associations between the prevalence of obesity as judged by increased BMI, cancer incidence, and cancer-related mortality [185]; [197]; [198]; [199]. More specifically, one of the most rigorous meta-analysis studies to data revealed strong associations of overweight or obesity with an increased risk of a subset of cancers, such as thyroid, colon, and renal cancers, and esophageal adenocarcinoma, leukemia, and non-Hodgkin lymphoma in both sexes; rectal and malignant melanoma in men; as well as endometrial, pancreas, ovarian, and breast cancers in women [198]. Obesity-associated colon, breast, and endometrial cancer incidence in women is critically dependent on menopausal status [197] (table 2). Although obesity affects tumor incidence, the correlation of elevated body fat mass with cancer-related mortalities has also been described for many cancers. Obesity accounted for a 52% higher (in males) and an 88% higher (in females) mortality rate across all cancers [199]. Although the epidemiological evidence connecting obesity with cancer incidence is strong, the underlying mechanistic basis linking obesity per se to tumor-initiating events remains largely elusive. At anatomical levels, the breast epithelial ducts and lobules are invested with a dense connective tissue matrix outside of which islands of AT occupy a large proportion of the stroma. Adipocytes/obese may fully exert their endocrine/paracrine role to influence the breast cancer progression. So, my work is focusing on the crosstalk between breast cancer and it`s surrounding adipocytes. 47 Table 2. Relative risk of cancer incidence and mortality in association to obesity (Park J, 2011, Endocr Rev). 6.1 Breast cancer at a glance Breast cancer is a complex disease including clinical, morphological and molecular very distinct entities. This heterogeneity cannot be explained only by clinical parameters such as tumor size, lymph node involvement, histological grade, age; or by biomarkers like estrogen receptor (ER), progesterone receptor (PR) and epidermal growth factor receptor 2 (HER2) routinely used in the diagnosis and treatment of patients. It is the female gender malignant neoplasia with the highest incidence in the industrialized world. In the United States, breast cancer is the second leading cause of cancer death in women. In 2011, an estimated 230,480 invasive breast cancers and 57,650 in situ breast cancers were diagnosed in women, and 39,520 deaths resulted from this disease in the United States [200]. The hierarchical cluster analysis revealed six molecular subtypes: Basal-like, HER2, Luminal A, Luminal B, Claudin-Low and normal breast. The different molecular subtypes were associated with different prognosis [201] (table 3). About 60% of breast carcinomas are hormone-dependent. Thus, weight increase and obesity, subsequent to menopause, have been identified as the most important risk factor for breast cancer in postmenopausal women [202]. Overall, there is a 12% increased breast cancer risk for overweight, and a 25% increased risk for obese, postmenopausal women. Weight gain after menopause also causes a considerable increase in the risk of developing breast cancer. Women who gain at least 22 kg have an 18% increase in risk, and a gain of 55 kg or more is associated with a 50% risk increase [203]. While some studies indicate that obesity in premenopausal women inversely correlates with breast cancer incidence [202]; [204], obesity is associated with poor prognosis for both pre- and postmenopausal breast cancer patients [458]. Three 48 main mechanistic connections have been suggested that may causally invoke obesity with breast cancer progression. These include: 1) changes in the levels of adipocyte-derived factors by endocrine /paracrine actions; 2) sex hormones; 3) alterations in signaling events along the insulin and IGF-I axis [185]. We will extend the discussion to recent advances highlighting evidence for direct contributions of the adipocyte toward cancer progression. Table 3. Features of molecular subtypes of breast cancer (Eroles P, 2012, Cancer Treat Rev). 6.2 How do adipocytes influence breast cancer biology? 6.2.1. Endocrine effects of dysregulated adipocytes Notably, endocrine signals such as adipokines, other hormones, inflammatory cytokines and lipid metabolites are produced by adipose tissue both proximal and distal to the tumor mass. The paracrine effect on breast tumor progression will be discussed in the next chapter. Adipokines Adipose tissue dysfunction results in altered serum levels of adipokines, and these changes may be directly involved in obesity-related tumorigenesis. Here, we limit our discussion on two key adipokines, adiponectin and leptin, both of which play an important role in tumor development and progression. Leptin: Leptin, a 16 kDa adipokine produced by WAT, plays a critical role in the regulation of body weight and energy balance by inhibiting food intake and stimulating energy expenditure. Under normal conditions, leptin functions as an energy sensor and signals the brain to reduce appetite (circulating leptin levels are actively transported through the blood-brain barrier and activates the hypothalamic anorexigenic neurons POMC/CART while inhibiting orexigenic NPY/AgRP neuropeptides leading to decreased appetite). In the obese state, however, leptin concentrations positively correlate with total body fat mass suggesting that resistance to leptin action develops with chronic overfeeding and obesity. The release of leptin is stimulated by insulin, glucocorticoids, TNF-α and estrogens [205]. Over time, it became apparent that leptin receptors were expressed in many normal cell types throughout the body as well as in malignant cells, and the addition of leptin to cells in culture was found to promote proliferation and to inhibit apoptosis [206]; [207]. Whereas leptin is localized to 49 the cytoplasm of breast cancer cells, the leptin receptor is both cytoplasmic and membrane bound. The leptin receptors (OB-R) have been identified in human breast tumors [208] and increased expression of the leptin receptor in mammary tumors may be associated with poor prognosis. It has been suggested that leptin induced proliferation of breast cancer cell lines, by activating JAK2STAT3, PI3K-AKT-GSK3, ERK1/2, and AP-1 pathways, increasing the expression of proteolytic enzymes that are essential in metastatic process and stimulating angiogenesis, which is needed for tumor growth [209]; [210]. Specifically, in estrogen receptor-positive human breast cancer cell lines, leptin exerts its effects through activation of MAPK pathway. Leptin itself can also enhance aromatase activity in MCF-7 cells and increase the production of estradiol or activate the telomerase which also promotes cell proliferation [211]. HER2/neu (human epidermal growth factor receptor 2) is a tyrosine kinase receptor that is homologous to the epidermal growth factor receptor, and its overexpression in breast tumors is associated with poor prognosis and invasive breast cancers [212]. In a recent study, leptin was shown to transactivate HER2/neu and enhance the growth of breast cancer cells with HER2/neu overexpression [213]. Maybe through HIF-1 and NF-κB, leptin upregulates VEGF in human and mouse mammary tumor cells, which has been linked to worse prognosis of breast cancer [214]. Adiponectin: Adiponectin is one of the most abundant adipokine mainly secreted by adipose tissue, and to a small degree also produced by cardiac myocytes, muscle cells and endothelial cells [215]. The molecular assembly of adiponectin is complex. There are three major oligomeric forms of adiponectin: a lowmolecular-weight (LMW) trimer, a middle-molecular-weight (MMW) hexamer, and a highmolecular-weight (HMW) multimer. LMW oligomers are the predominant form in the circulation, whereas the majority of intracellular adiponectin consists of HMW oligomers. However, the ratio, and not the absolute amounts, of these two oligomeric forms (HMW/LMW), is critical in determining insulin sensitivity [216]. Following secretion from the adipocyte, adiponectin undergoes posttranslational modifications to generate globular, low and high molecular weight isoforms that bind to one of two adiponectin receptors, adipoR1 and adipoR2 [217]. While both receptors are ubiquitously expressed, adipoR1 is found mostly in skeletal muscle and adipoR2 is found mostly in the liver. In contrast to leptin, circulating levels of adiponectin are negatively associated with obesity, BMI, visceral fat accumulation and insulin resistance [218]. Plasma concentrations of adiponectin are reduced in obesity and clinical studies point out an inverse relation between serum levels of adiponectin and the risk of breast, endometrial, prostate, colorectal, and kidney cancer. Several case-control studies have observed that serum adiponectin levels were significantly lower in women 50 with postmenopausal breast cancer compared with controls [219]. In addition, women with aggressive breast tumors are more likely to be those with low serum adiponectin concentrations [220]. In vitro studies have demonstrated that adiponectin treatment suppressed cell proliferation and caused cell growth arrest and apoptosis in breast cancer cells [221]. The exact mechanism of tumor inhibition with adiponectin treatment is not clear but probably involves adiponectin and the adiponectin receptors, since it has been observed that a number of human cancers express both adipoR1 and aipoR2 at very high level [222]; [223]; [224]; [225]. AdipoR1 and adipoR2 mediates the activation of AMP-activated protein kinase (AMPK). Activated AMPK plays an important role in the regulation of growth arrest and apoptosis by stimulating p53 and p21 [226]. Independent of AMPK activation, adiponectin decreases the production of reactive oxygen species (ROS), which may result in decreased activation of mitogen-activated protein kinases (MAPK) and thereby inhibition of cell proliferation [227]; [219]. Moreover, adiponectin has been shown to inhibit endothelial NF-κB signaling and to markedly reduce TNF-α production in cultured macrophages. Adiponectin deficient mice have increased levels of TNF-α mRNA in adipose tissue and higher TNF-α circulating levels [228]. Adiponectin also induces human leukocytes to produce IL-10, IL1RA [229]. Taken together, all these results indicate that adiponectin could play potent antiinflammatory role in cancer. In conclusion, the decreased plasma levels of adiponectin and increased of leptin in obesity may be associated with the increased risk of cancer in obesity. Thus, it has been proposed that upregulation of adiponectin levels and downregulation of leptin might be of therapeutic use in the prevention or treatment of some cancers [219]. Other hormones WAT can secrete different sex steroids. Obesity is associated with an increased serum concentration of estradiol and estrone and a decreased serum concentration of testosterone. Estrogens promote cell proliferation and growth, and are important in developing and maintaining the normal breast. However, studies have shown that estrogen also has important roles in the induction and maintenance of breast cancer [230]. Estrogen receptor (ER) status is closely related to prognosis; that is, ER-negative tumors tend to have a worse prognosis than do ER-positive tumors [231], in part because ER-negative tumors do not respond to important anticancer therapies such as tamoxifen. For postmenopausal breast cancer, the increased risk observed in obese women is generally explained by the higher rates of conversion of androgenic precursors to estradiol through increased aromatase enzyme activity in adipose tissue [232]. In addition, obesity is associated with increased insulin and bioactive IGF-1 levels which down-regulate the concentration of the circulating sex hormone-binding globulin, resulting in an increased fraction of bioavailable 51 estradiol, but decreased testosterone production [233]. Indeed, overweight or obese postmenopausal women exhibit a threefold increased risk for developing breast cancer compared with normalweight postmenopausal women [234]. Aromatase in breast adipose tissue versus at other body sites might have a substantially higher impact on carcinogenesis because of its proximity to the ductal epithelial cells. In fact, the use of aromatase inhibitors that block aromatase activity in the breast and the periphery as an effective hormonal treatment of postmenopausal breast cancer has been reported that leads to reduce the amount of local estrogen production—which in turn helps to suppress recurrence of the breast tumors [234]. 6.2.2 Chronic inflammation It is well recognized that inflammation is involved in the promotion and progression of cancer. Inflammatory responses play decisive roles at different stages of tumor development, including initiation, promotion, malignant conversion, invasion and metastasis. They also affect immune surveillance and responses to therapy [235]. Obesity is associated to systemic low-grade inflammation, which has been suggested to have an important role in the pathogenesis of some disorders such as insulin resistance, atherosclerosis and cancer [236]. In obesity, the expanding subcutaneous and visceral AT makes a different substantial contribution to the development of obesity-linked inflammation via enhanced secretion of VEGF, HGF, PAI1, Apeline and leptin in subcutaneous AT and enhanced secretion of pro-inflammatory cytokines (IL-6, TNF-α), chemikines (MCP-1) and adipokines (HGF, PAI-1, leptin, Apeline and VEGF) and both the reduction of antiinflammatory adipokines (adiponectin) (Figure 12) [237]; [238].The precise role of these factors as described in Figure 13. Very interestingly, several recent publications have shown that a subinflammatory state is observed in the mammary adipose tissue (MAT) of obese versus lean individuals (using both human and mouse models) and that in humans, the severity of breast inflammation was correlated with both BMI and breast adipocytes size [239]. 52 Figure 12. The secretion of adipocytes depend on the origin of adipose tissue and weight status. (Laurent V et al, 2013, Médecine/sciences) Figure 13. Potential pathways directly linking obesity with cancer. AdipoR1/R2, adiponectin receptor1/2; AMPK, 5’-AMPactivated protein kinase; IGF-1, insulin-like growth factor-1; IKK, IκB kinase; IR, insulin receptor; JAK, Janus kinase; MAPK, mitogen-activated-protein-kinase; mTOR, mammalian target of rapamycin; ObR, leptin receptor; STAT, signal transducer and activator of transcription 3; TRAF2, TNF receptor-associated factor 2; TSC2, tuberous sclerosis complex 2; uPA, urokinase-type plasminogen activator; PI3K, phosphatidylinositol 3-kinase; NF-κB, nuclear factor- κB (Pedro L, et al, 2011, Biochim Biophys Acta). 53 6.2.3 Adipose tissue angiogenesis and hypoxia It is now clear that oxygen levels are substantially lower in the white adipose tissue of obese mice compared with lean mice (15.2mm Hg versus 47.9mm Hg) [240] due to the inability of the vasculature to keep pace with adipose tissue growth. Adipose tissue hypoxia (ATH) is a key factor in the development of systemic insulin resistance, regulation of chronic inflammation, and reduced adiponectin and increased leptin gene expression [241]. Therefore ATH might contribute to cancer progression. Hypoxia occurs in solid tumors when the consumption of oxygen exceeds its delivery by the vascular system. In most large clinical studies, the prognosis is worse for patients with hypoxic tumor [242]. Furthermore, hypoxia leads to resistance to radiotherapy and anticancer chemotherapy, as well as predisposing for increased tumor metastasis [243]; [244]; [245]; [246]. The expansion of adipose tissue is like the propagation of a solid tumor: rapid growth induces hypoxia that in turn induces angiogenesis, which fuels more growth [247]. Angiogenesis—the process of new blood vessel formation—plays a critical role in tumor expansion. Once a tumor exceeds a few millimeters in diameter, hypoxia and nutrient deprivation triggers an “angiogenic switch” to allow the tumor to process [248]. The expansion of adipose tissue under conditions of nutritional excess is however highly dependent upon angiogenesis. Different fat pads vary with respect to their degree of angiogenic potential [172]. Adipocytes, adipose stromal cells and inflammatory cells produce multiple angiogenic factors (VEGFA and FGF2), adipokines (letpin, resistin and adiponectin) and cytokines (IL-6) all of which stimulate angiogenesis and contribute to an overall pro-angiogenic microenvironment [249]. One study recently showed that postmenopausal obesity (ovariectomy/high-fat diet) significantly promotes breast tumor angiogenesis, which is associated with increased VEGF protein levels in plasma and breast tumors in comparison with those in the control mice (ovariectomy/low-fat diet) [250]. 6.2.4 Lipids metabolites In the obese, insulin-resistant state, an increased rate of lipolysis is observed in adipocytes. As a result, lipid metabolites such as FFA are elevated in circulation, which in turn exacerbates insulin resistance further. In addition, several lipid metabolites, such as diacylglycerol and ceramide that are released from adipocytes, serve as secondary messengers in signaling pathways that are involved in cell proliferation, growth, and apoptosis. Such key signaling pathways include the PI3K, the protein kinase C, and the NF-κB inflammatory pathways [251]; [252]; [253]. Moreover, FFAs can also serve as ligands for the toll-like receptor 4 (TLR4), thereby induced insulin resistance through saturated fatty acid-induced ceramide biosynthesis, further establishing the tight link of elevated FFA and insulin resistance [254]. Enhanced lipolysis in host tissues can potentially fuel tumor growth by releasing free fatty acids (FFAs) from host adipocytes to be recycled via β54 oxidation in cancer cell mitochondria. The metabolic interactions between adipocytes and cancer cells (see in the third part), are consistent with the “metabolic symbiosis” between cancer cells and host stromal cells. 7. Paracrine role of adipocytes in tumor progression As stated in the first part of the introduction, the tumor progression is highly dependent on heterotypic cell signaling from microenvironment. In fact, an understanding of cancer is impossible without a comprehensive description of the tumor microenvironment. Most studies of the tumor microenvironment that focused on the tumor-promoting role of cancer-associated fibroblasts (CAF). With obesity and its pathophysiological sequelae still on the rise, the adipocyte is increasingly moving center stage in the context of tumor stroma-related studies. Moreover, at anatomical levels, the breast epithelial ducts and lobules are invested with a dense connective tissue matrix outside of which islands of AT occupy a large proportion of the stroma. We have already discussed the endocrine effect of dysregulated adipocytes on breast carcinoma, to better understanding the link between obesity and breast cancer progression, it is important to decipher the paracrine interaction between tumor cells and it`s surrounding adipocytes. 7.1 Evidence for the role of the adipocytes in breast cancer There are long standing arguments in the literature showing that fat tissue is able to support and amplify breast cancer progression. As early as in 1992, Eliott and colleagues showed that the murine breast carcinoma SP1 cell line grew best when injected in the mesenteric and ovarian fat pads and in the mammary gland, but very poorly in the subcutis or peritoneal cavity, and it was proposed that the adipose tissue exerts an estrogen-dependent positive regulatory effect on SP1 [255]. The positive influence of the local mammary fat-rich microenvironment on breast cancer growth is also sustained by the increase in xenograft success in mice when orthotopic, rather than subcutaneous, injections are employed [256]. An in vivo coinjection system using 3T3-L1 murine adipocytes and SUM159PT human breast cancer cells to recapitulate heterotypic crosstalk occurring in primary breast tumors has demonstrated that adipocytes favor tumorigenesis [257]. Except in vivo evidence, in vitro cell models which exclude other local or systemic factors might interfere have been designed to uncover the intrinsic properties and functions of adipocytes in breast cancer progression. One of the first evidence of their role in breast cancer progression came from the study of Manabe et al [258] showing that the rat mature adipocytes, but not the preadipocytes, promote the growth of several ER-positive breast cancer cell type. The same year, the pioneering study of the group of P. Scherer demonstrated that the full complement of adipokines, represented by the conditioned-medium of mature 3T3-L1 murine adipocytes, showed an unparalleled ability to 55 promote the growth, cell motility and invasion of estrogen-receptor –negative and positive breast cancer cells in vitro [257]. In our laboratory used 2D coculture system in which adipocytes and breast cancer cells were separated by an insert was set up to mimic the adipocyte-cancer cell crosstalk at the invasive front [68]. Using this original model, we extensively described tumorinduced changes in adipocytes that are reproducibly displayed by both mouse and human mammary adipocytes. Consistent with the name already used for fibroblasts surrounding tumors (CancerAssociated Fibroblast, CAFs) or with macrophages of the tumor microenvironment (TumorAssociated Macrophages, TAMs), we named these cells Cancer-Associated Adipocytes (CAAs). These adipocytes promote breast tumor cell invasion both in vitro and in vivo (see paper 1). Combined, these studies shed in light the crosstalk between adipocytes and breast cancer cells and underscore the need to fully understand the role of this heterotypic signaling in modulating tumor behavior. 7.2 Paracrine role of adipocytes Found at invasive fronts of human breast tumors (Figure 14), the key features of CAAs are decrease in size, delipidation, and loss of terminal differentiation markers (PPARγ, ap2, C/EBPα, resistin and HSL), over-expression of inflammatory cytokines (such as IL-6 and IL-1β) and proteases (such as MMP-11 and PAI-1) and overexpression of ECM and ECM-related molecules [69]; [70]. These “activated state” of CAAs strongly enhancing the malignance of tumor through implicated mechanism described below. Invasive front A. Tumor center B. Figure 14. Histology of the invasive front and the center of a human breast carcinoma. Hematoxylin-wosin histological examination. A, The invasive front of a primary tumor. Features of connective tissues are dramatically modified in response to cancer cell local invasion. Most importantly, CAAs located at the interface of invading cancer cells exhibit reduced size in comparison with normal adipocytes located at a distance; B, the center of the same tumor shows accumulation of firoblasts/CAFs, and adipocytes are no longer present. 56 ECM remodeling-related factors A very important aspect of this crosstalk is an extensive remodeling of the ECM. It has been shown that collagen VI (COLVI) is abundantly expressed in tumor-surrounding adipocytes and adipocytederived COLVI is involved in mammary tumor progression in vivo [257]; [69]. COLVI is composed of three chains: α1, α2, and α3, which associate to form higher-order complexes. Human breast cancer surrounding adipocytes exhibit increased COLVIα3 expression [257]. In vitro recombinant COLVI promotes GSK3β phosphorylation, β-catenin stabilization, and increases βcatenin activity in breast cancer cell lines, resulting in increased cell proliferation [257]. Accordingly, collagen (-/-) mice in the background of the mouse mammary tumor virus/polyoma virus middle T oncogene (MMTV-PyMT) mammary cancer model demonstrate dramatically reduced rates of early hyperplasia and primary tumor growth [69]. More recently, Scherer et al have shown that the cleaved C5 domain of the COLVIα3 chain (COL6A3-C5, a fragment referred to as “endotrophin”) augments fibrosis, angiogenesis, and inflammation, and is associated with more aggressive mammary tumor growth and metastasis in the MMTV-PyMT mouse model [259]. In the same way, adipocytes at the invasive front of human tumors consistently exhibit increased expression of metalloprotease 11 (MMP-11)/stromelysin 3 [70]. Part of the MMP-11 effect could be relied on COLVI since MMP-11 is able to cleave the native α3 chain of collagen VI [260]. Increase local fibrosis and its permanent remodeling (generating ECM components functioning as signaling molecules) have been clearly implicated in tumor progression. This association seems to justify prominently, the role of both COLVI and MMP-11 over-expression in a tumor context. In addition, these events might directly contribute to the occurrence of the CAA phenotype since adipocytes actively reorganize the ECM during differentiation processes. For example, it has been shown that MMP-11 is a potent negative regulator of adipogenesis [70]. In fact, a relative degree of “dedifferentiation” is one of the hallmarks of CAAs [68]. Inflammatory factors and EMT The second major event that takes place in CAAs is the occurrence of an inflammatory phenotype. The pleiotropic cytokine IL-6 has many homeostatic functions, including roles in B-cell development, myeloid lineage maturation, acute phase immune responses, hepatic function, and bone absorption [261]. Multiple studies have established IL-6 as a potent growth factor for several cancers, including multiple myeloma [262], prostate cancer [263], cholangiocarcinoma [264], and breast cancer [265]. With respect to breast cancer, elevated IL-6 serum levels are known to correlate with disease staging and unfavorable clinical outcomes in women with metastatic disease [266]; [267]. One of the studies determined that IL-6 promoted growth and invasion of breast cancer cells through signal transducer and activator of transcription 3 (STAT3)-dependent upregulation of 57 Notch-3, Jagged-1, and carbonic anhydrase IX [268]. We have shown that CAAs overexpress IL-6 both in vitro and in vivo and that, in the coculture system, IL-6 blocking antibody inhibits the CAAs-dependent proinvasive effect [68]. Interestingly, the human breast tumors of larger size and/or with lymph nodes involvement exhibit the higher levels of IL-6 in tumor surrounding adipocytes [68]. Such an inflammatory state in the tumor-surrounding adipose tissue has also been described for other cancers. High levels of IL-6 were found in the periprostatic adipose tissue of tumor-bearing patients and the levels of IL-6 correlated with the aggressiveness of the prostate tumor [269], and ovarian cancer cells preferentially migrate towards omental adipocytesconditioned medium rather than to adipocytes from other sources in a CXCR-1/IL-8 axis-dependent manner [71], highlighting the importance of this cytokine in the adipocyte/cancer cross-talk. Breast cancer cells that become invasive and transgress the ductal boundary come into contact first with the local adipose tissue. Epithelial-mesenchymal transition (EMT) permits temporally and spatially controlled cell migration and differentiation in normal embryogenesis. EMT is a process of epithelial cell trans-differentiation to a mesenchymal phenotype that decreases cell-cell adhesion properties and increases cell motility. This process is aberrantly reactivated in cancers and plays a role in metastasis [270]; [271]. The EMT process can be stimulated by IL-6 [272], IL-8 [273], CCL5 [274], and CCL2 [275]. Cancer-associated adipocytes may contribute to the acquisition of an EMT phenotype and promote invasion and metastasis of breast and other types of cancer cells through secretion of cytokines. In our lab, we have shown that coculturing breast cancer cells and adipocytes increases the expression of IL-6 and IL-1β, which contribute to cancer cell invasion both in vitro and in vivo [68]. Interestingly, this required bidirectional crosstalk between the CAAs and the tumor cells, since adipocytes lacking prior tumor cell contact did not produce factors necessary to enhance tumor invasion and metastasis. Adipokines Supported by epidemiological evidence, animal models and in vitro studies, two adipokines leptin and adiponectin have been largely involved in breast cancer occurrence and progression [171]; [276]. Schematically, leptin appears to promote tumor growth by mainly stimulating the activity of signaling pathways involved in proliferation process whereas adiponectin repressed proliferation, and induced apoptosis, in breast cancer cells [171]; [276]. The paracrine local implication for these adipokines in breast cancer cells appears to be weaker, or at least less characterized, than their endocrine effects. We found that CAAs exhibit a decrease in late adipose markers including leptin (Dirat et al, unpublished results), suggesting that this adipokine is not primarily involved in the negative cross-talk between adipocytes and breast cancer cells at the invasive front. By contrast, adiponectin expression is absent in CAAs suggesting that its negative effect on tumor progression 58 might be hampered in these tumor-modified adipocytes [68]. CAAs derived-factors might also affect in turns the secreted profile of tumor cells. For example, it has been shown that adipocytes stimulate the expression of genes related to immune function and wound healing in tumor cells, such as the chemokine CCL-20, the macrophage inhibitory cytokine 1 (MIC-1) or even IL-6 [277]; [278], contributing, among others things, to increase tumor invasiveness. Antitumor therapy Finally, one probably underestimated effect of adipocyte/cancer crosstalk is its role in the response to antitumor therapy. In our lab, we have recently shown that CAAs contributes to the occurrence of a radioresistant phenotype in breast tumor cells [279]. In a different tumor model (i.e. leukaemia) it has been demonstrated that adipocytes impairs leukaemia treatment by Vinca alkaloids both in vitro and in vivo [280]. Scherer identified endotrophin, a cleavage product of COLVIα3 that is actively involved in mammary tumor progression through enhancing EMT, fibrosis and chemokine activity, all of these activities are associated with acquired drug resistance [281]. 8. Contribution of ADSCs to breast cancer progression WAT is mainly comprised of adipocytes, although other cell types contained in so-called stroma vascular fraction (SVF) contribute to its growth and function, including Adipose-Derived Stem cells (ADSCs), preadipocytes, lymphocytes, macrophages, fibroblasts and vascular endothelial cells [77]. Studies have provided compelling in vivo evidences that mesenchymal stem cells (MSCs) distally recruited from the bone marrow contribute to breast cancer progression [282]. Recently studies demonstrated that ADSCs also contribute to tumor progression. ADSCs promote in vitro and in vivo in the growth and survival of breast cancer cells as well as their migratory and invasive capacities [283]; [284]; [67]; [285]; [286]; [287]. Several molecules have been involved in the pro-invasive effects of ADSCs including IL-6 [67], IL-8 [285], CCL-5 [284] and CXCL-12/SDF-1 [283]. More recently, it has been demonstrated that ADSCs promote the expansion of cancer stem cells and induce EMT in the cancer cells in a PDGF dependent manner [287]. Different functions of ADSCs within the tumor might be considered. First, different studies suggest that ADSCs might be activated by tumor cells and in turns express activated fibroblasts markers such as α-smooth muscle actin (αSMA) as well as fibronctin and tenascin C [287]. A recent study demonstrated that these activated ADSCs led to ECM deposition and contraction in vivo thereby enhancing breast cancer tissue stiffness, a parameter clearly contributing to breast cancer progression [288]. Secondly, ADSCs might also contribute to tumor vascularization [289]. Recent studies have demonstrated that, in mice, ADSCs are recruited by experimental tumors and promote cancer progression [290]; [291]. These studies using fluorescent-tagged cells show that these ADSCs contribute to form most 59 vascular and fibrovascular stroma (pericytes, α-SMA positive myofibroblasts, and endothelial cells) in murine tumors [291]. Finally, the role of AT to tumor vascularization is also sustained by the presence within itself of CD34+ endothelial cell progenitors (EPCs), that have been reported to generate in vitro and in vivo endothelial cells and vessels [292]. (For more detail information see review 1, 2). 9. Oncological risk after autologous lipofilling grafting in breast cancer patients These accumulating experimental evidences have raised a question over the oncological safety of autologous fat transfer following breast cancer resection by breast reconstructive surgeons. Generally, the procedure used by the majority of surgeons known as the Coleman technique, consists of the harvesting of subcutaneous fat usually from the abdominal wall or the thighs, followed by a short centrifugation and injection of the cellular “fat” into the area of interest [293]. The injected “fat” contains mature adipocytes as well as all the other cellular components present in adipose tissue (AT) including mainly ADSCs/preadipocytes and endothelial cells/endothelial progenitor cells [289]. The grafted fat, not only behave as a filler, but also improves surrounding tissues, bearing lesions such as scars, radiation damage and breast capsular contracture, into which the fat is placed [294]. In autologous fat transfer, ADSCs provide several benefits, they improve angiogenesis, graft vascularity and contribute actively to the adipocyte pool allowing fat grafts to maintain their volume [295]. However, as we talked before, the oncological safety of fat grafting problem need to be concerned. (For more detail information see review 2). In summary, on the one hand, mature adipocytes have moved from relatively inert lipid-storing cells to highly endocrine cells secreting growth factors, chemokines, inflammatory cytokines and extracellular matrix (ECM) proteins, all secretions potentially susceptible to affect tumor behavior. In the other hand, the regenerative pluripotential of ADSCs has been clearly emphasized. Finally, obesity, where both the cellular composition and the normal balance of these adipose tissue secretory proteins are perturbed, has recently emerged as an independent negative prognosis factor for breast cancer independently of menopause status. These data suggest that clinicians should consider obesity and metabolic factors, not only in assessing cancer risk but also in the design of clinical trials in oncology. However, it is important to note that this is a field that is still in its infancy, with a solid foundation of epidemiological data, but only very limited direct mechanistic insights at this point. Specially, the metabolic interactions between adipocytes and cancer cells (mentioned in “obesity” part), are consistent with the “metabolic symbiosis” between cancer cells and host stromal cells (I will extend the discussion in the next part). 60 PART III: CANCER METABOLISM Cell metabolism describes the intracellular chemical reactions that convert nutrients and endogenous molecules into the energy and matter (proteins, nucleic acids and lipids) that sustain life. Adenosine triphosphate (ATP), the principal molecule that drives all energy-dependent cellular processes, is mainly generated by two metabolic pathways: glycolysis and oxidative phosphorylation (Figure 15). Multiple molecular mechanisms, both intrinsic and extrinsic, converge to alter the cellular metabolism of cancer cells and provide support to the three basic needs of dividing cells: rapid ATP generation to maintain cellular energy status, increased biosynthesis of macromolecules and tightened maintenance of appropriate cellular redox status [296]. To meet these demands, both cancer cells and stromal cells undergo metabolic changes. In addition to the genetic changes that alter tumor cell metabolism, the tumor microenvironment has a major role in determining the metabolic phenotype of tumor cells. Given that adipocytes are a major source of adipokines and energy for the cancer cell, understanding the mechanisms of metabolic symbiosis between cancer cells and adipocytes should reveal new therapeutic possibilities. 1. A famous concept of cancer metabolism: The Warburg Effect Tumors are metabolic entities. They draw nutrients from the bloodstream, consume them through biochemical pathways, and secrete waste products which then become substrates for metabolism elsewhere in the body. The concept of dysregulated metabolism of cancer was first enunciated by the great German biochemist/cell biologist Otto Warburg over 80 years ago. Otto Warburg received the Nobel Prize in 1931 for the discovery of cytochrome oxidase but he also showed that tumor cells exhibit high rates of aerobic glycolysis, a phenomenon which became known as the Warburg Effect. The Warburg effect is defined by an increased utilization of glucose via glycolysis as a cellular resource even oxygen is abundant, and is a common phenotype of cancerous cells [297]. Without direct evidence, Warburg claimed that the respiratory machinery of cancer cells, mitochondria, must be damaged, thereby causing an increased reliance upon fermentation. In Warburg`s perspective, cancer arose in two phases. First, the respiratory system was damaged irreversibly. The second phase took place as injured cells struggled to obtain sufficient energy from fermentation. The characteristic enhanced glucose uptake observed in cancer cells has been used to detect and image cancers via PET detection of 2-18F-2-deoxylgucose, which preferentially concentrates within tumors as a result of their rapid uptake of glucose. In normal cells, the mitochondria can completely oxidize the pyruvate and NADH from glycolysis, resulting in the production of up to a further 36 moles of ATP per mole of glucose in the presence of oxygen, while cancer cells catabolize glucose to lactate only generates 2 ATP per mole of 61 glucose (Lehninger AL, Nelson DL, Cox MM. Principles of Biochemistry.2. Worth; New York: 1993). How do cancer cells benefit from their abnormal metabolism? Breaking these resources down via glycolysis is more to feed and protect the cell as it grows than provide energy to maintain cellular functions. Intermediates produced through glycolysis are diverted to biosynthetic pathways that are necessary to produce the basic building blocks of cellular growth. Carbon from glucose fuel nucleoside synthesis, whereas pyruvate feeds the citric acid cycle supporting continued fatty acid synthesis by supplying acetyl- and malonyl-CoA. The metabolic changes such as the Warburg effect, observed in cancer allow readily available resources to be converted into biomass in an efficient manner. This metabolic shift releases cells from the typical restraints on growth, and provides a potential way to distinguish them from healthy cells – allowing for treatments that may be selective for cancerous cells [298]. One compelling idea to explain the Warburg effect is that the altered metabolism of cancer cells confers a selective advantage for survival and proliferation in the unique tumor microenvironment. As the early tumor expands, it outgrows the diffusion limits of its local blood supply, leading to hypoxia and stabilization of the hypoxia-inducible transcription factor, HIF. HIF initiates a transcriptional program that provides multiple solutions to hypoxia stress [299]. Because a decreased dependence on aerobic respiration becomes advantageous, cell metabolism is shifted toward glycolysis by the increased expression of glycolytic enzymes, glucose transporters and also suppresses the glucose oxidation activity of the mitochondria by transactivating the pyruvate dehydrogenase (PDH) kinase enzyme (PDK), which phosphorylates and inhibits the PDH complex [300]. PDH is a key enzyme in controlling the rate of glucose oxidative metabolism in that it catalyzes the irreversible oxidation of pyruvate, yielding acetyl-CoA and CO2 and, therefore its inhibition creates a glycolytic shift of glucose metabolism. And this phenomenon is associated with attenuates hypoxic ROS generation and rescues cells from hypoxia induced apoptosis (Alda H, 2011) (Figure 15). 62 Figure 15. Metabolic transformation of cancer cells. Hypoxia induced factor-1α (HIF-1α) causes a pathological activation of pyruvate dehydrogenase (PDH) kinase (PDK), which in turn inhibits PDH activity, therefore limiting oxidation of pyruvate, which is shifted towards lactate production (Alda Huqi, 2011, Heart and Metabolism). In addition, HIF stimulates angiogenesis by upregulating several factors, including most prominently vascular endothelial growth factor (VEGF). However, some studies demonstrated that the Warburg effect – that is, an uncoupling of glycolysis from oxygen levels – cannot be explained solely by upregulation of HIF. Moreover, cancer cells appear to use glycolytic metabolism before exposure to hypoxic conditions. For example, leukemic cells are highly glycolytic [301]; [298], yet these cells reside within the bloodstream at higher oxygen tensions than cells in most normal tissues. Similarly, lung tumors arising in the airways exhibit aerobic glycolysis even though these tumor cells are exposed to oxygen during tumorigenesis [302]. Thus, although tumor hypoxia is clearly important for other aspects of cancer biology, the available evidence suggests that it is a late-occurring event that may not be a major contributor in the switch to aerobic glycolysis by cancer cells. Other molecular mechanisms are likely to be important, such as the metabolic changes induced by oncogene activation and tumor suppressor loss. The signaling molecule Ras, a powerful oncogene when mutated, promotes glycolysis [303]; [304]. Akt kinase, a well-characterized downstream effector of insulin signaling, reprises its role in glucose uptake and utilization in the cancer setting [305], whereas the Myc transcription factor upregulates the expression of various metabolic genes [306]. The most parsimonious route to tumorigenesis may be activation of key oncogenic nodes that execute a proliferative program, of which metabolism may be one important arm. Moreover, 63 regulation of metabolism is not exclusive to oncogenes. Loss of the tumor suppressor protein p53 prevents expression of the gene encoding SCO2 (Synthesis of Cytochrome C Oxidase Protein), which interferes with the function of the mitochondrial respiratory chain [307]. A second p53 effector, TIGAR (TP53-Induced Glycolysis and Apoptosis Regulator), inhibits glycolysis by decreasing levels of fructose-2, 6-bisphosphate, a potent stimulator of glycolysis and inhibitor of gluconeogenesis [308]. Another work also suggests that p53-deficiency mediated increase in the rate of aerobic glycolysis may be dependent on the activation of transcription factor NF-κB [309]. Regardless of whether the tumor microenvironment or oncogene activation plays a more important role in driving the development of a distinct cancer metabolism, it is likely that the resulting alterations confer adaptive, proliferative, and survival advantages on the cancer cell. 2. Diversity of energy production pathways of cancer cells 2.1 Glutamine metabolism Having originated from Warburg`s seminal observation of aerobic glycolysis in tumor cells, most of this attention has focused on glucose metabolism. However, people realized that aerobic glycolysis is not a universal feature of all cancers in humans [310]. Both clinical FDG-PET data, as well as in vitro and in vivo experiment studies showed that tumor cells are capable of using alternative fuel sources. In fact, amino acids, fatty acids and even lactate have been shown to function as fuels for tumor cells in a subset of micro-environmental settings [311]; [312]. 1950s cancer biologists have recognized the importance of glutamine as a tumor nutrient. It has been suggested that it participates in bioenergetics, supports cell defenses against oxidative stress, and complements glucose metabolism in the production of macromolecules. These observations are stimulating a renewed effort to understand the regulation of glutamine metabolism in tumors and to develop strategies to target glutamine metabolism in cancer. Glutamine is a nonessential amino acid, more than 90% of the body`s glutamine stores are in the muscle, and is the major amino acid exported from the muscle during catabolic stress. The metabolic fates of glutamine can roughly be divided into reactions that use glutamine for its γnitrogen (nucleotide synthesis and hexosamine synthesis) and those that utilize either the α-nitrogen or the carbon skeleton. The reactions in the first category, glutamine is required for the de novo synthesis of both purines and pyrimidines and is therefore essential for the net production of nucleotides during cell proliferation. The rate-limiting step in the formation of hexosamine is catalyzed by glutamine: fructose-6-phosphate amidotransferase (GFAT), which transfers glutamine`s group to fructose-6-phosphate to form glucosamine-6-phosphate, a precursor for Nlinked and O-linked glycolsylation reactions. These reactions are necessary to modify proteins and lipids for their participation in signal transduction, trafficking/secretion and other processes [313]. 64 The reactions in the second category use glutamate, not glutamine, as the substrate. The mitochondrial enzyme glutaminase (GLS) catalyzes the conversion of glutamine to glutamate, then it can be channeled into the TCA cycle. Increased expression of glutaminase is often observed in tumor and rapidly dividing cells [314]. Classical experiments demonstrated that glutaminase activity correlates with tumor growth rates in vivo [315]; [316], and experimental models to limit glutaminase activity resulted in decreased growth rates of tumor cells and xenografts [317]. Interestingly, a recent study demonstrated that c-Myc enhanced GLS expression through suppression of miR-23a/b, thus providing a molecular link between oncogenic signal and glutamine metabolism [317]. Furthermore, Wang et al report the identification of another class of oncogenic molecules, Rho GTPases, which can promote glutamine metabolism through activation of GLS in a NF-κB-dependent manner [318]. Glumate may also be converted into α-ketoglutarate (α-KG) and enters the TCA cycle to supply intermediates and energy for cell growth. Complete oxidation of glutamine carbon involves exit from the TCA cycle as malate, conversion to pyruvate and then acetyl-CoA, and finally re-entry into the cycle (Figure 16). It is particularly useful in the truncated TCA cycle which cannot efficiently use glucose to generate energy [319]. This process provides fuel for the passive TCA cycle due to a lack of isocitrate [320]; [319]. Therefore, it also demonstrates that cancer cells are able to use OXPHOS for ATP production. Pike et al found that when glutamine was eliminated from the growth medium (glucose only), the oxygen consumption rate of the cells was significantly lower compared to that of the cells grown in control medium (Glucose and Glutamine). Moreover, the oxygen consumption rate of cells grown in medium containing no glucose did not differ significantly from the control cells suggesting that glucose may not contribute significantly to the intracellular fatty acids that flux into mitochondria for oxidation and/or that the presence of glucose inhibits oxidative phosphorylation (the Crabtree effect). They suggested that glutamine is involved in the de novo synthesis of fatty acids which feed into mitochondrial β-oxidation in Glioblastoma cells [321]. 65 Figure 16. Biochemistry of cancer-cell metabolism. On entering the cell, glucose is converted to pyruvate by glycolysis. In normal cells, if oxygen is available, pyruvate undergoes oxidative phosphorylation in mitochondria, through the TCA cycle. If oxygen levels are low, however, pyruvate is converted to lactate in the cytoplasm. Cancer cells drive pyruvate conversion to lactate even in the presence of oxygen. Metabolism of the nutrient glutamine is also modified in cancer. The transcription factors HIF (yellow) and MYC (green) seem to affect these metabolic pathways at various steps. For simplicity, only some chemical reactions and enzymes (purple) are shown. GLUT, glucose transporter; MCT, monocarboxylate transporter. (Kaelin WG Jr, Thompson CB, 2010, Nature). 66 2.2 Mitochondrial oxidative phosphorylation (OXPHOS) Cancer cells are different from most normal tissues in the energy metabolism and they take up glucose and glutamine at a high rate for aerobic glycolysis. In addition, cancers are extremely heterogeneous and each cancer is different in tissue origin and metabolic phenotype [322]. Even in a single cancer, its constituent cells vary in metabolic phenotype [323]. It is worth mentioning that metabolic phenotypes in cancer are plastic, and cancer tissues exhibit greater plasticity than normal tissues [324]. Cancer cells may change their metabolic phenotypes to adapt to microenvironmental changes and the results of these changes give a selective advantage to cancer cells under the unfavorable environment [325]. Warburg originally proposed that the aerobic glycolysis in cancer cells was due to a permanent impairment of mitochondrial OXPHOS. However, recent investigations found that defects of mitochondrial OXPHOS are not common in spontaneous tumors and that the function of mitochondrial OXPHOS in most cancers is intact [326]; [319]. Certain authors consider that the Warburg effect in cancer is due to enhanced glycolysis suppressing OXPHOS rather than defects in mitochondrial OXPHOS. If glycolysis is inhibited in cancer cells, the function of mitochondrial OXPHOS can be restored. For example, Fantin et al observed that when LDH-A (lactate dehydrogenase A) was suppressed in cancer cells, OXPHOS function could be enhanced to compensate for reduced ATP by inhibited glycolysis. This observation suggests that most cancer cells reserve the capacity to produce ATP by OXPHOS. Furthermore, they also found that proliferation and tumorigenicity of cancer cells were inhibited when LDH-A activity was suppressed, suggesting that enhanced OXPHOS is still not sufficient to meet the requirement of cancer growth and that LDH-A is a target of cancer therapy [327]. An emerging hypothesis of the so-called “reverse Warburg effect” also supports the function of OXPHOS in cancer cells [328]. Previously, we have mentioned that the behavior of cancer was determined not only by cancer cells but also by stromal cells. This is possible due to the coevolution between cancer cells and stromal cells in tumorigenesis. For example, under the ‘education’ of cancer cells and inflammatory cytokines, stromal fibroblasts become carcinomaassociated fibroblasts (CAFs), macrophages become tumor-associated macrophages (TAMs) and neutrophils become tumor-associated neutrophils (TANs) and adipocytes become cancer-associated adipocytes (CAAs). In fact, these tumor-associated stromal cells are already different from their original cells and have genetic and epigenetic changes which led to alterations in gene expression and metabolic profiles. Therefore, tumor cells and stromal cells not only influence each other in cytokines and growth factors, but also in energy metabolites. In the reverse Warburg effect, epithelial cancer cells induce aerobic glycolysis in CAFs which produce lactate, ketones and pyruvate that enter the TCA cycle in cancer cells for OXPHOS [328]; [329]. 67 An increasing number of recent studies showed that lactate released by glycolysis in hypoxic tumor cells and/or stromal cells is not discharged as a waste product, but can be taken up by oxygenated tumor cells as energy fuel. Lactate is converted to pyruvate by LDH-B and then enters the mitochondria for OXPHOS to generate ATP [330]; [331]. Metabolic symbiosis is not cancerspecific. In fact, the cooperation between different cells in energy production is also observed in normal tissues. For example, neurons rely on OXPHOS to meet their energy demands, whereas astrocytes rely on glycolysis to meet their energy needs. Lactate released by astrocytes can be taken up by neurons, used as energy fuel and form the so-called astrocyte-neuron shuttle (ANLS) [332]. As such, it is perhaps not surprising that tumors may have also developed a form of metabolic coupling, specifically involving tumor-stromal interactions. In further support of the existence of a ‘lactate shuttle’ in human tumors, Sotgia et al have shown that CAFs express MCT4 (for lactate extrusion), while breast cancer cells express MCT1 (for lactate uptake). Interestingly, MCT4 expression in CAFs is induced by oxidative stress, and MCT4 is a known HIF1 target gene [312]. Co-cultures of normal human fibroblasts and MCF7 cells indicate that cancer cells use oxidative stress as a weapon to trigger the conversion of adjacent fibroblasts into myo-fibroblasts [333]. Cancer cell-induced oxidative stress potently perturbs the behavior of adjacent fibroblasts, induces the lysosomal-mediated degradation of Caveolin-1, and promotes mitochondrial dysfunction, resulting in increased aerobic glycolysis [334]. In turn, these glycolytic fibroblasts support tumor cell mitochondrial respiration and growth by actively transferring high-energy nutrients (such as lactate and pyruvate) to cancer cells. These studies suggest that tumor cells have a high degree of metabolic flexibility and given ample oxygen supply, utilize mitochondria to generate energy and important metabolic intermediates [335]. Considering the possible target for cancer therapy, stimulation of glucose oxidation through pharmacological inhibition of PDK with Dichloroacetate (DCA) was tested. Besides metabolic changes, DCA restores mitochondrial ROS production capacity, releases pro-apototic factors and, ultimately, decreases cell survival and increases apoptosis rates (Figure 15) [300]. However, despite these promising cytological effects, the adverse effects such as hepatotoxicity and neurotoxicity has been reported [336]. Bonnet et al proposed that the effects of DCA to increase glucose oxidation rates can be achieved by inhibiting mitochondrial fatty acid oxidation rates [337]. The reciprocal relationship between glucose and fatty acid metabolism is part of a phenomenon known as the “Randle cycle”. Since glucose oxidation and fatty acid oxidation both produce mitochondrial acetyl-CoA, the rate of each other`s activity has a direct reciprocal effect on the rates of others pathway. Therefore stimulation of glucose oxidation through direct inhibition of PDK activity can similarly be obtained by inhibiting fatty acid oxidation. This has been the rationale for the development and use of fatty acid oxidation inhibitors. However, at this point one may argue: even 68 there is compelling evidence supporting the function of oxidation in cancer cells, how can we determine the fatty acid oxidation also involved in it? 3. Fatty acid metabolism in the limelight In addition to glucose and glutamine, fatty acids (FFAs) are an extremely relevant energy source. They can be incorporated from the extracellular media, or can be potentially obtained from hydrolysed triglycerides by neutral hydrolases in the cytoplasm or acid hydrolases through a novel autophagic pathway: lipophagy [159]. FFAs are critically important in cellular homeostasis as they are involved in a wide variety of processes including phospholipid synthesis, protein posttranslational modifications, cell signaling, membrane permeability, and transcription control [338]. Furthermore, accumulating evidence suggested that some cancer can use adipocyte derived fatty acid for β-oxidation as an important energy source for tumor survival and proliferation [339]; [71]. Although vast majority of the research into cancer metabolism has been limited to glycolysis, glutaminolysis and fatty acid synthesis, the relevance of fatty acid β-oxidation (FAO) for cancer cell function have remained in the dark. Studies in the past 4 years have started to bring to light a relevant role for this metabolic pathway in cancer, a brief overview from fatty acid synthesis to their utilization is given below to help us better understanding the intricate metabolic systems in cancer. 3.1 De novo fatty acid synthesis and the relationship with cancer Fatty acid synthesis is an anabolic process that starts from the conversion of acetyl CoA to malonyl CoA by acetyl CoA carboxylase (ACC). Malonyl CoA is then committed to fatty acid synthesis (FAS) and is involved in the elongation of fatty acids through fatty acid synthase (FASN). Additional modifications of fatty acids can be carried out by elongases and desaturases. Most normal human tissues preferentially use dietary (exogenous) lipid for synthesis of new structural lipids, whereas de novo (endogenous) fatty acid synthesis is usually suppressed, and FASN (fatty-acid synthase) expression is maintained at low levels. By contrast, tumor cells catabolize glucose at a rate that exceeds bioenergetics need by shifting from oxidative to glycolytic metabolism. In this scenario, tumor cells can redirect the excess glycolytic end product pyruvate toward de novo synthesis which is necessary to maintain a constant supply of lipids and lipid precursors to fuel membrane production and lipid based post-translational modification of proteins in a highly-proliferating cell population. In the mitochondria pyruvate is converted to acetyl-CoA, which enters the citric acid cycle. Depending on the oxygen tension, citrate can be oxidized to carbon dioxide and oxaloacetate, thereby generating ATP via oxidative phosphorylation, or it can be transported to the cytosol, where it is converted by ATP citrate lyase (ACL) to oxaloacetate and acetyl-CoA. Acetyl-CoA is metabolized by acetyl-CoA carboxylase (ACC) to yield malonyl-CoA, 69 the first committed precursor of saturated long-chain fatty acids (LCFA) biosynthesis. MalonylCoA is subsequently metabolized to LCFAs, such as palmitic acid, which is the most abundant LCFA in cancer cells, by the NADPH-dependent enzyme – fatty acid synthase (FASN) (Figure 17). LCFAs can be subsequently desaturated to monounsaturated fatty acids (MUFAs) by stearoyl-CoA desaturase (SCD)-1 [340]; [341]. It has been reported that MUFAs are important constituents of the phospholipid cell membrane and are thought to affect its biomechanical integrity, so they are important for tumorigenesis. Inhibition of MUFA synthesis by SCD-1 inhibitors, such as CVT11127, has been proposed as a strategy for reducing tumor growth by attenuating cell proliferation at the G1/S cell cycle phase and initiating apoptosis, although concomitant inhibition of ACC in lung cancer cells does not augment the suppression of cell proliferation by SCD-1 inhibition alone [342]; [343]. Markedly increased ACL expression and activity have been reported in cancer cells [344]; [345]. RNA interference (RNAi) – directed and pharmacological inhibition of tumor-associated ACL drastically limits the in vitro proliferation and survival of cancer cells displaying aerobic glycolysis [345]. The relevance of ACL-driven channeling of glucose into de novo lipid synthesis as an important component of cell growth and transformation is further supported by the fact that ACL inhibition also reduces tumorigenesis in vivo [344]. The second rate-limiting enzyme for FA synthesis is ACC, it has been shown to be overexpressed both at the mRNA and protein levels, not only in advanced breast carcinomas but also in preneoplastic lesions associated with increased risk for the development of infiltrating breast cancer [346]. Numerous studies have shown overexpression of FASN in various human epithelial cancers, including prostate, ovary, colon, lung, endometrium and stomach cancers [347]. Moreover, several reports have shown that FASN and related lipogenic enzymes play important roles in tumor cell survival at multiple levels. In cancer cells, transcriptional regulation of FASN gene is one of the important mechanisms of FASN overexpression [348];[349]. The FASN expression is regulated by growth factors – growth factor receptors, including epidermal growth factor receptor (EGFR) and HER2, and steroid hormone – steroid hormone receptors, such as estrogen receptor (ER), androgen receptor (AR) and progesterone receptor (PR). Downstream of the receptors, the phosphatidylinositol-3-kinase (PI3K)-Akt and mitogen-activated protein kinase (MAPK) are candidate signaling pathway that mediate FASN expression through the sterol regulatory elementbinding protein 1c (SREBP-1c). Recent reports have further shown that the FASN expression is not only controlled by SREBP-1c, but also by other transcription factors, such as the p53 family proteins and the lipogenesis-related nuclear protein, SPOT14, which is overexpressed in breast tumors [350]. 70 Figure 17. De novo synthesis of fatty acids from carbohydrate precursors. Upon cellular uptake by glucose transporters, glucose is phosphorylated by hexokinases (HK) to glucose-6-phosphate, most of which enters the glycolytic pathway generating pyruvate and ATP. In the mitochondria pyruvate is converted to acetyl-CoA, which enters the citric acid cycle. Depending on the oxygen tension citrate can be oxidized to carbon dioxide and oxaloacetate, thereby generating ATP via oxidative phosphorylation, or it can be transported to the cytosol, where it is converted by ATP citrate lyase (ACL) to oxaloacetate and acetyl-CoA. Acetyl-CoA is the requisite building block for fatty acid synthesis, but it also functions as a precursor of mevalonate, which is used for the synthesis of both cholesterol and isoprenoids. Acetyl-CoA carboxylase-α (ACC) carboxylates acetyl-CoA to malonyl-CoA. To produce fatty acids such as palmitic acid by fatty acid synthase (FAS). Saturated long-chain FAs can be further modified by elongases or desaturases to form more complex FAs (Swinnen JV, 2006, Curr Opin Clin Nutr Metab Care). 71 As with these intracellular signaling molecules, extracellular tumor microenvironmental stresses play an important role in tumor-related FASN expression. Hypoxia and low pH stress induce the FASN expression in cancer cells [351]; [352]. Hypoxia upregulates SREBP-1, the major transcriptional regulator of the FASN gene, through phosphorylation of Akt. Apart from the transcriptional regulation of FASN, it is also controlled at the posttranslational levels. Graner et al showed that the isopeptidase USP2a (ubiquitin-specific protease-2a) interacts with and stabilizes FASN protein in prostate cancer [353]. These observations suggest that tumorrelated FASN overexpression could be regulated at multiple levels [354]. In cancer cells, LCFAs which are not metabolized to MUFAs are destined for two fates – cytoplasmic storage as glycerolipids or mitochondrial import for β-oxidation. The former involves the transient storage of palmitic acid as mainly cytoplasmic glycerolipid monoacylglycerol (MAG). MAG seems to be part of an important cellular homeostatic mechanism that prevents lipotoxicity within cancer cells with high levels of FA synthesis since palmitic acid can have both mitochondrial and endoplasmic reticulum-mediated proapoptotic effects which are probably cell type dependent. Three FAs are then esterified to a single glycerol molecule to create a molecule of TAG and stored as an energy reserve in lipid droplet. 3.2 Cellular uptake and transport of long-chain fatty acids Long-chain fatty acids (LCFA) are critically important in cellular homeostasis as they are involved in a wide variety of processes. The physiological response to fasting is linked to the endocrinemediated utilization of stored hepatic and muscle glycogen to maintain normoglycemia. When glycogen reserves are depleted, triglycerides are mobilized from lipid stores, and fatty acids are released at the endothelial walls of capillaries and at the hepatocyte surface by the action of lipoprotein lipase and hepatic lipase, respectively. The physiologically available fatty acids are mostly C16 and C18 species and include saturated and both mono- and di- unsaturated species. The free fatty acids (FFAs) released by lipolysis are transported bound to albumin in blood and taken up by tissues in a process mediated by transport proteins present in the plasma membrane. Once within the cell, FFAs are bound to fatty acid binding proteins which are present in the cytosol in high amounts [355]. Fatty acid-binding proteins are widely expressed throughout the tissues of the body (Table 4). Nine members of the FABP family have been identified as products of separate genes, yet they all appear to have a similar tertiary structure and demonstrate a high affinity for similar substrates [356]. Each FABP has a common 10-stranded antiparallel -barrel, which contains the ligand binding site, and an N-terminal helix-loop-helix motif [357]. Though they all bind single long-chain fatty acids, their individual levels of expression and specific cellular function appear to vary from tissue to tissue. As 72 lipid chaperones, FABPs may actively facilitate the transport of lipids to specific compartments in the cells, such as to the lipid droplet for storage; to the endoplasmic reticulum for signaling, trafficking and membrane synthesis; to the mitochondria or peroxisome for oxidation; to cytosolic or other enzymes to regulate their activity; to the nucleus for lipid-mediated transcriptional regulation; or even outside the cell to signal in an autocrine or paracrine manner [358]. FABP4, also known as ALBP or aP2, is expressed almost exclusively in adipocytes and macrophages. FABP5 (keratinocyte type FABP) is also found in adipocytes, as well as other cell types, though usually at much lower levels. Both proteins are generally implicated in the storage and transport of intracellular lipids, as well as in the regulation of metabolism and lipid mediated gene expression [359]. So they may involve in obesity and cancer as well. One study revealed that serum FABP4 levles were significantly higher in obese (41.16 ng/ml) than in non-obese women (24.95 ng/ml). Independent of obesity, the serum FABP4 levels were significantly higher in brease cancer patients (34.65 ng/ml) than in healthy controls (24.47 ng/ml) showed a significant association of FABP4 with breast cancer risk [360]. Through the use of a protein array, Nieman et al [71] identified an upregulation of FABP4 in metastatic tumour cells (compared with primary ovarian cancer cells) and, in vivo, they observed a significantly lower rate of tumour growth in FABP4 -/- knockout mice than in wild type – further implicating FABP4’s participation. They went on to identify FABP4 as a potential therapeutic target in cancer, particularly highlighting the potential for inhibition of FABP4 to prevent lipolysis in adipocytes and lipid accumulation in tumour cells. Pharmaceutical companies have since begun to explore the potential for FABP4 inhibition in oncology [358]. In an in vitro study of adipocytes treated with BMS309403, decrease fatty acids uptake [361] and inhibit the lipolysis ability [362], which may suggest that inhibition of FABP4 inhibit the liberation of FFAs by adipocytes and prevent their uptake by tumor cells. However, in general, the interacting molecular partners for FABPs are poorly understood, and the searches for such proteins with conventional approaches have not been fruitful. Little is known regarding how lipids regulate subcellular localization of FABPs. Further and clear evidence on the specific impact of FABPs on cell biology and lipid metabolism need to be created. 73 Table 4. family of fatty acid-binding proteins (FABPs) (Furuhashi M, 2008, Nat Rev Drug Discov). 74 3.3 Fatty acid β-oxidation 3.3.1 Peroxisome fatty acid β-oxidation β-oxidation is a major process by which fatty acids are oxidized, and this oxidation occurs both in mitochondria and in peroxisomes [363]; [364]; [365]. Fatty acids are also oxidized by ω-oxidation by a cytochrome P450 CYP4A subfamily, this oxidation occurs almost exclusively in smooth endoplasmic reticulum [366]; [367]. Fatty acid synthesis is enhanced and β-oxidation is lowered when glucose supply is plenty so that excess energy can be stored in the form of triacylglycerol. When glucose availability is diminished, however, the synthesis of FAs is depressed and βoxidation is enhanced in liver so as to generate ketone bodies for export to serve as fuels for other tissue, such as the skeletal and cardiac muscle [368]. Peroxisomes are cell organelles present in virtually all eukaryotic cells. Currently, more than 60 proteins have been found and more than half of these proteins participating in lipid metabolism in mammalian peroxisomes [369]. By virtue of this advantage, peroxisomes play a critical role in metabolic systems and physiological processes influencing alternate use of carbohydrate and fatty acids to generate ATP. It is clear that in animals both the mitochondrial and the peroxisomal FAO systems are present in the same cell; they are catalyzed by different enzymes encoded by different genes and they play functionally complementary but different roles [370]; [371]. Short- (C4-C6) medium-chain (C8-C12) of fatty acids are exclusively β-oxidized and Long-chain fatty acids (LCFAs) (C14-C20) are predominantly β-oxidized in mitochondria, while Very Long-chain fatty acids (VLCFAs) (>C20) are almost exclusively β-oxidized in peroxisomes because mitochondria are devoid of very-long-chain acyl-CoA synthetase [372]; [371]. The classical Peroxisomal β-oxidation pathway is catalyzed by three enzymes: fatty acyl-CoA oxidase (AOX), enoyl-CoA hydratase/L-3-hydroxyacyl-CoA dehydrogenase bifunctional protein (L-PBE) and 3-ketoacyl-CoA thiolase [370]; [372], and all three enzymes are transcriptionally activated by PPARα ligands [373]. AOX is the first and rate-limiting enzymes which reflect distinctive differences between peroxisomal and mitochondrial oxidation pathways [374]. Unlike the mitochondrial system, peroxisomal β-oxidation is carnitine independent, after 4 steps of reaction, they release acetyl-CoAs and an acyl-CoA that is two carbon atoms shorter than the original molecule and that can reenter the spiral for the next round of β-oxidation [370]. Then, it does not go to completion, as the chain-shortened acyl-CoAs are exported to mitochondria for the completion of β-oxidation. The brief comparison of mitochondrial and peroxisomal fatty acids βoxidation is shown in Figure 18. As mitochondrial β-oxidation is primarily involved in the catabolism of short-, medium-, and longchain fatty acids, we will describe it more carefully. 75 Figure 18. Enzymology of mitochondrial inner-membrane-bound long-chain fatty acid β-oxidation system involving trifunctional protein, and the peroxisomal-inducible classical straight-chain and the noninducible branched-chain fatty acid β-oxidation systems in humans (Reddy JK, 2001, Annu Rev Nutr). 76 3.3.2 Mitochondrial Transport of Fatty Acids Mitochondria are not only the seat for the electron transport chain but they are also the site for the tricarboxylic acid (TCA; Kreb`s) cycle. The TCA cycle is the cancer cell`s principal “biochemical hub” where different carbon sources are substrates for both OXPHOS and cellular biosynthesis such as nucleotide production for DNA synthesis and cellular membrane synthesis [375]. Lots of enzyme involved during these process. Carnitine (β-hydroxy γ-trimethylaminobutyric acid) is a critical factor for LCFA intramitochondrial transport. The first β-oxidation reaction is the cytoplasmic metabolism of LCFA to their respective acyl-CoA derivatives by acyl-CoA synthase (ACS) isoforms. Long-chain acyl-CoAs are subsequently esterified to their L-carnitine derivatives by Carnitine palmitoyltransferase I (CPT-I) on the surface of the outer mitochondrial membrane before mitochondrial import for β-oxidation, such that the principal long-chain acyl-CoA, palmitoyl-CoA (PALMCoA), is metabolized by CPT-I to palmitoylcarnitine. The resulting long-chain acyl-carnitine is transported across the inner mitochondrial membrane by carnitine: acylcarnitine translocase (CACT). Once inside the mitochondrial matrix, the acyl-CoA is reformed by the action of the inner mitochondrial membranebound CPT II using free CoA. The carnitine released by this reaction is recycled for subsequent reutilization via CACT [376]. The step catalyzed by CPT-I is rate limiting for entry of fatty acids into the mitochondria. During energy starvation, when ATP levels are low and AMPK is activated, ACC-dependent malonyl-CoA levels fall, releasing the inhibition on the CPT-I (malonyl-CoA inhibit CPT-I) which thus facilitates the mitochondrial entry of LCFAs for β-oxidation [365]. PALMCoA is subsequently metabolized by four enzymatic reactions to produce acetyl-CoA. This utilizes a quartet of cornerstone βoxidation enzymes that reside on different mitochondrial substructures [377], which in toto suppresses glucose oxidation by repressing PDH activity, thus preventing the mitochondrial metabolism of pyruvate. Medium- and short-chain fatty acids (chain length 12 and lower) enter the mitochondria independently of the carnitine shuttle and are presumably activated within the mitochondrial matrix by different acyl-CoA synthetases. CPT-I was the first enzyme of FAO shown to exist in distinct tissue-specific isoforms. CPTIA was first identified in the liver but is in fact broadly expressed. Mutations of the CPTIA gene have been implicated in hereditary disorders. In contrast, CPT1B expression is restricted to muscles, and CPT1C is a brain-specific isoform [378]. These enzymes are present on the cytosolic surface of mitochondria and catalyze the production of acyl carnitine from acyl-CoA, thereby facilitating lipid transport through the mitochondrial membranes. 77 3.3.3 Mitochondrial fatty acid β-oxidation reaction process The β-oxidation process involves the concerted action of a series of chain-length specific enzymes, which sequentially remove a molecule of acetyl-CoA per cycle from the initial fatty acid substrate. The first reaction involves a member of the acyl-CoA dehydrogenase family of FAD-requiring oxidoreductases. Very long-chain acyl CoA dehydrogenase (VLCAD) is a membrane-associated enzyme responsible for reduction across the 2, 3 position of the acyl-CoA moiety to produce a 2, 3enoyl-CoA [379]. VLCAD is responsible for reducing acyl-CoAs of chain lengths C12 - C18. Two additional members of the acyl-CoA dehydrogenase family, medium-chain and short-chain acylCoA dehydrogenases, respectively (MCAD, SCAD), are found in the mitochondrial matrix. MCAD is responsible for the metabolism of acyl-CoAs of chain lengths C6 - C10, and SCAD is specific for C4 and C6 substrates in the two final rounds of the β-oxidation cycle in the mitochondrial matrix (Figure 19). MCAD and SCAD are catalytically active as homotetramers of 44-kDa polypeptides [380]. Long chain acyl-CoA dehydrogenase (LCAD) is also a member of this family of enzymes and has substrate chain length specificity between VLCAD and MCAD. Although no human case of LCAD deficiency has been described, a mouse model of this disorder results in gestational loss, lipidosis, hypoglycemia, and myocardial degeneration, a biochemical phenotype similar to human VLCAD deficiency [381]. The second reaction involves hydration of the double bond in the 2, 3 position to produce a stereospecific L-3-hydroxyacyl-CoA species. Two enzymes able to carry out this reaction have been described to date: long-chain enoyl-CoA hydratase (LHYD) is responsible for hydrating long-chain species and is part of a membrane-associated trifunctional enzyme complex called the mitochondrial trifunctional protein (TFP). Active TFP is a heterooctamer of α4β4 subunits [382]; [383]. The α-subunit encodes LHYD activity and the subsequent enzyme in the sequence, longchain L-3-hydroxyacyl-CoA dehydrogenase (LCHAD). The β-subunit has long-chain 3-ketoacylCoA thiolase (LKAT) activity, the fourth enzyme in the cycle. Association of the complex is necessary for membrane translocation and for catalytic stability of the individual enzymes [384]; [385]. The second hydratase is crotonase (short-chain enoyl-CoA hydratase), which is responsible for the hydration of medium- and short-chain enoyl-CoA species. The third step of FAO involves the reduction at the L-3-hydroxy position to yield a 3-ketoacyl-CoA species. In this reaction, NAD+ is reduced to NADH. LCHAD is an integral part of the TFP and is responsible for the reduction of long-chain substrates, while a medium- short-chain L-3- hydroxyacyl-CoA dehydrogenase (M/SCHAD) with broad-chain-length specificity is responsible for medium- and short-chain species [386]. The final step of β-oxidation involves thiolytic cleavage of the 3-ketoacyl-CoA to yield acetyl-CoA and a two-carbon chain-shortened acyl-CoA. The enzyme responsible for long-chain species is 78 LKAT, which is also part of the TFP. Finally the generated acyl-CoA by this process is targeted toward steroidogenesis, ketogenesis or TCA cycle for complete oxidation to yield CO2. Mitochondrial FAO represents the major route of acyl-CoA oxidative metabolism via β-oxidation to produce acetyl-CoA and chain-shortened acyl-CoAs, with the produced acetyl-CoA potentially entering the TCA cycle, culminating in complete oxidation of the carbon to CO2 (complete FAO). However, a portion of lipids are incompletely oxidized, a process that leads to the production of acid-soluble metabolites (ketone bodies, acyl-CoAs, and acylcarnitines). It has been suggested that an increase in the relative proportion of complete FAO to CO2 may be physiologically beneficial [387]. The percentage of complete FAO to CO2 relative to total FAO can be viewed as a marker of FAO efficiency by estimation of the coupling of acetyl-CoA production by β-oxidation to the flux of acetyl-CoA through the TCA cycle. Recently, some studies reported that elevated liver FAO efficiency was associated with increases in hepatic mitochondrial protein expression and/or function and decreased steatosis [388]; [389]. Peroxisome proliferator-activated receptor-γ coactivator (PGC-1α) is a member of a family of transcription coactivators that plays a central role in the regulation of cellular energy metabolism. It has been observed to functionally control FAO efficiency in skeletal muscle. The mitochondrion is unique among mammalian organelles, in that it contains DNA that encodes proteins required for appropriate function [390]; as such, the relative mitochondrial DNA copy number in cells can serve as an index for mitochondrial content under differing environmental or metabolic conditions. In skeletal muscle, PGC-1α increases mtDNA content through upregulation of the nuclear-encoded mtTFA via coactivation of nuclear respiratory factors 1 and 2 [391]. Several studies suggested that increased PGC-1α expression produced coordinated increase in fatty acid β-oxidation and downstream mitochondrial pathways, resulting in elevated FAO to CO2 [392]; [393]. 79 Figure 19. Pathway of fatty acid metabolism from the transport of long-chain fatty acids and carnitine across the plasma membrane to the production of acetyl-CoA. Medium- and short-chain fatty acids do not require an active transport mechanism to reach to mitochondrial matrix. Enzymes of the carnitine cycle (CPTI, CACT, and CPTII) shuttle long-chain fatty acids across the mitochondrial membranes. The fatty acid β-oxidation spiral includes an FAD-dependent acyl-CoA dehydrogenase step (1) followed by a 2, 3-enoylCoA hydratase reaction (2), the NAD-dependent 3-hydroxyacyl-CoA dehydrogenase step (3), and the thiolase cleavage reaction (4). (Rinaldo P et al, 2002, Annu Rev Physiol) 80 3.4 Mitochondrial fatty acid β-oxidation in cancer There are a number of studies that link β-oxidation with cancer. Several enzymes involved in the metabolism of fatty acids have been determined to be altered in prostate cancer relative to normal prostate, which is indicative of an enhanced β-oxidation pathway in prostate cancer [394]. Another study provided significant evidence that increased mitochondrial β-oxidation of fatty acids has been linked to tumor promotion in pancreatic cancer [395]. The group of Nika Danial found that diffuse large B cell lymphoma (DLBCL) have an OXPHOS gene expression signature and are highly dependent on mitochondrial FAO for growth and survival that do not require the activation of the B cell receptor [396]; [397]. Linher-Melville K et al., revealed that Prolactin enhances FAO by stimulating CPT1a expression in breast cancer cells and these effects are partially dependent on the LKB1-AMPK pathway [398]. Pharmacological activation of β-oxidation can also rescue the glucose dependency of Akt-transformed cells [399], suggesting that this pathway can provide important metabolites for cancer-cell survival. FAO is controlled at the step of FA import into the mitochondria, a process executed by tissuespecific isoforms of CPT1. Pharmacologic inhibition of FAO with etomoxir, which inhibits the activity of CPT1, has yielded therapeutic benefits for the treatment of heart failure by shifting the failing heart`s energy supply from fatty acids to the energetically more efficient pyruvate [400]. Samudio et al., have demonstrated that etomoxir inhibited proliferation and sensitized human leukemia cells to apoptosis induction by ABT-737 (a molecule that releases proapoptotic Bcl-2 proteins). Importantly, etomoxir decreased the number of quiescent leukemia progenitor cells in approximately 50% of primary human acute myeloid leukemia samples, provided substantial therapeutic benefit in a murine model of leukemia [401]. Pike et al., reported that human glioblastoma SF188 cells oxidize fatty acids and that inhibition of FAO by etomoxir markedly reduces cellular ATP levels and viability. They also found that inhibition of FAO decreases NADPH levels and the reduced glutathione (GSH) content and elevates intracellular reactive oxygen species which suggested that mitochondrial fatty acid oxidation may provide NADPH for defense against oxidative stress and prevent ATP loss and cell death [321]. The requirement of FAO for ATP production in conditions of metabolic stress is recapitulated in other cancer types and conditions. The group of Tak W.Mak identified an atypical carnitine palmitoyltransferase 1 (CPT1) isoform—CPT1C—as a potential oncogene that is frequently expressed in tumors and up-regulated in response to metabolic stress. They showed that CPT1C expression in tumor cells correlates inversely with both mTOR pathway activation and sensitivity to the mTOR inhibitor rapamycin. Enhanced CPT1C expression increases FAO and ATP production and protects cells from death induced by glucose deprivation or hypoxia. Conversely, cells deficient in CPT1C show reduced ATP production, enhanced apoptosis: increased caspase-3 and -9 81 activation, and impaired mitochondrial membrane potential: swollen mitochondria exhibiting abnormal internal membrane structure and loss of internal cristae density. There is dramatic difference in lipid composition: in CPT1C deficiency cells, there is increased levels of linoleic, arachidonic, and docosotetraenoic acids, and decreased levels of oleic acid. Collectively, these results demonstrate that tumor cells constitutively expressing CPTIC show increased fatty acid oxidation, ATP production, and resistance to glucose deprivation or hypoxia. These data indicate that cells can use a novel mechanism involving CPTIC and FA metabolism to protect against metabolic stress [402]. Schafer and co-workers showed that antioxidants counteract ROS accumulation and can reactivate FAO, increase ATP levels and prevent loss of attachment (LOA)induced anoikis [403]. Pandolfi et al described a novel mechanism in which FAO is regulated by the promyelocytic leukaemia (PML) protein, and this regulation is dependent on peroxisome proliferator-activated receptors (PPARs) [404]. In agreement with the study from Joan Brugge`s group, the ability of PML to increase FAO activity promoted cell survival on LOA [403]. This mechanism of action provides an explanation for the upregulation of PML that is observed in a subset of aggressive breast cancers with increased PPAR activity and a poor prognosis [404]. Accordingly, the hallmarks of cancer metabolism are much more nuanced than can be explained by a single metabolic phenotype and recent evidence highlights an unexpected complexity of alterations in metabolic pathways within tumors. These recent studies also highlight the importance of “metabolic coupling” between cancer and stromal cells. They suggest that tumor cells promote their own growth and survival by behaving as a “parasitic organism”. Hence, the term “parasitic cancer metabolism” to describe this type of metabolic-coupling in tumors has been proposed. 3.4.1 Cancer cells behave as Metabolic Parasites: lactate and FFAs from stromal cells promotes mitochondrial metabolism in cancer cells, fueling tumor growth According to the “Reverse Warburg Effect” (discussed above), epithelial cancer cells induce oxidative stress in adjacent stromal fibroblasts, by secreting hydrogen peroxide and activating NFκB, these cause stromal fibroblast activation, with the upregulation of HIF1 activity driving autophagy, mitophagy, aerobic glycolysis and local inflammation state in the tumor stroma [328]; [334]; [333]; [335]; [329]; [405]. As such, the stroma provides catabolized nutrients to “fuel” the anabolic growth of tumor cells by enhancing their mitochondrial activity. L-lactate derived from glycolytic fibroblasts is transferred to cancer cells and is used to generate energy. Similarly, ketone bodies and glutamine derived from host cell catabolism can also fuel the mitochondrial activity of adjacent epithelial cancer cells (Figure 20). 82 Figure 20. Energy transfer in cancer metabolism. Cancer cells induce oxidative stress in adjacent stromal cells by secreting hydrogen peroxide, activating NF-κB and upregluating HIF-1 to drive autophagy, mitophagy, aerobic glycolysis and local inflammation state in the tumor stroma. Thus, the stroma provides catabolized nutrients: lactate, ketones, Glutamine and fatty acid to “fuel” the anabolic growth of tumor cells. 83 In the obese, an increased rate of lipolysis is observed in adipocytes. In line with this concept, enhanced lipolysis in host tissues can potentially fuel tumor growth by releasing free fatty acids (FFAs) from host adipocytes to be recycled via β-oxidation in cancer cell mitochondria. Over 80% of ovarian cancers are metastatic to the omental fat. Currently, it is unclear why ovarian cancer cells preferentially seed the omentum as compared to other sites. To address this issue, Nieman et al., showed that human omental adipocytes promote homing, migration and invasion of ovarian cancer cells, and that adipokines including IL-8 mediate these activities; a co-culture model of adipocytes with ovarian cancer cells suggested that, in the presence of ovarian cancer cells, adipocytes released significantly higher levels of FFAs and glycerol than adipocytes cultured in the absence of cancer cells; coculture led to the direct transfer of lipids from adipocytes to ovarian cancer cells and promoted in vitro and in vivo tumor growth. Moreover, they demonstrate that ovarian cancer cells have higher mitochondrial metabolic activity, specifically fatty acid βoxidation, when cocultured with adipocytes compare to cancer cells alone. The adipocyte fatty acid binding protein FABP4 was identified as a key mediator of ovarian cancer cell-adipocyte interaction [71]. These results suggested high-energy nutrients provided by host cells may bolster mitochondrial metabolism in cancer cells, but how these adipocyte-derived fatty acids are stored as TG in cancer cells and liberated as free fatty acid, whether mitochondria β-oxidation is important for tumor progression, was not demonstrated. 3.4.2 Adipocyte lipolysis promotes Cancer-Associated Cachexia driving tumor growth and tumor may possess this lipolytic activity supporting their malignant behavior Cancer associated cachexia (CAC) is a multi-factorial wasting syndrome, accounting for about 20% of cancer death, characterized by the loss of adipose tissue and skeletal muscle mass, which lead to physical impairment [406]. The severity of cachexia varies depending on the tumor type, site, and stage [407]. CAC is prevalent in patients suffering from gastrointestinal and pancreatic adenocarcinoma, occurring in 80-90% of patients. It also arises in patients suffering from other carcinomas, although to a lesser extent [408]. Patients suffering from CAC lose on average 32% of their body weight, 75% of their skeletal muscle, as well as 85% of total body fat [409]. The mechanism underlying CAC are poorly understood. Indeed, nutritional supplementation has largely failed to reverse the wasting process, thus, anorexia is unlikely to be solely responsible for the loss of weight in CAC [410]. The loss of muscle mass might be a result of decreased protein synthesis, increased protein catabolism, or both depending on the tumor or stage of CAC. Recent reports recognize a prominent role for lipid metabolism and triglyceride lipases in the initiation and/or progression of CAC [411]; [412]; [413]. 84 Triacylglycerol (TAG) stored in WAT is broken down into FFAs and glycerol by a highly regulated process known as lipolysis, a process of three subsequent steps catalyzed by three essential lipases. ATGL catalyzes the rate-limiting first step, converting TAG into diacylglycerol (DAG) and a free FA. DAG is then acted upon by HSL to remove the second FA to form monoacylglycerol (MAG). The third and final enzyme, monoglyceride lipase (MGL) converts MAG into glycerol and a third free FA. Thus three molecules of FA are released in this process that are then either re-esterified to form new TAG or shuttled to metabolically active tissues where they undergo fatty acid oxidation to generate energy or might be used for anabolic process. Lipolysis is influenced by several additional factors that regulate the activities of these essential lipases, and both lipolysis and lipogenesis not only regulate the homeostasis of WAT but also direct systemic energy production (described in the second part). The processes leading to the depletion of TAG reserves involve decreased lipogenesis, like the activity of FA synthase are reduced in WAT adjacent to the tumor, compared with distant WAT, in samples from 32 colorectal cancer patients [414]; [415] and most prominently, increased lipolysis [416]. Tisdale et al., has observed there is elevated levels of serum TAG and cholesterol in patients suffering from CAC and a marked increase in FA and glycerol concentrations in CAC patients as compared to weight-stable cancer patients. There is twofold increase in HSL expression in WAT and a similar elevation of free FAs in serum from cancer patients and patients in the early phases of CAC, compared with normal controls [417]; [418]; [419]. ATGL expression is somewhat enhanced in WAT of cachectic cancer patients; however, the increase was not significant [419]. Suman et al., used two different cachexia models in mice lacking either Atgl or Hsl. They observed that ATGL activity increases in parallel with tumor growth and WAT mobilization, the induction of lipolysis is not observed in the absence of ATGL and significantly reduced in the absence of HSL. Thus, lipase deficiency blocks tumor-induced WAT loss. Moreover, they also found that in gastrocnemius muscle samples of WT mice with Lewis lung carcinoma (LLC), there is 1.8- to 2.5- fold increased mRNA expression levels of genes involved in the regulation of cellular FA uptake (CD36 and fatty acid transport protein-1, Fatp-1), CPT-1β, and mitochondrial function (PGC-1α), no changement in Atgl-/-mice in response to LLC which suggested the increased FA oxidation in skeletal muscle of CAC patients [412]; [420]. Based on this work, it is tempting to speculate that drugs targeting adipose tissue lipases may represent a therapeutic strategy to avoid the devastating conditions of CAC. These data provide additional support for the intense metabolic-coupling between cancer and host cells. As we know that tumor cells display progressive changes in metabolism that correlate with malignancy, including storage of FFAs from surrounding adipocytes as TG or development of a 85 lipogenic phenotype. However, how stored fats are liberated and remodeled to support cancer pathogenesis, do they also possess these lipases that favor their own metabolic transformation? Nomura et al., used functional proteomic methods to discover MAGL highly elevated in aggressive cancer cells from multiple tissues of origin. They showed that MAGL, through hydrolysis of MAG, controls FFA levels in cancer cells. The resulting MAGL-FFA pathway feeds into a diverse lipid network enriched in protumorigenic signaling molecules and promotes migration, survival, and in vivo tumor growth. shMAGL melanoma, ovarian and breast cancer cells exhibited significantly reduced in vitro migration, invasion and cell survival under serum-starvation conditions. Thus, aggressive cancer cells possess high lipolytic activity to generate an array of protumorigenic signals that support their malignant behavior [421]. This is consistent with further observation indicating that MAGL is elevated in androgen-independent versus androgen-dependent human prostate cancer cell lines, and that pharmacological or RNA-interference disruption of this enzyme impairs prostate cancer aggressiveness. Furthermore, they showed that MAGL is part of a gene signature correlated with epithelial-to-mesenchymal transition and the stem-like properties of cancer cells that may support their progression to a high-malignancy state [422]. Another study demonstrated colorectal cancer cells growth can be inhibited via knockdown of MAGL through repress Cyclin D1 and Bcl-2 to reduce cell proliferation and increase apoptosis [423]. Although the relationship between the synthesis, storage and the use of FFAs in tumor cells is still poorly understood, it becomes clear that lipid metabolites, supplied either by exogenous sources— such as adipose tissue, or by intracellular de novo synthesis, are required for promoting tumor growth and metastasis. Taken together, over the past three decades, ground-breaking work has been performed on expanding our knowledge of the altered cellular signaling mechanisms responsible for the progression from healthy cells to transformed, aggressively growing tissues. Two new areas have received more attention in the more recent past. One is the increased realization that the stromal microenvironment surrounding the tumor cells plays a critical role for tumor progression and metastasis. Growing evidence from epidemiologic and preclinical studies highlights the link between obesity and cancer. The molecular mechanisms responsible for this adipocyte-cancer cell heterotypic crosstalk have remained largely unknown. However, it is likely that this interplay between adipocytes and tumor cells may lead to adipose tissue remodeling, including acquisition of the adipocytes of a fibroblast-like phenotype, altered adipokine production, thereby affecting the remodeling of the local ECM as well as local and systemic inflammation, enhanced angiogenesis as well as altered lipids metabolism. And these molecular alterations would be amplified because of adipose tissue dysfunction in obese condition. 86 The second area of interest focus on tumor metabolism, reviving the original observations related to the Warburg effect. While the importance of the host microenvironment and energy transfer in cancer metabolism is highlighted. More studies on two compartment tumor metabolism will be necessary to understand and therapeutically exploit the metabolic coupling between “parasitic” tumor cells and their hosts. Uncoupling “parasitic” tumor cells should allow us to starve cancer cells and effectively treat advanced and metastatic cancers. With the fatty acid oxidation in the limelight, we further speculate that concurrent targeting of FA oxidation in tumor cells could be a highly effective anticancer approach. Therefore, to date, there is no literature report the “metabolic symbiosis” between breast cancer and their close neighborhood: adipocytes. The lipolytic activity in breast cancer to favor their metabolic transformation is also in dark. My work is to shed in light the crosstalk between adipocytes and breast cancer cells, specially the “metabolic part” and underscore the need to fully understand the role of this heterotypic signaling in modulating tumor behavior. 87 RESULTATS 88 REVIEW I: Adipose tissue and breast epithelial cells: A dangerous dynamic duo in breast cancer (Wang et al, 2012, Cancer Lett) 89 Cancer Letters 324 (2012) 142–151 Contents lists available at SciVerse ScienceDirect Cancer Letters journal homepage: www.elsevier.com/locate/canlet Mini-review Adipose tissue and breast epithelial cells: A dangerous dynamic duo in breast cancer Yuan-Yuan Wang a,b,c, Camille Lehuédé a,b,d, Victor Laurent a,b, Béatrice Dirat a,b,d, Stéphanie Dauvillier a,b, Ludivine Bochet a,b,d, Sophie Le Gonidec a,d, Ghislaine Escourrou e, Philippe Valet a,d, Catherine Muller a,b,⇑ a Université de Toulouse, UPS, IPBS, F-31077 Toulouse, France Institut de Pharmacologie et de Biologie Structurale, CNRS UMR 5089, 205 route de Narbonne, BP 64182, F-31077 Toulouse, France c Department of Endocrine and Breast Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing, China d Institut National de la Santé et de la Recherche Médicale, INSERM U1048, F-31432 Toulouse, France e Service d’Anatomo-Pathologie, Hôpital de Rangueil, 1, avenue Jean-Poulhes, TSA 50032, 31403 Toulouse, France b a r t i c l e i n f o Article history: Received 28 March 2012 Received in revised form 14 May 2012 Accepted 16 May 2012 Keywords: Adipose tissue Breast cancer Microenvironment Obesity Inflammation a b s t r a c t Among the many different cell types surrounding breast cancer cells, the most abundant are those that compose mammary adipose tissue, mainly mature adipocytes and progenitors. New accumulating recent evidences bring the tumor-surrounding adipose tissue into the light as a key component of breast cancer progression. The purpose of this review is to emphasize the role that adipose tissue might play by locally affecting breast cancer cell behavior and subsequent clinical consequences arising from this dialog. Two particular clinical aspects are addressed: obesity that was identified as an independent negative prognostic factor in breast cancer and the oncological safety of autologous fat transfer used in reconstructive surgery for breast cancer patients. This is preceded by the overall description of adipose tissue composition and function with special emphasis on the specificity of adipose depots and the species differences, key experimental aspects that need to be taken in account when cancer is considered. Ó 2012 Elsevier Ireland Ltd. All rights reserved. 1. Introduction There is now cumulative evidence that cells immediately adjacent to a tumor are not only passive structural elements but also active actors in tumor progression (for reviews [1–3]). The tumor mass is undoubtedly a multifaceted show, where different cell types, including neoplastic cells, fibroblasts, endothelial and immune-competent cells, interact with one another continuously to favor tumor progression [1,4]. The carcinoma stroma shares many traits with conditions of chronic inflammation or wound healing and accordingly, tumors have been described as ‘‘wounds that never heals’’ [5]. Infiltration of inflammatory cells including T cells, neutrophils and macrophages, among others, is a very common feature in breast cancer lesions [6,7]. In addition, it is becoming increasingly clear that cancer-associated fibroblasts (CAFs) are also prominent modifiers of breast cancer progression [2]. Among the many different cell types surrounding breast cancer cells, the most abundant are those that compose mammary adipose tissue (MAT) (see Fig. 1), mainly mature adipocytes and progenitors (preadipocytes and Adipose-Derived Stem cells [ADSCs]). For a long time, MAT has not been considered more than a casual ⇑ Corresponding author at: Institut de Pharmacologie et de Biologie Structurale, CNRS UMR 5089, 205 route de Narbonne, BP 64182, F-31077 Toulouse, France. Tel.: +33 561175932. E-mail address: [email protected] (C. Muller). 0304-3835/$ - see front matter Ó 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.canlet.2012.05.019 observer, and certainly not a disease modifying entity. However, recent accumulating evidences bring the tumor-surrounding adipose tissue into the light as a key component of breast cancer progression. Both progenitors and mature adipocytes are not passive towards breast cancer cells and exhibit specific traits that begin to be characterized, as their ability to contribute to local inflammation through IL-6 secretion [8,9]. The effect of MAT does not appear to be limited to tumor progression but may also affect the early stages of carcinogenesis and the response to treatment of established tumors [10]. Studying the multifaceted role of MAT in breast cancer is of major clinical importance. In fact, obesity has recently emerged as an independent negative prognosis factor for breast cancer independently of menopause status [11,12]. This relationship has major consequences in public health since the prevalence of overweight and obesity has been increasing worldwide over the past decades and reaches alarming dimensions. According to the World Health Organization (WHO), by 2015 there will be 3 billion overweight and 700 million obese adults worldwide. Although not demonstrated experimentally, one might reasonably speculate that the positive contribution of MAT into tumor progression might be amplified in obese women, therefore explaining in part the poor prognosis observed in this subset of patients. The expected striking increase in the incidence of these aggressive cancers in the near future related to obesity turns the knowledge of this field of great impact. Another clinical consequence of the experimental studies Y.-Y. Wang et al. / Cancer Letters 324 (2012) 142–151 Ad IF IF IF C Fig. 1. In breast cancers, early local tumor invasion results in immediate proximity of cancer cells to adipose tissue. Histological examination of an invasive breast tumor after H&E staining (original magnification X 200). Ad, adipose tissue; IF, invasive front; C, tumor center. Note that at the invasive front, the number and size of adipocytes are reduced (indicated by arrows). on the crosstalk of epithelial cells and MAT concerns the safety of autologous fat transfer, also defined as lipofilling procedures, used to improve the results of the total or partial reconstruction in breast cancer patients [13]. The purpose of this review is to emphasize the role that MAT might play by locally affecting breast cancer cell behavior and subsequent clinical consequences arising from this dialog. This will be preceded by the overall description of adipose tissue (AT) composition and function with special emphasis on the specificity of adipose depots and the species differences, key aspects that need to be taken in account when cancer is considered. Of note, AT constitutes an active endocrine organ that can have far-reaching effects on the physiology of other tissues. To understand the endocrine effect of adipose tissue on breast cancer the reader is referred to reviews on that topic [14,15]. 143 involved mainly in the control of weight regulation, the BAT is the main tissue regulating thermogenesis in response to food intake and cold. WAT, which will be covered in this review, is mainly comprised of adipocytes, although other cell types contained in the so-called stroma vascular fraction (SVF) contribute to its growth and function, including ADSCs, preadipocytes, lymphocytes, macrophages, fibroblasts and vascular endothelial cells [16]. Mature white adipocytes have a spherical shape and a single lipid droplet, surrounded by a reduced rim of cytoplasm, which essentially occupies the fat cell volume (see Fig. 2). Mature adipocytes, first thought as energy-storing cells, have emerged this last decade as highly endocrine cells which are able to secrete hormones, growth factors, chemokines or pro-inflammatory molecules, an heterogeneous group of molecules termed «adipokines» [16]. Traditionally, the two major adipose depots considered and the more extensively studied are the visceral (VAT) and subcutaneous (SAT) adipose tissues. Differences between adipocytes from visceral and subcutaneous depots have been recognized for many years including their unique profile of adipokines production (for review see, [16]). In addition, VAT adipocytes exhibit higher rates of fatty acid turnover and lipolysis, and are less responsive to the anti-lipolytic effects of insulin and catecholamines than SAT adipocytes [17]. There is clearly a different impact on VAT versus SAT on human health. Increase in VAT is particularly linked to obesity-related complication such as type 2 diabetes, cardiovascular diseases and dyslipidemias whereas, storage of fat in subcutaneous adipose tissue (SAT) is linked to a lower risk for such conditions [16]. Accumulating evidence indicates that a state of chronic low-grade inflammation has a crucial role in the pathogenesis of obesity-related metabolic dysfunction in intra-abdominal adipose depots as opposed to subcutaneous depots. Accordingly, obese subjects were found to harbor increased AT macrophage content mainly in visceral depots [16,18]. 2.2. What are the specificities of mammary adipose tissue? 2. White adipose tissues: common features and differences, consequences on breast cancer studies 2.1. Characterization of white adipose tissues: common features and depot-specific differences in obesity conditions Mammals have two main types of adipose tissue: white adipose tissue (WAT), and brown adipose tissue (BAT), each of which possesses unique cell autonomous properties. While WAT is specialized in storing energy and is an important endocrine organ Normal Mammary Adipose Tissue The different impact of visceral versus subcutaneous fat on health during obesity conditions highlights an important concept in adipose tissue biology, namely, that fat in different body locations exhibits distinct features and functional characteristics. Regarding this later point, what is the specificity of MAT? The mammary gland is comprised of myoepithelial and luminal epithelial cells embedded in a complex stroma termed mammary fat pad composed predominantly of fibroblasts and adipocytes, and cells of both the interspersed vasculature and lymphatic systems [19]. A In vitro differentiated preadipocytes Fig. 2. Differences between in vivo mature adipocytes and in vitro differentiated cells. Left panel, Histological examination of normal mammary adipose tissue after H&E staining (original magnification X 400). Note that mature white adipocytes have a single lipid droplet (in white), which essentially occupies the fat cell volume surrounded by a reduced rim of cytoplasm. Right panel, phase contrast microscopy of preadipocytes cells after differentiation into mature adipocytes. Note that the differentiated cells have a rounded shape with multiple lipid droplets in the cytoplasm. 144 Y.-Y. Wang et al. / Cancer Letters 324 (2012) 142–151 long-standing line of evidence suggests that, at least in rodents, mammary fat pad is essential for the post-natal development of mammary epithelium by providing signals mediating ductal morphogenesis [19,20]. Adipocytes within the mammary fat pad specifically participate to the development of the normal mammary gland. For example, it has been shown that the total absence of breast fat in transgenic mice prevents normal mammary gland development [21]. The mammary adipocytes are very active during the transitions from pregnancy to lactation and into involution (corresponding to the post-lactation regression of mammary epithelium) underlying their responsiveness to local signals from the epithelium [22]. Briefly, during lactation, mammary adipocytes in close proximity to epithelial cells exhibit rapid depletion of their lipid store due to enhanced lipolysis. By contrast, the involution period is associated to a refilling of mammary adipocytes that is completed approximately within 4 days. Intimate and bidirectional interaction with adjacent epithelium is one of the hallmarks of mammary adipocytes, suggesting that this dialog might persist in physiopathological conditions such as cancer. It is also very important to underline that there is undoubtedly species differences concerning the composition and function of mammary fat pad between humans and rodents that should be taken in account when results obtained in rodents are extrapolated to humans. In contrast to rodents where the mammary fat pad consists primarily of adipocytes, human mammary adipose tissue is extensively interlaced with a network of fibroblasts and associated connective tissue [20]. Therefore, in murine mammary glands, the adipocytes are immediately adjacent to the ductal epithelial cells, whereas in human mammary glands, a fibrous layer separates the two cell types. In addition, it has been clearly shown that human mammary epithelium transplanted into the mammary fat pad of mice did not grow out unless human stromal fibroblasts are incorporated into the cleared fat pad [23]. 2.3. Models used to study the AT/breast cancer crosstalk: from established preadipose cell lines to freshly isolated cells These specificities in terms of depots as well as species raise the question of the source of adipose cells that should be used in experimental studies to study the breast cancer/adipose tissue connection. The detailed description of all the available human and murine models can be found in the extensive review recently written by Lafontan [24]. For feasibility reasons, the most common in vitro models used are the murine preadipocyte cell lines 3T3-L1 and 3T3-F442A cells. These cell lines were clonally isolated from Swiss 3T3 cells (derived from disaggregated 17- to 19-day mouse embryos). This clonality circumvents donor-to-donor variability of primary cells, providing standardized conditions [24,25]. They exhibit a fibroblast-like morphology and are already committed in the adipocyte lineage. Their differentiation into mature adipocytes can be achieved in vitro by the addition to confluent cells, in a serum-containing medium, of adipogenic stimuli, including glucocorticoids (dexamethasone), drugs that increase cyclic AMP levels (IBMX) and insulin for 3T3-L1 and insulin alone for 3T3-F442A, that are committed to a later stage of adipocyte differentiation [24,25]. Although these in vitro models share many similarities with primary adipocytes—including triglycerides storage, expression of adipocyte-specific genes and responsiveness to lipogenic and lipolytic factors, some differences persist. For example, triglycerides are stored in multiple lipid droplets in in vitro differentiated adipocytes in contrast to normal mature adipocytes that exhibit a unique large lipid droplet (see Fig. 2). This ‘‘incomplete’’ differentiation might lead to a lower expression of some genes and several adipocytes functions such as adipokines secretion. This is the case for example of leptin [26], an adipokine involved in the stimulation of the proliferative and migratory properties of cancer cells (see below). To circumvent these limits, the use of long-term culture of 3T3-L1 differentiated on 3D polymeric scaffolds has been proposed [27]. In vivo transplantation studies strongly reinforce the interest of these models, especially the 3T3-F442A preadipose cell line. In fact, when implanted subcutaneously into athymic mice at an anatomic site devoid of adipose tissue, the 3T3-F442A preadipocytes differentiate, and within few weeks, fat pads morphologically similar to normal subcutaneous adipose tissue developed at the site of injection [26]. An original 2D coculture system setup in our laboratory using human breast cancer cell lines and in vitro differentiated 3T3-F442A adipocytes mimics the adipocytes changes observed at the invasive front of breast tumors [9], underscoring the validity of these mouse models in cancer studies (see also below Section 3). More recently, a human multipotent adipose-derived stem cells (hMADS) cell line was isolated from the adipose tissue of young donors and established in culture. When differentiated into adipocytes, the cells show a lipolytic system similar to that reported in human mature adipocytes, therefore representing a promising tool in adipocyte biology [24]. Finally, mature adipocytes can be obtained from the in vitro differentiation of the SVF of adipose tissues (that contains ADSCs) from human and rodents in defined culture conditions either in 2D or 3D culture systems [24,28]. A clear limitation of the use of these human and murine preadipocyte cell lines and primary precursors present in the SVF fraction is that they are not suitable models to study obesity-related condition due to their inability to undergo hypertrophy in vitro. Therefore, the use of mature adipocytes isolated from AT of lean and obese subjects should be considered. In fact, adipocytes isolated from whole AT of either lean or obese (human or mouse) subjects exhibit similar features in vitro than in situ as far as they are maintained in appropriate culture conditions. From a structural point of view, isolated fat cells from obese are hypertrophied while those obtained from lean are smaller. Isolated adipocytes from lean and obese subject exhibit also functional differences in terms of lipid mobilization and adipokines secretion [29,30]. The isolation of adipocytes from the extracellular matrix and the SVF fraction is a technique available in many laboratories whatever the AT considered including MAT [9]. Briefly, collagenase treatment of AT release the fat cells from extracellular matrix. Fat cells, owing to their own fat content are floating whether the SVF fraction remains in the pellet [24]. Coculture system using this source of cells to obtain insight into the crosstalk with tumor cell population is clearly limited by the fact that these isolated mature adipocytes cannot be used for long terms culture. Isolated adipocytes in suspension in an appropriate culture medium remain viable for approximately 24 h but after this period both survival and function are profoundly altered [24]. Primary culture of AT explants represents a useful alternative to both improve adipocyte viability and preserve the entire tissue environment and structure. Several laboratories have been using adipose tissue explants culture to study the influence of various pharmacological or nutritional factors. Adipocytes can also be isolated from the explants after the treatment in order to focus on the fat cell itself [29]. However, such a tri-dimensional structures in vitro do not allow an accurate oxygen and nutrients supply during long -term periods leading to hypoxia-induced alterations of adipocyte function such as an increased anaerobic glycolysis or TNF-a accumulation [31]. Therefore, adipose tissue explants must be considered as useful over less than 48 h period after culture. Again, 3D culture of isolated adipocytes from lean and obese subjects on various scaffolds remains the most promising alternative for long-term coculture, model which is currently largely untapped with the exception of some studies using isolated adipocytes from rat and mice AT [32,33]. Finally, to study the in vivo cross-talk in both rodents and human breast tumors, modifications of the tumor-surrounding adipose tissue could be Y.-Y. Wang et al. / Cancer Letters 324 (2012) 142–151 characterized using either immunochemistry [9,34,35], qPCR on isolated mature adipocytes and precursors [9] or a proteomic approach [36]. To conclude, as a first step, the use of human and murine preadipocyte cell lines after in vitro differentiation represents highly useful tools to study the crosstalk with breast cancer cells. Nevertheless, the results obtained should be validated in vitro using mammary primary adipose cells in 2D (and ideally in 3D) coculture systems and in vivo in human breast tumors to ensure their relevance. 3. Paracrine role of the different components of adipose tissue in breast cancer progression There are long standing arguments in the literature showing that fat tissue is able to support and amplify breast cancer progression. In 1992, Eliott and colleagues showed that the murine carcinoma SP1 cell line grew best when injected in the mesenteric and ovarian fat pads and in the mammary gland, but very poorly in the subcutis or peritoneal cavity [37]. Moreover, mammary tumors cells transplanted into various adipose tissue depots subsequently metastasize to different organs. Massive dissemination of tumors from the ovarian and mesenteric sites occurs to the liver, spleen and diaphragm whether metastases from the mammary site occur primarily in the lung [37]. The positive influence of the local mammary fat-rich microenvironment on breast cancer growth is also sustained by the increase in xenograft success in mice when orthotopic, rather than subcutaneous, injections are employed [38]. In humans, it has been proposed that the adipose tissue invasion (ATI) at the tumor margin, as well as the invasive length of fat invasion, are indicators of tumor aggressiveness in early stage breast cancers [39]. It has been previously emphasized that adipose tissue at close distance to breast tumors is a source of pro-inflammatory cytokines such as IL-6, TNF-a, and reactive oxygen species [40]. A detailed proteomic study of fresh fat tissue samples collected from tumors of high risk breast cancer patients identified a large array of proteins, including numerous signalling molecules, hormones, cytokines, and growth factors, involved in a variety of biological processes such as signal transduction and cell communication, energy metabolism, protein metabolism, cell growth and/or maintenance, immune response and apoptosis [36]. As stated before, AT is composed of different cell types. Accordingly, regarding the specific cellular components of this tissue, namely mature adipocytes and preadipocytes/ADSCs, two important questions remain open: do they both participate in breast tumor progression and what are the signalling pathways involved? 3.1. Mature adipocytes are key actors in breast cancer progression: the concept of cancer-associated adipocytes (CAAs) As mentioned before, mature adipocytes are highly active endocrine cells and are therefore excellent candidates to play a crucial role in the control of tumor behavior through heterotypic signalling processes. One of the first evidence of their role in breast cancer progression came from the study of Manabe et al. [41], showing that the rat mature adipocytes, but not the preadipocytes, promote the growth of several oestrogen-receptor (ER)-positive breast cancer cell types. The same year, the pioneering study of the group of P. Scherer demonstrated that the full complement of adipokines, represented by the conditioned-medium of mature 3T3-L1 murine adipocytes, showed an unparalleled ability to promote the growth, cell motility and invasion of ER-negative and positive breast cancer cells in vitro [42]. Combined, these first studies shed in light the crosstalk between adipocytes and breast cancer cells and under- 145 score the need to fully understand the role of this heterotypic signalling in modulation of tumor behavior. As stated in the introduction of this review, cancer cells usually go about generating a supportive microenvironment by activating the wound-healing response of the host. For example, resident fibroblasts are capable of adapting to tissue injury (including cancer), and as a result change their phenotype to become ‘‘reactive.’’ In order to investigate if such phenotypic changes are observed in tumor-surrounding adipocytes, a 2D coculture system in which adipocytes and breast cancer cells were separated by an insert, that allows the diffusion of soluble factors, was setup in our laboratory to mimic the adipocyte-cancer cell crosstalk at the tumor invasive front [9]. Using this original model, we extensively described tumor-induced changes in adipocytes that are reproducibly displayed by both mouse and human mammary adipocytes. Adipocytes cocultivated with various human and murine breast cancer cell lines generally exhibit a loss of lipid content, a decrease in late adipose markers expression, and over-expression of inflammatory cytokines (such as IL-6 and IL-1b) and proteases (such as MMP-11 and PAI-1). We named these tumor-surrounding adipocytes, ‘‘Cancer-Associated Adipocytes’’ (CAAs). Equally important, using immunohistochemistry and quantitative PCR, we confirmed the presence of these modified adipocytes in human breast tumors. What are the effects of these CAAs on tumor progression? All murine and human tumor cells cocultivated with mature adipocytes exhibited increased invasive, but not proliferative, capacities in vitro and in vivo. In tumor cells, these increase invasive capacities were associated with incomplete epithelial to mesenchymal transition (EMT). In the case of IL-6, we further showed that it plays a key role in the acquired pro-invasive effect, and associated EMT, by tumor cells. Interestingly, the human breast tumors of larger size and/or with lymph nodes involvement exhibit the higher levels of IL-6 in tumor surrounding adipocytes [9]. Such an inflammatory state in the tumor-surrounding adipose tissue has also been described for prostate cancer. High levels of IL-6 were found in the periprostatic adipose tissue of tumor-bearing patients and the levels of IL-6 correlated with the aggressiveness of the tumors, highlighting the importance of this cytokine in the adipocyte/cancer cells crosstalk [43]. Another very important aspect of this crosstalk concerns the remodelling of the ECM. Collagen VI (COLVI) is abundantly expressed in tumor-surrounding adipocytes and adipocyte-derived COLVI production is involved in mammary tumor progression in vivo [35,42]. In the same way, adipocytes at the invasive front of human tumors consistently exhibit increased expression of metalloprotease 11 (MMP-11)/stromelysin 3 [34]. Increase local fibrosis and its permanent remodelling (generating ECM components functioning as signalling molecules) have been clearly implicated in tumor progression. This association seems to justify prominently, the role of both COLVI and MMP-11 overexpression in a tumor context. In addition, these events might directly contribute to the occurrence of the CAAs phenotype since adipocytes actively reorganize the ECM during differentiation processes [44]. For example, it has been shown that MMP-11 is a potent negative regulator of adipogenesis [34]. In fact, a relative degree of ‘‘dedifferentiation’’ is one of the hallmarks of CAAs [9,34]. Supported by epidemiological evidence, animal models and in vitro studies, two adipokines, leptin and adiponectin, have been largely involved in breast cancer occurrence and progression [15,45]. Schematically, leptin appears to promote tumor cells growth by mainly stimulating the activity of signalling pathways involved in proliferation process whereas adiponectin repressed proliferation and induced apoptosis, in breast cancer cells [15,45]. The paracrine local implication for these adipokines in breast cancer cells appears to be weaker, or at least less characterized, than their endocrine effects. We found that CAAs exhibit a decrease in late adipose markers including leptin (Dirat et al., 146 Y.-Y. Wang et al. / Cancer Letters 324 (2012) 142–151 unpublished results), suggesting that this adipokine is not primarily involved in the negative crosstalk between adipocytes and breast cancer cells at the invasive front. By contrast, adiponectin expression is absent in CAAs suggesting that its negative effect on tumor progression might be hampered in these tumor-modified adipocytes [9]. CAAs derived-factors might also affect in turn the secreted profile of tumor cells. For example, it has been shown that adipocytes stimulate the expression of genes related to immune function and wound-healing in tumor cells, such as the chemokine CCL-20, the macrophage inhibitory cytokine 1 (MIC-1) or even IL-6 [10,46,47], contributing among others things, to increase tumor invasiveness. Finally, one probably underestimated effect of adipocyte/cancer crosstalk is its role in the response to antitumor therapy. We have recently shown that CAAs contribute to the occurrence of a radioresistant phenotype in breast tumor cells [10]. In a different tumor model (i.e. acute lymphoblastic leukaemia) it has been demonstrated that adipocytes impairs leukaemia treatment by Vinca alkaloids both in vitro and in vivo [48]. Taken together, all these data strongly support the concept that an intimate crosstalk is established between cancer cells and mature adipocytes at the invasive front of the tumor, whose relevance has been clearly demonstrated in human tumors [9,34,35]. Invading tumor cells are able to modify adipocytes phenotype, which, in turn, stimulate cancer cells aggressive behavior, the stimulation of local tumor invasiveness being, to our point of view, one of the key events resulting from this crosstalk. The molecular circuitry involved in these processes as well as the resulting phenotypic changes observed in both populations is summarized in Fig. 3. 3.2. Contribution of ADSCs and pre-adipocytes to breast cancer progression Studies have provided compelling in vivo evidences that mesenchymal stem cells (MSCs) distally recruited from the bone marrow contribute to breast cancer progression [49]. Even though adipose tissue is the most abundant stromal constituent in the breast and a rich source of mesenchymal stem-like cells, only recent studies addressed the question of the involvement of this resident stem cells population in breast cancer progression [50]. Globally, these studies demonstrated that ADSCs also contribute to tumor progression. ADSCs promote in vitro and in vivo the growth and survival of breast cancer cells as well as their migratory and invasive capacities [8,51–55]. Several molecules have been involved in the proinvasive effects of ADSCs including IL-6 [8], IL-8 [52], CCL-5 [53] and CXCL-12/SDF-1 [55]. More recently, it has been demonstrated that ADSCs promote the expansion of cancer stem cells and induce EMT in the cancer cells in a PDGF dependent manner [54]. As for other components of the tumor stroma, a complex network is established between tumor cells and ADSCs. Tumor cells, through TGFb signalling, are able to «differentiate» ADSCs into CAF-like cells expressing a-smooth muscle actin (a-SMA) and tenascin C [54,56]. Interestingly, ADSCs are themselves chemo-attracted towards breast cancer cells [52,57]. Therefore, these compelling results suggest that ADSCs could directly contribute to the dense network of fibroblasts (the so-called desmoplastic reaction) frequently observed in the center of breast tumors and, as such, be considered as a subpopulation of CAFs. Of note most of these studies have been performed using ADSCs from abdominal or subcutaneous sources Fig. 3. Invading tumor cells are able to modify adipocytes phenotype, which, in turn, stimulate cancer cells aggressive behavior. In breast cancer, early local tumor invasion results in immediate proximity of cancer cells to mature adipocytes. In turns, mature adipocytes exhibit profound changes. CAAs clearly contribute to increase the aggressiveness of tumor cells by increasing tumor growth, tumor invasiveness and resistance to antitumor therapy including ionizing radiation. CAAs derived-factors might also affect the secreted profile of tumor cells. Y.-Y. Wang et al. / Cancer Letters 324 (2012) 142–151 with the noticeable exception of two studies that used MAT [8,50]. As stated before since adipose depots have different biochemical profiles, it appears important to use breast-derived ADSCs when investigating the effects of ‘‘resident’’ stem cells on breast cancer cells. ADSCs obtained from reduction mammoplasty differentiate along adipogenic, osteogenic and chondrogenic lineages in vitro and exhibit similar gene expression profiles and an indistinguishable immunophenotype from ADSCs from abdominoplasty specimens and bone marrow (BM)-MSCs [50]. However, notable gene expression differences are observed between stem cells from different sources, with abdominal ADSCs being more similar to BMMSCs and breast-derived ADSCs being more similar amongst them when compared to abdominal ADSCs. A comparison of the gene expression profiles breast ADSCs with BM-MSCs demonstrated that numerous genes implicated in cell growth, matrix deposition, remodelling, and angiogenesis are expressed at significantly higher levels in the local/breast ADSCs relative to BM-MSCs, suggesting that these resident stem-like cells may play a unique role in breast cancer progression [50]. More committed preadipose cells such as preadipocytes can also interact with breast cancer cells. It has been demonstrated that adipocyte differentiation is inhibited when preadipocytes are cocultivated with various breast cancer cell lines or in the presence of breast cancer cells conditioned media, this effect being dependent of TNF-a and IL-11 secreted by breast tumor cells [58]. Finally, it has been proposed that 3T3-L1 preadipocytes favored in vitro and in vivo fibronectin deposition and remodelling within the breast tumor microenvironment [59]. Again, these data favor the concept of ADSCs/preadipocytes as constituents of the CAFs population surrounding the tumors. However, it is important to note that most of these data were obtained in coculture systems 147 using breast cancer cell lines and isolated adipose precursors. In a series of 28 samples, we observed no modifications of inflammatory or protease gene expressions between the SVF fractions of adipose tissue obtained from tumorectomy or reduction mammoplasty [9]. These results obtained in human tumors suggest that within the cellular complexity of the adipose tissue, the crosstalk with tumor cells is rather established with mature adipose cells, than with their precursors. However, we cannot exclude that changes concern a minor subpopulation that does not affect the overall level of gene expression of the SVF fraction, which remains highly heterogeneous. Further experiments are clearly needed to assess that the phenotypic changes observed with isolated adipose precursors can also be observed in human tumors. The molecular circuitry involved in adipose precursors/tumor cells crosstalk described to date as well as the resulting phenotypic changes observed in both populations are summarized in Fig. 4. 4. Adipocytes could also contribute to carcinogenesis in addition to tumor progression It has been proposed that the stroma cells do not contribute only to the progression of existing tumors but can also contribute to early events in carcinogenesis [4,60]. Key to this ‘‘tumor microenvironment’’ perspective of malignancy is the idea that ‘‘initiated ‘‘ genetically primed resident cells within a tissue have a low predisposition to develop as a tumor and will probably remain dormant unless exogenous stimuli such as factors produced by activated stroma promote the carcinogenic process. A functional link between inflammation and cancer has long been recognized. Individuals suffering from chronic inflammatory disorders harbor Fig. 4. Crosstalk between tumor cells and adipose progenitors contribute to breast cancer progression. Invasive breast cancer cells could locally activate, via diverse soluble growth factors and cytokines, adipose progenitors. These activated progenitors or Adipose-Progenitors Derived Fibroblasts (ADPFs) exhibit similar characteristics than CAFs. Their increased migratory/invasive abilities allow them to join the center of the tumor and to participate to the desmoplastic reaction. These ADPFs stimulate tumor progression. Note however that all these results have been mostly obtained in in vitro coculture studies (mostly using ADSCs from other sources than MAT) and animal models and have not been fully validated in human tumors. 148 Y.-Y. Wang et al. / Cancer Letters 324 (2012) 142–151 a greatly increased risk for cancer development, owing primarily to the procarcinogenic environment generated by activated inflammatory cells [4,60]. Several studies have shown that fibroblasts can also induce a tumorigenic process. For example, when CAFs obtained from lesions of prostatic adenocarcinoma are engrafted with initiated but non tumorigenic prostate epithelial cells in mice, these later cells form tumors [61]. Senescent fibroblasts were also shown to have protumorigenic activity, underscoring a relationship between aging and cancer [62]. In mice, deleting the activity of one of the TGF-b receptors only within the fibroblasts leads to epithelial tumors in the prostate and forestomach [63]. Is there a role for adipocytes in this ‘‘tissue-integrated’’ view of carcinogenesis? Although not directly demonstrated, several studies argue in the favor of the later hypothesis. In mice, injection of unirradiated mammary epithelial cells into irradiated epithelialcell-free (cleared) mammary fat pads resulted in neoplastic transformation of the epithelial cells [64]. Interestingly, this effect appears to be independent of the systemic radiation effects since tumor incidence was restricted to the irradiated site as tested by hemi-body irradiation [64]. Of note, adipocytes by themselves have been described to be highly resistant to ionizing radiation [65]. Similarly, Maffini and co-workers [66] demonstrated that treatment of cleared mammary fat pads with the carcinogen N-nitroso-methyl urea (NMU) generated a stroma environment that allowed the development of epithelial tumors from transplanted normal epithelial cells. They even showed that treatment of the epithelial cells with NMU was not sufficient to induce tumor in untreated stromal background, but rather, required the grafting onto NMU-treated stroma [66]. The mechanisms by which this ‘‘activated’’ fat pad contributes to carcinogenesis and the signalling events involved are poorly understood. The fat pad consists, in addition to adipocytes, of various cell types. However, while in the human mammary gland, the developing mammary epithelium is closely sheathed by stromal fibroblasts in addition to adipocytes, the mouse mammary fat pad consists primarily of adipocytes [22]. Therefore, adipocytes are probably key targets of the genotoxic compounds leading to the stroma-dependent carcinogenesis models described above. Also as part of this concept, it is important to note that many environmental chemical carcinogens are indeed lipophilic, so they can bio-accumulate into adipocytes lipid droplets [67]. The local release of carcinogens from adipocytes might directly initiate, or contribute to the carcinogenesis process in adjacent epithelial cells. All of these studies, though still preliminary and mostly conducted in mouse models, open very interesting perspectives for the prevention, detection and treatment of breast cancer in humans. 5. Direct clinical consequences of the epithelial adipose tissue/ crosstalk 5.1. Obesity and breast cancer prognosis One of the main clinical consequences of the intimate crosstalk between adipose tissue and breast cancer concerns the prognosis of breast cancer in obese patients. In fact, overweight (defined as a body mass index [BMI] of 25–29.9 kg/m2) and obesity (BMI P 30 kg/m2) are now established risk factors for cancer and cancer-related mortality (for reviews see [11,12,68]). Concerning breast cancer, early studies have clearly established that obese women have an increased risk of developing postmenopausal, but not premenopausal, breast cancer [68]. Interestingly, the level of association with increasing adiposity becomes stronger with increasing time since the menopause [69]. One of the major mechanism contributing to the increased risk of post-menopausal breast cancer, as well as endometrial cancer, associated to obesity is the increase in circulating levels of estrogens since after the menopause the principal site of estrogens production is in the adipose tissue [69]. Noteworthy, excess bodyweight is not only associated to increased incidence of breast cancer, but is also an independent negative prognosis factor independently of menopause status (for reviews see [11,12]). As already discussed before [12,70], multiple factors might contribute to the poorer survival rates in obese patients with breast cancer including a higher likelihood of co-morbid conditions and other ‘‘non-biological’’ effects. However, there is now clear evidences that host factors contribute to the occurrence in obese women of tumors exhibiting at diagnosis an aggressive biology defined by an increase in lymph nodes involvement and a higher propensity to distant metastasis (reviewed in [12]). In the largest retrospective clinical study published to date, Ewertz et al. report that obesity is an independent prognosis factor for the development of distant metastases and death after the diagnosis of breast cancer [71]. The increased risk for obese women of developing distant metastases after 10 years, increased by almost 50% [71]. Obesity is associated with elevated levels of pro-inflammatory cytokines in VAT and in the circulation, which generates a lowgrade, chronic inflammatory state [72]. One hallmark of obesityassociated inflammation is the recruitment of macrophages into adipose tissue, where they form characteristic ‘‘crown-like’’ structures (CLS) around apoptotic adipocytes [72]. Interestingly, we have demonstrated that obesity and the defined profile of CAAs share inflammation as common traits [9]. Furthermore, in breast human tumors, the association of high levels of IL-6 in CAAs with high tumor size and enhanced local invasion reflect those traits present in obese patients [9]. Therefore, it is tempting to speculate that CAAs within a context of obesity should be more prone to amplify the negative crosstalk with tumor cells. Therefore, this assumption underlies that such an inflammatory condition also exists in breast adipose tissue. In opposition to VAT, very little is known about MAT and inflammation in obese subjects. Nevertheless, Subbaramaiah et al. has recently shown that obese mice (involving both dietary and genetics models of obesity) exhibit necrotic adipocytes surrounded by macrophages forming CLS in both the mammary gland and visceral fat [73]. Moreover, the presence of CLS was associated with activation of NF-jB and increased levels of pro-inflammatory mediators in the MAT of obese versus lean mice. The same team has shown that these findings can be translated into women since CLS were founded in nearly 50% of breast tissue from women undergoing mastectomy and the severity of breast inflammation was correlated with both BMI and breast adipocytes size [74]. Similarly, Sun et al. has recently shown that normal breast tissue, obtained from reduction mammoplasty of obese women, exhibit macrophages infiltration and a significant enrichment for pathways involving IL-6, IL-8, CCR5 signalling, consistent with a local pro-inflammatory state [75]. Therefore, these compelling very recent results demonstrate that obesity is associated with a sub-inflammatory state of the MAT reinforcing the hypothesis of an amplified paracrine negative crosstalk between adipose tissue and tumor cells to explain the poor prognosis observed in obese patients. However, this is still a hypothesis that remains to be validated both in vitro and in vivo. In mouse models, preliminary results have been obtained that links obesity and the occurrence of high-grade adenocarcinomas, increased tumor growth, as well as angiogenesis and distant metastasis [76,77]. These mouse models will be very helpful to identify the paracrine mechanisms involved in the stimulation of tumor progression in order to setup specific strategies for the treatment of obese patients exhibiting aggressive diseases. 5.2. Safety concerns between autologous fat grafting and breast cancer occurrence and recurrence In plastic and reconstructive surgery, autologous fat grating enables soft tissue augmentation and is increasingly used for Y.-Y. Wang et al. / Cancer Letters 324 (2012) 142–151 cosmetic indications but also for correction of defect following breast cancer treatment. Schematically, this procedure first proposed by Coleman, known as the Coleman technique, consists of the harvesting of subcutaneous fat usually from the abdominal wall or the thighs by a blunt liposuction cannula connected to a syringe, followed by a short centrifugation and injection of the cellular ‘‘fat’’ into the area of interest [78]. To maximize survival, fat is generally injected in small parcels and thin strips at different levels in the sub-cutis region of the breast [79]. Therefore, the injected preparation contains mature adipocytes as well as all the cellular components of the SVF including ADSCs/preadipocytes, endothelial cells and progenitors, fibroblasts and macrophages. Because the lipoaspirate contains at least two populations of cells, adipose precursors and mature adipocytes, which are involved in tumor–stromal interaction as we discussed before, the potential risk of this approach in increasing breast cancer recurrence (and even induction) needs to be addressed. To date, very few, if any, translational studies to evaluate the risk of fat grafting using the lipofilling technique described above are available. In our hands, the coinjection of fat used for lipofilling with human breast cancer cells dramatically increases the tumor growth in mice (I. Garrido, unpublished results). However, the design of the study was different from the clinical situation since in human, autologous fat transfer is used in treated patients and is expected to interact with dormant and not actively growing tumor cells. At clinical levels, available series addressing the oncological risk of lipotransfer in breast cancer patients are also limited [80]. Only one series using a retrospective control group has been published to date [81]. For each of the 321 patients operated for a primary breast cancer between 1997 and 2008 who subsequently underwent lipofilling for reconstructive purpose, two matched patients with similar characteristics who did not undergo a lipofilling were used as a control. This study concludes that the lipofilling transfer for breast cancer patients was a safe procedure. However, it is interesting to note that when the analysis was limited to intra-epithelial neoplasia (37 patients), the lipofilling group resulted at higher risk of local events [81]. Accordingly, prospective control protocols are clearly needed to definitively assess the safety of the procedure. In addition, recent fat transfer and lipoinjection protocols have focused on the addition of autologous ADSCs or freshly isolated adipose stromal vascular cells to promote graft volume retention [82]. This type of procedures should be considered with even greater caution with respect to conventional technique. In fact, a recent study demonstrated that the coinjection of human WAT-CD34(+) endothelial precursors cells (EPCs) from lipotransfer procedures contributed to tumor vascularisation and significantly increased tumor growth and metastases in several orthotopic models of human breast cancer in immunodeficient mice compared with coinjection with CD34 EPCs or breast cancer cells alone [83]. Interestingly in this study, the increase in axillary and lung metastases in mice injected with CD34+ WAT cells was even observed when these cells are injected after surgical removal of the initially transplanted tumor. Therefore, this first translational study designed to address the question of the safety of fat grafting highlights the urgent need of controlled clinical trials when ‘‘enriched’’ fat sources are used for lipofilling. 6. Conclusion and perspectives The AT has emerged these last 5 years as an integral and active component of breast cancer microenvironment. The role of the various cellular actors of AT begins to be addressed and it is important to underline that, to date, only the tumor-induced changes of mature adipocytes, the so-called CAAs, have been demonstrated in both in vitro studies, animal models and human tumors. Since 149 population of obese people is constantly increasing, it is of fundamental and of clinical interest to further study the relationship existing between adipocytes and breast cancer cells in order to prevent and treat this subset of aggressive diseases. As found in obese patients exhibiting an increase in both local and distant invasion, one of the principal hallmarks of the adipose tissue/cancer crosstalk appears to imply the invasive properties of tumor cells. Interestingly, it is suggested from several studies that tumor-surrounding adipose tissue, by its ability to secrete pro-inflammatory cytokines such as IL-6, contributes to local inflammation that contribute to promote an aggressive phenotype in breast cancer. Therefore, limiting inflammation through inhibition of IL-6 signalling might represent an interesting strategy to block disease progression, a strategy that need to be tested in in vitro 3D coculture models as well as in lean and obese conditions in vivo. CAAs appear to promote tumor progression by acting at least directly on the target tumor cells. However, these stromal cells might also mediate disease progression by secreting factors promoting angiogenesis and/or by creating an immunosuppressive microenvironment, hypothesis that remains to be explored. It is likely that the continued characterization of these interactions, and the molecular identification of key mediators, will provide new insights into tumor biology and suggest further novel therapeutic options. Acknowledgements Studies performed in our laboratories were supported by the French National Cancer Institute (INCA PL 2006-035 to GE, PV and CM and INCA PL 2010-214 to PV and CM), the ‘Ligue Régionale contre le Cancer’ (Comité du Lot et Haute-Garonne to CM), the Fondation de France (to PV and CM) and the University of Toulouse (AO CS 2009 to CM). CL is a recipient of a PhD fellowship from the ‘‘Ligue Nationale contre le Cancer’’. The authors would like to thank Dr Max Lafontan and Pr Jean-Yves Petit for critical reading of the manuscript. References [1] M.M. Mueller, N.E. Fusenig, Friends or foes – bipolar effects of the tumour stroma in cancer, Nat. Rev. Cancer 4 (2004) 839–849. [2] K. Polyak, R. Kalluri, The role of the microenvironment in mammary gland development and cancer, Cold Spring Harb. Perspect. Biol. 2 (2010) a003244. [3] A.E. Place, S. Jin Huh, K. Polyak, The microenvironment in breast cancer progression: biology and implications for treatment, Breast Cancer Res. 13 (2011) 227. [4] T.D. Tlsty, L.M. Coussens, Tumor stroma and regulation of cancer development, Annu. Rev. Pathol. 1 (2006) 119–150. [5] H.F. Dvorak, Tumors: wounds that do not heal. Similarities between tumor stroma generation and wound healing, N Engl. J. Med. 315 (1986) 1650–1659. [6] A. Mantovani, F. Marchesi, C. Porta, A. Sica, P. Allavena, Inflammation and cancer: breast cancer as a prototype, Breast 16 (Suppl 2) (2007) S27–S33. [7] W.H. Fridman, J. Galon, F. Pages, E. Tartour, C. Sautes-Fridman, G. Kroemer, Prognostic and predictive impact of intra- and peritumoral immune infiltrates, Cancer Res. 71 (2011) 5601–5605. [8] M. Walter, S. Liang, S. Ghosh, P.J. Hornsby, R. Li, Interleukin six secreted from adipose stromal cells promotes migration and invasion of breast cancer cells, Oncogene 28 (2009) 2745–2755. [9] B. Dirat, L. Bochet, M. Dabek, D. Daviaud, S. Dauvillier, B. Majed, Y.Y. Wang, A. Meulle, B. Salles, S. Le Gonidec, I. Garrido, G. Escourrou, P. Valet, C. Muller, Cancer-associated adipocytes exhibit an activated phenotype and contribute to breast cancer invasion, Cancer Res. 71 (2011) 2455–2465. [10] L. Bochet, A. Meulle, S. Imbert, B. Salles, P. Valet, C. Muller, Cancer-associated adipocytes promotes breast tumor radioresistance, Biochem. Biophys. Res. Commun. 411 (2011) 102–106. [11] J. Ligibel, Obesity and breast cancer, Oncology (Williston Park) 25 (2011) 994– 1000. [12] B. Dirat, L. Bochet, G. Escourrou, P. Valet, C. Muller, Unraveling the obesity and breast cancer links: a role for cancer-associated adipocytes?, Endocr Dev. 19 (2010) 45–52. [13] M. Saint-Cyr, K. Rojas, S. Colohan, S. Brown, The role of fat grafting in reconstructive and cosmetic breast surgery: a review of the literature, J. Reconstr. Microsurg. 28 (2012) 99–110. 150 Y.-Y. Wang et al. / Cancer Letters 324 (2012) 142–151 [14] L. Vona-Davis, D.P. Rose, Adipokines as endocrine, paracrine, and autocrine factors in breast cancer risk and progression, Endocr. Relat. Cancer 14 (2007) 189–206. [15] J. Park, D.M. Euhus, P.E. Scherer, Paracrine and endocrine effects of adipose tissue on cancer development and progression, Endocr. Rev. 32 (2011) 550– 570. [16] N. Ouchi, J.L. Parker, J.J. Lugus, K. Walsh, Adipokines in inflammation and metabolic disease, Nat. Rev. Immunol. 11 (2011) 85–97. [17] M. Lafontan, D. Langin, Lipolysis and lipid mobilization in human adipose tissue, Prog. Lipid Res. 48 (2009) 275–297. [18] K. Sun, C.M. Kusminski, P.E. Scherer, Adipose tissue remodeling and obesity, J. Clin. Invest. 121 (2011) 2094–2101. [19] J.E. Fata, Z. Werb, M.J. Bissell, Regulation of mammary gland branching morphogenesis by the extracellular matrix and its remodeling enzymes, Breast Cancer Res. 6 (2004) 1–11. [20] R.C. Hovey, T.B. McFadden, R.M. Akers, Regulation of mammary gland growth and morphogenesis by the mammary fat pad: a species comparison, J. Mammary Gland. Biol. Neoplasia 4 (1999) 53–68. [21] C. Couldrey, J. Moitra, C. Vinson, M. Anver, K. Nagashima, J. Green, Adipose tissue: a vital in vivo role in mammary gland development but not differentiation, Dev. Dyn. 223 (2002) 459–468. [22] R.C. Hovey, L. Aimo, Diverse and active roles for adipocytes during mammary gland growth and function, J. Mammary Gland. Biol. Neoplasia 15 (2010) 279– 290. [23] D.A. Proia, C. Kuperwasser, Reconstruction of human mammary tissues in a mouse model, Nat. Prot. 1 (2006) 206–214. [24] M. Lafontan, Historical perspectives in fat cell biology: the fat cell as a model for the investigation of hormonal and metabolic pathways, Am. J. Physiol. Cell Physiol. 302 (2012) C327–C359. [25] H. Green, O. Kehinde, Formation of normally differentiated subcutaneous fat pads by an established preadipose cell line, J. Cell. Physiol. 101 (1979) 169– 171. [26] S. Mandrup, T.M. Loftus, O.A. MacDougald, F.P. Kuhajda, M.D. Lane, Obese gene expression at in vivo levels by fat pads derived from s.c. implanted 3T3-F442A preadipocytes, Proc. Natl. Acad. Sci. USA 94 (1997) 4300–4305. [27] C. Fischbach, T. Spruss, B. Weiser, M. Neubauer, C. Becker, M. Hacker, A. Gopferich, T. Blunk, Generation of mature fat pads in vitro and in vivo utilizing 3-D long-term culture of 3T3-L1 preadipocytes, Exp. Cell Res. 300 (2004) 54– 64. [28] J.C. Gerlach, Y.C. Lin, C.A. Brayfield, D.M. Minteer, H. Li, J.P. Rubin, K.G. Marra, Adipogenesis of human adipose-derived stem cells within three-dimensional hollow fiber-based bioreactors, Tissue Eng. Part C Meth. 18 (2012) 54–61. [29] J. Boucher, B. Masri, D. Daviaud, S. Gesta, C. Guigne, A. Mazzucotelli, I. CastanLaurell, I. Tack, B. Knibiehler, C. Carpene, Y. Audigier, J.S. Saulnier-Blache, P. Valet, Apelin, a newly identified adipokine up-regulated by insulin and obesity, Endocrinology 146 (2005) 1764–1771. [30] M. Lafontan, S. Betuing, J.S. Saulnier-Blache, P. Valet, A. Bouloumie, C. Carpene, J. Galitzky, M. Berlan, Regulation of fat-cell function by alpha 2-adrenergic receptors, Adv. Pharmacol. 42 (1998) 496–498. [31] S. Gesta, K. Lolmede, D. Daviaud, M. Berlan, A. Bouloumie, M. Lafontan, P. Valet, J.S. Saulnier-Blache, Culture of human adipose tissue explants leads to profound alteration of adipocyte gene expression, Horm. Metab. Res. 35 (2003) 158–163. [32] A. Kaneko, Y. Satoh, Y. Tokuda, C. Fujiyama, K. Udo, J. Uozumi, Effects of adipocytes on the proliferation and differentiation of prostate cancer cells in a 3-D culture model, Int. J. Urol. 17 (2010) 369–376. [33] S. Amemori, A. Ootani, S. Aoki, T. Fujise, R. Shimoda, T. Kakimoto, R. Shiraishi, Y. Sakata, S. Tsunada, R. Iwakiri, K. Fujimoto, Adipocytes and preadipocytes promote the proliferation of colon cancer cells in vitro, Am. J. Physiol. Gastrointest. Liver Physiol. 292 (2007) G923–G929. [34] K.L. Andarawewa, E.R. Motrescu, M.P. Chenard, A. Gansmuller, I. Stoll, C. Tomasetto, M.C. Rio, Stromelysin-3 is a potent negative regulator of adipogenesis participating to cancer cell-adipocyte interaction/crosstalk at the tumor invasive front, Cancer Res. 65 (2005) 10862–10871. [35] P. Iyengar, V. Espina, T.W. Williams, Y. Lin, D. Berry, L.A. Jelicks, H. Lee, K. Temple, R. Graves, J. Pollard, N. Chopra, R.G. Russell, R. Sasisekharan, B.J. Trock, M. Lippman, V.S. Calvert, E.F. Petricoin 3rd, L. Liotta, E. Dadachova, R.G. Pestell, M.P. Lisanti, P. Bonaldo, P.E. Scherer, Adipocyte-derived collagen VI affects early mammary tumor progression in vivo, demonstrating a critical interaction in the tumor/stroma microenvironment, J. Clin. Invest. 115 (2005) 1163–1176. [36] J.E. Celis, J.M. Moreira, T. Cabezon, P. Gromov, E. Friis, F. Rank, I. Gromova, Identification of extracellular and intracellular signaling components of the mammary adipose tissue and its interstitial fluid in high risk breast cancer patients: toward dissecting the molecular circuitry of epithelial-adipocyte stromal cell interactions, Mol. Cell Proteomics 4 (2005) 492–522. [37] B.E. Elliott, S.P. Tam, D. Dexter, Z.Q. Chen, Capacity of adipose tissue to promote growth and metastasis of a murine mammary carcinoma: effect of estrogen and progesterone, Int. J. Cancer 51 (1992) 416–424. [38] J.M. Fleming, T.C. Miller, M.J. Meyer, E. Ginsburg, B.K. Vonderhaar, Local regulation of human breast xenograft models, J. Cell Physiol. 224 (2010) 795– 806. [39] J. Yamaguchi, H. Ohtani, K. Nakamura, I. Shimokawa, T. Kanematsu, Prognostic impact of marginal adipose tissue invasion in ductal carcinoma of the breast, Am. J. Clin. Pathol. 130 (2008) 382–388. [40] L.M. Berstein, A.Y. Kovalevskij, T.E. Poroshina, A.V. Kotov, I.G. Kovalenko, E.V. Tsyrlina, E.E. Leenman, S.Y. Revskoy, V.F. Semiglazov, K.M. Pozharisski, Signs of proinflammatory/genotoxic switch (adipogenotoxicosis) in mammary fat of breast cancer patients: role of menopausal status, estrogens and hyperglycemia, Int. J. Cancer 121 (2007) 514–519. [41] Y. Manabe, S. Toda, K. Miyazaki, H. Sugihara, Mature adipocytes, but not preadipocytes, promote the growth of breast carcinoma cells in collagen gel matrix culture through cancer-stromal cell interactions, J. Pathol. 201 (2003) 221–228. [42] P. Iyengar, T.P. Combs, S.J. Shah, V. Gouon-Evans, J.W. Pollard, C. Albanese, L. Flanagan, M.P. Tenniswood, C. Guha, M.P. Lisanti, R.G. Pestell, P.E. Scherer, Adipocyte-secreted factors synergistically promote mammary tumorigenesis through induction of anti-apoptotic transcriptional programs and protooncogene stabilization, Oncogene 22 (2003) 6408–6423. [43] D.S. Finley, V.S. Calvert, J. Inokuchi, A. Lau, N. Narula, E.F. Petricoin, F. Zaldivar, R. Santos, D.R. Tyson, D.K. Ornstein, Periprostatic adipose tissue as a modulator of prostate cancer aggressiveness, J. Urol. 182 (2009) 1621–1627. [44] A.G. Cristancho, M.A. Lazar, Forming functional fat: a growing understanding of adipocyte differentiation, Nat. Rev. Mol. Cell Biol. 12 (2011) 722–734. [45] T. Jarde, S. Perrier, M.P. Vasson, F. Caldefie-Chezet, Molecular mechanisms of leptin and adiponectin in breast cancer, Eur. J. Cancer 47 (2011) 33–43. [46] J.H. Kim, K.Y. Kim, J.H. Jeon, S.H. Lee, J.E. Hwang, J.H. Lee, K.K. Kim, J.S. Lim, K.I. Kim, E.Y. Moon, H.G. Lee, J.H. Ryu, Y. Yang, Adipocyte culture medium stimulates production of macrophage inhibitory cytokine 1 in MDA-MB-231 cells, Cancer Lett. 261 (2008) 253–262. [47] K.Y. Kim, A. Baek, Y.S. Park, M.Y. Park, J.H. Kim, J.S. Lim, M.S. Lee, S.R. Yoon, H.G. Lee, Y. Yoon, D.Y. Yoon, Y. Yang, Adipocyte culture medium stimulates invasiveness of MDA-MB-231 cell via CCL20 production, Oncol. Rep. 22 (2009) 1497–1504. [48] J.W. Behan, J.P. Yun, M.P. Proektor, E.A. Ehsanipour, A. Arutyunyan, A.S. Moses, V.I. Avramis, S.G. Louie, A. Butturini, N. Heisterkamp, S.D. Mittelman, Adipocytes impair leukemia treatment in mice, Cancer Res. 69 (2009) 7867– 7874. [49] C.P. El-Haibi, A.E. Karnoub, Mesenchymal stem cells in the pathogenesis and therapy of breast cancer, J. Mammary Gland Biol. Neoplasia 15 (2010) 399– 409. [50] M. Zhao, C.I. Dumur, S.E. Holt, M.J. Beckman, L.W. Elmore, Multipotent adipose stromal cells and breast cancer development: think globally, act locally, Mol. Carcinog. 49 (2010) 923–927. [51] J.M. Yu, E.S. Jun, Y.C. Bae, J.S. Jung, Mesenchymal stem cells derived from human adipose tissues favor tumor cell growth in vivo, Stem. Cells Dev. 17 (2008) 463–473. [52] G. Welte, E. Alt, E. Devarajan, S. Krishnappa, C. Jotzu, Y.H. Song, Interleukin-8 derived from local tissue-resident stromal cells promotes tumor cell invasion, Mol. Carcinog. (2011). [53] S. Pinilla, E. Alt, F.J. Abdul Khalek, C. Jotzu, F. Muehlberg, C. Beckmann, Y.H. Song, Tissue resident stem cells produce CCL5 under the influence of cancer cells and thereby promote breast cancer cell invasion, Cancer Lett. 284 (2009) 80–85. [54] E. Devarajan, Y.H. Song, S. Krishnappa, E. Alt, Epithelial-mesenchymal transition in breast cancer lines is mediated through PDGF-D released by tissue-resident stem cells, Int. J. Cancer (2011). [55] F.L. Muehlberg, Y.H. Song, A. Krohn, S.P. Pinilla, L.H. Droll, X. Leng, M. Seidensticker, J. Ricke, A.M. Altman, E. Devarajan, W. Liu, R.B. Arlinghaus, E.U. Alt, Tissue-resident stem cells promote breast cancer growth and metastasis, Carcinogenesis 30 (2009) 589–597. [56] C. Jotzu, E. Alt, G. Welte, J. Li, B.T. Hennessy, E. Devarajan, S. Krishnappa, S. Pinilla, L. Droll, Y.H. Song, Adipose tissue derived stem cells differentiate into carcinoma-associated fibroblast-like cells under the influence of tumor derived factors, Cell Oncol. (Dordr.) 34 (2011) 55–67. [57] S. Gehmert, L. Prantl, J. Vykoukal, E. Alt, Y.H. Song, Breast cancer cells attract the migration of adipose tissue-derived stem cells via the PDGF-BB/PDGFRbeta signaling pathway, Biochem. Biophys. Res. Commun. 398 (2010) 601– 605. [58] L. Meng, J. Zhou, H. Sasano, T. Suzuki, K.M. Zeitoun, S.E. Bulun, Tumor necrosis factor alpha and interleukin 11 secreted by malignant breast epithelial cells inhibit adipocyte differentiation by selectively down-regulating CCAAT/ enhancer binding protein alpha and peroxisome proliferator-activated receptor gamma: mechanism of desmoplastic reaction, Cancer Res. 61 (2001) 2250–2255. [59] E.M. Chandler, M.P. Saunders, C.J. Yoon, D. Gourdon, C. Fischbach, Adipose progenitor cells increase fibronectin matrix strain and unfolding in breast tumors, Phys. Biol. 8 (2011) 015008. [60] M.J. Bissell, W.C. Hines, Why do not we get more cancer? a proposed role of the microenvironment in restraining cancer progression, Nat. Med. 17 (2011) 320– 329. [61] A.F. Olumi, G.D. Grossfeld, S.W. Hayward, P.R. Carroll, T.D. Tlsty, G.R. Cunha, Carcinoma-associated fibroblasts direct tumor progression of initiated human prostatic epithelium, Cancer Res. 59 (1999) 5002–5011. [62] A. Krtolica, S. Parrinello, S. Lockett, P.Y. Desprez, J. Campisi, Senescent fibroblasts promote epithelial cell growth and tumorigenesis: a link between cancer and aging, Proc. Natl. Acad. Sci. USA 98 (2001) 12072–12077. [63] N.A. Bhowmick, A. Chytil, D. Plieth, A.E. Gorska, N. Dumont, S. Shappell, M.K. Washington, E.G. Neilson, H.L. Moses, TGF-beta signaling in fibroblasts modulates the oncogenic potential of adjacent epithelia, Science 303 (2004) 848–851. Y.-Y. Wang et al. / Cancer Letters 324 (2012) 142–151 [64] M.H. Barcellos-Hoff, S.A. Ravani, Irradiated mammary gland stroma promotes the expression of tumorigenic potential by unirradiated epithelial cells, Cancer Res. 60 (2000) 1254–1260. [65] A. Meulle, B. Salles, D. Daviaud, P. Valet, C. Muller, Positive regulation of DNA double strand break repair activity during differentiation of long life span cells: the example of adipogenesis, PLoS ONE 3 (2008) e3345. [66] M.V. Maffini, A.M. Soto, J.M. Calabro, A.A. Ucci, C. Sonnenschein, The stroma as a crucial target in rat mammary gland carcinogenesis, J. Cell Sci. 117 (2004) 1495–1502. [67] P. Irigaray, J.A. Newby, S. Lacomme, D. Belpomme, Overweight/obesity and cancer genesis: more than a biological link, Biomed. Pharmacother. 61 (2007) 665–678. [68] E.E. Calle, R. Kaaks, Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms, Nat. Rev. Cancer 4 (2004) 579–591. [69] D.P. Rose, L. Vona-Davis, Interaction between menopausal status and obesity in affecting breast cancer risk, Maturitas 66 (2010) 33–38. [70] J.J. Griggs, M.S. Sabel, Obesity and cancer treatment: weighing the evidence, J. Clin. Oncol. 26 (2008) 4060–4062. [71] M. Ewertz, M.B. Jensen, K.A. Gunnarsdottir, I. Hojris, E.H. Jakobsen, D. Nielsen, L.E. Stenbygaard, U.B. Tange, S. Cold, Effect of obesity on prognosis after earlystage breast cancer, J. Clin. Oncol. 29 (2011) 25–31. [72] E. Dalmas, K. Clement, M. Guerre-Millo, Defining macrophage phenotype and function in adipose tissue, Trends Immunol. 32 (2011) 307–314. [73] K. Subbaramaiah, L.R. Howe, P. Bhardwaj, B. Du, C. Gravaghi, R.K. Yantiss, X.K. Zhou, V.A. Blaho, T. Hla, P. Yang, L. Kopelovich, C.A. Hudis, A.J. Dannenberg, Obesity is associated with inflammation and elevated aromatase expression in the mouse mammary gland, Cancer Prev. Res. (Phila.) 4 (2011) 329–346. [74] P.G. Morris, C.A. Hudis, D. Giri, M. Morrow, D.J. Falcone, X.K. Zhou, B. Du, E. Brogi, C.B. Crawford, L. Kopelovich, K. Subbaramaiah, A.J. Dannenberg, Inflammation and increased aromatase expression occur in the breast tissue of obese women with breast cancer, Cancer Prev. Res. (Phila.) 4 (2011) 1021–1029. 151 [75] X. Sun, P. Casbas-Hernandez, C. Bigelow, L. Makowski, D. Joseph Jerry, S. Smith Schneider, M.A. Troester, Normal breast tissue of obese women is enriched for macrophage markers and macrophage-associated gene expression, Breast Cancer Res. Treat. 131 (2012) 1003–1012. [76] S. Dogan, X. Hu, Y. Zhang, N.J. Maihle, J.P. Grande, M.P. Cleary, Effects of highfat diet and/or body weight on mammary tumor leptin and apoptosis signaling pathways in MMTV-TGF-alpha mice, Breast Cancer Res. 9 (2007) R91. [77] E.J. Kim, M.R. Choi, H. Park, M. Kim, J.E. Hong, J.Y. Lee, H.S. Chun, K.W. Lee, J.H. Yoon Park, Dietary fat increases solid tumor growth and metastasis of 4T1 murine mammary carcinoma cells and mortality in obesity-resistant BALB/c mice, Breast Cancer Res. 13 (2011) R78. [78] S.R. Coleman, Structural fat grafts: the ideal filler?, Clin Plast. Surg. 28 (2001) 111–119. [79] C.W. Chan, S.J. McCulley, R.D. Macmillan, Autologous fat transfer – a review of the literature with a focus on breast cancer surgery, J. Plast. Reconstr. Aesthet. Surg. 61 (2008) 1438–1448. [80] V. Lohsiriwat, G. Curigliano, M. Rietjens, A. Goldhirsch, J.Y. Petit, Autologous fat transplantation in patients with breast cancer: ‘‘silencing’’ or ‘‘fueling’’ cancer recurrence?, Breast 20 (2011) 351–357 [81] J.Y. Petit, E. Botteri, V. Lohsiriwat, M. Rietjens, F. De Lorenzi, C. Garusi, F. Rossetto, S. Martella, A. Manconi, F. Bertolini, G. Curigliano, P. Veronesi, B. Santillo, N. Rotmensz, Locoregional recurrence risk after lipofilling in breast cancer patients, Ann. Oncol. 23 (2012) 582–588. [82] V.S. Donnenberg, L. Zimmerlin, J.P. Rubin, A.D. Donnenberg, Regenerative therapy after cancer: what are the risks?, Tissue Eng Part. B Rev. 16 (2010) 567–575. [83] I. Martin-Padura, G. Gregato, P. Marighetti, P. Mancuso, A. Calleri, C. Corsini, G. Pruneri, M. Manzotti, V. Lohsiriwat, M. Rietjens, J.Y. Petit, F. Bertolini, The white adipose tissue used in lipotransfer procedures is a rich reservoir of CD34+ progenitors able to promote cancer progression, Cancer Res. 72 (2012) 325–334. REVIEW II: Oncological risk after autologous lipoaspirate grafting in breast cancer patients : from the bench to the clinic and back (Wang et al, 2013, J Craniofac Surg) 90 SPECIAL EDITORIAL Oncological Risk After Autologous Lipoaspirate Grafting in Breast Cancer Patients: From the Bench to the Clinic and Back Yuan Yuan Wang, MD,* Guo Sheng Ren, MD, PhD,Þ Jean-Yves Petit, MD,þ and Catherine Muller, MD, PhD§ R estoring acceptable human appearance after cancer resection is an important part of the treatment process. Increasingly, autologous fat transfer is used by breast reconstructive surgeons following cancer treatment, particularly in the realms of breast-conserving surgery.1,2 Compared with other techniques, use of autologous fat has several advantages, including biocompatibility, versatility, natural appearance, and low donor-site morbidity. Schematically, the procedure used by the majority of surgeons, known as the Coleman technique, consists of the harvesting of subcutaneous fat usually from the abdominal wall or the thighs, followed by a short centrifugation and injection of the cellular ‘‘fat’’ into the area of interest.3 Therefore, the injected ‘‘fat’’ contains mature adipocytes as well as all the other cellular components present in adipose tissue (AT) including mainly adipose-derived stem cells (ADSCs)/preadipocytes and endothelial cells/endothelial progenitor cells.4 The grafted fat not only behaves as a filler, but also improves surrounding tissues, bearing lesions such as scars, radiation damage, and breast capsular contracture, into which the fat is placed.5 These effects clearly indicate a modification of the local physiology at the recipient site upon fat transfer. Unfortunately, accumulating experimental evidence has revealed that the factors accompanying tissue regeneration and revascularization are also critical to cancer growth and metastasis.6 In fact, cancer cells usually go about generating a supportive microenvironment by activating the wound-healing response of the host, and accordingly, tumors have been described as ‘‘wounds that never heal.’’7 Therefore, this concept of tumor-stroma interaction in cancer AQ1 From the *Université de Toulouse and Institut de Pharmacologie et de Biologie Structurale, Toulouse, France; and Department of Endocrine and Breast Surgery, the First Affiliated Hospital of Chongqing Medical University, Chongqing, China; †Department of Endocrine and Breast Surgery, the First Affiliated Hospital of Chongqing Medical University, Chongqing, China and ‡Division of Plastic Surgery, European Institute of Oncology, Milano, Italy. Received January 17, 2013. Accepted for publication February 3, 2013. Address correspondence and reprint requests to Catherine Muller, MD, PhD, IPBS, 205 route de Narbonne, 31077 Toulouse, France; E-mail: [email protected] Studies performed in our laboratories were supported by the French National Cancer Institute (INCA PL 2006Y035 and INCA PL 2010-214 to C.M.), the ‘‘Ligue Régionale contre le Cancer’’ (Comité du Lot, de la Haute-Garonne et du Gers to C.M.), the Fondation de France (to C.M.), and the University of Toulouse (AO CS 2009 to C.M.). Y.Y.W. is a recipient of a doctoral fellowship from the Chinese Research Council.Presented at the 61 Annual Meeting of the Italian Society of Plastic Surgery (SICPRE), Panel on Lipofilling; Palermo, Italy; September 24Y27, 2012. Copyright * 2013 by Mutaz B. Habal, MD ISSN: 1049-2275 DOI: 10.1097/SCS.0b013e31828b6c84 The Journal of Craniofacial Surgery progression raises questions over the oncological safety of fat transfer in cancer patients and indicates that this needs to be addressed at both experimental and clinical levels. In considering this question, we must first confirm whether AT, among other cellular components of the stroma, is an active player in the mammary tumor progression. CELLULAR COMPONENTS OF THE ADIPOSE TISSUE CONTRIBUTE TO BREAST CANCER GROWTH In fact, if we consider the ‘‘normal’’ cells surrounding a breast tumor, the cells that compose the AT are clearly the most abundant. In addition, in the case of invasive breast cancer, tumor cells come in close contact with AT (Fig. 1). Regarding the role of stromal cells in breast cancer progression, earlier studies have emphasized the importance of fibroblasts and macrophages,8 but an increasing curiosity has emerged these past few years concerning the role of AT.9 This growing interest is due to several reasons. On the one hand, mature adipocytes have moved from relatively inert lipid-storing cells to highly endocrine cellYsecreting growth factors, chemokines, inflammatory cytokines, and extracellular matrix (ECM) proteinsV all secretions capable of affecting tumor behavior.10 On the other hand, the regenerative pluripotential of ADSCs has been clearly demonstrated.11 Finally, obesity, where both the cellular composition and the normal balance of these AT secretory proteins are per- FIGURE 1. Breast cancers are surrounded by AT. Histological examination of an invasive breast tumor after hematoxylin-eosin staining (original magnification 200). Ad indicates adipose tissue; IF, invasive front; C, tumor centre. Note that at the invasive front the breast cancer cells become in very close contact to adipocytes (indicated by arrows). & Volume 24, Number, May 2013 Copyright @ 2013 Mutaz B. Habal, MD. Unauthorized reproduction of this article is prohibited. 1 F1 Special Editorial The Journal of Craniofacial Surgery turbed, has recently emerged as a negative prognosis factor for breast cancerVindependent of menopausal status.12 Both major cellular components of AT, namely, mature adipocytes and ADSCs, contribute to breast cancer progression (for recent reviews from our laboratories, see Bertolini et al4 and Wang et al9). We have recently demonstrated that tumor-surrounding adipocytes strongly stimulated the invasive behavior of breast cancer cells both in vitro (two-dimensional coculture system) and in mouse models.13 At least in vitro, the stimulatory effect of adipocytes was far more pronounced on nonaggressive tumor cell lines.13 Interestingly, adipocytes that are in close contact with tumor cells exhibit specific traits including delipidation and decrease in late adipose markers and inflammatory phenotype, traits that are found in human breast tumors confirming the clinical relevance of our findings.13 In our study, the proinvasive effect of adipocytes was mainly mediated by interleukin 6. Interestingly, the human breast tumors of larger size and/or with lymph node involvement exhibit the higher levels of interleukin 6 in tumor-surrounding adipocytes.9,13 Other teams have stressed the role of ECM (such as collagen VI) and ECMremodeling enzymes in the paracrine effect of adipocytes on breast tumor progression. Finally, a wide range of molecules that enhance tumor growth, survival, and invasion in both paracrine and endocrine manners are also secreted by adipocytes including, among others, leptin and adiponectin.14 Adipose-derived stem cells are also a source of significant bioactive molecules (for review, see Bertolini et al4). In autologous fat transfer, ADSCs provide several benefits; they improve angiogenesis and graft vascularity and contribute actively to the adipocyte pool allowing fat grafts to maintain their volume.15 As for mature adipocytes, several studies demonstrated that ADSCs promote in vitro and in vivo growth and survival of breast cancer cells as well as their migratory and invasive capacities.4,9 Different functions of ADSCs within the tumor should be considered. First, a number of different studies have suggested that ADSCs might be activated by tumor cells and in turn express activated fibroblasts markers such as >smooth muscle actin, as well as fibronectin and tenascin C.9 A recent study demonstrated that these activated ADSCs led to ECM deposition and contraction in vivo, thereby enhancing breast cancer tissue stiffness, a parameter clearly contributing to breast cancer progression.16 Second, ADSCs might also contribute to tumor vascularization (for review, see Bertolini et al4). Recent elegant studies have demonstrated that, in mice, ADSCs are recruited by experimental tumors and promote cancer progression.17,18 These studies using fluorescent-tagged cells show that these ADSCs contribute to the formation of most vascular and fibrovascular stroma (pericytes, >smooth muscle actinYpositive myofibroblasts, and endothelial cells) in murine tumors.18 Finally, the role of AT in tumor vascularization is also sustained by the presence of CD34+ endothelial cell progenitors within the AT itself, which have been reported to generate endothelial cells and vessels in vitro and in vivo.19 Taken together, these studies convincingly demonstrate that cellular components of mammary AT are key players in actively growing and disseminating tumor cells. Could these results be observed with subcutaneous AT that is generally used as a source in lipofilling? In immunodeficient mice, when human AT (obtained from lipotransfer procedures for breast reconstruction in breast cancer patients) was coinjected with triple-negative breast tumor cells, a clear increase in tumor volume was observed in comparison to control group injected with tumor cells alone.19 Given the data obtained before on the negative crosstalk between breast cancer and AT, these results were as expected. However, 2 new results obtained in this study merit our attention. First, the authors demonstrated that this effect on tumor growth was mainly due to the CD34+ population representing endothelial cell progenitors. Second, following tumor resection, an increase in both lung and axillary metastases was ob- 2 & Volume 24, Number, May 2013 served in mice injected with CD34+ cells from AT compared with the control group without an AT graft.19 Although these experiments were performed in mice, these results provide the first experimental evidence that at least a certain population of cells present in subcutaneous AT might favor the resurgence of quiescent and minority tumor cells. In the context of these findings, what do the clinical studies tell us? CLINICAL STUDIES ON THE ONCOLOGICAL SAFETY OF FAT GRAFTING A bibliographic survey of past studies concerned with the applicability and safety of autologous fat for the reconstruction of the breast was published in 2012.20 This review included 60 articles with around 4600 patients, of which only 3 studies specifically address the risk of breast cancer (616 patients, mean follow-up of 45.2 months).20 From these 3 studies, which used standard Coleman techniques, there was no evidence that fat grafting significantly increases the risk of breast cancer.21Y23 However, of note and as underlined in this review,20 only our study conducted at the European Institute of Milan included a case-control group.23 A systematic review of the literature on the oncological safety of autologous lipoaspirate grafting in breast cancer patients has been published this year.24 Again, this review underlines the lack of cohort including a case-control group except our own study and insists that larger prospective trials with longer follow-up are needed.23 Given the previously described interaction between normal and tumoral mammary epithelial cells and AT, the risk of recurrence in patients who undergo either mastectomy or quadrantectomy should be afforded greater consideration. These 2 different groups were analyzed in our study, and no differences were observed.23 Of note, although not significant, the lipofilling group showed a higher risk of local events when the analysis was limited to intraepithelial neoplasia.23 On the whole, this study suggested that lipofilling is a safe procedure in breast cancer patients but also that the group of in situ breast carcinomas needs further attention. To this end, we set up a new matched cohort study, limited to patients with intraepithelial lesions and including a large number of patients with a longer follow-up as compared with our former study.23 A higher risk of local events was observed in intraepithelial neoplasia patients following lipofilling as compared with control groups with a 5-year cumulative incidence of 18% and 3%, respectively.25 Taken together, these results confirmed the recurrence risk for in situ breast cancer. Because of the small samples of the study (59 patients), a definitive conclusion could not be drawn, but additional studies are urgently needed to confirm or deny the highlighted risk. Concerning invasive breast cancers, the procedure appears safe, although long-term follow-up and larger sample population are also clearly needed. To definitively assess this latter point would require at least the use of a control group or, ideally, randomized controlled trials. Moreover, all the reported clinical studies that assess the relative safety of fat grafting were obtained using only the Coleman technique with no specific enhancement of the ADSC pool in the reinjected fat. It is therefore urgent to perform matched cohort study with breast cancer patients treated with any kind of enrichment of the reinjected fat. CONCLUSIONS: BACK TO THE BENCH? From the oncologist point of view, AT has emerged these last 10 years as a rather active player in breast cancer progression. Intimate and bidirectional interaction with adjacent mammary epithelium, during mammary gland development, pregnancy lactation, and involution, is one of the hallmarks of mammary adipocytes.9 Therefore, the fact that this crosstalk persists in pathophysiological conditions such as cancer does not come as a great shock. Of interest, tumorsurrounding adipocytes exhibit specific changes including delipidation, * 2013 Mutaz B. Habal, MD Copyright @ 2013 Mutaz B. Habal, MD. Unauthorized reproduction of this article is prohibited. The Journal of Craniofacial Surgery & Volume 24, Number, May 2013 inflammatory phenotype, and overexpression of ECM and ECMmodifying molecules.13 It would be worth characterizing the phenotype of adipocytes harvested by lipoaspiration because one might overlook that mechanical stress in AT induces an inflammatory phenotype. In addition, although the definitive answer would come only from welldesigned clinical studies, the coinjection of human AT (obtained from lipotransfer procedures for breast reconstruction in breast cancer patients) with murine models of in situ breast carcinoma might be of use. In fact, it would be interesting to investigate if intraepithelial lesions are more receptive to supportive signals by AT, and if AT confers a more aggressive phenotype on them. Recent fat transfer and lipoinjection protocols have focused on the addition of autologous ADSCs or freshly isolated adipose stromal vascular cells to promote graft volume retention.26 In mice, it has been demonstrated that the use of collagenase for AT digestion (a necessary step in the purification procedure) induces inflammatory mediators and down-regulates adipocyte genes, a phenotype reminiscent of the tumor-surrounding adipocyte.13,27 This type of procedure should also be considered with even greater caution with respect to conventional techniques, regarding the results obtained in mouse models with the use of CD34+ sorted cells.19 In addition to prospective clinical studies required to address the issue of these specific strategies, similar experimental approaches to those of Martin-Padura et al19 with specific sorted cell population should be helpful to delineate the risk of cancer recurrence after tumor resection in mice to provide reliable preclinical data. Fat grafting represents a strong interest in breast cancer patients to improve the results of breast cancer reconstruction. Efforts made by both the research and clinical community would undoubtedly contribute to define the risk-benefit balance for the patients. ACKNOWLEDGMENTS The authors thank Jamie Brown for the English editing of the manuscript. REFERENCES 1. Chan CW, McCulley SJ, Macmillan RD. Autologous fat transferVa review of the literature with a focus on breast cancer surgery. J Plast Reconstr Aesthet Surg 2008;61:1438Y1448 2. Gutowski KA. Current applications and safety of autologous fat grafts: a report of the ASPS fat graft task force. Plast Reconstr Surg 2009;124:272Y280 3. Coleman SR. Structural fat grafts: the ideal filler? Clin Plast Surg 2001;28:111Y119 4. Bertolini F, Lohsiriwat V, Petit JY, et al. Adipose tissue cells, lipotransfer and cancer: a challenge for scientists, oncologists and surgeons. Biochim Biophys Acta 2012;1826:209Y214 5. Coleman SR. Structural fat grafting: more than a permanent filler. Plast Reconstr Surg 2006;118:108SY120S 6. Schafer M, Werner S. Cancer as an overhealing wound: an old hypothesis revisited. Nat Rev Mol Cell Biol 2008;9:628Y638 7. Dvorak HF. Tumors: wounds that do not heal. Similarities between tumor stroma generation and wound healing. N Engl J Med 1986;315:1650Y1659 Special Editorial 8. Polyak K, Kalluri R. The role of the microenvironment in mammary gland development and cancer. Cold Spring Harb Perspect Biol 2010;2:a003244 9. Wang YY, Lehuede C, Laurent V, et al. Adipose tissue and breast epithelial cells: a dangerous dynamic duo in breast cancer. Cancer Lett 2012;324:142Y151 10. Ouchi N, Parker JL, Lugus JJ, et al. Adipokines in inflammation and metabolic disease. Nat Rev Immunol 2011;11:85Y97 11. Huang SJ, Fu RH, Shyu WC, et al. Adipose-derived stem cells: isolation, characterization and differentiation potential. Cell Transplant 2012 12. Dirat B, Bochet L, Escourrou G, et al. Unraveling the obesity and breast cancer links: a role for cancer-associated adipocytes? Endocr Dev 2010;19:45Y52 13. Dirat B, Bochet L, Dabek M, et al. Cancer-associated adipocytes exhibit an activated phenotype and contribute to breast cancer invasion. Cancer Res 2011;71:2455Y2465 14. Park J, Euhus DM, Scherer PE. Paracrine and endocrine effects of adipose tissue on cancer development and progression. Endocr Rev 2011;32:550Y570 15. Yoshimura K, Sato K, Aoi N, et al. Cell-assisted lipotransfer for facial lipoatrophy: efficacy of clinical use of adipose-derived stem cells. Dermatol Surg 2008;34:1178Y1185 16. Chandler EM, Seo BR, Califano JP, et al. Implanted adipose progenitor cells as physicochemical regulators of breast cancer. Proc Natl Acad Sci U S A 2012;109:9786Y9791 17. Zhang Y, Daquinag A, Traktuev DO, et al. White adipose tissue cells are recruited by experimental tumors and promote cancer progression in mouse models. Cancer Res 2009;69:5259Y5266 18. Kidd S, Spaeth E, Watson K, et al. Origins of the tumor microenvironment: quantitative assessment of adipose-derived and bone marrow-derived stroma. PLoS One 2012;7:e30563 19. Martin-Padura I, Gregato G, Marighetti P, et al. The white adipose tissue used in lipotransfer procedures is a rich reservoir of CD34+ progenitors able to promote cancer progression. Cancer Res 2012;72:325Y334 20. Claro F Jr, Figueiredo JC, Zampar AG, et al. Applicability and safety of autologous fat for reconstruction of the breast. Br J Surg 2012;99:768Y780 21. Rietjens M, De Lorenzi F, Rossetto F, et al. Safety of fat grafting in secondary breast reconstruction after cancer. J Plast Reconstr Aesthet Surg 2011;64:477Y478 22. Rigotti G, Marchi A, Stringhini P, et al. Determining the oncological risk of autologous lipoaspirate grafting for post-mastectomy breast reconstruction. Aesthetic Plast Surg 2010;34:475Y480 23. Petit JY, Botteri E, Lohsiriwat V, et al. Locoregional recurrence risk after lipofilling in breast cancer patients. Ann Oncol 2012; 23:582Y588 24. Krastev TK, Jonasse Y, Kon M. Oncological safety of autologous lipoaspirate grafting in breast cancer patients: a systematic review. Ann Surg Oncol 2013;20:111Y119 25. Petit JY, Rietjens M, Botteri E, et al. Evaluation of fat grafting safety in patients with intraepithelial neoplasia: a matched-cohort study. Ann Oncol. In press 26. Donnenberg VS, Zimmerlin L, Rubin JP, et al. Regenerative therapy after cancer: what are the risks? Tissue Eng Part B Rev 2010; 16:567Y575 27. Ruan H, Zarnowski MJ, Cushman SW, et al. Standard isolation of primary adipose cells from mouse epididymal fat pads induces inflammatory mediators and down-regulates adipocyte genes. J Biol Chem 2003;278:47585Y47593 * 2013 Mutaz B. Habal, MD Copyright @ 2013 Mutaz B. Habal, MD. Unauthorized reproduction of this article is prohibited. 3 AQ2 AQ3 ARTICLE I: Cancer-associated adipocytes exhibit an activated phenotype and contribute to breast cancer invasion (Dirat et al, 2011, Cancer Res) 91 Cancer Research Microenvironment and Immunology Cancer-Associated Adipocytes Exhibit an Activated Phenotype and Contribute to Breast Cancer Invasion atrice Dirat1,2,3, Ludivine Bochet1,2,3, Marta Dabek1,2, Danie le Daviaud1,3, Ste phanie Dauvillier1,2, Be Bilal Majed6, Yuan Yuan Wang1,2,3, Aline Meulle1,2,3, Bernard Salles1,2, Sophie Le Gonidec1,3, Ignacio Garrido4, Ghislaine Escourrou5, Philippe Valet1,3, and Catherine Muller1,2 Abstract Early local tumor invasion in breast cancer results in a likely encounter between cancer cells and mature adipocytes, but the role of these fat cells in tumor progression remains unclear. We show that murine and human tumor cells cocultivated with mature adipocytes exhibit increased invasive capacities in vitro and in vivo, using an original two-dimensional coculture system. Likewise, adipocytes cultivated with cancer cells also exhibit an altered phenotype in terms of delipidation and decreased adipocyte markers associated with the occurrence of an activated state characterized by overexpression of proteases, including matrix metalloproteinase-11, and proinflammatory cytokines [interleukin (IL)-6, IL-1b]. In the case of IL-6, we show that it plays a key role in the acquired proinvasive effect by tumor cells. Equally important, we confirm the presence of these modified adipocytes in human breast tumors by immunohistochemistry and quantitative PCR. Interestingly, the tumors of larger size and/or with lymph nodes involvement exhibit the higher levels of IL-6 in tumor surrounding adipocytes. Collectively, all our data provide in vitro and in vivo evidence that (i) invasive cancer cells dramatically impact surrounding adipocytes; (ii) peritumoral adipocytes exhibit a modified phenotype and specific biological features sufficient to be named cancer-associated adipocytes (CAA); and (iii) CAAs modify the cancer cell characteristics/phenotype leading to a more aggressive behavior. Our results strongly support the innovative concept that adipocytes participate in a highly complex vicious cycle orchestrated by cancer cells to promote tumor progression that might be amplified in obese patients. Cancer Res; 71(7); 2455–65. 2011 AACR. Introduction Cells that compose the tumor stroma are associated, if not obligate, partners in tumor progression (1–3). In breast cancer, stromal cells include resident adipocytes and fibroblasts, a wide range of recruited hematopoietic cells, and newly formed blood vessels with their associated cells (3). Dynamic and reciprocal communication between epithelial and stromal compartments occurs during breast cancer progression de Toulouse; 2CNRS (Centre National de Authors' Affiliations: 1Universite la Recherche Scientifique), Institut de Pharmacologie et de Biologie et de la Recherche me dicale, Structurale; 3Institut National de la Sante partement de Chirurgie Oncologique, Institut ClauINSERM U1048; 4De 5 dius Regaud; and Service d’Anatomo-Pathologie, Hôpital de Rangueil, partement de Biostatistiques, Institut Curie, Toulouse, France; and 6De d'Epide miologie et de Recherche Clinique, Hôpital Paris, France et Unite d'Arras, Arras, France Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). Corresponding Author: Catherine Muller, Institut de Pharmacologie et de Biologie Structurale, 205 route de Narbonne, 31077 Toulouse Cedex, Toulouse, France. Phone: 33-561-17-59-32; Fax: 33-561-17-59-94; E-mail: [email protected] doi: 10.1158/0008-5472.CAN-10-3323 2011 American Association for Cancer Research. (1, 2). Cancer cells usually go about generating a supportive microenvironment by activating the wound-healing response of the host (4). Conversely, the stromal cells, such as cancerassociated fibroblasts or tumor-associated macrophages, promote tumor progression by secreting growth factors, chemokines, and promigratory extracellular matrix components (2). To date, most of the studies focused on cancer cell–mesenchymal cell interactions have emphasized the contribution of fibroblasts, endothelial, and inflammatory cells (1). Little attention has been given to the mature adipocytes despite the fact that in breast cancers, early local tumor invasion results in immediate proximity of cancer cells to adipocytes (3). Until recently, adipocytes were mainly considered as an energy storage depot, but there are now clear evidences pointing adipocytes as endocrine cells producing hormones, growth factors, cytokines, and other molecules named adipokines (5). Therefore, mature adipocytes represent excellent candidates to influence tumor behavior through heterotypic signaling processes. Adipokines, such as leptin, adiponectin (APN), hepatocyte growth factor, or collagen VI, stimulate the growth and survival of breast tumor cells even in estrogen-negative cells (6, 7). Moreover, it has been shown that metalloproteinase (MMP)-11/stromelysin-3 is induced in adipose tissue by cancer cells as they invade their surrounding environment (8). www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. 2455 Dirat et al. Obesity, wherein the normal balance of adipose tissue secretory proteins is disturbed, has been recently identified as a negative prognosis factor for breast cancer (9, 10). This poor prognosis seems to be independent of menopausal status, tumor stage, and tumor hormone–binding characteristics (for review, see refs. 11–13). Several studies pointed out that obese women exhibit at diagnosis an increase in lymph nodes involvement and a higher propensity to distant metastasis (10, 11, 14–17). Furthermore, obesity is also associated with the occurrence of tumors of high grade with increased local and distant invasion in prostate cancer (18). Taken together, these compelling observations suggest that excess adiposity may favor tumor invasiveness by yet uncharacterized mechanism(s). We show here that tumor-surrounding adipocytes exhibit profound phenotypic changes in vitro and in human tumors, and these modified adipocytes promote tumor cell invasion and metastasis. Materials and Methods Cell culture The murine 3T3-F442A preadipocyte cell line was differentiated as described previously (19). To estimate the adipocyte phenotype, triglyceride (TG) content was quantified using a colorimetric kit (Wako Chemicals), and red oil staining was carried out as previously described (20). The human breast cancer cell line ZR 75.1 (provided by Prof. K. Bystricky, Laboratoire de Biologie Moleculaire Eucaryote, Toulouse, France) and the murine 67NR and 4T1 breast cancer cell lines (ref. 21; provided by Dr. S. Vagner, INSERM U563, Toulouse, France) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% (ZR 75.1 and 67NR) and 5% (4T1) fetal calf serum (FCS). The human breast cancer cell line SUM159PT (provided by Dr. J Piette, IGMM, Montpellier, France) was grown in Ham F12 (50:50) medium complemented with 5% FCS, 1 mg/mL hydrocortisone (Sigma), and 0.2 UI/ mL insulin. All the cell lines were used within 2 months after resuscitation of frozen aliquots. Cell lines were authenticated on the basis of viability, recovery, growth, and morphology. For ZR 75.1 and SUM159PT cell lines, the expression status of estrogen receptor (ER) a, E-cadherin, N-cadherin, and vimentin was confirmed by immunoblotting before they were used in the experiments (22). For all cell lines, their invasive behavior was confirmed using Boyden chamber assays before they were used in the experiments. Cell lines 67NR and 4T1 were also tested for their ability to form (4T1) or not (67NR) metastatic tumors when injected in syngenic BALB/c mice (21). Human samples Breast adipose tissue samples were collected from reduction mammoplasty (RM) or tumorectomy (TU), according to the guidelines of the Ethical Committee of Toulouse-Rangueil. All subjects gave their informed consent to participate in the study, and investigations were conducted in accordance with the Declaration of Helsinki as revised in 2000. In cases of TU, the fat tissue samples obtained were immediately close to the tumor mass and 2456 Cancer Res; 71(7) April 1, 2011 were devoid of fibrosis, as assessed macroscopically (data not shown). Adipose tissue pieces were immediately used for collagenase digestion as previously described (23) and centrifuged (20 minutes, room temperature, 1,000 rpm) to separate adipocytes from the stroma vascular fraction (pellet, SVF). Coculture and invasion assays Tumor cells and adipocytes were cocultured using a Transwell culture system (0.4-mm pore size; Millipore). A total of 5 104 (67NR), 1.5 105 (SUM159PT, 4T1), or 3 105 (ZR 75.1) cells were seeded in the top chamber of the Transwell system in the culture medium of adipocytes and cocultivated with or without mature adipocytes in the bottom chamber for the indicated times. Adipocytes or tumor cells cultivated alone in similar conditions served as controls. To evaluate the effect of adipocyte-conditioned medium (Ad-CM) on tumor cell invasion, mature adipocytes were cultivated overnight with serum-free medium containing 1% of delipidated bovine serum albumin (Sigma) and medium was collected. CM was also collected from adipocytes previously cocultivated during 3 days with tumor cells [cancer-associated adipocytes conditioned medium (CAA-CM)]. After 3 days of coculture in the presence of mature adipocytes, Ad-CM, or CAA-CM (complemented with 10% FCS), tumor cells were used to conduct Matrigel invasion assays as previously described (24). A total of 35 to 40 fields per filter were counted using an optical microscope. Invasion assays were also conducted with tumor cells previously cultivated for 3 days with recombinant human IL-6 (PeproTech). Western blot analysis Whole cell extracts and immunoblots were prepared as previously described (25). All the antibodies used in our study are presented in Supplementary Information. Tail vein metastasis assays A total of 1 106 4T1 cells, previously cocultivated either with or without mature adipocytes for 4 days, were injected intravenously in BALB/c mice (6 animals per condition). Mice were sacrificed after 14 days, and lungs were taken for analyses. Nodules were scored from 1 to 5 according to their likelihood to represent metastasis to lung (0, normal lung tissue; 1, tissue with 1–5 nodules; 2, 6–10 nodules; 3, 11–20 nodules; 4, 21–30 nodules; and 5, >31 nodules). Lungs were then fixed in 4% paraformaldehyde and embedded in paraffin. Sections were stained with hematoxylin and eosin (H&E) and nodules were observed. The mean number of nodules per lung area and the mean nodule area as a function of lung area (that defined the nodule area index) were measured by ImageJ software program. The local Institutional Animal Care and Use Committee approved the experimental protocols described in the study. Immunofluorescence, immunohistochemistry, and determination of adipokines secretion Immunofluorescence and immunohistochemistry were carried out as previously described (8, 24). Concentration of Cancer Research Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. Key Role of Mature Adipocytes in Breast Cancer Progression secreted factors in supernatants was determined using the xMAP Technology (Luminex), with a Milliplex kit (Millipore). RNA extraction and quantitative PCR Gene expression was analyzed using real-time PCR as described previously (23). The sequences of the primers are presented in Supplementary Information. Statistical methods Quantitative expression of biological markers measured by quantitative PCR (qPCR) in isolated human adipocytes was assessed using estimations of means and SDs. Hence, a normal distribution of these measures was assumed. However, the size of subpopulations was limited in most cases. Thus, we tested differences about the expression of biological markers between subpopulations of interest, using nonparametric tests (i.e., Wilcoxon's nonparametric rank test). Quartiles were also computed; box plots permitted to appreciate the presence of outliers and to illustrate differences in the expression of biological markers. The threshold of statistical significance was fixed at alpha risk at 5%. SPlus statistical software was used for the data analysis (26). For the in vitro experiments, the statistical significance of differences between the means (at least 3 independent experiments) was evaluated using Student's t test, done using Prism (GraphPad Inc.). The values of *P 0.05, **P < 0.01, and ***P < 0.001 were deemed as significant whereas "NS" stands for not significant. Results and Discussion Tumor cells cocultivated with mature adipocytes exhibit an enhanced invasive phenotype Human cancer cells with low (ZR 75.1) or high (SUM159PT) invasive capacities (27) were grown for 3 days on Transwells, allowing the diffusion of soluble factors, in the presence or absence of murine mature adipocytes (28). After 3 days, tumor cells were trypsinized and Matrigel invasion assays were conducted in a medium containing either 0% or 10% FCS. As shown in Figure 1A, the invasive capacity of ZR 75.1 tumor cells in 10% FCS containing medium was increased by 3-fold in cells previously cocultivated for 3 days with adipocytes as compared with tumor cells grown alone (P < 0.01). No additional increase in the invasive capacity of ZR 75.1 was observed when the time of coculture with adipocytes was increased up to 5 days (data not shown). This effect was not observed when tumor cells were cocultivated with preadipocytes (Supplementary Fig. S1A). Similar results were obtained with the SUM159PT cell line, although to a lesser extent (Fig. 1A, P < 0.05). Experiments were also carried out with the mouse mammary cell line 4T1 and its nonmetastatic sibling cell line 67NR (21). Coculture with adipocytes increases both 67NR and 4T1 invasive capacities by 2-fold (Fig. 1B, P < 0.05 and 0.01, respectively). Therefore, mature adipocytes are able to stimulate the invasive capacities of murine and human breast cancer cell lines that are either positive (ZR 75.1) or negative (SUM159PT, 67NR, 4T1) for the ER. In addition, the proinvasive effect was independent from the tumor growth– promoting effect because coculture with adipocytes has no www.aacrjournals.org effect on ZR 75.1 or murine tumor cell lines proliferation in contrast to SUM159PT cells (Supplementary Fig. S1B). When tumor cells were grown in the presence of CM obtained from adipocytes, which have never been cocultivated with tumor cells (Ad-CM), invasive capacities were not significantly increased for any of cell lines (Fig. 1C). When CM was prepared from adipocytes previously cocultivated with tumor cells (CAA-CM), a significant stimulation of tumor invasive capacities was observed in all the tested models as compared with cells grown in control medium (P < 0.05 for the 67NR cells, P < 0.01 for the ZR 75.1, SUM159PT, and 4T1 cells). These results highlight that a cross-talk between the 2 cell populations is necessary to obtain this effect (Fig. 1C). Noncocultivated ZR 75.1 cells displayed a characteristic epithelial morphology and form compacted colonies. Yet, when these cells were cocultivated with adipocytes from 3 to 5 days, morphologic changes became apparent. Cells formed less compacted colonies and exhibited a more scattered aspect. In addition, these cells displayed a downregulation of membrane E-cadherin expression, in association with b-catenin redistribution, resulting into a disorganized state in the cytoplasm (Fig. 2A). Decreased E-cadherin expression was observed both at mRNA (Fig. 2B) and protein levels (Fig. 2C) without an increased expression of mesenchymal markers (Fig. 2B and C), suggesting the occurrence of an incomplete epithelial-mesenchymal transition (EMT). For the SUM159PT cell line, which has already undergone a complete EMT, morphologic changes were also observed along with the reorganization and polarization of vimentin (Fig. 2A) without a change in its expression level (Fig. 2C). Our coculture system shows that adipocytes stimulate the invasiveness of tumor cells in vitro. To test the hypothesis that "priming" tumor cells with adipocytes regulate tumor cell distal organ seeding and growth, we conducted tail vein metastasis assays, using the 4T1 cell line. 4T1 tumor cells were cultured in vitro for 4 days in the presence or absence of adipocytes, harvested, and injected intravenously into BALB/c mice. As shown in Figure 3A, the number of lung metastases was enhanced in mice injected with 4T1 cells previously cocultivated with adipocytes as compared with mice injected with 4T1 grown alone (P < 0.05). Histologic analysis (Fig. 3B) confirmed that both the number and size of the nodules were significantly increased in mice injected with adipocytes-cocultivated 4T1 compared with 4T1 cells grown alone (Fig. 3C and D, P < 0.05 for the 2 parameters). Therefore, our results clearly show that adipocytes promote the invasive phenotype of breast tumor cells both in vitro and in vivo. Cocultivated adipocytes exhibit extensive phenotypic changes Adipocytes have been shown to promote tumor survival and growth in vitro and in vivo (6, 29), but their contribution to tumor cell invasion is an emerging concept. Because our results showed that a cross-talk between the 2 cell populations is necessary to observe the proinvasive effect (Fig. 1C), we next examined the phenotype of cocultivated adipocytes. As shown in Figure 4A (left), mature adipocytes cocultivated with ZR 75.1 tumor cells exhibited a dramatic reduction in Cancer Res; 71(7) April 1, 2011 Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. 2457 Dirat et al. Figure 1. Coculture of breast tumor cells with mature adipocytes stimulates their invasive capacities. A, ZR 75.1 or SUM159PT cells were cocultivated in the presence (C) or absence (NC) of mature adipocytes. After 3 days, tumor cells were trypsinized and used for Matrigel invasion assay in a medium containing either 0% (white bars) or 10% FCS (black bars). B, similar experiments were done with the 67NR and 4T1 murine cancer cells. A and B, representative images of Matrigel invasion assay conducted in a medium containing 10% FCS are shown below each graph. C, indicated cells were cultivated either in normal medium (control), in CM obtained from adipocytes (Ad-CM), or in CM obtained from adipocytes previously grown in the presence of tumor cells (CAA-CM). After 3 days, tumor cells were trypsinized and used for Matrigel invasion assays in a medium containing either 0% (white bars) or 10% FCS (black bars). the number and size of lipid droplets that correlated with a significant decrease in lipid accumulation (Fig. 4A, right, P < 0.05). These adipocytes lose several terminal differentiation markers exemplified by the strong decrease in HSL (hormone-sensitive lipase), APN, resistin, and aP2 mRNA (ref. 5; 2458 Cancer Res; 71(7) April 1, 2011 Fig. 4B, P < 0.05 for all the markers), this loss was also confirmed at protein levels for APN and resistin (Fig. 4C, P < 0.05). In cocultivated adipocytes, the level of C/EBPa was dramatically reduced (P < 0.001) whereas that of PPARg was not significantly decreased (Fig. 4B). As previously stated, Cancer Research Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. Key Role of Mature Adipocytes in Breast Cancer Progression Figure 2. Cancer cells exhibit morphologic changes and incomplete EMT on coculture with adipocytes. A, ZR 75.1 or SUM159PT were grown on coverslips in inserts, the lower wells cocultivated in the presence (C) or absence (NC) of mature adipocytes. After 3 or 5 days, cells were fixed and stained with the indicated antibodies. Nuclei were labeled with TO-PRO-3; scale bars, 40 mmol/L. B, relative mRNA expression of N-cadherin and E-cadherin in indicated tumor cell lines cocultivated in the presence (C) or absence (NC) of murine adipocytes for 5 days evaluated by qPCR. C, analysis of protein expression of the indicated markers done by Western blots with extracts obtained from tumor cells cocultivated in the presence (C) or absence (NC) of adipocytes (5 days). MMP-11/stromelysin-3 is induced in vivo in adipose tissue by cancer cells as they invade their surrounding environment (8). Similarly, an upregulation for this protease was noted in the cocultivated adipocytes, highlighting the in vivo relevance of this coculture model (Fig. 4B, P < 0.001). In contrast, the levels of MMP-9 (Fig. 4B) and MMP-2 (not shown) remain unchanged whereas a significant increase (10-fold) of plasminogen activator inhibitor-1 (PAI-1) expression was found (Fig. 4B, P < 0.01). In cocultivated adipocytes, a 5-fold increase in levels of IL-6, IL-1b, and TNFa was shown at mRNA levels (Fig. 4B, P < 0.001 for all cytokines). At protein levels, however, only IL-6 and IL-1b were found to be significantly higher in the supernatant of cocultivated cells (Fig. 4C, P < 0.05 for both cytokines) whereas the levels of TNF-a remained undetectable in both conditions (data not shown). Of note, these extensive adipocyte phenotypic changes were obtained with other tumor cells lines (Supplementary Fig. S2). Furthermore, these results were confirmed with mammary adipocytes derived www.aacrjournals.org from ex vivo differentiation of progenitors purified from mammary adipose tissue of healthy donors undergoing RM (6 independent donors; Supplementary Fig. S3). Therefore, we extensively described tumor-induced changes in adipocytes that are reproducibly displayed by both human and mouse cocultivated adipocytes. Collectively, our observations clearly show that cocultivated adipocytes generally exhibit a loss of lipid content, a decrease in late adipose markers, and overexpression of inflammatory cytokines and proteases. We named these cells "cancer associated adipocytes" (11). CAAs are found in human tumors We next investigate whether these cells are present in primary human tumors. To address this critical issue, we first conducted a histologic analysis of human breast tumors. As exemplified in Figure 5A, we consistently observed at the invasive front of human breast tumors the presence of adipocytes of smaller sizes with a dilated interstitial space, which Cancer Res; 71(7) April 1, 2011 Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. 2459 Dirat et al. Figure 3. Coculture with adipocytes stimulates the metastatic potential of 4T1 cells in vivo. A, left, representative lungs harvested at necropsy after tail vein injection of 4T1 cocultivated in the presence (C) or absence (NC) of adipocytes during 4 days prior to injection. Right, metastatic score as determined by macroscopic examination. B, left, H&E stained transverse sections of host lungs from mice injected with 4T1 cells previously cocultivated in the presence (C) or absence (NC) of adipocytes during 4 days (original magnification 40). Examples of invading lesions are shown by arrows. Right, magnified views of invading lesions. C and D, metastasis number obtained from mice injected with 4T1 cells, previously cocultivated in the presence (C) or absence (NC) of adipocytes during 4 days, is expressed either as the average number of metastasis sites per lung area (C) or as nodule area index (D) representing the average metastasis area normalized by total lung area. might be related to extensive extracellular matrix occurring in tumor-surrounding adipocytes such as collagen VI overexpression (6). Further characterization of these CAAs was done by immunohistochemistry. As shown in Figure 5B (i and ii), we observed a decreased expression of the adipocyte marker APN in CAAs as compared with normal mammary adipose tissue. Although MMP-11 and IL-6 were not detected in mature adipocytes of RM (Fig. 5B, iii and v, respectively), these proteins were expressed within the rim of cytoplasm of the 2460 Cancer Res; 71(7) April 1, 2011 adipocytes located proximally to the invasive cancer cells (Fig. 5B, iv and vi, respectively). To further assess the expression of these markers by a quantitative approach, adipocytes were isolated from fat samples associated with TU or RM (23). A series of 28 samples, with 14 samples in each group (Supplementary Tables S1 and S2 for the clinical characteristics of the patients), was used comparable with respect to age (mean: 51.8 7.3 vs. 60 13) and BMI (26.2 2.8 vs. 25.2 2.3). Adipocytes isolated from tumor samples overexpressed MMP-11 (P ¼ 0.001), PAI-1 (P < 0.01), and IL-6 (P < 0.001), as compared with adipocytes purified from normal mammary gland, whereas the mRNA levels of IL-1b and TNF-a were not statistically different (Fig. 5C). The adipose tissue also contains stromal cells (present in the SVF), such as fibroblasts, endothelial cells, and adipocyte precursors. The levels of expression of MMP-11, PAI-1, IL-6, IL-1b, and TNF-a remained unchanged between normal and tumor-surrounding adipose SVF, highlighting that the observed increase in proinflammatory molecules and proteases is an adipocyte-dedicated event (Fig. 5C). Furthermore, when the expression levels of IL-6 in adipocytes were analyzed as a function of tumor characteristics, we found that higher levels of this cytokine were associated with the tumors of larger size and with lymph nodes involvement (Fig. 5D). This correlation was not found either for PAI-1 or for MMP-11 (Supplementary Fig. S4). Taken together, these results show that CAAs are found in human tumors. Our data strongly support the concept that an intimate cross-talk is established between cancer cells and mature adipocytes at the invasive front of the tumor. Invading tumor cells are able to modify adipocytes phenotype, which, in turn, stimulate cancer cells aggressive behavior (30). The mechanism(s) responsible for the transition from mature adipocytes to CAAs remain(s) unclear. Modification resembling to CAAs is also observed in adipose tissue of tumor-bearing mice far from the tumor site. In cachexia, adipocytes also exhibit morphologic modification, decreased in adipogenic transcription factors such as C/EBPa and late differentiation markers such as leptin (31). However, during cancer cachexia, adipocytes exhibit a decrease in resistin expression and upregulation of lipolytic enzymes such as HSL or ATGL (adipose triglyceride lipase) (31), events not found in CAAs (Fig. 4 and Supplementary Fig. S5), alluding to their unique phentotype. Several molecules expressed by tumor cells have been described as strong suppressors of adipogenesis such as IL-1b, TNF-a, or even IL-6 (32), representing one mechanism by which tumor cells might directly influence adipocyte behavior. An alternative mechanism might be adipocytes themselves as the source of autocrine signals that induce the CAAs phenotype. In favor of the latter hypothesis, we showed that tumor CM was not able to reproduce CAAs phenotype, suggesting that either adipocyte factors or inducible factors in tumor cells are necessary to observe this effect (Supplementary Fig. S6). Adipocyte IL-6 plays a key role in mediating adipocytedependent invasive activity of tumor cells Our results show that IL-6 is overexpressed in tumorsurrounding adipocytes both in vitro and in vivo. We showed Cancer Research Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. Key Role of Mature Adipocytes in Breast Cancer Progression Figure 4. Adipocytes cocultivated with breast tumor cells undergo extensive phenotypic changes. A, left, mature murine adipocytes cocultivated in the presence (C) or absence (NC) of ZR 75.1 tumor cells were stained with red oil. Right, the TG content was dosed in adipocytes. B, adipocytes were cocultivated in the presence (C) or absence (NC) of ZR 75.1 tumor cells. After 3 days, mRNAs were extracted and expression of the indicated genes was analyzed by qPCR. C, dosage of the indicated murine secreted factors in the supernatants of adipocytes grown alone (NC) or in the presence of breast tumor cells (C). that IL-6 (at 10 ng/mL, a dose equivalent to the levels secreted by CAAs, Fig. 4C) significantly increased the invasive capacities in ZR 75.1 and 67NR cells (Fig. 6A, P < 0.01 for the 2 cell lines). As compared with untreated cells, the epithelial-like ZR 75.1 cells exposed to IL-6 form less compacted colonies and exhibit a more scattered aspect (Fig. 6B). A downregulation of membrane E-cadherin expres- www.aacrjournals.org sion resulting into a disorganized state in the cytoplasm, in association with b-catenin redistribution (Fig. 6B), was observed in treated cells in accordance with the literature (33–35). Strikingly, when ZR 75.1 cells were cocultivated with adipocytes in the presence of murine IL-6 blocking antibody, the adipocyte proinvasive effect was significantly decreased (Fig. 6C, P < 0.01). mIL-6 blocking antibody specifically Cancer Res; 71(7) April 1, 2011 Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. 2461 Dirat et al. Figure 5. CAAs from human breast tumor exhibit extensive phenotypic changes in accordance with the in vitro coculture assays. A, top, histologic examination of an invasive breast tumor after H&E staining (original magnification 200). Ad, adipose tissue; IF, invasive front; C, tumor center. Bottom, histologic magnification of the invasive front of the tumor. Note that the number and the size of adipocytes were reduced (adipocytes of smaller size are indicated by arrows). B, the expression of APN (i and ii), MMP11 (iii and iv), and IL-6 (v and vi) was visualized (in brown) in adipocytes (lipids in white, nucleus in blue) located adjacent to invading cancer cells (right) as compared with normal adipose tissue (left). Arrows indicate the expression of proteins of interest within the rim of cytoplasm of adipocytes. C, top, the expression of the indicated genes was analyzed by qPCR in mature adipocytes obtained from RM or TU (14 independent samples per group). Bottom, similar experiments were done with the SVF of the samples. D, the expression of IL-6 was measured as a function of tumor characteristics. G, grade; IDC, invasive ductal carcinoma; ILC, invasive lobular carcinoma; N, lymph node involvement. inhibits the proinvasive effect of CAA-CM in both 67NR and 4T1 models and had no effect on the invasive capacities of cells grown in control medium (Fig. 6D, P < 0.01 and P < 0.05, respectively). Altogether, these results indicate that IL-6 plays a key role in the CAAs proinvasive effects. In breast cancer patients, the extent of the increase in serum IL-6 correlates with poor disease outcome and reduced prognosis (36). Recent evidence shows that fibroblast-derived IL-6 supports breast tumor growth and metastasis (37). Our results show that the stromal IL-6 is also produced by mature adipocytes surrounding the tumors. The absence of IL-6 overexpression in the SVF of human adipose tissue isolated 2462 Cancer Res; 71(7) April 1, 2011 from breast tumor biopsies (Fig. 5C) apparently contradicts a recent study conducted ex vivo, and not in vivo, using human adipose tissue–derived stromal cells cocultivated with tumor cells (38). Our results obtained in human tumors suggest that within the cellular complexity of the adipose tissue, the crosstalk with tumor cells is rather established with mature, than with precursors, adipose cells (Fig. 5C and D). In addition, because mature adipocytes are the most abundant cells in the breast tumor stroma (3), their cumulative secretion of IL-6 could therefore have profound impact on tumor progression. Finally, this work paves the way for future clinical and cellular studies aimed at determining the impact of this Cancer Research Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. Key Role of Mature Adipocytes in Breast Cancer Progression Figure 6. IL-6 is involved in the adipocyte-driven proinvasive effect. A, ZR 75.1 and 67NR cells were cultivated either alone (NT) or in the presence of IL-6, and after 3 days, they were harvested to conduct Matrigel assays in a medium containing either 0 or 10% serum. B, similarly treated ZR 75.1 cells were fixed and stained with the indicated antibodies. Nuclei were labeled with TO-PRO3; scale bars, 40 mmol/L. C, ZR 75.1 were cocultivated for 3 days in the presence (C) or absence (NC) of murine adipocytes. As indicated, blocking antibody directed against murine IL-6 (aIL-6) or control antibody (IgG) was added in the culture medium. Tumor cells were then harvested to conduct Matrigel invasion assays in a medium containing 10% FCS. D, 67NR and 4T1 cells were cultivated in normal medium (control), normal medium containing control immunoglobulin (control þ IgG), or blocking antibody directed against murine IL-6 (control þ aIL-6) conditioned medium obtained from adipocytes previously grown in the presence of tumor cells (CAA-CM), CAA-CM containing control (CAA-CM þ IgG), or IL-6 blocking antibody (CAA-CM þ aIL-6). After 3 days, tumor cells were harvested to conduct Matrigel invasion assay in a medium containing either 0% or 10% FCS. cross-talk in obesity conditions. Indeed, our results suggest that the cross-talk between the CAAs and tumor components might be amplified in obesity in which the normal balance of adipose tissue secretory proteins is disturbed. www.aacrjournals.org Obesity is related to a condition of low chronic inflammation characterized by the abnormal production of inflammatory cytokines involved in insulin resistance (5). Obesity and the now-defined profile of CAAs share inflammation as common Cancer Res; 71(7) April 1, 2011 Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. 2463 Dirat et al. traits, including overexpression of IL-6 with the noticeable absence of overexpression of TNF-a in CAAs (Fig. 5). Interestingly, the association of high levels of IL-6 in CAAs with high tumor size and enhanced local invasion reflects those traits present in obese patients (10, 16, 17). Therefore, CAAs within a context of obesity should be more prone to amplify the negative cross-talk with tumor cells that we have identified and characterized in this study. This is a hypothesis that remains to be shown in both murine and human models. Such studies will provide unique opportunities to set up specific strategies for the treatment of the subsets of patients exhibiting aggressive diseases. Disclosure of Potential Conflicts of Interest No potential conflicts of interest were disclosed. Acknowledgments The authors thank Sandrine Imbert for her excellent technical assistance, Sandra Gres for qPCR primer design, the Anexplo-Phenotypage platform, IFR150, in Toulouse for Luminex analysis, and all our colleagues from I2MR and IPBS for critical reading of the manuscript. Grant Support The "Canceropole Grand Sud-Ouest", INCA (P. Valet, C. Muller, and G. Escourrou), the "Ligue Nationale Contre le Cancer (Comite "Midi-Pyrenees, Gers et du Lot" to C. Muller), and the radioprotection Committee of EDF (C. Muller) supported this work. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received September 10, 2010; revised January 13, 2011; accepted January 20, 2011; published online April 1, 2011. References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 2464 Mueller MM, Fusenig NE. Friends or foes—bipolar effects of the tumour stroma in cancer. Nat Rev Cancer 2004;4:839–49. Joyce JA, Pollard JW. Microenvironmental regulation of metastasis. Nat Rev Cancer 2009;9:239–52. Wiseman BS, Werb Z. Stromal effects on mammary gland development and breast cancer. Science 2002;296:1046–9. Schafer M, Werner S. Cancer as an overhealing wound: an old hypothesis revisited. Nat Rev Mol Cell Biol 2008;9:628–38. Rajala MW, Scherer PE. Minireview: The adipocyte—at the crossroads of energy homeostasis, inflammation, and atherosclerosis. Endocrinology 2003;144:3765–73. Iyengar P, Espina V, Williams TW, Lin Y, Berry D, Jelicks LA, et al. Adipocyte-derived collagen VI affects early mammary tumor progression in vivo, demonstrating a critical interaction in the tumor/stroma microenvironment. J Clin Invest 2005;115:1163– 76. Vona-Davis L, Rose DP. Adipokines as endocrine, paracrine, and autocrine factors in breast cancer risk and progression. Endocr Relat Cancer 2007;14:189–206. Andarawewa KL, Motrescu ER, Chenard MP, Gansmuller A, Stoll I, Tomasetto C, et al. Stromelysin-3 is a potent negative regulator of adipogenesis participating to cancer cell-adipocyte interaction/ crosstalk at the tumor invasive front. Cancer Res 2005;65:10862– 71. Calle EE, Kaaks R. Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms. Nat Rev Cancer 2004;4:579– 91. Majed B, Moreau T, Senouci K, Salmon RJ, Fourquet A, Asselain B. Is obesity an independent prognosis factor in woman breast cancer?Breast Cancer Res Treat 2008;111:329–42. Dirat B, Bochet L, Escourrou G, Valet P, Muller C. Unraveling the obesity and breast cancer links: a role for cancer-associated adipocytes? Endocr Dev 2010;19:45–52. Carmichael AR. Obesity and prognosis of breast cancer. Obes Rev 2006;7:333–40. Stephenson GD, Rose DP. Breast cancer and obesity: an update. Nutr Cancer 2003;45:1–16. Feigelson HS, Patel AV, Teras LR, Gansler T, Thun MJ, Calle EE. Adult weight gain and histopathologic characteristics of breast cancer among postmenopausal women. Cancer 2006;107:12–21. Maehle BO, Tretli S, Skjaerven R, Thorsen T. Premorbid body weight and its relations to primary tumour diameter in breast cancer patients; its dependence on estrogen and progesteron receptor status. Breast Cancer Res Treat 2001;68:159–69. Berclaz G, Li S, Price KN, Coates AS, Castiglione-Gertsch M, Rudenstam CM, et al. Body mass index as a prognostic feature in operable breast cancer: the International Breast Cancer Study Group experience. Ann Oncol 2004;15:875–84. Cancer Res; 71(7) April 1, 2011 17. Daniell HW, Tam E, Filice A. Larger axillary metastases in obese women and smokers with breast cancer—an influence by host factors on early tumor behavior. Breast Cancer Res Treat 1993; 25:193–201. 18. Buschemeyer WC III, Freedland SJ. Obesity and prostate cancer: epidemiology and clinical implications. Eur Urol 2007;52:331–43. 19. Meulle A, Salles B, Daviaud D, Valet P, Muller C. Positive regulation of DNA double strand break repair activity during differentiation of long life span cells: the example of adipogenesis. PLoS One 2008;3: e3345. 20. Masson O, Chavey C, Dray C, Meulle A, Daviaud D, Quilliot D, et al. LRP1 receptor controls adipogenesis and is up-regulated in human and mouse obese adipose tissue. PLoS One 2009;4:e7422. 21. Aslakson CJ, Miller FR. Selective events in the metastatic process defined by analysis of the sequential dissemination of subpopulations of a mouse mammary tumor. Cancer Res 1992;52:1399–405. 22. Neve RM, Chin K, Fridlyand J, Yeh J, Baehner FL, Fevr T, et al. A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell 2006;10:515–27. 23. Daviaud D, Boucher J, Gesta S, Dray C, Guigne C, Quilliot D, et al. TNFalpha up-regulates apelin expression in human and mouse adipose tissue. FASEB J 2006;20:1528–30. 24. Monferran S, Paupert J, Dauvillier S, Salles B, Muller C. The membrane form of the DNA repair protein Ku interacts at the cell surface with metalloproteinase 9. EMBO J 2004;23:3758–68. 25. Muller C, Monferran S, Gamp AC, Calsou P, Salles B. Inhibition of Ku heterodimer DNA end binding activity during granulocytic differentiation of human promyelocytic cell lines. Oncogene 2001;20:4373–82. 26. Venables WN, Ripley BD. Modern Applied Statistics with S. 4th ed. New York: Springer; 2002. p. xi, 495 27. Sommers CL, Byers SW, Thompson EW, Torri JA, Gelmann EP. Differentiation state and invasiveness of human breast cancer cell lines. Breast Cancer Res Treat 1994;31:325–35. 28. Green H, Kehinde O. Spontaneous heritable changes leading to increased adipose conversion in 3T3 cells. Cell 1976;7:105–13. 29. Elliott BE, Tam SP, Dexter D, Chen ZQ. Capacity of adipose tissue to promote growth and metastasis of a murine mammary carcinoma: effect of estrogen and progesterone. Int J Cancer 1992;51:416–24. 30. Motrescu ER, Rio MC. Cancer cells, adipocytes and matrix metalloproteinase 11: a vicious tumor progression cycle. Biol Chem 2008;389:1037–41. 31. Bing C, Trayhurn P. Regulation of adipose tissue metabolism in cancer cachexia. Curr Opin Clin Nutr Metab Care 2008;11:201–7. 32. Harp JB. New insights into inhibitors of adipogenesis. Curr Opin Lipidol 2004;15:303–7. 33. Sullivan NJ, Sasser AK, Axel AE, Vesuna F, Raman V, Ramirez N, et al. Interleukin-6 induces an epithelial-mesenchymal transition phenotype in human breast cancer cells. Oncogene 2009;28:2940–7. Cancer Research Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. Key Role of Mature Adipocytes in Breast Cancer Progression 34. Arihiro K, Oda H, Kaneko M, Inai K. Cytokines facilitate chemotactic motility of breast carcinoma cells. Breast Cancer 2000;7:221–30. 35. Sansone P, Storci G, Tavolari S, Guarnieri T, Giovannini C, Taffurelli M, et al. IL-6 triggers malignant features in mammospheres from human ductal breast carcinoma and normal mammary gland. J Clin Invest 2007;117:3988–4002. 36. Knupfer H, Preiss R. Significance of interleukin-6 (IL-6) in breast cancer [review]. Breast Cancer Res Treat 2007;102:129–35. www.aacrjournals.org 37. Studebaker AW, Storci G, Werbeck JL, Sansone P, Sasser AK, Tavolari S, et al. Fibroblasts isolated from common sites of breast cancer metastasis enhance cancer cell growth rates and invasiveness in an interleukin-6-dependent manner. Cancer Res 2008;68: 9087–95. 38. Walter M, Liang S, Ghosh S, Hornsby PJ, Li R. Interleukin 6 secreted from adipose stromal cells promotes migration and invasion of breast cancer cells. Oncogene 2009;28:2745–55. Cancer Res; 71(7) April 1, 2011 Downloaded from cancerres.aacrjournals.org on July 9, 2013. © 2011 American Association for Cancer Research. 2465 ARTICLE II: Adipocyte-Derived Fibroblasts promote tumor progression and contribute to the desmoplastic reaction in breast cancer (Bochet et al, 2013, Cancer Res) 92 Cancer Research Microenvironment and Immunology Adipocyte-Derived Fibroblasts Promote Tumor Progression and Contribute to the Desmoplastic Reaction in Breast Cancer de 1,2,3, Ste phanie Dauvillier1,2, Yuan Yuan Wang1,2,3, Be atrice Dirat1,2,3, Ludivine Bochet1,2,3, Camille Lehue 1,2 1,3 1,2 1,2 dric Dray , Romain Guiet , Isabelle Maridonneau-Parini , Sophie Le Gonidec1,3, Victor Laurent , Ce 4 Bettina Couderc , Ghislaine Escourrou5, Philippe Valet1,3, and Catherine Muller1,2 Abstract Cancer-associated fibroblasts (CAF) comprise the majority of stromal cells in breast cancers, yet their precise origins and relative functional contributions to malignant progression remain uncertain. Local invasion leads to the proximity of cancer cells and adipocytes, which respond by phenotypical changes to generate fibroblast-like cells termed as adipocyte-derived fibroblasts (ADF) here. These cells exhibit enhanced secretion of fibronectin and collagen I, increased migratory/invasive abilities, and increased expression of the CAF marker FSP-1 but not a-SMA. Generation of the ADF phenotype depends on reactivation of the Wnt/b-catenin pathway in response to Wnt3a secreted by tumor cells. Tumor cells cocultivated with ADFs in two-dimensional or spheroid culture display increased invasive capabilities. In clinical specimens of breast cancer, we confirmed the presence of this new stromal subpopulation. By defining a new stromal cell population, our results offer new opportunities for stroma-targeted therapies in breast cancer. Cancer Res; 73(18); 5657–68. 2013 AACR. Introduction One of the features of breast cancer is the presence of a dense collagenous stroma, the so-called desmoplastic response, comprising of fibroblast-like cells known as cancer-associated fibroblasts (CAF; ref. 1). Accumulating experimental evidence has shown that CAFs play an active role in breast cancer progression through the release of growth factors and chemokines and by contributing to the remodeling of the extracellular matrix (for review see refs. 2–4). CAFs are "activated" fibroblasts and were first identified upon morphologic criteria and a-smooth muscle actin (a-SMA) expression, in the same manner as wound-healing myofibroblasts (5). However, this marker is not ubiquitous, highlighting that CAFs is a heterogeneous cell population (6). Indeed, CAFs are alternatively reported to stem from resident local fibroblasts, bone marrow– derived progenitor cells, or trans-differentiating epithelial/ endothelial cells (for review, see refs. 4, 7). At present, neither de Toulouse, UPS; 2CNRS; Institut de Authors' Affiliations: 1Universite et Pharmacologie et de Biologie Structurale; 3Institut National de la Sante dicale, INSERM U1048; 4Institut Claudius Regaud, de la Recherche Me ^ pital de Rangueil, TouEA3035; and 5Service d'Anatomo-Pathologie, Ho louse, France Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). de contributed equally to this work. L. Bochet and C. Lehue Corresponding Author: Catherine Muller, Institut de Pharmacologie et de Biologie Structurale, 205 route de Narbonne, 31077 Toulouse Cedex, France. Phone: 33-56117-5932; Fax: 33-56117-5994; E-mail: [email protected] doi: 10.1158/0008-5472.CAN-13-0530 2013 American Association for Cancer Research. www.aacrjournals.org the origin of these cells, nor the extent to which their origin determines their contribution to tumor progression can be unanimously agreed upon. We have recently shown that invasive cancer cells have a dramatic impact on surrounding adipocytes. Both in vitro and in vivo, these adipocytes exhibit a decrease in lipid content, a decreased expression of adipocyte markers, and an activated state indicated predominantly by the overexpression of proinflammatory cytokines (8). These cells are present in vivo at the tumor invasive front and retain an adipocyte-like rounded morphology. We named them cancer-associated adipocytes (CAA; reviewed in refs. 8–10). CAAs also display overexpression of extracellular matrix (ECM, such as collagen VI) and ECMrelated molecules (11–13), events contributing to breast cancer progression. As the origin of CAFs is unclear, one attractive hypothesis is that during tumor evolution, peritumoral adipocytes undergo "dedifferentiation", first into CAAs then into fibroblast-like cells that may account for a part of the CAFs population present in the desmoplastic reaction of breast cancers. Although suggested in several reviews (14, 15), this hypothesis has never been directly shown experimentally using combined in vitro and in vivo approaches. Independent of the effect of cancer cells, several recent studies have shown that mature adipocytes are in fact plastic cells capable of "dedifferentiation" towards fibroblast-like cells (16). Although limited data exists on the mechanisms that could potentially be involved in this effect, the role of soluble factors such as TNF-a, Wnt3a (17), or specific mitochondrial uncoupling (18) has been described. In vitro, recombinant MMP-11 is also able to "dedifferentiate" mature adipocytes (11). However, the existence of this phenomenon in human pathology remains elusive. In the present study, we use both in vitro and in vivo (including human 5657 Bochet et al. tumors) approaches to show that breast cancer cells are able to force mature adipocytes towards fibroblast-like cells, named adipocyte-derived fibroblasts (ADF), in a Wnt-dependent manner. We also extensively describe the distinctive phenotype of these new stromal cells, expressing some CAFs markers like fibroblast-specific protein 1/S100A4, but not a-SMA, and underline their ability to promote the spread of breast cancer cells. Materials and Methods Antibodies, probes, and drugs All the primary antibodies used in this study are presented in Supplementary Table S1. The Wnt/b-catenin inhibitor, ICG001 (19) was from Enzo Life Sciences and was used at 2.5 and 5 mmol/L final concentrations. The bodipy lipid probe (used at 1 mg/mL) and TO-PRO-3 (used at 1 mmol/L final concentration) were obtained from Invitrogen. Cell culture, cell lines, and isolation of primary adipocytes The murine 3T3-F442A preadipocytes cell line was differentiated as previously described (20). To estimate the adipocyte phenotype, triglyceride content was quantified using a colorimetric kit (Wako Chemicals) and Red Oil staining was conducted as previously described (20). The murine 4T1 breast cancer cell line (provided by Dr. S. Vagner, INSERM U563, Toulouse, France) was cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 5% fetal calf serum (FCS). The human breast cancer cell line SUM159PT (provided by Dr. J Piette, IGMM, Montpellier, France) was grown in Ham F12 (50:50) medium complemented with 5% FCS, 1 mg/mL hydrocortisone (Sigma), and 0.2 UI/mL insulin. All the cell lines were used within 2 months after resuscitation of frozen aliquots. Cell lines were authenticated on the basis of viability, recovery, growth, and morphology. The expression status of E-cadherin, N-cadherin, and vimentin using immunofluorescence approaches, as well as their invasive behavior, was confirmed before they were used in the experiments (8). Coculture of tumor cells and adipocyte was carried out using a Transwell culture system (0.4 mm pore size, Millipore) as previously described (8). In certain experiments, cells genetically modified by lentiviral vectors encoding either eGFP (Genethon, Evry; 3T3-F442A) or Hc-Red (vector core ICR; SUM159PT) were used. The isolation of mammary adipocytes either from tumor or reduction mammoplasty was carried out as previously described by our group (8). In vivo GFP-subcutaneous fat pad formation and tumor injection A total of 1 107 confluent GFP-3T3-F442A preadipocytes were injected into the flank of athymic nude mice, as described (21). Fat pad formation was allowed to proceed for 5 weeks, after which fat pads were injected with 4 104 4T1 breast cancer cells. Mice with fat pad alone or tumor cells alone were used as controls. Five mice were used in each group. After 10 days, mice were sacrificed and fat pad, tumors, and fat pads containing tumors were embedded in paraffin after 48 hours of 5658 Cancer Res; 73(18) September 15, 2013 fixation in buffered formalin. The local Institutional Animal Care and Use Committee approved the experimental protocol used in our study. Immunofluorescence and immunohistochemistry Adipocytes differentiated on coverslips grown alone, or cocultivated for the indicated times with breast cancer cells were processed for immunofluorescence as previously described (8). Fluorescence images were acquired with a confocal laser microscopy system (Leica SP2). The image resolution was 512 512 pixels and scan rate was 400 Hz. For each sample, more than 100 cells were examined in at least three independent experiments. Immunohistochemistry was conducted as previously described (11). Adjacent sections were stained with hematoxylin and eosin or Masson trichrome to visualize collagen fibers (murine fat pad experiments). Images were captured on a Leica DMRA2. Western blot analysis Whole-cell extracts and immunoblots were prepared as previously described (22). All the antibodies used in this study are presented in Supplementary Table S1. RNA extraction and quantitative PCR RNA extraction and quantitative PCR (qPCR) were conducted as previously described (23). All the primers used in this study are presented in the Supplementary Table S2. Migration and invasion assays (two-dimensional) After 3 or 8 days of coculture in the presence of SUM159PT cells, adipocytes were trypsinized and used to conduct migration or Matrigel invasion assays as previously described (23). Similar Matrigel invasion assays were conducted with tumor cells grown alone or cocultivated with ADFs or with mature adipocytes during 3 days (8). In these assays, FCS (10%) was used as a chemoattractant, and similar experiments were run in parallel in the absence of serum (no chemoattractant, negative control). Spheroids formation and invasion in a threedimensional collagen matrix The hanging-drop method has been adapted to produce spheroids of similar diameter (24). Drops (20 mL) containing 1,000 tumor cells alone or mixed with 1,000 ADFs or preadipocytes were suspended on the lid of 2% agar-coated 24-well dishes containing culture media. After the 7 days required for cell aggregation, the spheroids were transferred to the bottom of a well containing culture medium. Multicellular spheroids were then allowed to grow for 14 days and the spheroids used in the invasion experiments had an average diameter of 500 mm. The spheroid invasion in collagen I matrix was conducted as previously described (25). Glucose uptake experiments Differentiated adipocytes cocultivated or not during 3 and 8 days with SUM159PT cells were used to measure the uptake of 2-deoxy[3H]glucose in the presence or not of insulin as previously described (26). Cancer Research ADF, a Novel Tumor-Promoting Cell Type Statistical analysis The statistical significance of differences (at least three independent experiments) was evaluated using Student t test or ANOVA using Prism (GraphPad Inc.). P values less than 0.05 ( ), 0.01, ( ), and 0.001 ( ) were deemed as significant while "NS" stands for not significant. Results and Discussion Breast tumor cells are able to cause mature adipocytes to revert to fibroblast-like cells in vitro and in vivo To test our main hypothesis in vitro, we took advantage of the coculture model recently set up in our laboratory. As previously described, mature 3T3-F442A adipocytes cocultivated in the presence of breast cancer cells exhibited a decrease in the number and size of lipid droplets (8). We show here that this decrease is time-dependent and, after 8 days of coculture, these cells were almost devoid of lipid droplets (Fig. 1A, top). In contrast with CAAs (typically obtained after 3 days of coculture), which retain their rounded morphology (8), adipocytes that have been cocultivated for longer times in the presence of tumor cells took on a highly elongated, fibroblastic shape (Fig. 1A, middle). Preadipocyte factor 1 (Pref-1) expression, a preadipocyte transmembrane protein that inhibits adipogenesis (27), is progressively detected in cocultivated adipocytes (Fig. 1A, bottom). After 8 days of coculture, we also observed that mature adipocytes exhibit a loss in adipose markers expression that was more accentuated than in CAAs (8). An overall dramatic reduction of all the tested adipogenic markers including Adipisin, Adiponectin (APN), Ap2, HSL, as well as C/EBPa and PPARg2 mRNA was observed by qPCR analysis (reduced by more than 70% for all tested genes, P < 0.001, Fig. 1B). These results were confirmed by Western blots for HSL, Adiponectin, PPARg2, and C/EBPa expression, whose expression was no longer detected in cocultivated adipocytes (Supplementary Fig. S1A). Similar results were obtained by cocultivating adipocytes with the human ZR 75.1, HMT3522-T4.2 or mouse 4T1 breast cancer cell lines (Supplementary Fig. S1B), as well as when human mammary adipocytes derived from ex-vivo differentiation of progenitors, purified from mammary adipose tissue of healthy donors undergoing reduction mammoplasty, were used (Supplementary Fig. S1C). At 8 days, cocultivated Figure 1. Breast cancer cells revert mature adipocytes into fibroblast-like cells in vitro. A, mature adipocyte cultivated in the presence (C) or in the absence (NC) of tumor cells during the indicated times were stained with Bodipy (top), Pref-1 antibody (bottom; scale bars, 20 mm), or observed through phase contrast microscopy (middle; scale bar, 50 mm). Nuclei were labeled with TO-PRO-3. Similar experiments were conducted with 3T3-F442A preadipocytes used as a control. B, expression of the indicated genes analyzed by qPCR in mature adipocytes cocultivated for 8 days in the presence (C) or in the absence (NC) of SUM159PT tumor cells. C, GLUT4 and GLUT1 gene expression in mature adipocytes cultivated in the presence (C) or in the absence (NC) of SUM159PT cells during the indicated times (left). Analysis of Glut1 and Glut4 protein expression was done by Western blot analysis with extracts from mature adipocytes cultivated in the presence (þ) or in the absence () of SUM159PT cells for the indicated times (right). D, glucose uptake assay in the presence of the increasing concentrations of insulin conducted in adipocytes cultivated in the presence (C) or in the absence (NC) of tumor cells during 3 and 8 days. Bars and errors flags represent the means SD of at least three independent experiments; statistically significant by Student t test; , P < 0.01; , P < 0.001 relative to NC cells or to untreated cells for glucose uptake experiments. www.aacrjournals.org Cancer Res; 73(18) September 15, 2013 5659 Bochet et al. adipocytes exhibited a marked decrease in GLUT4 expression and a concomitant increase in GLUT1 expression (Fig. 1C) and became resistant to insulin (Fig. 1D). No gain of proliferative ability was observed in these cocultivated adipocytes exhibiting insulin resistance and a fibroblast-like shape. Indeed, the cell number, as well as the cell-cycle distribution, remained unchanged during the coculture period (see Supplementary Fig. S2). We next investigated whether this process might be observed in vivo. To address this critical issue, we used GFP-tagged confluent 3T3-F442A preadipocytes implanted subcutaneously into athymic BALB/c nude mice, where they developed into typical fat pads after 5 weeks (21). Murine breast cancer cells 4T1 were then either injected into the newly formed fat pads or used alone as a control, whereas untreated fat pads also provided a separate control. Immunohistochemical staining for GFP was conducted in fat pads removed 10 days after the injection (Fig. 2A). Tagged-mature adipocytes were used to ensure that the cells with a fibroblast-like shape present in the tumors did in fact arise from local adipocytes and not from other sources. The fat pads derived from 3T3-F442A–confluent preadipocytes exhibited histologic features of adipose tissue. Adipocytes were positive for GFP whereas tumor cells were not (Fig. 2B, bottom). In the case of tumors injected into the fat pads, adipose tissue at the tumor periphery was composed of adipocytes of small size and elongated cells containing many small lipid droplets—all cells that are GFP positive (Fig. 2B, bottom, indicated by arrows). Within the tumor, GFP-positive cells with fibroblast-like shape appear to interdigitate with tumor cells (Fig. 2B, bottom, indicated by asterisks). Staining of the tissue sections with Masson trichrome revealed a significant amount of collagen fibrils in the tumor grown within the fat pad, whereas few collagen fibrils were seen in tumor grown alone (Fig. 2B, top). Taken together, these results are consistent with the fact that breast tumor cells induce phenotypical changes in mature adipocytes, leading to cells exhibiting low (if any) lipid content and profound morphologic changes associated with a marked increase in the expression of matrix proteins in the tumors. Therefore, our results compellingly suggest that cells with a fibroblast-like shape could be derived from mature adipocytes in a tumor-context both in vitro and in vivo. ADFs overexpress FSP-1, but not aSMA, and exhibit an activated phenotype We then investigated the expression of major markers, previously used to identify CAFs in these cells (6). As shown in Fig. 3A, adipocytes cocultivated with tumor cells exhibit a gradual increase in FSP-1 expression, as opposed to a-SMA or FAP expression that remains very low. We confirmed that mature adipocytes cocultivated for 8 days with tumor cells overexpressed FSP-1 mRNA by 3-fold, compared with mature adipocytes grown alone (P < 0.01), whereas the difference in mRNA levels of a-SMA between these two conditions was not statistically significant (Fig. 3B). These results were confirmed with human mammary adipocytes (Supplementary Fig. S3). Functionally activated fibroblasts surrounding tumors are highly contractile and motile and also display increased ECM 5660 Cancer Res; 73(18) September 15, 2013 expression (3). As shown in Fig. 3C, increased expression of the ECM proteins, type I collagen and fibronectin, was also observed during adipocyte conversion. The fibrotic network produced by these cells in vitro is in accordance with the results obtained with Masson trichrome staining in vivo (see Fig. 2). As shown in Fig. 3D (top), coculture of adipocytes with tumor cells was associated with a profound reorganization of actin cytoskeleton, marked by the occurrence of stress fibers and the formation of punctuate spots of vinculin at the ends of actin bundles. Accordingly, cocultivated adipocytes, as they acquire a fibroblast-like phenotype, progressively exhibit increased migratory (Fig. 3D, bottom left) and invasive (Fig. 3D, bottom right) abilities. Therefore, our compelling results show that tumor cells can cause mature 3T3-F442A adipocytes, as well as human mammary adipocytes, to revert to an activated FSP-1 fibroblastic cell population. Because of the common characteristics of CAFs and these cells, highlighting that they represent a subpopulation of CAFs, we named them ADFs. In vitro, the CAA to ADF transition is time dependent (Figs. 1 and 3) and intermediate forms of adipocyte phenotypical changes (from small adipocytes to fibroblast-like cells that may or may not still contain small lipid droplets) could be observed in vitro and in vivo (Figs. 1 and 2). Once modified at the tumor invasive front, where the cross-talk between breast tumor and adipocytes is established (8), our data strongly suggests that ADFs are able to join the center of the tumor and participate in the desmoplastic reaction by exhibiting increased migratory and invasive abilities (Fig. 3), as shown in the murine fat pad experiments (Fig. 2). The Wnt/b-catenin pathway is reactivated in ADFs and contributes to the occurrence of the ADFs phenotype Among the many signaling networks involved in relaying information from extracellular signals during adipogenesis, the Wnt/b-catenin pathway plays a prominent role (28). This pathway negatively regulates precursors' commitment and differentiation along the adipocyte lineage (28) and its activation has recently been shown to also induce a "dedifferentiated" state in mature adipocytes (17). As shown in Fig. 4A (top), adipocytes cocultivated with tumor cells exhibit a gradual increase in b-catenin expression, associated with its redistribution from the cell membrane to the cytoplasm. During activation of this pathway by Wnt ligands (the so-called canonical pathway), the b-catenin is hypophosphorylated and translocated into the nucleus where it contributes to the activation of Wnt target genes (28). A progressive increase in active b-catenin in the nucleus of cocultivated adipocytes was detected (Fig. 4A, bottom). In accordance, cocultivated adipocytes exhibit an upregulation of all Wnt target gene mRNAs analyzed as described for Dishevelled-1 (Dvl1), Wnt10b, Endothelin-1 (EDT1), and metalloprotease-7 (MMP7; Fig. 4B). Taken together, our results show that the canonical Wnt/b-catenin pathway is reactivated during coculture and is likely to contribute to the occurrence of the ADFs. Given our results, we reasoned that targeted inhibition of this signaling using ICG001, a unique small molecule that selectively inhibits TCF/ b-catenin transcription in a CBP-dependent fashion (19) might be able to mitigate the tumor-induced changes in adipocytes. Cancer Research ADF, a Novel Tumor-Promoting Cell Type Figure 2. The phenotypic changes of mature adipocytes towards fibroblast-like cells are observed in vivo. A, GFP-tagged confluent 3T3-F442A preadipocytes were implanted subcutaneously into athymic BALB/c nude mice, where they develop into fat pads after 5 weeks. Murine breast cancer cells 4T1 were then injected into the newly formed fat pads or assayed separately. Immunohistochemical staining for GFP was conducted in fat pads removed 10 d after the injection, tumor cells alone being also used as a control. B, representative Masson trichrome–stained sections from fat pads alone, tumors grown alone, or tumors grown into the fat pads with collagen stained in blue and nucleus in red (top). Representative images of the expression of GFP (brown) visualized in fat pads alone, tumors grown alone, or tumors grown into the fat pads (lipids, white; nucleus, blue; middle). Arrows indicate GFP-positive elongated cells with small lipid droplets present at the tumor periphery, whereas asterisks identify GFP-fibroblast–like cells within the tumor; scale bars, 50 mm. The bottom panel shows a two-fold magnified view of the framed areas. As shown in Fig. 4C, exposure to ICG-001 for 3 days significantly inhibits the increase in Wnt10b expression induced by coculture (about 3-fold decrease in 5 mmol/L ICG-001–treated cells compared with untreated cells, P < 0.05) and partially restores lipid accumulation in cocultivated adipocytes in a dose-dependent manner. We next investigated the signal emanating from tumor cells that could have reactivated the www.aacrjournals.org canonical Wnt/b-catenin pathway. Soluble Wnt3a or TNF-a has been recently shown to induce the "dedifferentiation" of murine and human adipocytes through activation of the Wnt/ b-catenin pathway (17). TNF-a was undetectable in the supernatant of all breast cancer cell lines that were cultivated with or without adipocytes. In contrast, Wnt3a was expressed and secreted by the breast cancer cells, as shown in Fig. 4D for the Cancer Res; 73(18) September 15, 2013 5661 Bochet et al. Figure 3. ADFs overexpress FSP-1, but not a-SMA, and exhibit an activated phenotype. A, 3T3-F442A mature adipocytes were grown on coverslips and cultivated in the presence (C) or in the absence (NC) of tumor cells during 3, 5, and 8 days (D3, D5, and D8). After this period, cells were fixed and stained with the indicated antibodies. 3T3-F442A preadipocytes served as a control. Nuclei were labeled with TO-PRO-3; scale bars, 20 mm. B, a-SMA and FSP-1 gene expression was evaluated by qPCR in adipocytes cultivated in the presence (C) or in the absence (NC) of tumor cells during 8 days with tumor cells. Bars and errors flags represent the means SEM of at least three independent experiments; statistically significant by Student t test, , P < 0.01 relative to NC cells. NS, non significant. C, fibronectin and collagen 1 expression were assessed by immunofluorescence in adipocytes cultivated in the presence (C) or in the absence (NC) of tumor cells during 3, 5, and 8 days (D3, D5, and D8). 3T3-F442A preadipocytes served as a control. Nuclei were labeled with TO-PRO-3; scale bars, 20 mm. D, top, 3T3-F442A mature adipocytes were grown on coverslips and cultivated in the presence (C) or in the absence (NC) of tumor cells during 3, 5, and 8 days (D3, D5, and D8). After this period, cells were fixed and stained with the indicated antibodies. 3T3-F442A preadipocytes served as a control. Nuclei were labeled with TO-PRO-3; scale bars, 20 mm. Bottom, adipocytes grown alone (NC) or in the presence of tumor cells (C) for 3 (D3) and 8 (D8) days. Adipocytes were then trypsinised and used for migration (left) or Matrigel invasion (right) assays towards a medium containing either 0% (white bars) or 10% FCS (black bars). Bars and errors flags represent the means SEM of three independent experiments; statistically significant by Student t test; , P < 0.05, , P < 0.01, , P < 0.001 relative to NC cells. SUM159PT cells. The levels of Wnt3a expression and secretion were not regulated by coculture. Similar results were obtained with the human breast cancer cell lines ZR 75.1 and MDAMB231 (Supplementary Fig. S4). As shown in Fig. 4E (left), in the presence of Wnt3a blocking antibody, we observe a clear inhibition of b-catenin upregulation and redistribution induced by coculture, suggesting that Wnt3a is indeed upstream of the b-catenin stabilization. Of note, cells that have been treated with Wnt3a blocking antibody exhibit a significant decrease of Wnt10b mRNA expression (1.6-fold decrease in antibody-treated cells compared with untreated cells, P < 0.05) and conversely, an increase in lipid content as compared with untreated cells (Fig. 4E, right). Therefore, the occurrence of ADFs is 5662 Cancer Res; 73(18) September 15, 2013 associated with activation of the Wnt/b-catenin pathway and blocking this pathway partially reversed the ADFs phenotype (Fig. 4C and E). Elevated levels of cytoplasmic and/or nuclear b-catenin are detectable by immunohistochemistry in the majority of breast tissue samples and high b-catenin activity significantly correlated with poor prognosis of the patients (29). This activation might rely on Wnt ligands because several studies have described overexpression of Wnt protein themselves, including Wnt3a, in breast cancer cells lines as well as breast tumors relative to normal tissue (30). Expression of these ligands is generally thought to activate the canonical Wnt/b-catenin pathway in tumor cells by an autocrine mechanism (31) to favor tumor growth, migration, inhibition of Cancer Research ADF, a Novel Tumor-Promoting Cell Type Figure 4. The Wnt/b-catenin pathway is reactivated in ADFs and contributes to the occurrence of this new stromal cell population. A, adipocytes cultivated in the presence (C) or in the absence (NC) of tumor cells during 3, 5, and 8 days (D3, D5, D8) and 3T3-F442A preadipocytes were fixed and stained with the indicated antibodies. Nuclei were labeled with TO-PRO-3; scale bars, 20 mm. B, mRNA expression (qPCR) of the indicated Wnt/b-catenin targets was evaluated in adipocytes cultivated in the presence (C) or in the absence (NC) of tumor cells during 3, 5, and 8 days (D3, D5, D8). C, Wnt10b mRNA expression (right) and Bodipy accumulation or morphology observed through phase contrast microscopy (left; scale bars, 20 mm) were evaluated in adipocytes cultivated in the presence (C) or in the absence (NC) of tumor cells for 3 days with tumor cells in the presence of increasing concentrations of ICG-001. D, Wnt3a expression and secretion was measured in the SUM159PT cells cultivated in the presence (C) or in the absence (NC) of adipocytes. E, adipocytes were cultivated in the presence (C) or in the absence (NC) of breast tumor cells in the presence (þ) or absence () of a Wnt3a blocking antibody. In these adipocytes, the expression of Wnt10b mRNA was measured by qPCR (right), and the b-catenin expression and lipid accumulation were evaluated by immunofluorescence. Nuclei were labeled with TO-PRO-3 (left); scale bars, 20 mm. Bars and errors flags represent the means SEM of three independent experiments; statistically significant by Student t test or ANOVA; , P < 0.05, , P < 0.01, , P < 0.001 relative to NC cells. www.aacrjournals.org Cancer Res; 73(18) September 15, 2013 5663 Bochet et al. apoptosis, and potentially stem cell renewal in certain tissues (32). We propose here a new and paracrine effect of Wnt ligands in promoting the occurrence of a subpopulation of CAFs. ADFs stimulate tumor cells' invasive phenotype in twodimensional and three-dimensional coculture systems Mature adipocytes were cocultivated with breast cancer cells for 5 days to obtain ADFs, which were then used to carry out two-dimensional (2D) coculture experiments or to produce mixed spheroids with "na€ve or unprimed" tumor cells. In 2D coculture experiments, ADFs strongly stimulated the invasive properties of SUM159PT cells (increase of 2.4-fold compared with tumor cells grown alone, P < 0.01; Fig. 5A), this effect being more pronounced in the presence of ADFs than in the presence of mature adipocytes (1.5-fold increase as compared with tumor cells grown alone, P < 0.05; 1.6-fold increase in cells cocultivated with ADFs as compared with mature adipocytes, P < 0.05). In addition to the increased cell invasive abilities, we have previously shown that cocultivated SUM159PT exhibit morphologic changes along with the reorganization and polarization of vimentin (8). As shown in Fig. 5B, after 3 days of coculture, ADFs induce similar but more pronounced effects Figure 5. ADFs enhance tumor cells invasion in 2D and 3D coculture models. A, tumor cells cultivated in the presence (C) or in the absence (NC) of mature adipocytes or ADFs for 3 d were used for Matrigel invasion assay toward a medium containing either 0% (white bars) or 10% (black bars) FCS. Representative images of Matrigel invasion assay conducted towards a medium containing 10% FCS are shown below each graph; scale bar, 50 mm. Bars and errors flags represent the means SD of three independent experiments; statistically significant by Student's t test; , P < 0.05, , P < 0.01 relative to NC cells. B, immunofluorescence experiments using monoclonal antibody against vimentin or rhodamin phalloidin were conducted on tumor cells cultivated in the presence (C) or in the absence (NC) of mature adipocytes or ADFs for 3 days. Nuclei were labeled with TO-PRO-3; scale bar, 20 mm. C, a representative picture of spheroid invasion in a collagen matrix [left, scale bar, 250 mm and measurement of the invasion distance (in mm) 48 h after collagen embedding (right)]. Bars and errors flags represent the means SEM of three independent experiments, statistically significant by Student t test; , P < 0.01 relative to spheroids composed by tumor cells alone (SUM), NS, nonsignificant. D, confocal microscopy analysis of spheroids invasion 48 hours after collagen inclusion, spheroids being composed by HcRed-SUM, by mixed HcRed-SUM þ GFP-3T3-F442A, or by HcRed-SUM159PT þ GFP-ADF; scale bar, 100 mm. SUM159PT, SUM. 5664 Cancer Res; 73(18) September 15, 2013 Cancer Research ADF, a Novel Tumor-Promoting Cell Type on vimentin expression that was associated with profound actin reorganization, leading to the occurrence of stress fibers. As three-dimensional (3D) invasion models more closely follow the cell behavior observed in vivo (33), we confirmed our results using a spheroid invasion model within a collagen matrix (25; see Fig. 5C, left, for a representative experiment). We found that mixed ADFs/tumor cells spheroids exhibit higher invasive capacities compared with spheroids of tumor cell alone (P < 0.01), yet the presence of preadipocytes had no effect on 3D tumor cells' invasion (Fig. 5C, right), in accordance with the results previously obtained in 2D (8). HcRed-SUM159PT cells, GFP-preadipocytes, and GFP-ADFs were used to investigate the invasive behavior of each cell subpopulation. Interestingly, ADFs (and preadipocytes) remained in the center of the spheroids in contrast with tumor cells that invaded the collagen matrix (Fig. 5D). These combined results indicate that ADFs stimulate the invasive behavior of tumor cells. Reorientation of mature adipocytes into ADFs is observed in human tumors We next investigated whether ADFs are present in primary human tumors. To address this critical issue, we first conducted a histologic analysis of human breast tumors to investigate the presence of cells exhibiting ADF traits. As defined in vitro and in vivo in murine fat pads, ADFs originate from progressive changes of the morphology of adipocytes, giving rise to small adipocytes and of elongated cells containing many small lipid droplets. As shown in Fig. 6A, we observed a profound reorganization of the adipose tissue at the tumor invasive front (see left for the adipose tissue aspect at distance of the tumors) with numerous cells exhibiting the features of intermediate forms of ADFs. Of note, elongated cells with lipid droplets could be observed within the dense desmoplastic reaction surrounding the tumors (Fig. 6A, bottom, indicated by arrows). Figure 6. ADFs are found in human tumors. A, histologic examination of human breast cancers showing distant adipose tissue (left) and tumor tissue containing reorientated adipocytes (middle) after H&E staining (original magnification, 200; scale bar, 50 mm.). The right panels show a 2-fold magnification of the framed area. Results of representative experiments were obtained using tumors issued from 2 independent donors. B, histologic examination of adipose tissue (lipids, white; nucleus, blue) in a representative breast tumor after anti FSP-1 staining (brown). The results obtained in different areas from the adipose tissue away from the tumor to the tumor center are shown (scale bar, 50 mm). C, left, the expression of FSP-1 and aSMA was visualized (brown) in adipocytes (lipids, white; nucleus, blue) located adjacent to invading cancer cells (TU) as compared with normal adipose tissue [reduction mammoplasty (RM)]. Right, the expression of the indicated genes was analyzed by qPCR in mature adipocytes obtained from RM or TU (8 independent samples per group), statistically significant by Student t test; , P < 0.05. NS, nonsignificant. www.aacrjournals.org Cancer Res; 73(18) September 15, 2013 5665 Bochet et al. To further characterize these cells, we investigated FSP-1 expression in the breast-cancer surrounding adipocytes at variable distances from the tumor center. As shown in Fig. 6B, the mature adipocytes further from the tumor are negative for FSP-1 expression, whereas those closer to the tumor exhibit FSP-1 expression. FSP-1 positive fibroblasts were present in the center of the tumors as previously described (6). Therefore, as observed in vitro, we consistently observed a gradient of FSP-1 expression in mature adipocytes exhibiting first CAA, then ADF phenotype (Fig. 6B). Finally, we investigated the differential expression of both aSMA and FSP-1 in tumor-surrounding adipocytes by immunohistochemistry. In fact, one of the key findings of our study is that ADFs, at least in vitro, express FSP-1 but not aSMA (see Fig. 3A and B). Interestingly, using experimentally generated tumors in mice, Sugimoto and colleagues found unique FSP-1-expressing CAFs, which are clearly distinct from the a-SMA–positive myofibroblasts (6). This subpopulation of CAFs is very important functionally, because FSP-1–positive fibroblasts promote tumor metastasis (34). Mammary carcinoma cells injected into FSP1/ mice showed significant delay in tumor uptake and decreased tumor incidence (34). Coinjection of carcinoma cells with FSP1þ/þ mouse embryonic fibroblasts partially restored the kinetics of tumor development and the ability to metastasize, underlying the role of this specific subset of stromal population in invasive processes (34). As shown in Fig. 6C (left), we found that a-SMA expression was not upregulated in adipocytes close to tumors when compared with normal breast adipose tissue (reduction mammoplasty) whereas in the same sample, an upregulation of FSP-1 expression was found. To further assess the expression of these markers by a quantitative approach, adipocytes were isolated from fat samples associated with tumors or reduction mammoplasty. A series of 16 samples, with 8 samples in each group (Supplementary Table S3 for the clinical characteristics of the patients), was used, matched with respect to age (mean: 54.5 10.4 vs. 51.1 8.3 years) and BMI (mean: 26.1 3.5 vs. 24.9 2.3 kg/m2). Adipocytes isolated from tumor samples overexpressed FSP-1 mRNA when compared with adipocytes isolated from normal mammary glands, whereas the mRNA levels of a-SMA were not statistically different between the two groups (Fig. 6C, right). Therefore, the phenotype described here both in vitro and in vivo for ADFs is clearly reminiscent of the one of FSP-1– positive CAFs, including the absence of a-SMA expression and the invasion-promoting effect. Because mature adipocytes represent the most abundant cellular type in breast cancer stroma, the process of adipose "dedifferentiation" is likely to provide a large part of this CAFs subpopulation. Interestingly, the impact of tumor cells on various component of adipose tissue might also participate in the heterogeneity of CAFs phenotype. In fact, it has been shown both in vitro and in vivo that breast cancer cells activate adipose stem cells towards a CAFs-like phenotype associated with a-SMA overexpression (for review see refs. 35, 10). Therefore, mature and precursor adipose cells could contribute to divergent CAFs subpopulation, whose relative contributions in cancer progression remain to be determined in lean and obese conditions. 5666 Cancer Res; 73(18) September 15, 2013 Figure 7. Mechanism of ADFs occurrence and role in tumor progression. Schematic representation of the described bidirectional crosstalk established between breast cancer and adipose cells, underlying the presence of ADFs in the desmoplastic reaction of breast cancers. To conclude, the proposed mechanism to explain the occurrence and the role of ADFs in breast cancer is summarized in Fig. 7. In our model, early local tumor invasion in breast cancer results in immediate proximity of tumor cells and adipocytes. Cancer cells secrete soluble factors, including Wnt3a, that are able to activate Wnt/b-catenin pathway in mature adipocytes, leading to adipocyte "dedifferentiation". Adipocytes undergo morphologic changes, first marked by a decrease in adipocyte size and lipid content (CAAs), then by acquiring a fibroblast-like morphology (ADFs), yet still containing small lipid droplets. At the start of this process, tumorprimed adipocytes express FSP-1. ADFs exhibit increased migratory and invasive abilities and are able to join the center of the tumor, where they significantly promote tumor invasion. In the center of the tumor, these cells no longer express adipose markers nor exhibit lipid droplets, which render them indistinguishable from other CAFs cell population. Studying the process of occurrence of ADFs in breast cancer is of major clinical importance. In fact, the occurrence of specific stromal cells, such as ADFs, is critical to the aggressiveness of nearby tumor cells and they need to be identified to develop targeted therapeutic strategies inhibiting their development and/or tumor-promoting activity. Implicating adipose tissue in this crosstalk is also of major interest because several studies pointed out that obese women exhibit higher propensity for local invasion and distant metastasis (10). Obesity condition is also associated with an increase in adipose tissue fibrosis (15). Therefore, further studies should address whether ADFs are over-represented in the breast tumor stroma of obese patients Cancer Research ADF, a Novel Tumor-Promoting Cell Type in which they would provide an invasion-promoting population. Such studies will provide unique opportunities to set up specific strategies for the treatment of the subsets of patients exhibiting aggressive diseases. Acknowledgments The authors thank Pr. Laurence Nieto for helpful technical advices for qPCR, Guillaume Andrieu, Emilie Mirey, and Nathalie Ortega for critical reading of the manuscript. The authors also thank Jamie Brown for the language editing of the manuscript and Françoise Viala for iconographic assistance. Disclosure of Potential Conflicts of Interest No potential conflicts of interest were disclosed. Authors' Contributions Conception and Design: L. Bochet, C. Lehuede, P. Valet, C. Muller Development of methodology: L. Bochet, B. Couderc Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): L. Bochet, S. Dauvillier, Y.Y. Wang, V. Laurent, C. Dray, R. Guiet, I. Maridonneau-Parini, S. Le Gonidec, G. Escourrou Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): L. Bochet, C. Lehuede, S. Dauvillier, Y.Y. Wang, B. Dirat, V. Laurent, C. Dray, G. Escourrou, P. Valet Writing, review, and/or revision of the manuscript: L. Bochet, C. Lehuede, C. Muller Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): S. Le Gonidec Study supervision: C. Muller Grant Support Studies conducted in our laboratories were supported by the French National Cancer Institute (INCA PL 2006–035 and INCA PL 2010-214; P. Valet, G. Escourrou, and C. Muller), the 'Ligue Regionale Midi-Pyrenees contre le Cancer' (Comite du Lot, de la Haute-Garonne et du Gers; C. Muller), the Fondation de France (P. Valet and C. Muller), and the University of Toulouse (AO CS 2009; C. Muller). In addition, the Fondation pour la Recherche Medicale, ANR Migre Flame 2010, and ARC #2010-120-1733 supported this work (R.Guiet and I. Maridonneau-Parini). C. Lehuede is a recipient of a PhD fellowship from the Ligue Nationale Contre le Cancer. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received February 19, 2013; revised July 5, 2013; accepted July 13, 2013; published OnlineFirst July 31, 2013. References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. Polyak K, Kalluri R. The role of the microenvironment in mammary gland development and cancer. Cold Spring Harb Perspect Biol 2010;2:a003244. Orimo A, Gupta PB, Sgroi DC, Arenzana-Seisdedos F, Delaunay T, Naeem R, et al. Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion. Cell 2005;121:335–48. Kalluri R, Zeisberg M. Fibroblasts in cancer. Nat Rev Cancer 2006;6: 392–401. Cirri P, Chiarugi P. Cancer-associated-fibroblasts and tumour cells: a diabolic liaison driving cancer progression. Cancer Metastasis Rev 2012;31:195–208. Ronnov-Jessen L, Petersen OW, Koteliansky VE, Bissell MJ. The origin of the myofibroblasts in breast cancer. Recapitulation of tumor environment in culture unravels diversity and implicates converted fibroblasts and recruited smooth muscle cells. J Clin Invest 1995;95: 859–73. Sugimoto H, Mundel TM, Kieran MW, Kalluri R. Identification of fibroblast heterogeneity in the tumor microenvironment. Cancer Biol Ther 2006;5:1640–6. Allen M, Louise Jones J. Jekyll and Hyde: the role of the microenvironment on the progression of cancer. J Pathol 2011;223:162–76. Dirat B, Bochet L, Dabek M, Daviaud D, Dauvillier S, Majed B, et al. Cancer-associated adipocytes exhibit an activated phenotype and contribute to breast cancer invasion. Cancer Res 2011;71: 2455–65. Dirat B, Bochet L, Escourrou G, Valet P, Muller C. Unraveling the obesity and breast cancer links: a role for cancer-associated adipocytes? Endocr Dev 2010;19:45–52. Wang YY, Lehuede C, Laurent V, Dirat B, Dauvillier S, Bochet L, et al. Adipose tissue and breast epithelial cells: a dangerous dynamic duo in breast cancer. Cancer Lett 2012;324:142–51. Andarawewa KL, Motrescu ER, Chenard MP, Gansmuller A, Stoll I, Tomasetto C, et al. Stromelysin-3 is a potent negative regulator of adipogenesis participating to cancer cell-adipocyte interaction/crosstalk at the tumor invasive front. Cancer Res 2005;65:10862–71. Iyengar P, Espina V, Williams TW, Lin Y, Berry D, Jelicks LA, et al. Adipocyte-derived collagen VI affects early mammary tumor progression in vivo, demonstrating a critical interaction in the tumor/stroma microenvironment. J Clin Invest 2005;115:1163–76. Park J, Scherer PE. Adipocyte-derived endotrophin promotes malignant tumor progression. J Clin Invest 2012;122:4243–56. Motrescu ER, Rio MC. Cancer cells, adipocytes and matrix metalloproteinase 11: a vicious tumor progression cycle. Biol Chem 2008;389: 1037–41. www.aacrjournals.org 15. Park J, Euhus DM, Scherer PE. Paracrine and endocrine effects of adipose tissue on cancer development and progression. Endocr Rev 2011;32:550–70. 16. Matsumoto T, Kano K, Kondo D, Fukuda N, Iribe Y, Tanaka N, et al. Mature adipocyte-derived dedifferentiated fat cells exhibit multilineage potential. J Cell Physiol 2008;215:210–22. 17. Gustafson B, Smith U. Activation of canonical wingless-type MMTV integration site family (Wnt) signaling in mature adipocytes increases beta-catenin levels and leads to cell dedifferentiation and insulin resistance. J Biol Chem 2010;285:14031–41. 18. Tejerina S, De Pauw A, Vankoningsloo S, Houbion A, Renard P, De Longueville F, et al. Mild mitochondrial uncoupling induces 3T3-L1 adipocyte de-differentiation by a PPARgamma-independent mechanism, whereas TNFalpha-induced de-differentiation is PPARgamma dependent. J Cell Sci 2009;122:145–55. 19. Emami KH, Nguyen C, Ma H, Kim DH, Jeong KW, Eguchi M, et al. A small molecule inhibitor of beta-catenin/CREB-binding protein transcription [corrected]. Proc Natl Acad Sci U S A 2004;101:12682–7. 20. Meulle A, Salles B, Daviaud D, Valet P, Muller C. Positive regulation of DNA double strand break repair activity during differentiation of long life span cells: the example of adipogenesis. PLoS ONE 2008; 3:e3345. 21. Green H, Kehinde O. Formation of normally differentiated subcutaneous fat pads by an established preadipose cell line. J Cell Physiol 1979;101:169–71. 22. Muller C, Monferran S, Gamp AC, Calsou P, Salles B. Inhibition of Ku heterodimer DNA end binding activity during granulocytic differentiation of human promyelocytic cell lines. Oncogene 2001;20:4373–82. 23. Daviaud D, Boucher J, Gesta S, Dray C, Guigne C, Quilliot D, et al. TNFalpha up-regulates apelin expression in human and mouse adipose tissue. FASEB J 2006;20:1528–30. 24. Del Duca D, Werbowetski T, Del Maestro RF. Spheroid preparation from hanging drops: characterization of a model of brain tumor invasion. J Neurooncol 2004;67:295–303. 25. Guiet R, Van Goethem E, Cougoule C, Balor S, Valette A, Al Saati T, et al. The process of macrophage migration promotes matrix metalloproteinase-independent invasion by tumor cells. J Immunol 2011;187: 3806–14. 26. Dray C, Knauf C, Daviaud D, Waget A, Boucher J, Buleon M, et al. Apelin stimulates glucose utilization in normal and obese insulinresistant mice. Cell Metab 2008;8:437–45. 27. Wang Y, Hudak C, Sul HS. Role of preadipocyte factor 1 in adipocyte differentiation. Clin Lipidol 2010;5:109–15. 28. Christodoulides C, Lagathu C, Sethi JK, Vidal-Puig A. Adipogenesis and WNT signalling. Trends Endocrinol Metab 2009;20:16–24. Cancer Res; 73(18) September 15, 2013 5667 Bochet et al. 29. Lin SY, Xia W, Wang JC, Kwong KY, Spohn B, Wen Y, et al. Beta-catenin, a novel prognostic marker for breast cancer: its roles in cyclin D1 expression and cancer progression. Proc Natl Acad Sci U S A 2000;97:4262–6. 30. Benhaj K, Akcali KC, Ozturk M. Redundant expression of canonical Wnt ligands in human breast cancer cell lines. Oncol Rep 2006;15:701–7. 31. MacDonald BT, Tamai K, He X. Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell 2009;17:9–26. 32. Herr P, Hausmann G, Basler K. WNT secretion and signalling in human disease. Trends Mol Med 2012;18:483–93. 33. Van Goethem E, Poincloux R, Gauffre F, Maridonneau-Parini I, Le Cabec V. Matrix architecture dictates three-dimensional migration 5668 Cancer Res; 73(18) September 15, 2013 modes of human macrophages: differential involvement of proteases and podosome-like structures. J Immunol 2010;184: 1049–61. 34. Grum-Schwensen B, Klingelhofer J, Berg CH, El-Naaman C, Grigorian M, Lukanidin E, et al. Suppression of tumor development and metastasis formation in mice lacking the S100A4(mts1) gene. Cancer Res 2005;65:3772–80. 35. Zhang Y, Daquinag A, Traktuev DO, Amaya-Manzanares F, Simmons PJ, March KL, et al. White adipose tissue cells are recruited by experimental tumors and promote cancer progression in mouse models. Cancer Res 2009;69:5259–66. Cancer Research ARTICLE III: Tumor-surrounding adipocytes stimulates a paired lipolytic /fatty acid β-oxidation network promoting breast cancer cell invasion (Wang et al, manuscript in preparation) 93 Tumor-surrounding adipocytes stimulates a paired lipolytic/fatty acid β-oxidation network promoting breast cancer cell invasion Yuan Yuan Wang1,2,3,4, Béatrice Dirat 1,2 1,2,3 , Camille Attané 5 1,3 , Stéphanie Dauvillier1,2, Sophie Le Gonidec 4 6 Victor Laurent , Denis Biard , Guo Sheng Ren , Ghislaine Escourrou , Philippe Valet 1,3 1,3 , and Catherine Muller 1,2 * 1 Université de Toulouse, UPS, F-31077 Toulouse, France. 2 CNRS ; Institut de Pharmacologie et de Biologie Structurale F-31077 Toulouse, France. 3 Institut National de la Santé et de la Recherche Médicale, INSERM U1048, F-31432 Toulouse, France. 4 Department of Endocrine and Breast Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing, China 5 CEA, DSV/iMETI/SEPIA, F-92265 Fontenay-aux-Roses cedex, France 6 Service d’Anatomo-Pathologie, Hôpital de Rangueil, 31403 Toulouse, France. *Corresponding author: Pr Catherine Muller, IPBS CNRS UMR 5089, 205 route de Narbonne, 31077 Toulouse Cedex – Tel: 33-561-17-59-32; Fax: 33-561-17-59-33; e-mail: [email protected] Key words: Adipose triglyceride Lipase (ATGL), Adipocytes, breast cancer, Fatty Acid β-oxidation (FAO), Invasion Conflict of interest: The authors declare 1 that no conflict of interest exists. Summary One of the key features of the peritumoral adipocytes named Cancer-Associated Adipocytes (CAAs) is their loss of lipid content observed both in vitro (2D coculture system) and in human breast tumors. We demonstrate here that part of this delipidation is due to the ability of tumor, but not normal, breast epithelial cells to induce lipolysis in adipocytes. The FFAs released during the lipolysis process are transferred, processed and stored in tumor cells as triglycerides (TG), contained in lipid droplets. When needed, these TG can be released as FFAs by an ATGL-dependent lipolytic pathway specifically present in tumor cells as shown both in vitro and in human tumors. These released FFAs are used for fatty acid β-oxidation (FAO), an activity present in cancer, but not normal, breast epithelial cells and regulated by coculture with adipocytes. Inhibition of these lipolytic/FAO coupled pathways either by pharmacological or gene repression strategies strongly decreases the invasive abilities of tumor cells that have been cocultivated with adipocytes. Taken together, these results show a metabolic symbiosis between cancer cells and tumor surrounding adipocytes that stimulate tumor progression. Graphical abstract: 2 Introduction Cancer tissues exhibit greater plasticity than normal tissues in their energy metabolism, since they have to survive in a dynamic environment where oxygen and nutrients are often scarce [1];[2]. One of the first described adaptation to this metabolic stress was the demonstration by Otto Warburg that anaerobic metabolism of glucose occurred even in the presence of oxygen (aerobic glycolysis) in cancer cells, but not in normal untransformed cells [3]. However, accumulating evidence now demonstrate that in human tumors both mitochondrial oxidative phosphorylation (OXPHOS) and aerobic glycolysis coexist, their relative proportion being dependent on both the genetics background of the tumors as well as its microenvironment [4];[5]. In addition to glucose and glutamine, free fatty acids (FFAs) are extremely relevant energy source, through the mitochondrial fatty acid oxidation (FAO) pathway [6]. At physiological levels, FAO is carried out in energy-demanding tissues (such as the heart and skeletal muscle) and, in cancer recent works bring to light a role for this metabolic pathway during stress conditions. For example, FAO is induced during loss of attachment (LOA) of epithelial tumor cells and rescued the cells from death by anoikis [7]. Pandolfi et al recently described a novel mechanism in which FAO is regulated by the promyelocytic leukemia (PML) protein and again, the ability of PML to increase FAO activity promoted cell survival on LOA [8]. Finally, in lung cancers, the expression of an atypical isoform of carnitine palmitoyltransferase 1, CPT1C, promote FAO and ATP production, tumor growth and rescue from metabolic stress [35]. Accordingly, FAO should be considered as a metabolic pathway that is highly responsive to microenvironmental changes. The metabolism of cancer cells is also regulated by the crosstalk with cellular components of the tumor microenvironment. For example, epithelial cells can induce aerobic glycolysis in Cancer-Associated Fibroblasts (CAFs) with produce lactate, ketones and pyruvate that, in turns, participate to OXPHOS in cancer cells [9];[10]. One very important source of FFAs for tumor cells in order to fuel FAO could be the tumor-surrounding adipocytes. In fact, we have initially demonstrated in breast cancers that in vitro and in vivo, these adipocytes exhibit a decrease in lipid content, a decreased expression of adipocyte markers and an activated state indicated predominantly by the overexpression of proinflammatory cytokines [11]. We named them Cancer-Associated Adipocytes (CAAs) [11];[12], reviewed in[13]. The loss of lipid content in CAAs might suggest that these lipids are released and transferred to cancer cells. Such a direct transfer of lipid from adipocytes to cancer cells has been demonstrated in both prostate [14] and ovarian cancer [15]. In their very elegant study, Nieman et al demonstrated that lipid transfer from adipocytes to cancer cells fuel the tumor growth in vitro and in vivo because inhibiting the adipocytes released of FFAs, through inhibition of the small Fatty Acid Binding Protein 4 (FABP4) expression, impaired this tumor promoting effect [15]. The fact that ovarian cancer cells exhibit FAO activity that is slightly up-regulated in the presence of adipocytes suggest, without demonstrating it directly, that these FFAs are used as an energy source for cancer cells. For example, monoacylglycerol lipase (MAGL) an enzyme that liberates FFAs from lipid stores promotes cancer progression and aggressiveness independently of FAO [16]. Therefore, the goal of our current study was to investigate whether FAO is directly involved in adipocyte-cancer cell crosstalk and the network that allowed the FFAs to be available to this metabolic pathway. Our work underlines the very important role of FAO in breast cancer invasion and the importance of a paired lipolytic activity to fully support its role in tumor aggressiveness. 3 Results and Discussion A lipid transfer occurs between breast cancer cells and tumor-surrounding adipocytes. In the presence of breast cancer cells, both murine and human mammary adipocytes (obtained from ex vivo differentiation of progenitors isolated from mammary adipose tissue of healthy donors undergoing reduction mammoplasty) exhibit a dramatic reduction in the number and size of lipid droplets that correlated with a significant decrease in triglycerides (TG) accumulation in accordance with our previous results [11] (Fig. 1A). We speculated that, in addition to a “dedifferentiation” process, the observed loss of lipid content observed in CAAs could involve a lipolysis process. Glycerol, one of the products of TG hydrolysis along with FFAs, was detected when adipocytes were incubated in the presence of tumor cells conditioned medium (CM) (fig. 1B). Of note, the CM of normal mammary epithelial cells was unable to induce lipolysis in adipocytes, showing that this event is tumor-specific (fig. 1B). To further confirm the presence of a lipolytic process in tumor-surrounding adipocytes, we showed in adipocytes grown in the presence of CM of tumor, but not normal, breast epithelial cells a disappearance of perilipin which serves as a gate-keeper of lipid droplet [17] (fig. 1C) as well as the activation of the Hormone-Sensitive Lipase (HSL) as revealed by its phosphorylation (fig. 1D). As shown in fig.1B, no product of lipolysis was detected when adipocytes were cocultivated with tumor cells and not with their CM. These results suggest that the released FFAs and glycerol are uptaken and stored by cancer cells themselves, as other tissues use them during energy deprivation. As shown in fig. 1E, cocultivated ZR 75.1 exhibit multiple, small lipid droplets as revealed by two probes that stain neutral lipids either the lipophilic fluorescent dye Bodipy 493/503 (left, upper panel) or red oil (left, lower panel). Such a lipid accumulation was associated to less compacted colonies and a more scattered aspect. Dosage of TG in these cells revealed a 5-fold increase as compared to non cocultivated cells in accordance with the visualization of lipid droplets (right panel). Similar results were obtained with another tumor cell line SUM159PT (fig. 1F). Total lipids were extracted and analyzed by high performance thin layer chromatography (HPTLC), and electrospray ionization mass spectroscopy (ESIMS). Cocultivated tumor cells showed significantly higher levels of TG than non cocultivated cells. In contrast to TG no changes were observed in the levels of DG and cholesteryl-esters, whereas MG was undetectable (fig. S1). Saturated fatty acids (SFA) levels (both C 16:0 and C18:0) were increased in cocultivated cells whereas unsaturated fatty acid levels were not modified by coculture (fig. S1). Breast cancer cells frequently exhibit exacerbated lipogenesis, caused by the up-regulation of lipid metabolizing enzymes such as Fatty Acid Synthase (FAS), but also as a result of increased intermediate metabolites of pathways such as anaerobic glycolysis [18]. To further confirm that the lipid accumulation in tumor cells was issued from adipocytes-released FFAs, we differentiate the preadipocyte 3T3-FF442A with a differentiation medium containing radiolabeled palmitate acid. The radiolabeled mature adipocytes obtained were then cocultivated with ZR 75.1 cells for 3 and 5 days. As shown in fig. 1G, a progressive decrease of radioactivity was observed in adipocytes that was parallelized with a progressive increase of radioactivity contained in tumor cells. In addition, we further demonstrate that the key lipogenic enzyme FAS was not upregulated by coculture and that inhibition of its function by the broad inhibitor C75 [19] did not modify the increase of lipid content observed in cocultutivated tumor cells (fig. S2). Taken together, these compelling results show that a bidirectional crosstalk is established between breast tumor and surrounding adipocytes that favors a transfer of lipid between the two populations. In an adipocyte-rich 4 microenvironment, the continued cellular fatty acid import in tumor cells lead to accumulation of lipids as TG within lipid droplets, as already described for other non adipose cells. Coculture with adipocytes reprogramm the breast cancer cells to use FAO. FFAs might provide cancer cells with membrane building blocks, signaling lipid molecules, posttranslational modifications of proteins as well as energy supply through FAO. To our knowledge, the existence and relevance of FAO in breast cancer cells has been poorly investigated except as the initiation of carcinogenesis process [7]. As shown in fig. 2A, we found that the two tumor cell lines used were able to perform FAO at significantly higher levels than the normal HMEC cells. Coculture with adipocytes increases the ability of tumor cells to completely oxidize the FA whereas the incomplete FAO decreases (left and middle panel). As a result, the oxidative efficiency was significantly elevated in cocultivated cells as compared to non cocultivated one (right panel). We also investigated whether altered mitochondria accompanied the metabolic switch observed above. As shown in fig. 2B, OXPHOS-associated proteins involved in the electron transport chain (complex I) were increased in cocultivated breast tumor cells compared to non-cultivated one. In addition, non-cultivated and co-cultivated ZR 75.1 cells were subjected to transmission electron microscopy (TEM). Electron micrographs revealed significant changes in the ultrastructure of particular mitochondria in co-cultivated tumor cells with the occurrence of dense mitochondrial matrix and aggregated cristae (Fig 2C). Taken together, these results show that within a context of surrounding adipocytes, breast tumor cells exhibit increased FAO. Whether the FFAs derived from adipocytes are used in this metabolic pathway is further demonstrated by the results obtained with the FAO pharmacological inhibitor etomoxir (ETO). ETO inhibits the entry of FFAs into mitochondria by blocking the activity of the longchain fatty acids transporter carnitine palmitoyl transferase 1 (CPT1) [20]. A dose-dependent effect of FAO inhibition by ETO was performed and we shows that complete FAO was efficiently inhibited by ETO in a dose dependent manner between 1 to 30 µM ETO (fig. 3D). When tumor cells were cocultivated with adipocytes in the presence of ETO, a 2 to 3-fold increase in TG content was observed (3E, left panel). This increase in lipid droplets is also illustrated by the immunofluorescence study performed with bodipy (3E, right panel). Similar results were obtained with the SUM159PT cells (fig. S3). The metabolic switch towards the use of FAO was further confirmed by the fact that AMP-activated protein kinase (AMPK) phosphorylation is enhanced in cocultivated cells, and that this phosphorylation was inhibited by ETO (Fig. 2F). In fact, AMPK favors energy producing processes by inhibiting lipogenesis and activating β-oxidation [21]. Finally, we demonstrated that ATP production was efficiently inhibited by ETO in these cocultivated cells (fig. 2G). Inhibition of FAO by pharmacological agents and gene repression strategies specifically impairs invasiveness of cocultivated breast cancer cells We have previously demonstrated that coculture with adipocytes stimulates cell invasion [11]. Within this context, we investigate the effect of the inhibition of FAO by ETO. As shown in fig. 3A (left panel), the invasive capacity of ZR 75.1 tumor cells toward 10 % FCS containing medium was increased by 3-fold in cells previously co-cultivated for 3 days with adipocytes as compared to tumor cells grow alone (p< 0.05), and this effect was completely abrogated by ETO. By contrast, ETO was without effect on cell proliferation (fig. 3A, right panel). Similar effect was observed in SUM159PT cells although the effect of adipocytes on tumor cell invasion was less pronounced in these aggressive cells (fig. 3B). Our co-culture system shows that adipocytes 5 stimulate the invasiveness of tumor cells in vitro, and that this effect is abrogated by the use of ETO. To test the hypothesis that “priming” tumor cells with adipocytes regulates tumor cell distal organ seeding and growth, we performed tail vein metastasis assays using the TS/A cell line. It has been previously shown that when injected intravenously in syngenic immunocompetent BALB/c mice, these cells form metastases in lung and liver, after 1 to 2 weeks [22]. Before performing these in vivo experiments, we assessed that TS/A cells was a suitable model. As shown in fig. S4, these cells exhibit increase in lipid content when cocultivated with adipocytes, an increase in the ratio of complete-to incomplete FAO as well as a decrease in invasiveness in the presence of ETO in vitro. Untreated or ETO-treated TS/A tumor cells were cultured in vitro for 4 days in the presence or not of adipocytes, harvested, and injected i.v. into BALB/c host mice. As shown in fig. 3C, the number of lung metastases was enhanced in mice injected with TS/A cells previously co-cultivated with adipocytes as compared to mice injected with TS/A grown alone. This effect was abrogated in the presence of ETO. Histological analysis (fig. 3D) confirmed that when the TS/A cells have been previously co-cultivated with adipocytes, the lesions replaced large areas of the lung parenchyma, whereas cocultivated cells in the presence of ETO exhibited less parenchymal involvement. We have previously demonstrated that cocultivated ZR75.1 exhibit incomplete EMT [11]. As shown in fig. 3E (left panel), all the hallmarks of EMT observed in cocultivated cells, such as a more scattered aspect and less compacted colonies, the development of multiple extended protrusions shown by βactin staining as well as the down-regulation of membrane E-Cadherin expression to a disorganized state in the cytoplasm, were inhibited by ETO treatment. Accordingly, the overexpression of the transcription factor snail that contributes to EMT, was also inhibited in ETO treated cells as both mRNA and protein levels (fig. 3E, right panel). As shown before, the FAO is controlled at the step of FA import into the mitochondria, a process executed by tissue-specific isoforms of CPT1- the so-called ‘liver’ (CPT1A), ‘muscle’ (CPT1B) and ‘brain’ (CPT1C). It has been recently demonstrated that CPT1C is overexpressed in lung cancer [23]. While investigating the expression of CPT1 isoforms in breast cancer cell lines, we observed that only CPT1a was specifically expressed in breast cancer, but not normal, cell lines (Fig. 3F). Similar results have been previously observed using different couple of tumor/normal cells [24]. Interestingly, CPT1a expression was increased in cocultivated cells as exemplified for ZR75.1 cells (Fig. 3G). CPT1a expression was efficiently inhibited by stable ShRNA expression (fig. 3H). As shown in fig. 3I, deficiency in CPT1a expression does not affect proliferation at baseline or in the presence of adipocytes. By contrast, the absence of CPT1a expression specifically interferes with the increase in tumor aggressiveness induced by adipocytes (fig. 3J). In fact, cocultivated CPT1a Sh cells do no longer exhibit increased invasion, nor EMT as shown both by morphological changes or snail/E-cadherin expression changes (fig. 3K). These results suggest that inhibition of FAO by pharmacological or gene repression strategies impairs aggressiveness of cancer cells, at least in part, through reversion of EMT. Therefore, we have directly demonstrated here for the first time that the FFAs transferred between adipocytes and tumor cells are used to perform FAO. Importance of the lipolytic pathway to supply FAO with FFAs over time. As seen above, FFAs that are transferred to tumor cells are used for FAO and the excess of FFAs are stored in lipid droplets (to protect cells again lipid toxicity). Once the lipids are stored as TG, they should be liberated as FFAs to fuel FAO in order to sustain invasive activities following the initial crosstalk with adipocytes. As shown in fig. 4A, we found that when tumor that have been cocultivated for three days with adipocytes were grown alone, a progressive decrease 6 in TG content was observed during the first 48h. This was associated with a significant increase in the levels of glycerol release in the culture medium. The lipolysis process has been mostly studied in adipocytes where it is carried out by three major lipases, ATGL, HSL and MAGL [25]. Among these lipases, ATGL is the rate-limiting enzyme for the initiation of catabolism in adipose and non-adipose tissues such as heart and muscle [26]. Expression of these lipases has not been studied in cancer cells with the exception of MAGL that have been shown to promote tumor growth through fatty acid release in cancer cells [16]. However, the spectrum of MAGL activity would not be efficient in releasing TG store in lipid droplets. We therefore investigated lipases expression in normal and tumoral breast epithelial cells representative of a range of poorly and highly aggressive cells. As shown in fig. 4B, ATGL expression was not detected in HMEC and its levels of expression was higher in aggressive than in non-aggressive cells. Close results were obtained with HSL (with the exception of its expression in HMEC cells) whereas by contrast MAGL was expressed in normal, poorly aggressive and highly aggressive cells with no large differences within the two groups. The regulation of ATGL expression was observed in cocultivated cells with the exception of the highly aggressive triple negative MDA-MB231 whereas at the opposite MAGL expression remains unaffected by coculture except a slight increased expression in the ZR75.1 cells (fig.4C). Due to its role in hydrolyzing TG, its pattern of expression and its regulation by coculture, we decided to invalidate ATGL in the ZR75.1 cells. As shown in fig. 4D, a significant decrease of more than 80% was observed at protein levels in ATGL deficient cells. The doubling time of these cells were unaffected by ATGL deficiency (fig. 4E). In cocultivated cells, we observed that the TG content was stable after adipocytes removal (fig. 4F). The coculture was without effect on cell number in both control and ATGL Sh cells (fig. 4G), whereas adipocytes were able to stimulate cell invasion only in ATGL proficient cells (fig. 4H). Accordingly, cocultivated ATGL Sh cells do no longer exhibit increase EMT as shown both by morphological changes or snail/E-cadherin expression changes (fig. 4I). Taken together these results show that ATGL plays a key role in regulating lipid network and invasiveness of breast cancer cells cocultivated with adipocytes. Very interestingly, when cells were incubated with exogenous lipids, an increase in TG content was observed in tumor cells but these TG were not released over times when the lipid source was removed from the culture medium. In accordance, no positive regulation of ATGL expression is observed in the lipid-treated cells. Furthermore, these cells, despite a positive increase in lipid accumulation, do not exhibit increased cellular invasion (fig. S5). Given the exquisite importance of ATGL expression and function in the adipose/cancer crosstalk, we decided to study its expression in human tumors along with the two other lipases HSL and MAGL. A Tumor-MicroArray (TMA) of 69 patients exhibiting breast cancer as well as normal breast epithelial cells was used (Supplementary Table S1 for the clinical characteristics of the patients). As shown in fig. 4J, in accordance with the results obtained in cell lines, we observed that ATGL was only expressed in human cancer cells whereas MAGL expression was detected both in normal and canceroustissues. Surprisingly, HSL was not expressed in both normal and tumor, in apparent contradiction with the results obtained in vitro. ATGL expression was associated with aggressive features of the tumor. In fact, a significant increase in ATGL expression was observed in tumor of high grade, expressing HER2 and negative for ER and PR expression (see fig. 4L). By contrast, MAGL expression was not associated with poor prognosis factors in breast cancer (fig. S6). Another important finding of this immunohistochemistry study was the fact that when TMA contains adipose tissue, a highly significant increase of ATGL expression was observed in tumor cells at close proximity of adipocytes in all the available samples (fig. 4J). To further verify these findings, ten breast cancer biopsies corresponding to cases included in TMA 7 were further analyzed for ATGL expression. As seen in fig. 4K for one representative case, we observed for ATGL a gradient of expression with a higher level at the tumor invasive front at proximity of adipocytes. Therefore, these results show both in vitro and in human tumors that ATGL is associated to aggressiveness in breast cancer and that its level of expression is regulated in areas of the tumor where the dialog with adipocytes is engaged. These results strongly reinforced the idea of a metabolic crosstalk between adipose tissue and human tumors involving ATGL , an enzyme that plays a key role in regulating lipid network and invasiveness in breast cancer cells in an adipocyte-rich microenvironment as shown in vitro. Our results are in apparent contradiction with the work of Nomura et al, that shows that MAGL is highly express in aggressive human cancer cells where it regulates a fatty acid network enriched in oncogenic signaling lipids that promotes tumor progression [16]. In fact, in breast cancer, both in vitro and in vivo, we found only a slight differences in MAGL expression between normal epithelial cells, non aggressive and aggressive tumors, in contrast to their data which was limited for breast tumors to two cell lines (MCF-7 and 231MFP). Therefore, our results suggest that in breast cancer, this enzyme might be less important for tumor progression than in melanomas or ovarian cancer [16]. However, our work, like their, sustains the concept that lipogenesis or accumulation of lipid from exogenous sources required a paired lipolytic activity to promote tumor progression. In accordance with our results that link ATGL expression and function with invasion, it has also been described that MAGL is part of a gene signature correlated with EMT properties of cancer cells [27]. Implicating adipose tissue in a metabolic crosstalk with tumor is also of major interest since several studies pointed out that obese women exhibit higher propensity for local invasion and distant metastasis [28]. In obese patients, the basal rates of lipolysis in adipocytes could be enhanced, which could favor in turns the metabolic symbiosis with tumor and tumor aggressiveness. Further studies specifically addressing these questions will provide unique opportunities to set up specific strategies for the treatment of the subsets of patients exhibiting aggressive diseases. EXPERIMENTAL PROCEDURES Cell Lines and Reagents. The murine 3T3-F442A pre-adipocyte cell line was cultured in DMEM medium supplemented with 10% of fetal calf serum (FCS). Differentiation was induced by incubating confluent cells in differentiation medium (DMEM supplemented with 10% FCS plus 50nM insulin) for up to 14 days as described previously [29]. Human mammary epithelial cells (HMEC) (provided by Dr J Piette, IGMM, Montpellier, France) were grown in MEBM medium (Lonza), containing transferrin (5μg/ml) andisoproterenol (10-5M). The human breast cancer cell line ZR 75.1 (Sigma, France) was cultured in DMEM medium supplemented with 10% FCS, and the SUM159PT (provided by Dr J Piette, IGMM, Montpellier, France) was grown in Ham F12 (50:50) medium complemented with 5% FCS, 1µg/ml hydrocortisone (Sigma, Saint-Quentin les Ulysses, France) and 0.2UI /mL insulin. HMT3522-T4-2 mammary epithelial cells (provided by Dr E. Liaudet-coopman, IRCM, Montpellier, France) were cultured in H14 medium [30] consisting in DMEM/F12 with 250 ng/ml insulin, 10 mg/ml transferrin, 2.6 ng/ml sodium selenite, 10-10 M estradiol and 1.4 x10-6 M hydrocortisone. The human breast cancer cell line MCF-7, T47D, MDA-MB-231 (provided by Dr K. Bystricky, LBME, Toulouse, France) and the murine breast cancer cell line TS/A cell lines (provided by Dr V. Philippe, INSERM U563, Toulouse, France) were cultured in RPMI 1640 medium supplemented with 10% FCS. All the cell lines were maintained at 37oC in a humidified 8 atmosphere of 5% CO2/95% air. At 80% confluence, cells were trypsinized and counted using a hemocytometer, preparing for use. All the cell lines used within 2 months after resuscitation of frozen aliquots. Antibodies against perilipin (D418), hormone-sensitive lipase (HSL), p-HSL (ser660), adipose triglyceride lipase (ATGL), Snail (C15D3), AMP kinase (AMPK), p-AMPK (thr172) were purchased from Cell signaling. Monoglyceride lipase (H-300), PGC-1 (H-300) antibodies were purchased from Santa Cruz. The CPT1A (ab53532) and OXPHOS antibodies were obtained from Abcam. E-cadherin antibody was from Calbiochem. Actin and Tubulin-α antibodies were from Thermo Scientific. Dimethyl Sulfoxide (DMSO), Oil red O, Toluidine Blue O, Etomoxir (used at 1-30μM final concentration), C75 (used at 10 and 20μM final concentration) were purchased from Sigma. The bodipy lipid probe (used at 1μg/ml) and TO-PRO-3 (used at 1μM final concentration) were obtained from Invitrogen. Coculture, Cell Proliferation and Invasion Assays. Coculture and invasion assays were conducted as described [11]. Briefly, 5x104 (SUM159PT), 1x105 (ZR 75.1) cells were seeded in the top chamber of the Transwell system (0.4 µM pore size, Millipore) cocultivated with or without mature adipocytes in the bottom chamber. In indicated experiments, cells were treated or not with Etomoxir for 3 days. After coculture, tumor cells were fixed with methanol, stained with Toluidine Blue O buffer. Then washed several times with distilled water, air-dried, dissolved in dissolving buffer (125μl Tris HCL pH 6.8, 2g glycerol, 2ml 20% SDS, 2ml Beta mercaptoethanol, made up to 20ml with distilled water), the optical density was then read at 570 nm using a MicroQaunt plate reader for cell proliferation assay. After coculture, tumor cells were cultivated with serum-free medium overnight, cells were then trypsinized and used for Matrigel invasion assay. 6x104 cells were allowed to migrate for 4h (SUM159PT) and 24h (ZR 75-1) in Transwell chambers (8µm pore size, Greiner Bio one) towards a medium containing either 0% or 10% serum. Cells in the upper chamber removed with cotton swabs, cells on the bottom surface of the filter were fixed with methanol, stained with Toluidine Blue O. The invaded cells were quantified in 5 fields per well in triplicate. MTT Assay. 4x103 of ZR 75.1 shControl and shCPT1A, ZR 75.1 shControl and shATGL cells were seeded in 96 well plates in quadruplicate and incubated for 24hr, 48hr and 72hr. Following this period 100μl of Thiazolyl Blue Tetrazolium Bromide (0.05g dissolved in 50ml PBS) was added before further 2 hours incubation. All medium was then removed, 100μl of DMSO added for staining and then the colorimetric absorbance at a wavelength of 570nm. Animal Studies. Eight- to twelve-week-old female syngeneic BALB/c host mice (Janvier, Le Genest St-Isle, France) with an average body weight of 22g were used in this study. A catheter was indwelled into the femoral vein under anesthesia (sodium pentobarbital, 1:10; 0.2ml per mice; Ceva, Libourne, France), sealed under the back skin, and glued on the top of the skull. The mice were housed individually and allowed to recover for 4 days. Then, a total of 1x105 TS/A cells, previously cocultivated or not with mature adipocytes in the presence or not of Etomoxir (30μm) for 4 days, were injected through the catheter in BALB/c mice (NC, n=6; NC+E, n=7; C, n=7; C+E, 9 n=8). All the mice received the cells injection in less than 1.5 hours. Mice were sacrificed after 25 days, the lungs were immediately excised, and the number of tumor nodules on the lung surface was recorded. Lungs were then fixed in 4% paraformaldehyde and embedded in paraffin. Sections were stained with hematoxylin and eosin (H&E) and nodules were observed microscopically. The mean number of nodules per lung area and the mean nodule area as a function of lung area (that defined the nodule area index) were measured by ImageJ software program. The local Institutional Animal Care and Use Committee approved the experimental protocols described in the study. Immunofluorescence and Immunohistochemistry. Mature adipocytes differentiated on glass coverslips grown alone or treated with HMEC and SUM159PT CM for 3 days. Breast tumor cells ZR 75.1 (8 x 104) grown on coverslips in inserts which were cocultivated in the presence or absence of adipocytes treated with or without Etomoxir (30μM) for 3 days. The coverslips were fixed in 3.7% paraformaldehyde for 20 min at room temperature (RT). After blocking with 10% FCS and 2% BSA in PBS for 1 hour, cells were incubated 2 hours at RT with the following antibodies: Perilipin (1:200), pHSL (1:150) for adipocytes and E-cadherin (1:50), rhodamine-phalloidin (1:200) for tumor cells. The secondary antibody, Alexa fluor 488-conjugated anti-rabbit (1:500) or anti-mouse (1:400) was used for 30 min at RT. Coverslips were examined using an Olympus FV-1000 with 60X oil PLAPON OSC objective or a Zeiss LSM 710 confocal microscope with 40× oil PlanApo objective (1.4 N.A.). A minimum of three independent experiments were performed. Images were processed to filter the noise with Fiji software and a similar filter was used to analyze all acquisitions for the experiment. Immunohistochemistry was performed as previously described [31]. Histologic examinations of human normal breast tissue and breast invasive tumors were done using Haematoxylin & Eosin staining. Tissue sections were stained using the following primary antibody dilutions: ATGL (1:100), HSL (1:100) and MAGL (1:50). Transmission Electron Microscopy. 1x105 cells/well of ZR 75.1 were seeded in the upper chamber of the Transwell system for co-cultivated with or without adipocyte for 4 days. Cells were then fixed in 2% glutaraldehyde, 3% paraformaldehyde in 0.1M pH7.4 cacodylate buffer, and treated with 1% osmium tetraoxide. Specimens were rinsed with distilled water and embedded in 0.5% uranyl acetate. After dehydration in ethanol gradients and embedded in Epon812 resin (DeltaMicroscopies, France). Tissue sections of 80nm were cut on Ultracut Reichert ultratome, then placed on copper grides, stained with uranyl acetate and lead citrate and examined in a Jeol JEM-1400 Transmission electron microscope coupled to a digital camera Gatan (Toulouse RIO-imaging, CNRS FRBT). RNA Extraction and Quantitative RT-PCR (qPCR). Total RNAs were extracted using the RNeasy mini kit (Qiagen GmbH, Hilden, Germany). Gene expression was analyzed using real time PCR as described previously [32]. Total RNAs (1 µg) were reverse-transcribed for 60 min at 37°C using Superscript II reverse transcriptase (Invitrogen, Auckland, NZ) in the presence of a random hexamer. A minus reverse transcriptase reaction was performed in parallel to ensure the absence of genomic DNA contamination. Real time PCR was performed starting with 25 ng of cDNA and the indicated concentrations of both forward and reverse primers (Snail 300nM: forward, TCCCAGATGAGCATTGGCAG; 10 reverse, CGCGCTCTTTCCTCGTCAG, CPT1A 300nM: forward, TGTGCTGGATGGTGTCTGTCTC; reverse, CGTCTTTTGGGAT CCACGATT) in a final volume of 25 μl using the SYBR Green TaqMan Universal PCR master mix (Applied Biosystems, Foster City, CA). Fluorescence was monitored and analyzed in a GeneAmp 7300 detection system instrument (Applied Biosystems, Foster City, CA). Analysis of 18S ribosomal RNA was performed in parallel using the ribosomal RNA control TaqMan assay kit (Applied Biosystem), or HPRT RNA (100 nM: forward, TGACACTGGCAAAACAATGCA; reverse, GCTTGCGACCTTGACCATCT) or GAPDH RNA (300 nM: forward, TGCACCACCAACTGCTTAGC; reverse, GGCATGGACTGTGG TCATGAG) to normalize for gene expression. Oligonucleotide primers were designed using the Primer Express software (PerkinElmer Life Sciences) as previously described [32]. RNA Interference Studies in Human Cancer Cell lines. To stably switch off ATGL (NM_020376) and CPT1A (NM_001876) gene expressions in ZR 75.1 cells, we used replicative short hairpin (shRNA) expressing vectors (pEBVsiRNA) which impose a very strong and stable gene silencing in human cells even after several months in culture. siRNA design was performed using the DSIR program [33]. RNAi sequences against ATGL stretched from nucleotides 11-29 (with ATGL as the first nucleotide, GCGAGAAGACGTGGAACAT; pBD2338) and against CPT1A nucleotide 203-221 (GCGTGATGACAACGATGTA, pBD2405 or pBD2408). pEBVsiRNA vectors were transfected into ZR 75.1 cells by using Lipofectamine and knock down (KD) cell populations were selected with 30 µg/mL of hygromycin B (Invitrogen, Life Technologies).. ATGL and CPT1A silenced cells were termed as ATGLKD and CPT1AKD cells. These cells were currently analyzed by Western blot and RT-qPCR for the loss of ATGL and CPT1A gene expression. As control, we used the pBD650 plasmid which expresses an inefficient shRNA sequence. Western Blot Analysis. Total proteins were extracted as described previously [34]. Briefly, cells were resuspended in lysis buffer (1μl/ml aprotinine, 10μl/ml phosphatase inhibitor cocktail 1, 10μl/ml phosphatase inhibitor cocktail 2, 1μl/ml pepstatin, 2μl/ml leupeptin, 10μl/ml PMSF). 50μg proteins were electrophoresed on SDS-polyacrylamide gels and transferred onto polyvinyl difluoride (PVDF) membrane. After being blocked with 5% skimmed milk in Trisbuffered saline (TBS 1Х), the membranes were incubated with appropriate primary antibodies. Then the membranes were washed with 0.1% TBS-T and incubated with HRP-conjugated secondary antibodies. The immunoreactive protein bands were detected by ECL. Primary antibodies were used at the following dilutions: p-AMPK, total AMPK, ATGL, HSL, MAGL, Snail, OXPHOS, PGC-1, Actin and Tubulin-α, 1:1000; CPT1A, 1:500. Transfer of radioactive lipids between mature adipocytes and tumor cells. The preadipocyte 3T3-F442A cells at confluence were incubated in differentiation medium (DMEM 4.5g/L glucose supplemented with 10% FCS plus 50 nM insulin) plus 0.12 µCi/ml of radiolabeled palmitate acid. At 11 days of differentiation, the human breast cancer cell line ZR 75.1 were seeded in the upper chamber of the Transwell system for co-culture or not with adipocyte for 3 and 5 days using a medium that do not contain any 11 more radiolabeled palmitate acid. ZR 75.1 and adipocytes were washed 3 times with PBS, then resuspendeds in 500µl of lysis buffer and the radioactivity was counted in the samples. Oil Red O Staining. The intracellular lipid content was evaluated with the lipophilic dye Oil Red O. Cells in culture were fixed in 3.7% paraformaldehyde for 20 min at room temperature (RT), rinsed twice with distilled water, and then airdried. The fixed cells were then stained for 20 min with solution of Oil Red O in 60% (v/v) isopropanol and then washed several times with distilled water. Measure of adipocyte lipolysis. HMEC and tumor cells (ZR 75.1, SUM159PT) conditioned-medium (CM) containing 0.2% of delipidated bovine serum albumin (Sigma) were collected for 12h in the absence of serum. Glycerol released in the medium was measured in 30µl aliquot using the Glycerol-Free Reagent Kit (Sigma) in mature adipocytes 3T3-F442A grown alone, in the presence of CM or cocultivated with tumor cells for 3 days. Triglyceride (TG) Content Dosage. Tumor cells or adipocytes were grown in the conditions indicated in the Results Section. Cells were were pelleted and resuspended in 15µl of TG buffer (10mM Tris.HCL pH 7.5, 1mM EDTA made up to 50ml with distilled water). TG content was quantified using a colorimetric kit (Wako Chemicals) and read at a wavelength of 505nm. Fatty Acid Oxidation. HMEC and ZR 75.1, SUM159PT were cultivated alone or with mature adipocytes in inserts for 3 days. Cells were then incubated with 2ml of warmed (37oC), pre-gazed (95% O2-5% CO2, PH 7.4), modified KrebsHenseleit buffer containing 1.5% FA-free BSA, 5mM glucose, 1mM palmitate and 0.5 µCi/ml (14C) palmitate (Perkin Elmer) for 120 min. At the end of the incubation, tumor cells were removed and placed in a tube containing 800µl of lysis buffer. A 0.5ml microtube containing 300µl of benzethonium hydroxide (Sigma) was placed in the vial to capture the 14CO2. The incubation buffer was then acidified with 1ml of 1M H2SO4 and the vial was quickly sealed with parafilm. After 120 minutes, the microtube was removed and placed in a scintillation vial and the radioactivity, corresponding to complete oxidation, incomplete oxidation and total oxidation were counted (cytoscint. MP Biomedicals). C2C12 was used as a positive control. Cellular ATP Measurement. Luminescence was used to determine the relative ATP level in tumor cells exposed to different conditions. 1x105 cells/well of ZR 75.1 or 5x104 cells/well of SUM159PT were seeded in the upper chamber of the Transwell system and co-cultivated or not with adipocytes in the presence or not of Etomoxir (30μm) for 3 days. According to ATP Bioluminescence Assay Kit HSII (Roche), harvested cells were plated in 96 microwell plate (MWP). Luminescent intensity from each well was measured using Centro LB 960 Microplate Luminometer. Statistical Analysis. 12 The statistical significance of differences between the means (at least three independent experiments) was evaluated using Student`s t-tests, performed using Prism (GraphPad Inc.). p values below 0.05 (*), <0.01 (**) and <0.001 (***) were deemed as significant while “NS” stands for not significant. Acknowledgements. Studies performed in our laboratories were supported by the French National Cancer Institute (INCA PL 2006– 035 and INCA PL 2010-214 to PV, GE and CM), the ‘Ligue Régionale Midi-Pyrénées contre le Cancer’ (Comité du Lot, de la Haute-Garonne et du Gers to CM), the Fondation de France (to PV and CM) and the University of Toulouse (AO CS 2009 to CM). YYW is a recipient of a PhD fellowship from the Chinese Scholarship Council. 13 References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. Marusyk, A. and K. Polyak, Tumor heterogeneity: causes and consequences. Biochim Biophys Acta, 2010. 1805(1): p. 105-17. Hanahan, D. and R.A. Weinberg, Hallmarks of cancer: the next generation. Cell, 2011. 144(5): p. 64674. Warburg, O., On respiratory impairment in cancer cells. Science, 1956. 124(3215): p. 269-70. Koppenol, W.H., P.L. Bounds, and C.V. Dang, Otto Warburg's contributions to current concepts of cancer metabolism. Nat Rev Cancer, 2011. 11(5): p. 325-37. Kroemer, G. and J. Pouyssegur, Tumor cell metabolism: cancer's Achilles' heel. Cancer Cell, 2008. 13(6): p. 472-82. Carracedo, A., L.C. Cantley, and P.P. Pandolfi, Cancer metabolism: fatty acid oxidation in the limelight. Nat Rev Cancer, 2013. 13(4): p. 227-32. Schafer, Z.T., et al., Antioxidant and oncogene rescue of metabolic defects caused by loss of matrix attachment. Nature, 2009. 461(7260): p. 109-13. Carracedo, A., et al., A metabolic prosurvival role for PML in breast cancer. J Clin Invest, 2012. 122(9): p. 3088-100. Bonuccelli, G., et al., Ketones and lactate "fuel" tumor growth and metastasis: Evidence that epithelial cancer cells use oxidative mitochondrial metabolism. Cell Cycle, 2010. 9(17): p. 3506-14. Pavlides, S., et al., The reverse Warburg effect: aerobic glycolysis in cancer associated fibroblasts and the tumor stroma. Cell Cycle, 2009. 8(23): p. 3984-4001. Dirat, B., et al., Cancer-associated adipocytes exhibit an activated phenotype and contribute to breast cancer invasion. Cancer Res, 2011. 71(7): p. 2455-65. Dirat, B., et al., Unraveling the obesity and breast cancer links: a role for cancer-associated adipocytes? Endocr Dev, 2010. 19: p. 45-52. Wang, Y.Y., et al., Adipose tissue and breast epithelial cells: a dangerous dynamic duo in breast cancer. Cancer Lett, 2012. 324(2): p. 142-51. Gazi, E., et al., Direct evidence of lipid translocation between adipocytes and prostate cancer cells with imaging FTIR microspectroscopy. J Lipid Res, 2007. 48(8): p. 1846-56. Nieman, K.M., et al., Adipocytes promote ovarian cancer metastasis and provide energy for rapid tumor growth. Nat Med, 2011. 17(11): p. 1498-503. Nomura, D.K., et al., Monoacylglycerol lipase regulates a fatty acid network that promotes cancer pathogenesis. Cell, 2010. 140(1): p. 49-61. Ducharme, N.A. and P.E. Bickel, Lipid droplets in lipogenesis and lipolysis. Endocrinology, 2008. 149(3): p. 942-9. Kuhajda, F.P., Fatty acid synthase and cancer: new application of an old pathway. Cancer Res, 2006. 66(12): p. 5977-80. Kim, E.K., et al., C75, a fatty acid synthase inhibitor, reduces food intake via hypothalamic AMPactivated protein kinase. J Biol Chem, 2004. 279(19): p. 19970-6. Hernlund, E., et al., Potentiation of chemotherapeutic drugs by energy metabolism inhibitors 2deoxyglucose and etomoxir. Int J Cancer, 2008. 123(2): p. 476-83. Wang, W. and K.L. Guan, AMP-activated protein kinase and cancer. Acta Physiol (Oxf), 2009. 196(1): p. 55-63. Nanni, P., et al., TS/A: a new metastasizing cell line from a BALB/c spontaneous mammary adenocarcinoma. Clin Exp Metastasis, 1983. 1(4): p. 373-80. Zaugg, K., et al., Carnitine palmitoyltransferase 1C promotes cell survival and tumor growth under conditions of metabolic stress. Genes Dev, 2011. 25(10): p. 1041-51. Linher-Melville, K., et al., Establishing a relationship between prolactin and altered fatty acid betaoxidation via carnitine palmitoyl transferase 1 in breast cancer cells. BMC Cancer, 2011. 11: p. 56. Lafontan, M. and D. Langin, Lipolysis and lipid mobilization in human adipose tissue. Prog Lipid Res, 2009. 48(5): p. 275-97. Haemmerle, G., et al., Defective lipolysis and altered energy metabolism in mice lacking adipose triglyceride lipase. Science, 2006. 312(5774): p. 734-7. Nomura, D.K., et al., Monoacylglycerol lipase exerts dual control over endocannabinoid and fatty acid pathways to support prostate cancer. Chem Biol, 2011. 18(7): p. 846-56. Louie, S.M., L.S. Roberts, and D.K. Nomura, Mechanisms linking obesity and cancer. Biochim Biophys Acta, 2013. Meulle, A., et al., Positive regulation of DNA double strand break repair activity during differentiation of long life span cells: the example of adipogenesis. PLoS One, 2008. 3(10): p. e3345. 14 30. 31. 32. 33. 34. 35. Weaver, V.M., et al., Reversion of the malignant phenotype of human breast cells in three-dimensional culture and in vivo by integrin blocking antibodies. J Cell Biol, 1997. 137(1): p. 231-45. Andarawewa, K.L., et al., Stromelysin-3 is a potent negative regulator of adipogenesis participating to cancer cell-adipocyte interaction/crosstalk at the tumor invasive front. Cancer Res, 2005. 65(23): p. 10862-71. Daviaud, D., et al., TNFalpha up-regulates apelin expression in human and mouse adipose tissue. FASEB J, 2006. 20(9): p. 1528-30. Vert, J.P., et al., An accurate and interpretable model for siRNA efficacy prediction. BMC Bioinformatics, 2006. 7: p. 520. Muller, C., et al., Inhibition of Ku heterodimer DNA end binding activity during granulocytic differentiation of human promyelocytic cell lines. Oncogene, 2001. 20(32): p. 4373-82. Zaugg K., et al., Carnitine palmitoyltransferase 1C promotes cell survival and tumor growth under conditions of metabolic stress. Genes Dev. 2011 May 15;25(10):1041-51. 15 B Adipocytes Glycerol release(µM) Murine 2500 C Human NC TG content (fold) 2.5 2.0 1.5 ** 1.0 0.5 0.0 NC NC Perilipin 2000 1500 1000 500 0 C C Nucleus Merge pHSL ** 2000 1500 1000 500 i M C CM Ad C CO ZR EC Z R HM D 0 i M C CM Ad C CO M EC M U S HM SU Nucleus Merge Adipocytes + SUM CM Adipocytes + SUM CM Adipocytes + HMEC CM Adipocytes + HMEC CM Adipocytes Adipocytes C 2500 *** Glycerol release(µM) A C 7 6 5 4 3 2 1 0 1000000 C 6 * 5 4 3 2 1 NC C C 10000 Adipocytes 750000 ZR 75.1 7500 * dpm dpm NC 0 NC G F ** TG content (fold) ZR 75.1 TG content (fold) NC SUM159PT E 500000 ** 250000 0 *** 5000 ** 2500 0 NC C 3 days NC C 5 days NC C 3 days NC C 5 days Figure 1. Lipid transfer from adipocytes to cancer cells. (A) Left, mature murine and human adipocytes cocultivated in the presence (C) or in the absence (NC) of ZR 75.1 tumor cell were stained with red oil. Right, the TG content was dosed in murine adipocytes. (B) Glycerol release is detected in 3T3-F442A mature adipocytes treated or not (Adi) with normal mammary epithelial cells (HMEC) and breast tumor cells (ZR 75.1, SUM159PT) conditioned medium (CM) for 3 days. In certain experiments, adipocytes were cocultivated (COC) with the indicated tumor cells. (C, D) Immunofluorescence staining using confocal microscopy for perilipin and phosphorylated HSL (p-HSL) expression (in green) in mature adipocytes alone and mature adipocytes treated with HMEC and SUM159PT conditioned medium (CM) for 3 days (scale bars, 20µM). Nucleus were labeled with TO-PRO-3 (in blue). (E) Left, lipid accumulation (staining using fluorescent dye Bodipy 493/503, upper panel, or red oil, lower panel, in ZR 75.1 cells cultured alone or with murine mature adipocytes for 3 days. Right, the TG content was dosed in ZR 75.1 cells in cells cocultivated (C) or not (NC) with adipocytes. (F) Left, lipid accumulation in SUM159PT cocultivated (C) or not (NC) with adipocyes, shown after staining with Bodipy (left) or by measure of TG content (right). (G) Murine adipocytes that were labeled with radioactive palmitate during in vitro differentiation were cocultivated in the presence (C) or absence (NC) of ZR 75.1 tumor cells for 3 and 5 days. The redioactivity level was detected in both adipocytes and tumor cells. Bars and errors flags represent the means ± SD of at least three independent experiments; statistically significant by Student’s t-test, * p < 0.05, ** p<0.01, *** p<0.001. A 800 0.06 ** 400 0 C2C12 B HMEC SUM NC C SUM ZR NC NC C 3000 * 2000 1000 0 ZR C2C12 HMEC SUM 0.6 NC C 0.4 * 0.2 0 ZR ** SUM ZR C C CV OXPHOS *** 4000 Ratio (comp/total) Complete FAO (nmol/g) *** 1200 NC C Incomplete FAO (nmol/g) 0.08 1600 NC C III C IV C II C CI actin 800 E * * 600 400 200 0 24 TG content (fold) Complete FAO (nmol/g) D NT 1µM 18 pAMPK AMPK β-actin NC C 1µM C+E 120 ATP production (arbitrary units) G C C+E ** 30µM etomoxir F NC+E C * 6 etomoxir NC NC+E 12 0 10µM 30µM NC ** * 90 60 30 0 NC NC+E C C+E Figure 2. In the presence of adipocytes, co-cultivated breast cancer cells undergo a metabolic switch towards mitochondrial Fatty acid β-oxidation. (A) Complete (left panel) and incomplete (middle panel) FAO in HMEC and breast tumor cells (ZR 75.1 and SUM159PT cultured alone (NC) or with murine adipocytes (C) (the myoblast cell line C2C12 is used as a positive control). The ratio between incomplete and complete FAO was calculated and reflect FAO efficiency (right panel). (B) Expression of mitochondrial OXPHOS complexes determined by Western blot in breast tumor cells cultured alone (NC) or with murine mature adipocytes (C). Actin is shown as a control for equal protein loading. (C) Transmission electron microscopy pictures showing pronounced ultrastructural changes in ZR 75.1 cells co-cultivated (C) with mature 3T3-F442A for 4 days as compared to non-cultivated (NC) cells. Scale bars, from left to right: 5μm-2μm-1μm. (D) Complete FAO levels in ZR 75.1 treated or not (NT) with increasing doses of Etomoxir. (E) Left, the TG content was dosed in non-cultivated (NC) and co-cultivated (C) ZR 75.1 cells in the presence of increasing doses of etomoxir. Right, confocal microscopy images of lipid accumulation (green) in non-cultivated (NC) and co-cultivated (C) ZR 75.1 cells in the presence of 30μM Etomoxir (NC+E, C+E) for 3 days (nuclei in blue). (F) Immunoblot for total and p-AMPK in non-cultivated (NC) and co-cultivated (C) ZR 75.1 cells in the presence of 30μM Etomoxir (NC+E, C+E) for 3 days. (G) ATP production was evaluated in non-cultivated (NC) and co-cultivated (C) ZR 75.1 cells in the presence of 30μM Etomoxir (NC+E, C+E). Bars and errors flags represent the means ± SD of at least three independent experiments; statistically significant by Student’s t-test, * p < 0.05, ** p<0.01, *** p<0.001. Cell proliferation Absorbance Units (570nm) * 75 50 25 0 NC C+E C C+E NC C+E C C+E N N 0% C NS 1.2 120 NS Number of cells per field * 0.9 0.6 0.3 0.0 60 30 0 NC NC+E C C+E E C 0.8 NS 0.6 0.4 0.2 0.0 NC NC+E C C+E 10% D ** 7.5 Number of metastasis NC (n=6) NC+E (n=7) C (n=7) C+E (n=8) ** C 5.0 2.5 C+E 0.0 NC NC+E C C+E NC+E C ZR 75.1 C+E Relative mRNA level NC NC C+E C C+E N C+ 0% C+E E E NC C+ N NC+E C Cell proliferation * * 90 10% NC SUM159PT Cell invasion Absorbance Units (570nm) Cell invasion 100 Number of cells per field B ZR 75.1 E-cadherin 1.0 *** 0.8 SUM159PT NS Relative mRNA level A 0.6 0.4 0.2 0.0 NC NC+E C Actin C+E ZR 75.1 NC NC+E C C+E NS ** 0.4 0.3 0.2 0.1 0.0 NC NC+E C C+E SUM159PT NC NC+E C C+E NC C Snail adipocytes ** 0.4 H T CP sh 1a NS 60 0.75 0.50 *** 0.25 0.00 C sh l ro 1a T CP Cell growth 1.2 0.8 0.4 0.0 0 sh shControl shControl NC 24 48 hours 72 shCPT1a 1.2 0.9 0.6 0.3 0.0 NC C shControl shCPT1a shCPT1a C NC C E-cadherin shControl shCPT1a NC 30 0 I 1.00 t on K ** 90 sh l tro n Co CPT1a β-actin SUM T47D 120 C CPT1a β-actin 0.2 HMEC ZR ZR 75.1 NC Cell proliferaion (by fold) *** Absorbance Units (570nm) ** 0.6 Number of cells per field J 0.8 0.0 β-actin G Relative mRNA level Relative mRNA level F C NC C Snail NC C NC C NC C NC 0% 10% β-actin C shCon shCPT shCon shCPT Actin Figure 3. Metabolic crosstalk between adipocytes and breast cancer cells contribute to EMT and tumor invasion. (A, B) 1x105 ZR 75.1 cells or 5x104 SUM159PT cells were grown for 3 days on Transwells in the presence or not of mature adipocytes and treated or not with Etomoxir. After 3 days, cells were dissolved and colorimetric absorbance of solution was measured for proliferation. In other wells, cells were trypsinized and used for Matrigel invasion assay against medium containing either 0% or 10% FCS. (C) BALB/c nude mice were inoculated with murine breast cancer cells TS/A cocultivated in the presence (C) or absence (NC) of adipocytes treated with 30μM Etomoxir (NC+E, C+E) during 4 days prior to tail vein injection. Left, representative picture of lungs from each group harvested at necropsy after 25 days. Right, number of tumor nodules on the surface of the lung from each group of mice. (D) Left, H&E stained transverse sections of host lungs from mice injected with TS/A cells previously cocultivated with adipocytes treated with (C+E) or without Etomoxir (C) during 4 days (original magnification Х2). Examples of invading lesions are shown by arrows. Right, magnified views of invading lesions. (E) Left, ZR 75.1 cells were grown on coverslips in inserts which were cocultivated in the presence (C) or absence (NC) of adipocytes treated with 30μM Etomoxir (NC+E, C+E). After 3 days, cells were fixed and stained with E-cadherin and Actin antibody. Nucleus were labeled with TO-PRO-3 (scale bars 20μm). Relative mRNA expression (upper right) or Western blots of Snail (lower, right) in ZR 75.1 and SUM159PT incubated in similar conditions. (F) Relative mRNA expression of CPT1a in HMEC and breast tumor cells. (G) Immunoblot for CPT1a in non-cultivated (NC) and co-cultivated (C) ZR 75.1 cells for 3 days. (H) Quantification of the mRNA and protein levels of CPT1a in ZR 75.1 cells transfected with CPT1a shRNA and CPT1a shVector. (I) Left, cell proliferation of ZR75.1 transfected with control or CPT1 ShRNAs determined by MTT assays. Right, 1Х105 CPT1a shRNA and CPT1a shVector cells were grown on Transwells in the presence or not of mature adipocytes for 3 days and the cells number was determined after this incubation period. (J) CPT1a shRNA and CPT1a shVector cells were grown on Transwells in the presence or not of mature adipocytes. After 3 days, cells were trypsinized and used for Matrigel invasion assay towards a medium containing either 0% or 10% FCS. (K) Left, Immunofluorescence using confocal microscopy for E-cadherin (green) and Actin (red) in CPT1a shRNA and CPT1a shVector cells cocultivated in the presence (C) or absence (NC) of adipocytes for 3 days. Nuclears were labeled with TO-PRO-3 (scale bars 20μm). Right, the Snail protein expression was detected by western blot. Bars and errors flags represent the means ± SD of at least three independent experiments; statistically significant by Student’s t-test, * p < 0.05, ** p<0.01, *** p<0.001. * * 1.5 1.0 0.5 0.0 2hr 24hr 48hr 150 * ** G AT sh L β-actin CF M 7D T4 M SU DA non-aggressive ZR -2 T4 M NC HSL HSL MAGL MAGL β-actin β-actin 0 2hr 24hr 0.8 0.4 0 24 48 hours shControl aggressive T47D C NC SUM C NC MDA C NC C ATGL 50 48hr F 0.0 ZR -7 100 Cell growth 1.2 EC HM ATGL TG content (fold) ATGL tr n Co sh ol NC C * E Absorbance Units (570nm) D 200 72 4 shControl shATGL 3 G 2 1 0 NC C shATGL H 1.2 0.9 0.6 0.3 0.0 NC C NC C NC ** 90 60 NS 30 0 shControl shATGL NC NC C NC 0% shATGL C C C NC C shCon shATGLshCon shATGL shControl I 120 Number of cells per field NC C C non-aggressive aggressive Cell proliferaion (by fold) 2.0 Glycerol release (µM) B TG content (mg/l/103 cells) A NC 10% C shControl shATGL NC C NC C E-cadherin Snail β-actin J Tumor center Actin Invasive front ATGL Normal epithelial ATGL MAGL HE HSL K ** 1.0 0.5 0.0 Grade I Grade II Grade III 1.5 0.07 1.0 0.5 0.0 ER - ER + 2.0 1.5 0.08 1.0 0.5 0.0 PR - PR + 2.0 ** 1.5 1.0 0.5 0.0 HER2 - HER 2 + ATGL expression (staining intensity) *** ATGL expression (staining intensity) 1.5 ATGL expression (staining intensity) 2.0 ATGL expression (staining intensity) ATGL expression (staining intensity) L 2.0 1.5 0.1 1.0 0.5 0.0 LN - LN + Figure 4. Breast cancer cells possess an ATGL-dependent lipolytic pathway that favor cancer aggressiveness in the presence of adipocytes. (A) Left, ZR 75.1 cells were cocultivated in the presence (C) or absence (NC) of adipocytes for 3 days, then the adipocytes were removed. The TG content in tumor cells was dosed after 2hr, 24hr and 48hr. Right, Glycerol release was detected at the same time. (B) ATGL, HSL, MAGL protein levels were analyzed in HMEC and non-aggressive breast tumor cells (ZR 75.1, MCF-7 and T47D) and aggressive breast tumor cells (SUM159PT, MDA MB231 and T4-2) by Western blotting. (C) ATGL, HSL, MAGL protein levels were analyzed in tumor cells cocultivated in the presence (C) or absence (NC) of adipocytes for 3 days. β-actin was blotted as a loading control. (D) ATGL protein levels were analyzed in ZR 75.1 cells transfected with ATGL shRNA and ATGL shVector. (E) Cell proliferation of ZR75.1 transfected with control or ATGL ShRNAs determined by MTT assays. (F) TG content was detected in ATGL shRNA and ATGL shVector cells after cocultivated with adipocytes for 3 days. (G) 1Х105 ATGL shRNA and ATGL shVector cells were grown on Transwells in the presence or not of mature adipocytes for 3 days and the cells number was determined after this incubation period. (H) ATGL shRNA and ATGL shVector cells were grown on Transwells in the presence or not of mature adipocytes. After 3 days, cells were trypsinized and used for Matrigel invasion assay in a medium containing either 0% or 10% FCS for 24hr of invasion assay. (I) Right, Immunofluorescence using confocal microscopy for E-cadherin (green) and Actin (red) in ATGL shRNA and ATGL shVector cells cocultivated in the presence (C) or absence (NC) of adipocytes for 3 days. Nucleus were labeled with TO-PRO-3 (scale bars 20μm). Left, the Snail protein expression was detected by western blot. (J) Representative immunohistochemical staining (bottom) for ATGL obtained in TMA in areas containing or not adipocytes. (K) Representative experiment of ATGL staining obtained in a tumor biopsie, in the center of the tumor and at the tumor invasive front. (L) Expression of ATGL as a function of tumor characteristics in the series of 69 tumors included in the TMA. Bars and errors flags represent the means ± SD of at least three independent experiments; statistically significant by Student’s t-test, * p < 0.05, ** p<0.01, *** p<0.001. FA (nmol/mg) Lipid amont (nmol/mg) * 50 25 0 CHOE DG TG 300 Chol NC C * 200 100 0 180 SFA (nmol/mg) NC C 75 SFA MUFA PUFA 120 * NC C * 60 0 C 16:0 C 18:0 Supplementary Figure 1. Cocultivated tumor cells exhibit increase in TG and saturated free fatty acids. ZR75.1 cells were cocultivated (C) or not (NC) in the presence of adipocytes. Total lipids were extracted and analyzed by high performance thin layer chromatography (HPTLC), and electrospray ionization mass spectroscopy (ESI-MS). Left panel, dosage of the different lipid species. middle and right panels, dosage of FFAs. Abbreviations : CHOE, esterified cholesterol, Chol, cholesterol, SFA Saturated fatty acids, MUFA, monounsaturated fatty acids, PUFA, polyunsaturated fatty acids. Bars and errors flags represent the means ± SD of at least three independent experiments; statistically significant by Student’s t-test, * p < 0.05. NS NS 4 SUM159PT NC C T47D NC C TG content (fold) ZR 75.1 NC C FAS Ku 70 * 3 2 1 0 NC C 10µM 20µM C75 Supplementary Figure 2. The increase of TG content in cocultivated tumor cells is not dependent of lipogenesis. Left panel: ZR75.1, SUM159PT and T47D cells were cocultivated (C) or not (NC) in the presence of adipocytes. After three days, the proteins were extracted and used for the detection of Fatty Acid Synthase (FAS) expression. Right panel:ZR75.1 were cocultivated in the presence or not of adipocytes and treated or not with the FAS inhibitor C75 for three days. After this incubation period, the TG content of tumor cells was dosed. Bars and errors flags represent the means ± SD of at least three independent experiments; statistically significant by Student’s t-test, * p < 0.05. NS, not significant SUM159PT * TG content (fold) 10.0 7.5 * 5.0 2.5 0.0 NC C 1µM 30µM etomoxir Supplementary figure 3. Etomoxir increases TG content in cocultivated SUM159PT tumor cells. SUM159PT cells were cocultivated (C) or not (NC) in the presence of adipocytes, and treated or not with etomoxir for 3 days. After this time, TG content was dosed in tumor cells Bars and errors flags represent the means ± SD of at least three independent experiments; statistically significant by Student’s t-test, * p < 0.05. 3000 Ratio (comp/total) Complete FAO (nmol/g) A 2000 1000 0 NC C 0.6 0.4 0.2 0.0 C TG content (mg/l/103 cells) 0.3 0.2 0.1 0.0 NC C Absorbance Units (570nm) B 0.8 0.4 NC C Cell Invasion 0.3 0.2 0.1 0.0 NC C+E C C+E NC C+E C C+E N N 0% 10% Supplementary figure 4. The TS/A cell line exhibit a similar crosstalk with adipocytes in vitro. A, Complete (left panel) and complete to incomplete ratio of FAO in TSA/cells cocultivated (C) or not (NC) in the presence of adipocytes. After this time, TG content was dosed in tumor cells (B) and invasion assays were performed in cells cocultivated or not in the presence of adipocytes and treated or not with etomoxir (C). A B ZR 75.1 NT IL IL TG content (mg/l/103 cells) NT 1.8 ATGL 1.2 HSL 0.6 0.0 SUM159PT NT IL MAGL actin NT IL D * NT IL ** 1.2 0.6 0.0 2hr 24hr 48hr 200 NT IL 150 100 50 0 2hr 24hr 48hr 45 Number of cells per field 1.8 Glycerol release (µM) TG content (mg/l/103 cells) C 30 15 0 NT 0% IL NT IL 10% Supplementary figure 5. Treatment with intralipids do not stimulate ATGL expression and activity, nor tumor cell invasion. ZR 75.1 cells were exposed or not to 0.025% intralipids (IL) for three days. A, the TG content is show after staining with bodipy (left) or dosage (right). B, Expression of ATGL in SUM159PT and ZR75.1 cells exposed or not for three days to intralipids. C, Cells were exposed to IL for three days, then washed. The TG content and the lipolysis activity was measured at the indicated times after IL removal. D, Invasion assays performed in ZR75.1 cells exposed or not to IL. 0.0 Grade I Grade II Grade III 3.0 2.0 1.0 0.0 HER2 - HER 2 + 3.0 2.0 1.0 0.0 ER - ER + LN - LN + MAGL expression (staining intensity) 1.0 MAGL expression (staining intensity) 2.0 MAGL expression (staining intensity) MAGL expression (staining intensity) MAGL expression (staining intensity) 3.0 3.0 2.0 1.0 0.0 PR - PR + 3.0 2.0 1.0 0.0 Supplementary figure 6. MAGL expression is not associated to tumor aggressiveness. MAGL expression was stratified according to tumor characteristics. Abbreviations: ER, oestrogen receptor, PR, progesterone receptor, LN, lymph nodes. Table 1. Clinical characteristics of the patients used in the TMA. CONCLUSIONS AND PERSPECTIVES 94 Conclusions and perspectives There is now accumulative evidence that cells immediately adjacent to a tumor are not only passive structural elements but also active actors in tumor progression. Among the many different cell types surrounding breast cancers, the most abundant are those that compose mammary adipose tissue, mainly adipocytes and progenitors. Since current epidemiological evidence convincingly showed that obesity is associated with greater breast cancer specific mortality and poor disease free survival [424], the involvement of fat cells in the progression of cancer appears of major interest. During my thesis, I participate to the efforts of my team to characterize the phenotypical changes induced by tumor cells in surrounding adipocytes. We have defined during these 4 years, two new stromal populations CAAs (Experimental article 1) and ADFs (Experimental article 2). In addition, we have shown that these modified adipocytes strongly stimulate tumor local and distant invasion. This effect appears to be dependent of different soluble signals such as inflammatory mediators (IL6) by CAAs or potentially through the secretion of the S100A4/FSP-1 protein by CAAs/ADFs. Moreover, during my thesis, I have shown that a metabolic crosstalk is established between cancer cells and tumor-surrounding adipocytes (Experimental article 3). The FFAs that are uptaken and stored by breast cancer cells are used for FAO and our results highlight the important and rather unexpected role of FAO in tumor cell invasion. Furthermore, we show here for the first time that ATGL expressed by tumor cells plays a key role in regulating lipid network and invasiveness in breast cancer cells cocultivated with adipocytes. Of importance, this enzyme is expressed at the tumor invasive front of human breast tumors where cancer cells and adipocytes meet. Taken together, these results offer new opportunities to inhibit the tumor/stroma crosstalk in order to inhibit tumor progression. In addition, our work raises the question of the amplification of this negative crosstalk in obesity conditions with appropriate in vitro and in vivo models that I will discuss here. The peritumoral adipocytes: characterization of two new stroma cell populations CAAs and ADFs Adipocytes surrounding tumors exhibit profound phenotypic changes that include both morphological and functional alterations. We have shown that adipocytes cultivated with cancer cells exhibit an altered phenotype characterized by a delipidation, a decreased in late adipose markers (HSL, APN, resistin and aP2) associated with the occurrence of an activated state marked by overexpression of proteases (such as MMP-11 and PAI-1), and pro-inflammatory cytokines (IL6 and IL-1β). We named these tumor-surrounding adipocytes, CAAs [68]; [425]. It is important to underline that the occurrence of CAAs (defined by the decrease in adipocyte size and loss of lipid content) is not restricted to breast cancer and is also observed in all the invasive cancer that reach 95 AT such as disseminated ovarian cancer, invasive colon, prostate and melanomas (review [426], our own unpublished results). However, whether the secretion profile that we defined in breast cancer is found also in other tumor types, remain to be determined. In tumors growing in an adipose tissue-dominated microenvironment such as breast cancer, adipocytes disappear, fibroblast-like cells accumulate, and a desmoplastic stroma ensues. As the origin of CAFs is unclear, we postulated that under “tumor pressure”, part of the CAAs population might revert to fibroblast-like cells therefore contributing to a sub-population of CAFs. We have demonstrated for the first time using both in vitro and in vivo approaches (including human samples) that part of the CAFs originate from the “dedifferentiation” of mature adipocytes, a process that is initiated at the tumor invasive front. We named this new stromal cell population ADFs. One of the very important characteristic of ADFs is that they express FSP-1 but not SMA protein. The expression of this protein might have important functional impact since it has been shown that FSP-1 express by fibroblasts could stimulate tumor invasion [427], as discussed in the following paragraph. As for CAAs, ADFs are probably present in other tumors than breast. For example, in both ovarian cancer and renal cell cancer, tumor cells replace and invade the adipocyte microenvironment and the adipocytes vanish. Histological studies of these and other abdominally metastasizing cancers (colon, gastric, pancreatic) confirm that adipocytes at the tumor invasive front become smaller and the number of fibroblast-like cells increases [426]. Again it would be very important to determine whether or not ADFs exhibit the same phenotype (FSP1+/ SMA-) regardless of the tumor at proximity. Other important phenotypical changes might occur in the AT at proximity of tumor cells that are not described in the works presented here. In fact, it has been described that WAT can acquire BATlike properties which are generally referred as “browning” and this have been proven to be of great of importance in protecting against diet-induced obesity and metabolic diseases [428]. BAT activation is mediated by thyroid hormone and β3-adrenergic signaling pathways, which stimulate β-oxidation of fatty acids and heat production via the electron transport chain-uncoupling protein UCP1 [429]; [430]. Under the “tumor cell pressure”, the metabolic change occurring in adipocyte is still unknown. Our preliminary result showed that after being co-cultivated with tumor cells, adipocytes acquire UCP1 expression which suggest that they can undergo the “browning process”. Given BAT huge capacity for energy expenditure and thermogenesis, it would be of high interest to investigate this aspect in both cancer progression and cachexia. What are the signals emanating from tumor cells that explain the occurrence of CAAs/ADFs? In the data presented, we show that the occurrence of the ADF phenotype depends on the reactivation of Wnt/β-catenin pathway in response to Wnt ligands (Wnt3a) secreted by tumor cells 96 and blocking this pathway partially reversed the ADF phenotype. However, these results need to be confirmed in vivo by showing for example that in human tumors the FSP1+ population also express an activated Wnt/ -catenin pathway. An important finding of my study is that in addition to dedifferentiation, the CAAs exhibit enhanced lipolytic activity, both processes probably contributing to the delipidation of tumor surrounding-adipocytes. The best known mechanism regulating adipocytes lipolysis is the activation of the β-adrenergic G protein-coupled receptors on the plasma membrane that generates a signaling cascade activating cAMP-dependent PKA. As we have described in the introduction, other pathways are able to induce lipolysis like the inhibition of the α2-adrenergic receptors, or the involvement of proinflammatory cytokines IL-6 and TNF-α [175]. For the moment, the tumorderived signals that contribute to induce lipolysis in adipocytes in our study remain unresolved. In the study of Nieman et al., the use of the β-adrenergic antagonist, propranolol, partially reverses the lipolysis induced by ovarian tumor cells. However, in our hands, propranolol did not inhibit breast cancer cell-induced lipolysis (data not shown). The use of the α2-adrenergic receptor agonist UK14304 as well as IL-6 blocking antibody (TNF was not detected in the supernatant of our breast cancer cells) has no effect as well (data not shown). Therefore, the differences between our results and the study of Nieman [71], clearly suggest that the lipolysis in tumor surrounding adipocytes might be differentially regulated depending on the tumor type. We are currently addressing the role of AMP-activated protein kinase (AMPK) in tumor-induced lipolysis using either AMPK pharmacological activator AICAR or inhibitor Compound C. To date, the role of AMPK in regulation of adipocytes lipolysis remains controversial. Some studies have described its anti-lipolytic role, whereas other studies have suggested the converse [431]; [432]. However, given the activation of AMPK in our coculture model, we think that this hypothesis deserves further investigation. CAAs modify the cancer cell characteristics leading to a more aggressive behavior through secretions of soluble factors. Meanwhile, we found that both CAAs and ADFs strongly enhance the aggressiveness of tumor cells both in vitro and in vivo. CAAs secrete adipokines which stimulate the adhesion, migration, and invasion of tumor cells. We have shown that CAAs overexpress IL-6 both in vitro and in vivo and that, in the coculture system, IL-6 blocking antibody inhibits the CAAs-dependent proinvasive effect. Interestingly, the human breast tumors of larger size and/or with lymph nodes involvement exhibit the higher levels of IL-6 in tumor surrounding adipocytes. Such an inflammatory state in the tumour-surrounding adipose tissue has also been described for other cancers. High levels of IL-6 were found in the periprostatic adipose tissue of tumor-bearing patients and the levels of IL-6 97 correlated with the aggressiveness of the prostate tumor [269], Such results are not surprising since IL-6 has been shown to induce EMT [272]. The secretion of IL-6 is not specific to adipocytes since this proinflammatory cytokine is also secreted by TAMs/CAFs [433]; [434]. Obesity is associated to systemic low-grade inflammation, which has been suggested to have an important role in the pathogenesis of cancer. In obesity, the expanding visceral AT makes a different substantial contribution to the development of obesity-linked inflammation via enhanced secretion including IL-6 [238]. To date, a new therapeutic approach to block the actions of IL-6 by use of a humanized anti-IL-6R antibody has been proven to be therapeutically effective for rheumatoid arthritis, systemic juvenile idiopathic arthritis and Castleman`s disease [435] and these antibodies are currently evaluated in cancer patients. Therefore, it would be of high interest to stratify the patient population and to investigate if there is a higher effect in obese patients. We found that CAAs also exhibit increased expression of MMP-11. MMP-11 plays a role in adipogenesis and acquisition of fibroblast-like phenotypes of adipocytes [70]. Overexpression of MMP-11 is associated with poor clinical outcome in patients in numerous carcinomas [436]. Furthermore, MMP11 combine with collagen VI (COLVI) contribute to ECM remodeling. Adipocyte-derived COLVI is abundantly expressed in tumor-surrounding adipocytes and is involved in mammary tumor progression in vivo [257]; [69]. Increase local fibrosis and its permanent remodeling (generating ECM components functioning as signaling molecules) have been clearly implicated in tumor progression. These results underline that the contribution of CAAs to tumor progression is probably like CAFs or TAMs, multifactorial. Another very interesting candidate is S100A4, also known as FSP-1, that belongs to the S100 protein family of small Ca2+-binding protein, Members of this family have been implicated in cytoskeletal-membrane interactions, calcium signal transduction, and cellular growth and differentiation [437]. S100A4 is localized in the nucleus, cytoplasm, and in extracellular space and in cancer possesses a wide range of biological functions, such as regulation of angiogenesis, cell survival, motility, and invasion. Accordingly, its expression is tightly correlated with poor prognosis in patients with numerous types of cancer [438]. Several investigations have reported the expression of S100A4/FSP-1 in lymphocytes, macrophages, endothelium and smooth muscle cells of vessel walls adjacent to tumor tissue in various organs, suggesting the involvement of FSP-1 in the tumor/stroma crosstalk [439]; [440]; [441]; [442]. It has been shown that S100A4 is markedly up-regulated in activated fibroblasts both in normal conditions (e.g., wound healing) and in tumor stroma [443]; [444]. Coculture of fibroblasts and tumor cells stimulated the release of S100A4 from fibroblasts. When S100A4 is released into the extracellular compartment, it strongly contributes to tumor progression by creating a favorable microenvironment for tumor invasion and neovascularization (activation of MMPs, VEGF, induction of the key transcriptional EMT-regulator 98 Snail as well as NF-κB) [445]; [427]; [446]; [447]. Our results clearly shown that ADFs express S100A4/FSP-1, an expression that could contribute to stimulate tumor invasion. Thus, it would be of high interest to investigate whether or not FSP-1 expression is the key event that contributes to ADFs-dependent stimulation of cancer invasion, by down-regulating its expression by gene repression strategies. If positive results are obtained, the representation of this FSP1+ population in breast cancers in obese versus lean conditions (both animal and human models) should be studied. In fact, it is reasonable to speculate that the increase of the ADFs population in obese patients could contribute to the poor prognosis observed. Adipocyte/tumor cell metabolic coupling contribute to cancer progression The best characterized and most widely appreciated metabolic phenotype observed in tumor cells is the “Warburg effect”, which is a shift of ATP generation from oxidative phosphorylation to glycolysis, even under normal oxygen concentrations. Warburg originally proposed that the elevated aerobic glycolysis in cancer cells was due to a permanent impairment of mitochondrial oxidative phosphorylation (OXPHOS). However, recent investigations found that defects of mitochondrial OXPHOS are not common in spontaneous tumors and that the function of mitochondrial OXPHOS in most cancers is intact [326]; [319]. According to the “reverse Warburg effect”, epithelial cancer cells induce aerobic glycolysis in CAFs which produce lactate, ketones and pyruvate that as fuels for tumor cells in a subset of micro-environmental setting [328]; [329]. According to this concept, we speculated that CAAs may also contribute to the “metabolic symbiosis” with tumor cells. In a study published during my thesis, Nieman et al demonstrated that lipid transfer from adipocytes to cancer cells fuel the tumor growth in vitro and in vivo [71]. Inhibiting the adipocytes released of FFAs, through inhibition of the small Fatty Acid Binding Protein 4 (FABP4) expression, impaired this tumor promoting effect [71]. The fact that ovarian cancer cells exhibit FAO that is slightly upregulated in the presence of adipocytes suggest, without demonstrating it directly, that these FFAs are used as an energy source for cancer cells [71]. During my PhD work, we showed that the FFAs released during the lipolysis process by adipocytes are transferred, processed and stored in tumor cells as triglycerides (TG), contained in lipid droplets. When needed, these TG can be released as FFAs by an ATGL-dependent lipolytic pathway specifically present in tumor cells as shown both in vitro and in human tumors. These released FFAs are used for fatty acid β-oxidation (FAO), an activity present in cancer, but not normal, breast epithelial cells and regulated by coculture with adipocytes. Inhibition of these lipolytic/FAO coupled pathways either by pharmacological or gene repression strategies strongly decreases the invasive abilities of tumor cells that have been cocultivated with adipocytes. 99 Our study underlines a very important link between tumor invasion and FAO. The molecular mechanism contributing to this effect remains for the moment undetermined. AMPK is a central metabolic sensor that, upon phosphorylation, favors energy producing processes by activating βoxidation [448]; [449]. Beside its key role in regulation of cellular energy homeostasis, one study suggested that AMPK is able to modulate Smad3 transcriptional activity, which plays an important role in TGF-β1-induced epithelial-to-mesenchymal transition (EMT) [450]. We observed in our study that cocultivated tumor cells exhibit activation of AMPK and incomplete EMT. Conversely, the FAO inhibitor etomoxir (ETO) efficiently blocked AMPK phosphorylation and reversed EMT process, thus impairing the aggressiveness of cancer cells. Therefore, this molecular link could deserve further investigation. Another very important finding of our study is the fact that ATGL expression is highly regulated by coculture and at the invasive front of human tumors. Regulation of ATGL activity might also be related to AMPK activity. In fact, it has been shown that ATGL is phosphorylated by AMPK, therefore increasing its TAG hydrolase activity [451]. On the opposite, Atgl deficiency in mice decreases mRNA levels of PPAR-α and PPAR-δ target genes. In the heart, this leads to decreased PGC-1α and PGC-1β expression and severely disrupted mitochondrial substrate oxidation and respiration [452]. Until now, expression of these lipases has not been studied in cancer cells with the exception of the work of Nomura et al, showed that MAGL is highly express in aggressive human cancer cells where it regulates a fatty acid network enriched in oncogenic signaling lipids that promotes tumor progression [421]. Our results suggest that in breast cancer, this enzyme might be less important for tumor progression than in melanomas or ovarian cancer [421]. However, our work, like their, sustain the concept that lipogenesis or accumulation of lipid from exogenous sources required a paired lipolytic activity to promote tumor progression. Furthermore, Nomura et al demonstrated that MAGL is part of a gene signature correlated with EMT and support the tumor aggressive behavior [422]. Whether ATGL correlated also with an EMT signature as well remain to be determined. Therefore, inhibition of ATGL expression and activity by selective inhibitors and/or genetic repression strategies should be investigated both in vitro and in vivo to evaluate its effect on tumor progression. Other therapeutic and investigate opportunities: The concept of metabolic coupling between tumor cells and their hosts raises the possibility for new therapeutic avenues. As discussed above, FFAs are another crucial source of metabolic fuel derived from adipocytes, supporting both energetic and anabolic requirements of tumor cells. Therefore, drugs that target lipolysis and FFAs efflux from adipocytes to cancer cells, as well as drugs that 100 interfere with FFA oxidation in cancer cells may provide additional mechanism-based strategies to curb tumor progression. The adipocyte lipid binding protein FABP4 was identified as a key mediator of ovarian-cancer celladipocyte interaction in the host, mediating increased lipid availability leading to a more effective support of metastatic growth [71]. The “metabolic coupling” can be reversed by inhibiting lipid transport from adipocytes to carcinoma cells. Pharmaceutical companies have since begun to explore the potential for FABP4 inhibition in oncology [358]. In an in vitro study, adipocytes treated with BMS309403 (FABP4 small-molecule inhibitor) showed decrease of fatty acids uptake [361] and inhibition of lipolysis ability [362]. However, in our lab, we found that there is dramatical decrease of FABP4 expression in cocultivated adipocyte (data not shown). Breast tumor cells poorly express this protein and its expression was not regulated after coculture. Furthermore, when we used FABP4 inhibitor BMS309403, we observed only a slight effect of inhibition of tumorinduced adipocyte lipolysis and TG accumulation in tumor cells (data is not shown). These results suggested breast tumor cells may not dependent on FABP4 but other member of FABP family like FABP3, FABP7 or FABP9 [453] which are also expressed in mammary gland [358]. Other proteins that have been implicated as functionally linked to fatty acid transport like Caveolin-1, Fatty acyl CoA synthetases (FATP and ACSL) and Fatty acid translocase (FAT/CD36) [358] might also represent good targets whose function in adipocytes/cancer crosstalk needs to be investigated. Two key enzymes in the FAO pathway are particularly interesting as potential targets for pharmacological intervention. 1) CPT1 is considered the rate-limiting enzyme in FAO and can be pharmacologically targeted. We and others [401] found that etomoxir has promising anti-tumoural effects in vitro and in vivo. However, its clinical use could not be envisioned since it has been reported that etomoxir treatment in patients results in hepatotoxicity [454]. Other CPT1 inhibitor, Perhexiline has been approved in Australia and some Asian countries for the treatment of heart disease but its effect on tumor progression remains unknown. 2) Drugs that target 3ketoacylthiolase (3-KAT), which catalyses the final step in FAO, are also available [455]. Trimedazidine [456] and ranolazine [457] which are 3-KAT inhibitors, are both licensed in Europe for the treatment of angina, and deserve also further investigation in adipocytes/cancer crosstalk. All the drugs information is summarized below. 101 Table 1. Pharmacological tools to manipulate FAO. Carracedo A et al., 2013, Nat Rev Cancer Several mechanisms have been suggested to explain the association between cancer and obesity, involving elevated lipid levels and lipid signaling, inflammatory responses, insulin resistance, and secretion of adipokines. Future area of study is to understand if there is a difference in the interaction of tumor cells with adipocytes in lean as compared to obese individuals. In other words, does activated adipose tissue in obesity, with its high content of inflammatory cells and increased cytokine secretion, higher released level of FFAs will affect the interaction of adipocytes with tumor cells? Currently, conventional techniques used for studying the crosstalk between adipocytes and cancer is performed in 2D monolayer system, which is not compatible with the use of isolated primary adipocytes. In our lab, we have recently successfully set up three-dimensional (3D) coculture system. Coculture of adipocytes isolated from obese and lean mice/patient with human cancer cells will be performed to evaluate if obesity has an impact on tumor progression. For in vivo experiment, one way to assess the systemic role (endocrine/paracrine) of obese adipocytes on cancer progression is to use xenografts models in obese mice. We have recently obtained in the laboratory two models that are syngenic for C57BL/6 mice that is the model of reference for obesity. Therefore, MMTV-Wnt (ER/PR negative mouse mammary tumor cell line) or E0771 (ER positive medullary breast adenocarcinoma cells) will be injected into syngeneic obese and lean, and the effect on obesity on tumor growth, metastasis, angiogenesis, inflammatory state and metabolism 102 will be studied. More clinical studies are also warranted to assess the angiogenesis, fibrosis, inflammation state and lipid transfer in breast tumors with obese setting as well. Figure 21. Dialogue of adipose tissue and cancer in the context of obesity (Lehuede C et al;, 2013, cancers aux feminins). In conclusion, all our data brought in vitro and in vivo evidences that: i) invasive cancer cells dramatically impact surrounding adipocytes; ii) peri-tumoral adipocytes exhibit modified phenotype and specific biological features; iii) CAAs and ADFs play an essential role during the cancer cell invasion of adjacent connective tissues; iv) CAAs modify the cancer cell characteristics/phenotype leading to their more aggressive behavior, by secreting proteases, pro-inflammatory cytokines and by modulating cancer cell metabolism, which is the dedicated part that I develop during my thesis. Our work should help in fine in identifying adipocyte-related molecules as possible intervention points for innovative anticancer strategies. This is of particular interest since recent epidemiological studies have identified obesity as one of the major risk factors for cancer, and a large amount of adipose tissues has been associated with poor prognosis for breast and prostate cancers. The expected striking increase in the incidence of these aggressive cancers in the near future related to obesity turns the knowledge of this field of great impact as it is needed to the development of strategies to prevent and treat this disease. 103 BIBLIOGRAPHIE 104 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. Paget, S., The distribution of secondary growths in cancer of the breast. 1889. Cancer Metastasis Rev, 1989. 8(2): p. 98-101. Petrulio, C.A., S. Kim-Schulze, and H.L. Kaufman, The tumour microenvironment and implications for cancer immunotherapy. Expert Opin Biol Ther, 2006. 6(7): p. 671-84. Joyce, J.A. and J.W. Pollard, Microenvironmental regulation of metastasis. Nat Rev Cancer, 2009. 9(4): p. 239-52. Hanahan, D. and R.A. Weinberg, Hallmarks of cancer: the next generation. Cell, 2011. 144(5): p. 646-74. Dvorak, H.F., Tumors: wounds that do not heal. Similarities between tumor stroma generation and wound healing. N Engl J Med, 1986. 315(26): p. 1650-9. Dvorak, H.F., D.R. Senger, and A.M. Dvorak, Fibrin as a component of the tumor stroma: origins and biological significance. Cancer Metastasis Rev, 1983. 2(1): p. 41-73. Kuperwasser, C., et al., Reconstruction of functionally normal and malignant human breast tissues in mice. Proc Natl Acad Sci U S A, 2004. 101(14): p. 4966-71. Baluk, P., H. Hashizume, and D.M. McDonald, Cellular abnormalities of blood vessels as targets in cancer. Curr Opin Genet Dev, 2005. 15(1): p. 102-11. Hanahan, D. and J. Folkman, Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell, 1996. 86(3): p. 353-64. Ruan, K., G. Song, and G. Ouyang, Role of hypoxia in the hallmarks of human cancer. J Cell Biochem, 2009. 107(6): p. 1053-62. Laderoute, K.R., et al., Opposing effects of hypoxia on expression of the angiogenic inhibitor thrombospondin 1 and the angiogenic inducer vascular endothelial growth factor. Clin Cancer Res, 2000. 6(7): p. 2941-50. Chouaib, S., et al., Endothelial cells as key determinants of the tumor microenvironment: interaction with tumor cells, extracellular matrix and immune killer cells. Crit Rev Immunol, 2010. 30(6): p. 529-45. Hashizume, H., et al., Openings between defective endothelial cells explain tumor vessel leakiness. Am J Pathol, 2000. 156(4): p. 1363-80. Xiong, Y.Q., et al., Human hepatocellular carcinoma tumor-derived endothelial cells manifest increased angiogenesis capability and drug resistance compared with normal endothelial cells. Clin Cancer Res, 2009. 15(15): p. 4838-46. Seaman, S., et al., Genes that distinguish physiological and pathological angiogenesis. Cancer Cell, 2007. 11(6): p. 539-54. Abramsson, A., et al., Analysis of mural cell recruitment to tumor vessels. Circulation, 2002. 105(1): p. 112-7. Morikawa, S., et al., Abnormalities in pericytes on blood vessels and endothelial sprouts in tumors. Am J Pathol, 2002. 160(3): p. 985-1000. Ferrara, N. and R.S. Kerbel, Angiogenesis as a therapeutic target. Nature, 2005. 438(7070): p. 967-74. Kim, R., M. Emi, and K. Tanabe, Cancer immunoediting from immune surveillance to immune escape. Immunology, 2007. 121(1): p. 1-14. Coussens, L.M. and Z. Werb, Inflammation and cancer. Nature, 2002. 420(6917): p. 860-7. Hussain, S.P. and C.C. Harris, Inflammation and cancer: an ancient link with novel potentials. Int J Cancer, 2007. 121(11): p. 2373-80. O'Sullivan, C., et al., Secretion of epidermal growth factor by macrophages associated with breast carcinoma. Lancet, 1993. 342(8864): p. 148-9. Lewis, C.E. and J.W. Pollard, Distinct role of macrophages in different tumor microenvironments. Cancer Res, 2006. 66(2): p. 605-12. Sica, A., et al., Autocrine production of IL-10 mediates defective IL-12 production and NFkappa B activation in tumor-associated macrophages. J Immunol, 2000. 164(2): p. 762-7. Mao, Y., et al., Stromal cells in tumor microenvironment and breast cancer. Cancer Metastasis Rev, 2013. 32(1-2): p. 303-15. 105 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. Chen, J., et al., CCL18 from tumor-associated macrophages promotes breast cancer metastasis via PITPNM3. Cancer Cell, 2011. 19(4): p. 541-55. Gershon, R.K. and K. Kondo, Infectious immunological tolerance. Immunology, 1971. 21(6): p. 903-14. Chakraborty, N.G., et al., Autologous melanoma-induced activation of regulatory T cells that suppress cytotoxic response. J Immunol, 1990. 145(7): p. 2359-64. Ara, T. and Y.A. Declerck, Interleukin-6 in bone metastasis and cancer progression. Eur J Cancer, 2010. 46(7): p. 1223-31. de Visser, K.E., Spontaneous immune responses to sporadic tumors: tumor-promoting, tumor-protective or both? Cancer Immunol Immunother, 2008. 57(10): p. 1531-9. Fridman, W.H., et al., Immune infiltration in human cancer: prognostic significance and disease control. Curr Top Microbiol Immunol, 2011. 344: p. 1-24. Tarin, D. and C.B. Croft, Ultrastructural features of wound healing in mouse skin. J Anat, 1969. 105(Pt 1): p. 189-90. Chang, H.Y., et al., Diversity, topographic differentiation, and positional memory in human fibroblasts. Proc Natl Acad Sci U S A, 2002. 99(20): p. 12877-82. Tomasek, J.J., et al., Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol, 2002. 3(5): p. 349-63. Kalluri, R. and M. Zeisberg, Fibroblasts in cancer. Nat Rev Cancer, 2006. 6(5): p. 392-401. Pietras, K. and A. Ostman, Hallmarks of cancer: interactions with the tumor stroma. Exp Cell Res, 2010. 316(8): p. 1324-31. Micke, P. and A. Ostman, Tumour-stroma interaction: cancer-associated fibroblasts as novel targets in anti-cancer therapy? Lung Cancer, 2004. 45 Suppl 2: p. S163-75. Sugimoto, H., et al., Identification of fibroblast heterogeneity in the tumor microenvironment. Cancer Biol Ther, 2006. 5(12): p. 1640-6. Zeisberg, M., F. Strutz, and G.A. Muller, Role of fibroblast activation in inducing interstitial fibrosis. J Nephrol, 2000. 13 Suppl 3: p. S111-20. Shimoda, M., K.T. Mellody, and A. Orimo, Carcinoma-associated fibroblasts are a ratelimiting determinant for tumour progression. Semin Cell Dev Biol, 2010. 21(1): p. 19-25. Surowiak, P., et al., Stromal myofibroblasts in breast cancer: relations between their occurrence, tumor grade and expression of some tumour markers. Folia Histochem Cytobiol, 2006. 44(2): p. 111-6. Orimo, A., et al., Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion. Cell, 2005. 121(3): p. 335-48. Orimo, A. and R.A. Weinberg, Stromal fibroblasts in cancer: a novel tumor-promoting cell type. Cell Cycle, 2006. 5(15): p. 1597-601. Toullec, A., et al., Oxidative stress promotes myofibroblast differentiation and tumour spreading. EMBO Mol Med, 2010. 2(6): p. 211-30. Hugo, H.J., et al., Contribution of Fibroblast and Mast Cell (Afferent) and Tumor (Efferent) IL-6 Effects within the Tumor Microenvironment. Cancer Microenviron, 2012. Hynes, R.O., The extracellular matrix: not just pretty fibrils. Science, 2009. 326(5957): p. 1216-9. Vosseler, S., et al., Distinct progression-associated expression of tumor and stromal MMPs in HaCaT skin SCCs correlates with onset of invasion. Int J Cancer, 2009. 125(10): p. 2296306. Giannoni, E., et al., Reciprocal activation of prostate cancer cells and cancer-associated fibroblasts stimulates epithelial-mesenchymal transition and cancer stemness. Cancer Res, 2010. 70(17): p. 6945-56. Lederle, W., et al., MMP13 as a stromal mediator in controlling persistent angiogenesis in skin carcinoma. Carcinogenesis, 2010. 31(7): p. 1175-84. 106 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. Boire, A., et al., PAR1 is a matrix metalloprotease-1 receptor that promotes invasion and tumorigenesis of breast cancer cells. Cell, 2005. 120(3): p. 303-13. Blasi, F. and N. Sidenius, The urokinase receptor: focused cell surface proteolysis, cell adhesion and signaling. FEBS Lett, 2010. 584(9): p. 1923-30. Noskova, V., et al., Ovarian cancer cells stimulate uPA gene expression in fibroblastic stromal cells via multiple paracrine and autocrine mechanisms. Gynecol Oncol, 2009. 115(1): p. 121-6. Discher, D.E., P. Janmey, and Y.L. Wang, Tissue cells feel and respond to the stiffness of their substrate. Science, 2005. 310(5751): p. 1139-43. Huijbers, I.J., et al., A role for fibrillar collagen deposition and the collagen internalization receptor endo180 in glioma invasion. PLoS One, 2010. 5(3): p. e9808. Kauppila, S., et al., Aberrant type I and type III collagen gene expression in human breast cancer in vivo. J Pathol, 1998. 186(3): p. 262-8. Kaplan, R.N., et al., VEGFR1-positive haematopoietic bone marrow progenitors initiate the pre-metastatic niche. Nature, 2005. 438(7069): p. 820-7. Kagan, H.M. and W. Li, Lysyl oxidase: properties, specificity, and biological roles inside and outside of the cell. J Cell Biochem, 2003. 88(4): p. 660-72. Levental, K.R., et al., Matrix crosslinking forces tumor progression by enhancing integrin signaling. Cell, 2009. 139(5): p. 891-906. Olive, K.P., et al., Inhibition of Hedgehog signaling enhances delivery of chemotherapy in a mouse model of pancreatic cancer. Science, 2009. 324(5933): p. 1457-61. Shieh, A.C., et al., Tumor cell invasion is promoted by interstitial flow-induced matrix priming by stromal fibroblasts. Cancer Res, 2011. 71(3): p. 790-800. Oyama, F., et al., Coordinate oncodevelopmental modulation of alternative splicing of fibronectin pre-messenger RNA at ED-A, ED-B, and CS1 regions in human liver tumors. Cancer Res, 1993. 53(9): p. 2005-11. Serini, G., et al., The fibronectin domain ED-A is crucial for myofibroblastic phenotype induction by transforming growth factor-beta1. J Cell Biol, 1998. 142(3): p. 873-81. Castellani, P., et al., Differentiation between high- and low-grade astrocytoma using a human recombinant antibody to the extra domain-B of fibronectin. Am J Pathol, 2002. 161(5): p. 1695-700. Mitra, A.K., et al., Ligand-independent activation of c-Met by fibronectin and alpha(5)beta(1)-integrin regulates ovarian cancer invasion and metastasis. Oncogene, 2011. 30(13): p. 1566-76. Brown, L.F., et al., Vascular stroma formation in carcinoma in situ, invasive carcinoma, and metastatic carcinoma of the breast. Clin Cancer Res, 1999. 5(5): p. 1041-56. Kobayashi, N., et al., Hyaluronan deficiency in tumor stroma impairs macrophage trafficking and tumor neovascularization. Cancer Res, 2010. 70(18): p. 7073-83. Walter, M., et al., Interleukin 6 secreted from adipose stromal cells promotes migration and invasion of breast cancer cells. Oncogene, 2009. 28(30): p. 2745-55. Dirat, B., et al., Cancer-associated adipocytes exhibit an activated phenotype and contribute to breast cancer invasion. Cancer Res, 2011. 71(7): p. 2455-65. Iyengar, P., et al., Adipocyte-derived collagen VI affects early mammary tumor progression in vivo, demonstrating a critical interaction in the tumor/stroma microenvironment. J Clin Invest, 2005. 115(5): p. 1163-76. Andarawewa, K.L., et al., Stromelysin-3 is a potent negative regulator of adipogenesis participating to cancer cell-adipocyte interaction/crosstalk at the tumor invasive front. Cancer Res, 2005. 65(23): p. 10862-71. Nieman, K.M., et al., Adipocytes promote ovarian cancer metastasis and provide energy for rapid tumor growth. Nat Med, 2011. 17(11): p. 1498-503. Lau, D.C., et al., Adipokines: molecular links between obesity and atheroslcerosis. Am J Physiol Heart Circ Physiol, 2005. 288(5): p. H2031-41. 107 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. Flegal, K.M., et al., Prevalence and trends in obesity among US adults, 1999-2008. JAMA, 2010. 303(3): p. 235-41. Cinti, S., Adipose tissues and obesity. Ital J Anat Embryol, 1999. 104(2): p. 37-51. Cinti, S., Between brown and white: novel aspects of adipocyte differentiation. Ann Med, 2011. 43(2): p. 104-15. Bjorndal, B., et al., Different adipose depots: their role in the development of metabolic syndrome and mitochondrial response to hypolipidemic agents. J Obes, 2011. 2011: p. 490650. Ouchi, N., et al., Adipokines in inflammation and metabolic disease. Nat Rev Immunol, 2011. 11(2): p. 85-97. Sethi, J.K. and A.J. Vidal-Puig, Thematic review series: adipocyte biology. Adipose tissue function and plasticity orchestrate nutritional adaptation. J Lipid Res, 2007. 48(6): p. 125362. Gregoire, F.M., C.M. Smas, and H.S. Sul, Understanding adipocyte differentiation. Physiol Rev, 1998. 78(3): p. 783-809. Cannon, B. and J. Nedergaard, Brown adipose tissue: function and physiological significance. Physiol Rev, 2004. 84(1): p. 277-359. Ricquier, D., Respiration uncoupling and metabolism in the control of energy expenditure. Proc Nutr Soc, 2005. 64(1): p. 47-52. Frontini, A., et al., Thymus uncoupling protein 1 is exclusive to typical brown adipocytes and is not found in thymocytes. J Histochem Cytochem, 2007. 55(2): p. 183-9. Murano, I., et al., Morphology of ferret subcutaneous adipose tissue after 6-month daily supplementation with oral beta-carotene. Biochim Biophys Acta, 2005. 1740(2): p. 305-12. Vitali, A., et al., The adipose organ of obesity-prone C57BL/6J mice is composed of mixed white and brown adipocytes. J Lipid Res, 2012. 53(4): p. 619-29. Murano, I., et al., Dead adipocytes, detected as crown-like structures, are prevalent in visceral fat depots of genetically obese mice. J Lipid Res, 2008. 49(7): p. 1562-8. Barbatelli, G., et al., The emergence of cold-induced brown adipocytes in mouse white fat depots is determined predominantly by white to brown adipocyte transdifferentiation. Am J Physiol Endocrinol Metab, 2010. 298(6): p. E1244-53. English, J.T., S.K. Patel, and M.J. Flanagan, Association of pheochromocytomas with brown fat tumors. Radiology, 1973. 107(2): p. 279-81. Huttunen, P., J. Hirvonen, and V. Kinnula, The occurrence of brown adipose tissue in outdoor workers. Eur J Appl Physiol Occup Physiol, 1981. 46(4): p. 339-45. Wu, J., et al., Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell, 2012. 150(2): p. 366-76. Petrovic, N., et al., Chronic peroxisome proliferator-activated receptor gamma (PPARgamma) activation of epididymally derived white adipocyte cultures reveals a population of thermogenically competent, UCP1-containing adipocytes molecularly distinct from classic brown adipocytes. J Biol Chem, 2010. 285(10): p. 7153-64. Walden, T.B., et al., Recruited vs. nonrecruited molecular signatures of brown, "brite," and white adipose tissues. Am J Physiol Endocrinol Metab, 2012. 302(1): p. E19-31. Cristancho, A.G. and M.A. Lazar, Forming functional fat: a growing understanding of adipocyte differentiation. Nat Rev Mol Cell Biol, 2011. 12(11): p. 722-34. Seale, P., et al., Prdm16 determines the thermogenic program of subcutaneous white adipose tissue in mice. J Clin Invest, 2011. 121(1): p. 96-105. Majka, S.M., et al., De novo generation of white adipocytes from the myeloid lineage via mesenchymal intermediates is age, adipose depot, and gender specific. Proc Natl Acad Sci U S A, 2010. 107(33): p. 14781-6. Gesta, S., Y.H. Tseng, and C.R. Kahn, Developmental origin of fat: tracking obesity to its source. Cell, 2007. 131(2): p. 242-56. 108 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. 113. 114. 115. 116. Tontonoz, P., E. Hu, and B.M. Spiegelman, Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell, 1994. 79(7): p. 1147-56. Rosen, E.D. and O.A. MacDougald, Adipocyte differentiation from the inside out. Nat Rev Mol Cell Biol, 2006. 7(12): p. 885-96. Fajas, L., et al., The organization, promoter analysis, and expression of the human PPARgamma gene. J Biol Chem, 1997. 272(30): p. 18779-89. Tontonoz, P., et al., mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev, 1994. 8(10): p. 1224-34. Ren, D., et al., PPARgamma knockdown by engineered transcription factors: exogenous PPARgamma2 but not PPARgamma1 reactivates adipogenesis. Genes Dev, 2002. 16(1): p. 27-32. Mueller, E., et al., Genetic analysis of adipogenesis through peroxisome proliferatoractivated receptor gamma isoforms. J Biol Chem, 2002. 277(44): p. 41925-30. He, W., et al., Adipose-specific peroxisome proliferator-activated receptor gamma knockout causes insulin resistance in fat and liver but not in muscle. Proc Natl Acad Sci U S A, 2003. 100(26): p. 15712-7. Liao, W., et al., Suppression of PPAR-gamma attenuates insulin-stimulated glucose uptake by affecting both GLUT1 and GLUT4 in 3T3-L1 adipocytes. Am J Physiol Endocrinol Metab, 2007. 293(1): p. E219-27. Barroso, I., et al., Dominant negative mutations in human PPARgamma associated with severe insulin resistance, diabetes mellitus and hypertension. Nature, 1999. 402(6764): p. 880-3. Monajemi, H., et al., Familial partial lipodystrophy phenotype resulting from a single-base mutation in deoxyribonucleic acid-binding domain of peroxisome proliferator-activated receptor-gamma. J Clin Endocrinol Metab, 2007. 92(5): p. 1606-12. Vinson, C.R., P.B. Sigler, and S.L. McKnight, Scissors-grip model for DNA recognition by a family of leucine zipper proteins. Science, 1989. 246(4932): p. 911-6. Yeh, W.C., et al., Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev, 1995. 9(2): p. 168-81. Tanaka, T., et al., Defective adipocyte differentiation in mice lacking the C/EBPbeta and/or C/EBPdelta gene. EMBO J, 1997. 16(24): p. 7432-43. Zuo, Y., L. Qiang, and S.R. Farmer, Activation of CCAAT/enhancer-binding protein (C/EBP) alpha expression by C/EBP beta during adipogenesis requires a peroxisome proliferator-activated receptor-gamma-associated repression of HDAC1 at the C/ebp alpha gene promoter. J Biol Chem, 2006. 281(12): p. 7960-7. Rosen, E.D., et al., C/EBPalpha induces adipogenesis through PPARgamma: a unified pathway. Genes Dev, 2002. 16(1): p. 22-6. Wu, Z., et al., Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol Cell, 1999. 3(2): p. 151-8. Takada, I., A.P. Kouzmenko, and S. Kato, Wnt and PPARgamma signaling in osteoblastogenesis and adipogenesis. Nat Rev Rheumatol, 2009. 5(8): p. 442-7. Longo, K.A., et al., Wnt10b inhibits development of white and brown adipose tissues. J Biol Chem, 2004. 279(34): p. 35503-9. Kang, S., et al., Wnt signaling stimulates osteoblastogenesis of mesenchymal precursors by suppressing CCAAT/enhancer-binding protein alpha and peroxisome proliferator-activated receptor gamma. J Biol Chem, 2007. 282(19): p. 14515-24. Ross, S.E., et al., Inhibition of adipogenesis by Wnt signaling. Science, 2000. 289(5481): p. 950-3. Wang, L., et al., Histone H3K27 methyltransferase Ezh2 represses Wnt genes to facilitate adipogenesis. Proc Natl Acad Sci U S A, 2010. 107(16): p. 7317-22. 109 117. 118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 128. 129. 130. 131. 132. 133. 134. 135. 136. 137. 138. 139. Gagnon, A., et al., Phosphatidylinositol-3,4,5-trisphosphate is required for insulin-like growth factor 1-mediated survival of 3T3-L1 preadipocytes. Endocrinology, 2001. 142(1): p. 205-12. Takada, I., et al., A histone lysine methyltransferase activated by non-canonical Wnt signalling suppresses PPAR-gamma transactivation. Nat Cell Biol, 2007. 9(11): p. 1273-85. Kanazawa, A., et al., Wnt5b partially inhibits canonical Wnt/beta-catenin signaling pathway and promotes adipogenesis in 3T3-L1 preadipocytes. Biochem Biophys Res Commun, 2005. 330(2): p. 505-10. Sarjeant, K. and J.M. Stephens, Adipogenesis. Cold Spring Harb Perspect Biol, 2012. 4(9): p. a008417. Green, H. and M. Meuth, An established pre-adipose cell line and its differentiation in culture. Cell, 1974. 3(2): p. 127-33. Green, H. and O. Kehinde, Spontaneous heritable changes leading to increased adipose conversion in 3T3 cells. Cell, 1976. 7(1): p. 105-13. Rubin, C.S., et al., Development of hormone receptors and hormonal responsiveness in vitro. Insulin receptors and insulin sensitivity in the preadipocyte and adipocyte forms of 3T3-L1 cells. J Biol Chem, 1978. 253(20): p. 7570-8. Spiegelman, B.M. and C.A. Ginty, Fibronectin modulation of cell shape and lipogenic gene expression in 3T3-adipocytes. Cell, 1983. 35(3 Pt 2): p. 657-66. Moustaid, N., et al., Analysis of the glucocorticoid receptor during differentiation of 3T3F442A preadipocyte cell line in culture. Biochem Med Metab Biol, 1990. 43(2): p. 93-100. Green, H. and O. Kehinde, Formation of normally differentiated subcutaneous fat pads by an established preadipose cell line. J Cell Physiol, 1979. 101(1): p. 169-71. Mandrup, S., et al., Obese gene expression at in vivo levels by fat pads derived from s.c. implanted 3T3-F442A preadipocytes. Proc Natl Acad Sci U S A, 1997. 94(9): p. 4300-5. Lafontan, M., Historical perspectives in fat cell biology: the fat cell as a model for the investigation of hormonal and metabolic pathways. Am J Physiol Cell Physiol, 2012. 302(2): p. C327-59. Gerlach, J.C., et al., Adipogenesis of human adipose-derived stem cells within threedimensional hollow fiber-based bioreactors. Tissue Eng Part C Methods, 2012. 18(1): p. 5461. Boucher, J., et al., Apelin, a newly identified adipokine up-regulated by insulin and obesity. Endocrinology, 2005. 146(4): p. 1764-71. Gesta, S., et al., Culture of human adipose tissue explants leads to profound alteration of adipocyte gene expression. Horm Metab Res, 2003. 35(3): p. 158-63. Kaneko, A., et al., Effects of adipocytes on the proliferation and differentiation of prostate cancer cells in a 3-D culture model. Int J Urol, 2010. 17(4): p. 369-76. Amemori, S., et al., Adipocytes and preadipocytes promote the proliferation of colon cancer cells in vitro. Am J Physiol Gastrointest Liver Physiol, 2007. 292(3): p. G923-9. Brasaemle, D.L., Thematic review series: adipocyte biology. The perilipin family of structural lipid droplet proteins: stabilization of lipid droplets and control of lipolysis. J Lipid Res, 2007. 48(12): p. 2547-59. Kuerschner, L., C. Moessinger, and C. Thiele, Imaging of lipid biosynthesis: how a neutral lipid enters lipid droplets. Traffic, 2008. 9(3): p. 338-52. Gubern, A., et al., Group IVA phospholipase A2 is necessary for the biogenesis of lipid droplets. J Biol Chem, 2008. 283(41): p. 27369-82. Guo, Y., et al., Lipid droplets at a glance. J Cell Sci, 2009. 122(Pt 6): p. 749-52. Walther, T.C. and R.V. Farese, Jr., The life of lipid droplets. Biochim Biophys Acta, 2009. 1791(6): p. 459-66. Murphy, G., Jr., et al., Combustion-derived hydrocarbons localize to lipid droplets in respiratory cells. Am J Respir Cell Mol Biol, 2008. 38(5): p. 532-40. 110 140. 141. 142. 143. 144. 145. 146. 147. 148. 149. 150. 151. 152. 153. 154. 155. 156. 157. 158. 159. 160. 161. 162. 163. Ost, A., et al., Triacylglycerol is synthesized in a specific subclass of caveolae in primary adipocytes. J Biol Chem, 2005. 280(1): p. 5-8. Duncan, R.E., et al., Regulation of lipolysis in adipocytes. Annu Rev Nutr, 2007. 27: p. 79101. Haemmerle, G., et al., Defective lipolysis and altered energy metabolism in mice lacking adipose triglyceride lipase. Science, 2006. 312(5774): p. 734-7. Langin, D., Control of fatty acid and glycerol release in adipose tissue lipolysis. C R Biol, 2006. 329(8): p. 598-607; discussion 653-5. Brasaemle, D.L., et al., The lipolytic stimulation of 3T3-L1 adipocytes promotes the translocation of hormone-sensitive lipase to the surfaces of lipid storage droplets. Biochim Biophys Acta, 2000. 1483(2): p. 251-62. Marcinkiewicz, A., et al., The phosphorylation of serine 492 of perilipin a directs lipid droplet fragmentation and dispersion. J Biol Chem, 2006. 281(17): p. 11901-9. Zimmermann, R., et al., Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase. Science, 2004. 306(5700): p. 1383-6. Lass, A., et al., Adipose triglyceride lipase-mediated lipolysis of cellular fat stores is activated by CGI-58 and defective in Chanarin-Dorfman Syndrome. Cell Metab, 2006. 3(5): p. 309-19. Subramanian, V., et al., Perilipin A mediates the reversible binding of CGI-58 to lipid droplets in 3T3-L1 adipocytes. J Biol Chem, 2004. 279(40): p. 42062-71. Granneman, J.G., et al., Analysis of lipolytic protein trafficking and interactions in adipocytes. J Biol Chem, 2007. 282(8): p. 5726-35. Sengenes, C., et al., Natriuretic peptides: a new lipolytic pathway in human adipocytes. FASEB J, 2000. 14(10): p. 1345-51. Yu, J., et al., Differences in the amount of lipolysis induced by atrial natriuretic peptide in small and large adipocytes. J Pept Sci, 2008. 14(8): p. 972-7. Sengenes, C., et al., Involvement of a cGMP-dependent pathway in the natriuretic peptidemediated hormone-sensitive lipase phosphorylation in human adipocytes. J Biol Chem, 2003. 278(49): p. 48617-26. Birkenfeld, A.L., et al., Lipid mobilization with physiological atrial natriuretic peptide concentrations in humans. J Clin Endocrinol Metab, 2005. 90(6): p. 3622-8. Jaworski, K., et al., Regulation of triglyceride metabolism. IV. Hormonal regulation of lipolysis in adipose tissue. Am J Physiol Gastrointest Liver Physiol, 2007. 293(1): p. G1-4. Dhalla, A.K., et al., Comparison of the antilipolytic effects of an A1 adenosine receptor partial agonist in normal and diabetic rats. Diabetes Obes Metab, 2009. 11(2): p. 95-101. Lafontan, M., et al., Control of lipolysis by natriuretic peptides and cyclic GMP. Trends Endocrinol Metab, 2008. 19(4): p. 130-7. Mishra, R. and M.S. Simonson, Saturated free fatty acids and apoptosis in microvascular mesangial cells: palmitate activates pro-apoptotic signaling involving caspase 9 and mitochondrial release of endonuclease G. Cardiovasc Diabetol, 2005. 4(1): p. 2. Yang, Z. and D.J. Klionsky, Mammalian autophagy: core molecular machinery and signaling regulation. Curr Opin Cell Biol, 2010. 22(2): p. 124-31. Singh, R., Autophagy in the control of food intake. Adipocyte, 2012. 1(2): p. 75-79. Cook, K.S., et al., Adipsin: a circulating serine protease homolog secreted by adipose tissue and sciatic nerve. Science, 1987. 237(4813): p. 402-5. Hotamisligil, G.S., N.S. Shargill, and B.M. Spiegelman, Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science, 1993. 259(5091): p. 87-91. Zhang, Y., et al., Positional cloning of the mouse obese gene and its human homologue. Nature, 1994. 372(6505): p. 425-32. Shimomura, I., et al., Enhanced expression of PAI-1 in visceral fat: possible contributor to vascular disease in obesity. Nat Med, 1996. 2(7): p. 800-3. 111 164. 165. 166. 167. 168. 169. 170. 171. 172. 173. 174. 175. 176. 177. 178. 179. 180. 181. 182. 183. 184. 185. 186. 187. Hu, E., P. Liang, and B.M. Spiegelman, AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem, 1996. 271(18): p. 10697-703. Scherer, P.E., et al., A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem, 1995. 270(45): p. 26746-9. Roca-Rivada, A., et al., FNDC5/irisin is not only a myokine but also an adipokine. PLoS One, 2013. 8(4): p. e60563. Bostrom, P., et al., A PGC1-alpha-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature, 2012. 481(7382): p. 463-8. Villarroya, F., Irisin, turning up the heat. Cell Metab, 2012. 15(3): p. 277-8. Hauner, H., The new concept of adipose tissue function. Physiol Behav, 2004. 83(4): p. 6538. Kissebah, A.H. and G.R. Krakower, Regional adiposity and morbidity. Physiol Rev, 1994. 74(4): p. 761-811. Park, J., D.M. Euhus, and P.E. Scherer, Paracrine and endocrine effects of adipose tissue on cancer development and progression. Endocr Rev, 2011. 32(4): p. 550-70. Sun, K., C.M. Kusminski, and P.E. Scherer, Adipose tissue remodeling and obesity. J Clin Invest, 2011. 121(6): p. 2094-101. Matsuzawa, Y., The role of fat topology in the risk of disease. Int J Obes (Lond), 2008. 32 Suppl 7: p. S83-92. Kuriyama, H., et al., Enhanced expression of hepatic acyl-coenzyme A synthetase and microsomal triglyceride transfer protein messenger RNAs in the obese and hypertriglyceridemic rat with visceral fat accumulation. Hepatology, 1998. 27(2): p. 557-62. Lafontan, M. and D. Langin, Lipolysis and lipid mobilization in human adipose tissue. Prog Lipid Res, 2009. 48(5): p. 275-97. Villaret, A., et al., Adipose tissue endothelial cells from obese human subjects: differences among depots in angiogenic, metabolic, and inflammatory gene expression and cellular senescence. Diabetes, 2010. 59(11): p. 2755-63. Fata, J.E., Z. Werb, and M.J. Bissell, Regulation of mammary gland branching morphogenesis by the extracellular matrix and its remodeling enzymes. Breast Cancer Res, 2004. 6(1): p. 1-11. Hovey, R.C., T.B. McFadden, and R.M. Akers, Regulation of mammary gland growth and morphogenesis by the mammary fat pad: a species comparison. J Mammary Gland Biol Neoplasia, 1999. 4(1): p. 53-68. Couldrey, C., et al., Adipose tissue: a vital in vivo role in mammary gland development but not differentiation. Dev Dyn, 2002. 223(4): p. 459-68. Hovey, R.C. and L. Aimo, Diverse and active roles for adipocytes during mammary gland growth and function. J Mammary Gland Biol Neoplasia, 2010. 15(3): p. 279-90. Proia, D.A. and C. Kuperwasser, Reconstruction of human mammary tissues in a mouse model. Nat Protoc, 2006. 1(1): p. 206-14. Krings, A., et al., Bone marrow fat has brown adipose tissue characteristics, which are attenuated with aging and diabetes. Bone, 2012. 50(2): p. 546-52. Lecka-Czernik, B., Marrow fat metabolism is linked to the systemic energy metabolism. Bone, 2012. 50(2): p. 534-9. Naveiras, O., et al., Bone-marrow adipocytes as negative regulators of the haematopoietic microenvironment. Nature, 2009. 460(7252): p. 259-63. Calle, E.E. and R. Kaaks, Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms. Nat Rev Cancer, 2004. 4(8): p. 579-91. Lolmede, K., et al., Effects of hypoxia on the expression of proangiogenic factors in differentiated 3T3-F442A adipocytes. Int J Obes Relat Metab Disord, 2003. 27(10): p. 118795. Fantuzzi, G., Adipose tissue, adipokines, and inflammation. J Allergy Clin Immunol, 2005. 115(5): p. 911-9; quiz 920. 112 188. 189. 190. 191. 192. 193. 194. 195. 196. 197. 198. 199. 200. 201. 202. 203. 204. 205. 206. 207. 208. 209. 210. 211. 212. 213. Ohman, M.K. and D.T. Eitzman, Targeting MCP-1 to reduce vascular complications of obesity. Recent Pat Cardiovasc Drug Discov, 2009. 4(3): p. 164-76. Sartipy, P. and D.J. Loskutoff, Monocyte chemoattractant protein 1 in obesity and insulin resistance. Proc Natl Acad Sci U S A, 2003. 100(12): p. 7265-70. Dalmas, E., K. Clement, and M. Guerre-Millo, Defining macrophage phenotype and function in adipose tissue. Trends Immunol, 2011. 32(7): p. 307-14. Cinti, S., et al., Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans. J Lipid Res, 2005. 46(11): p. 2347-55. Smorlesi, A., et al., The adipose organ: white-brown adipocyte plasticity and metabolic inflammation. Obes Rev, 2012. 13 Suppl 2: p. 83-96. Bjorntorp, P. and R. Rosmond, Visceral obesity and diabetes. Drugs, 1999. 58 Suppl 1: p. 13-8; discussion 75-82. Lumeng, C.N., J.L. Bodzin, and A.R. Saltiel, Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J Clin Invest, 2007. 117(1): p. 175-84. Gordon, S., Alternative activation of macrophages. Nat Rev Immunol, 2003. 3(1): p. 23-35. Odegaard, J.I. and A. Chawla, Alternative macrophage activation and metabolism. Annu Rev Pathol, 2011. 6: p. 275-97. Reeves, G.K., et al., Cancer incidence and mortality in relation to body mass index in the Million Women Study: cohort study. BMJ, 2007. 335(7630): p. 1134. Renehan, A.G., et al., Body-mass index and incidence of cancer: a systematic review and meta-analysis of prospective observational studies. Lancet, 2008. 371(9612): p. 569-78. Calle, E.E., et al., Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U.S. adults. N Engl J Med, 2003. 348(17): p. 1625-38. DeSantis, C., et al., Breast cancer statistics, 2011. CA Cancer J Clin, 2011. 61(6): p. 40918. Eroles, P., et al., Molecular biology in breast cancer: intrinsic subtypes and signaling pathways. Cancer Treat Rev, 2012. 38(6): p. 698-707. Bergstrom, A., et al., Overweight as an avoidable cause of cancer in Europe. Int J Cancer, 2001. 91(3): p. 421-30. Eliassen, A.H., et al., Adult weight change and risk of postmenopausal breast cancer. JAMA, 2006. 296(2): p. 193-201. Ursin, G., et al., A meta-analysis of body mass index and risk of premenopausal breast cancer. Epidemiology, 1995. 6(2): p. 137-41. Friedman, J.M. and J.L. Halaas, Leptin and the regulation of body weight in mammals. Nature, 1998. 395(6704): p. 763-70. Tsuchiya, T., et al., Expression of leptin receptor in lung: leptin as a growth factor. Eur J Pharmacol, 1999. 365(2-3): p. 273-9. Artwohl, M., et al., Modulation by leptin of proliferation and apoptosis in vascular endothelial cells. Int J Obes Relat Metab Disord, 2002. 26(4): p. 577-80. Ishikawa, M., J. Kitayama, and H. Nagawa, Enhanced expression of leptin and leptin receptor (OB-R) in human breast cancer. Clin Cancer Res, 2004. 10(13): p. 4325-31. Binai, N.A., et al., Expression of estrogen receptor alpha increases leptin-induced STAT3 activity in breast cancer cells. Int J Cancer, 2010. 127(1): p. 55-66. Housa, D., et al., Adipocytokines and cancer. Physiol Res, 2006. 55(3): p. 233-44. Ren, H., et al., Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells. Biochem Biophys Res Commun, 2010. 394(1): p. 59-63. Slamon, D.J., et al., Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science, 1989. 244(4905): p. 707-12. Soma, D., et al., Leptin augments proliferation of breast cancer cells via transactivation of HER2. J Surg Res, 2008. 149(1): p. 9-14. 113 214. 215. 216. 217. 218. 219. 220. 221. 222. 223. 224. 225. 226. 227. 228. 229. 230. 231. 232. 233. 234. 235. Gonzalez-Perez, R.R., et al., Leptin upregulates VEGF in breast cancer via canonic and non-canonical signalling pathways and NFkappaB/HIF-1alpha activation. Cell Signal, 2010. 22(9): p. 1350-62. Moreno-Aliaga, M.J., S. Lorente-Cebrian, and J.A. Martinez, Regulation of adipokine secretion by n-3 fatty acids. Proc Nutr Soc, 2010. 69(3): p. 324-32. Pajvani, U.B., et al., Complex distribution, not absolute amount of adiponectin, correlates with thiazolidinedione-mediated improvement in insulin sensitivity. J Biol Chem, 2004. 279(13): p. 12152-62. Byeon, J.S., et al., Adiponectin and adiponectin receptor in relation to colorectal cancer progression. Int J Cancer, 2010. 127(12): p. 2758-67. Kadowaki, T. and T. Yamauchi, Adiponectin and adiponectin receptors. Endocr Rev, 2005. 26(3): p. 439-51. Schaffler, A., J. Scholmerich, and C. Buechler, Mechanisms of disease: adipokines and breast cancer - endocrine and paracrine mechanisms that connect adiposity and breast cancer. Nat Clin Pract Endocrinol Metab, 2007. 3(4): p. 345-54. Miyoshi, Y., et al., Association of serum adiponectin levels with breast cancer risk. Clin Cancer Res, 2003. 9(15): p. 5699-704. Kang, J.H., et al., Adiponectin induces growth arrest and apoptosis of MDA-MB-231 breast cancer cell. Arch Pharm Res, 2005. 28(11): p. 1263-9. Takemura, Y., et al., Expression of adiponectin receptors and its possible implication in the human endometrium. Endocrinology, 2006. 147(7): p. 3203-10. Korner, A., et al., Total and high-molecular-weight adiponectin in breast cancer: in vitro and in vivo studies. J Clin Endocrinol Metab, 2007. 92(3): p. 1041-8. Yoneda, K., et al., Expression of adiponectin receptors, AdipoR1 and AdipoR2, in normal colon epithelium and colon cancer tissue. Oncol Rep, 2008. 20(3): p. 479-83. Dalamaga, M., et al., Pancreatic cancer expresses adiponectin receptors and is associated with hypoleptinemia and hyperadiponectinemia: a case-control study. Cancer Causes Control, 2009. 20(5): p. 625-33. Luo, Z., M. Zang, and W. Guo, AMPK as a metabolic tumor suppressor: control of metabolism and cell growth. Future Oncol, 2010. 6(3): p. 457-70. van Kruijsdijk, R.C., E. van der Wall, and F.L. Visseren, Obesity and cancer: the role of dysfunctional adipose tissue. Cancer Epidemiol Biomarkers Prev, 2009. 18(10): p. 2569-78. Maeda, N., et al., Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nat Med, 2002. 8(7): p. 731-7. Tilg, H. and A.R. Moschen, Adipocytokines: mediators linking adipose tissue, inflammation and immunity. Nat Rev Immunol, 2006. 6(10): p. 772-83. Dickson, R.B., M.E. Lippman, and D. Slamon, UCLA colloquium. New insights into breast cancer: the molecular biochemical and cellular biology of breast cancer. Cancer Res, 1990. 50(14): p. 4446-7. Nomura, Y., et al., Relative effect of steroid hormone receptors on the prognosis of patients with operable breast cancer. A univariate and multivariate analysis of 3089 Japanese patients with breast cancer from the Study Group for the Japanese Breast Cancer Society on Hormone Receptors and Prognosis in Breast Cancer. Cancer, 1992. 69(1): p. 153-64. Baglietto, L., et al., Circulating steroid hormone concentrations in postmenopausal women in relation to body size and composition. Breast Cancer Res Treat, 2009. 115(1): p. 171-9. Irigaray, P., et al., Overweight/obesity and cancer genesis: more than a biological link. Biomed Pharmacother, 2007. 61(10): p. 665-78. Bulun, S.E., et al., Aromatase, breast cancer and obesity: a complex interaction. Trends Endocrinol Metab, 2012. 23(2): p. 83-9. Grivennikov, S.I., F.R. Greten, and M. Karin, Immunity, inflammation, and cancer. Cell, 2010. 140(6): p. 883-99. 114 236. 237. 238. 239. 240. 241. 242. 243. 244. 245. 246. 247. 248. 249. 250. 251. 252. 253. 254. 255. 256. 257. 258. Moreno-Aliaga, M.J., et al., Does weight loss prognosis depend on genetic make-up? Obes Rev, 2005. 6(2): p. 155-68. Kershaw, E.E. and J.S. Flier, Adipose tissue as an endocrine organ. J Clin Endocrinol Metab, 2004. 89(6): p. 2548-56. Rajala, M.W. and P.E. Scherer, Minireview: The adipocyte--at the crossroads of energy homeostasis, inflammation, and atherosclerosis. Endocrinology, 2003. 144(9): p. 3765-73. Subbaramaiah, K., et al., Obesity is associated with inflammation and elevated aromatase expression in the mouse mammary gland. Cancer Prev Res (Phila), 2011. 4(3): p. 329-46. Ye, J., et al., Hypoxia is a potential risk factor for chronic inflammation and adiponectin reduction in adipose tissue of ob/ob and dietary obese mice. Am J Physiol Endocrinol Metab, 2007. 293(4): p. E1118-28. Trayhurn, P., Hypoxia and adipose tissue function and dysfunction in obesity. Physiol Rev, 2013. 93(1): p. 1-21. Vaupel, P. and A. Mayer, Hypoxia in cancer: significance and impact on clinical outcome. Cancer Metastasis Rev, 2007. 26(2): p. 225-39. Semenza, G.L., Hypoxia-inducible factors: mediators of cancer progression and targets for cancer therapy. Trends Pharmacol Sci, 2012. 33(4): p. 207-14. Hockel, M., et al., Association between tumor hypoxia and malignant progression in advanced cancer of the uterine cervix. Cancer Res, 1996. 56(19): p. 4509-15. Brown, J.M. and Q.T. Le, Tumor hypoxia is important in radiotherapy, but how should we measure it? Int J Radiat Oncol Biol Phys, 2002. 54(5): p. 1299-301. Brizel, D.M., et al., Tumor oxygenation predicts for the likelihood of distant metastases in human soft tissue sarcoma. Cancer Res, 1996. 56(5): p. 941-3. Rutkowski, J.M., K.E. Davis, and P.E. Scherer, Mechanisms of obesity and related pathologies: the macro- and microcirculation of adipose tissue. FEBS J, 2009. 276(20): p. 5738-46. Folkman, J., et al., Induction of angiogenesis during the transition from hyperplasia to neoplasia. Nature, 1989. 339(6219): p. 58-61. Cao, Y., Adipose tissue angiogenesis as a therapeutic target for obesity and metabolic diseases. Nat Rev Drug Discov, 2010. 9(2): p. 107-15. Gu, J.W., et al., Postmenopausal obesity promotes tumor angiogenesis and breast cancer progression in mice. Cancer Biol Ther, 2011. 11(10): p. 910-7. Blobe, G.C., L.M. Obeid, and Y.A. Hannun, Regulation of protein kinase C and role in cancer biology. Cancer Metastasis Rev, 1994. 13(3-4): p. 411-31. Reynolds, C.P., B.J. Maurer, and R.N. Kolesnick, Ceramide synthesis and metabolism as a target for cancer therapy. Cancer Lett, 2004. 206(2): p. 169-80. Schutze, S., T. Machleidt, and M. Kronke, The role of diacylglycerol and ceramide in tumor necrosis factor and interleukin-1 signal transduction. J Leukoc Biol, 1994. 56(5): p. 533-41. Holland, W.L., et al., Lipid-induced insulin resistance mediated by the proinflammatory receptor TLR4 requires saturated fatty acid-induced ceramide biosynthesis in mice. J Clin Invest, 2011. 121(5): p. 1858-70. Elliott, B.E., et al., Capacity of adipose tissue to promote growth and metastasis of a murine mammary carcinoma: effect of estrogen and progesterone. Int J Cancer, 1992. 51(3): p. 41624. Fleming, J.M., et al., Local regulation of human breast xenograft models. J Cell Physiol, 2010. 224(3): p. 795-806. Iyengar, P., et al., Adipocyte-secreted factors synergistically promote mammary tumorigenesis through induction of anti-apoptotic transcriptional programs and protooncogene stabilization. Oncogene, 2003. 22(41): p. 6408-23. Manabe, Y., et al., Mature adipocytes, but not preadipocytes, promote the growth of breast carcinoma cells in collagen gel matrix culture through cancer-stromal cell interactions. J Pathol, 2003. 201(2): p. 221-8. 115 259. 260. 261. 262. 263. 264. 265. 266. 267. 268. 269. 270. 271. 272. 273. 274. 275. 276. 277. 278. 279. 280. 281. Park, J. and P.E. Scherer, Adipocyte-derived endotrophin promotes malignant tumor progression. J Clin Invest, 2012. 122(11): p. 4243-56. Motrescu, E.R., et al., Matrix metalloproteinase-11/stromelysin-3 exhibits collagenolytic function against collagen VI under normal and malignant conditions. Oncogene, 2008. 27(49): p. 6347-55. Heinrich, P.C., et al., Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway. Biochem J, 1998. 334 ( Pt 2): p. 297-314. Kawano, M., et al., Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature, 1988. 332(6159): p. 83-5. Okamoto, M., C. Lee, and R. Oyasu, Interleukin-6 as a paracrine and autocrine growth factor in human prostatic carcinoma cells in vitro. Cancer Res, 1997. 57(1): p. 141-6. Okada, K., et al., Interleukin-6 functions as an autocrine growth factor in a cholangiocarcinoma cell line. J Gastroenterol Hepatol, 1994. 9(5): p. 462-7. Sasser, A.K., et al., Interleukin-6 is a potent growth factor for ER-alpha-positive human breast cancer. FASEB J, 2007. 21(13): p. 3763-70. Knupfer, H. and R. Preiss, Significance of interleukin-6 (IL-6) in breast cancer (review). Breast Cancer Res Treat, 2007. 102(2): p. 129-35. DeMichele, A., et al., Interleukin-6 -174G-->C polymorphism is associated with improved outcome in high-risk breast cancer. Cancer Res, 2003. 63(22): p. 8051-6. Studebaker, A.W., et al., Fibroblasts isolated from common sites of breast cancer metastasis enhance cancer cell growth rates and invasiveness in an interleukin-6-dependent manner. Cancer Res, 2008. 68(21): p. 9087-95. Finley, D.S., et al., Periprostatic adipose tissue as a modulator of prostate cancer aggressiveness. J Urol, 2009. 182(4): p. 1621-7. Kalluri, R., EMT: when epithelial cells decide to become mesenchymal-like cells. J Clin Invest, 2009. 119(6): p. 1417-9. Thiery, J.P., et al., Epithelial-mesenchymal transitions in development and disease. Cell, 2009. 139(5): p. 871-90. Xie, G., et al., IL-6-induced epithelial-mesenchymal transition promotes the generation of breast cancer stem-like cells analogous to mammosphere cultures. Int J Oncol, 2012. 40(4): p. 1171-9. Hwang, W.L., et al., SNAIL regulates interleukin-8 expression, stem cell-like activity, and tumorigenicity of human colorectal carcinoma cells. Gastroenterology, 2011. 141(1): p. 279-91, 291 e1-5. Karnoub, A.E., et al., Mesenchymal stem cells within tumour stroma promote breast cancer metastasis. Nature, 2007. 449(7162): p. 557-63. Qian, B.Z., et al., CCL2 recruits inflammatory monocytes to facilitate breast-tumour metastasis. Nature, 2011. 475(7355): p. 222-5. Jarde, T., et al., Molecular mechanisms of leptin and adiponectin in breast cancer. Eur J Cancer, 2011. 47(1): p. 33-43. Kim, K.Y., et al., Adipocyte culture medium stimulates invasiveness of MDA-MB-231 cell via CCL20 production. Oncol Rep, 2009. 22(6): p. 1497-504. Kim, J.H., et al., Adipocyte culture medium stimulates production of macrophage inhibitory cytokine 1 in MDA-MB-231 cells. Cancer Lett, 2008. 261(2): p. 253-62. Bochet, L., et al., Cancer-associated adipocytes promotes breast tumor radioresistance. Biochem Biophys Res Commun, 2011. 411(1): p. 102-6. Behan, J.W., et al., Adipocytes impair leukemia treatment in mice. Cancer Res, 2009. 69(19): p. 7867-74. Park, J., T.S. Morley, and P.E. Scherer, Inhibition of endotrophin, a cleavage product of collagen VI, confers cisplatin sensitivity to tumours. EMBO Mol Med, 2013. 5(6): p. 93548. 116 282. 283. 284. 285. 286. 287. 288. 289. 290. 291. 292. 293. 294. 295. 296. 297. 298. 299. 300. 301. 302. 303. 304. 305. 306. El-Haibi, C.P. and A.E. Karnoub, Mesenchymal stem cells in the pathogenesis and therapy of breast cancer. J Mammary Gland Biol Neoplasia, 2010. 15(4): p. 399-409. Muehlberg, F.L., et al., Tissue-resident stem cells promote breast cancer growth and metastasis. Carcinogenesis, 2009. 30(4): p. 589-97. Pinilla, S., et al., Tissue resident stem cells produce CCL5 under the influence of cancer cells and thereby promote breast cancer cell invasion. Cancer Lett, 2009. 284(1): p. 80-5. Welte, G., et al., Interleukin-8 derived from local tissue-resident stromal cells promotes tumor cell invasion. Mol Carcinog, 2012. 51(11): p. 861-8. Yu, J.M., et al., Mesenchymal stem cells derived from human adipose tissues favor tumor cell growth in vivo. Stem Cells Dev, 2008. 17(3): p. 463-73. Devarajan, E., et al., Epithelial-mesenchymal transition in breast cancer lines is mediated through PDGF-D released by tissue-resident stem cells. Int J Cancer, 2012. 131(5): p. 102331. Chandler, E.M., et al., Implanted adipose progenitor cells as physicochemical regulators of breast cancer. Proc Natl Acad Sci U S A, 2012. 109(25): p. 9786-91. Bertolini, F., et al., Adipose tissue cells, lipotransfer and cancer: a challenge for scientists, oncologists and surgeons. Biochim Biophys Acta, 2012. 1826(1): p. 209-14. Zhang, Y., et al., White adipose tissue cells are recruited by experimental tumors and promote cancer progression in mouse models. Cancer Res, 2009. 69(12): p. 5259-66. Kidd, S., et al., Origins of the tumor microenvironment: quantitative assessment of adiposederived and bone marrow-derived stroma. PLoS One, 2012. 7(2): p. e30563. Martin-Padura, I., et al., The white adipose tissue used in lipotransfer procedures is a rich reservoir of CD34+ progenitors able to promote cancer progression. Cancer Res, 2012. 72(1): p. 325-34. Coleman, S.R., Structural fat grafts: the ideal filler? Clin Plast Surg, 2001. 28(1): p. 111-9. Coleman, S.R., Structural fat grafting: more than a permanent filler. Plast Reconstr Surg, 2006. 118(3 Suppl): p. 108S-120S. Yoshimura, K., et al., Cell-assisted lipotransfer for facial lipoatrophy: efficacy of clinical use of adipose-derived stem cells. Dermatol Surg, 2008. 34(9): p. 1178-85. Cairns, R.A., I.S. Harris, and T.W. Mak, Regulation of cancer cell metabolism. Nat Rev Cancer, 2011. 11(2): p. 85-95. Warburg, O., On the origin of cancer cells. Science, 1956. 123(3191): p. 309-14. Elstrom, R.L., et al., Akt stimulates aerobic glycolysis in cancer cells. Cancer Res, 2004. 64(11): p. 3892-9. Kaelin, W.G., Jr. and P.J. Ratcliffe, Oxygen sensing by metazoans: the central role of the HIF hydroxylase pathway. Mol Cell, 2008. 30(4): p. 393-402. Kim, J.W., et al., HIF-1-mediated expression of pyruvate dehydrogenase kinase: a metabolic switch required for cellular adaptation to hypoxia. Cell Metab, 2006. 3(3): p. 177-85. Gottschalk, S., et al., Imatinib (STI571)-mediated changes in glucose metabolism in human leukemia BCR-ABL-positive cells. Clin Cancer Res, 2004. 10(19): p. 6661-8. Nolop, K.B., et al., Glucose utilization in vivo by human pulmonary neoplasms. Cancer, 1987. 60(11): p. 2682-9. Dang, C.V. and G.L. Semenza, Oncogenic alterations of metabolism. Trends Biochem Sci, 1999. 24(2): p. 68-72. Ramanathan, A., C. Wang, and S.L. Schreiber, Perturbational profiling of a cell-line model of tumorigenesis by using metabolic measurements. Proc Natl Acad Sci U S A, 2005. 102(17): p. 5992-7. Manning, B.D. and L.C. Cantley, AKT/PKB signaling: navigating downstream. Cell, 2007. 129(7): p. 1261-74. Gordan, J.D., C.B. Thompson, and M.C. Simon, HIF and c-Myc: sibling rivals for control of cancer cell metabolism and proliferation. Cancer Cell, 2007. 12(2): p. 108-13. 117 307. 308. 309. 310. 311. 312. 313. 314. 315. 316. 317. 318. 319. 320. 321. 322. 323. 324. 325. 326. 327. 328. 329. Matoba, S., et al., p53 regulates mitochondrial respiration. Science, 2006. 312(5780): p. 1650-3. Bensaad, K., et al., TIGAR, a p53-inducible regulator of glycolysis and apoptosis. Cell, 2006. 126(1): p. 107-20. Kawauchi, K., et al., p53 regulates glucose metabolism through an IKK-NF-kappaB pathway and inhibits cell transformation. Nat Cell Biol, 2008. 10(5): p. 611-8. Moreno-Sanchez, R., et al., Energy metabolism in tumor cells. FEBS J, 2007. 274(6): p. 1393-418. Sonveaux, P., et al., Targeting lactate-fueled respiration selectively kills hypoxic tumor cells in mice. J Clin Invest, 2008. 118(12): p. 3930-42. Whitaker-Menezes, D., et al., Evidence for a stromal-epithelial "lactate shuttle" in human tumors: MCT4 is a marker of oxidative stress in cancer-associated fibroblasts. Cell Cycle, 2011. 10(11): p. 1772-83. DeBerardinis, R.J. and T. Cheng, Q's next: the diverse functions of glutamine in metabolism, cell biology and cancer. Oncogene, 2010. 29(3): p. 313-24. Mullen, A.R., et al., Reductive carboxylation supports growth in tumour cells with defective mitochondria. Nature, 2012. 481(7381): p. 385-8. Linder-Horowitz, M., W.E. Knox, and H.P. Morris, Glutaminase activities and growth rates of rat hepatomas. Cancer Res, 1969. 29(6): p. 1195-9. Knox, W.E., M.L. Horowitz, and G.H. Friedell, The proportionality of glutaminase content to growth rate and morphology of rat neoplasms. Cancer Res, 1969. 29(3): p. 669-80. Gao, P., et al., c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism. Nature, 2009. 458(7239): p. 762-5. Wang, J.B., et al., Targeting mitochondrial glutaminase activity inhibits oncogenic transformation. Cancer Cell, 2010. 18(3): p. 207-19. Kroemer, G. and J. Pouyssegur, Tumor cell metabolism: cancer's Achilles' heel. Cancer Cell, 2008. 13(6): p. 472-82. Yuneva, M., Finding an "Achilles' heel" of cancer: the role of glucose and glutamine metabolism in the survival of transformed cells. Cell Cycle, 2008. 7(14): p. 2083-9. Pike, L.S., et al., Inhibition of fatty acid oxidation by etomoxir impairs NADPH production and increases reactive oxygen species resulting in ATP depletion and cell death in human glioblastoma cells. Biochim Biophys Acta, 2011. 1807(6): p. 726-34. Griguer, C.E., C.R. Oliva, and G.Y. Gillespie, Glucose metabolism heterogeneity in human and mouse malignant glioma cell lines. J Neurooncol, 2005. 74(2): p. 123-33. Miccheli, A., et al., Metabolic profiling by 13C-NMR spectroscopy: [1,2-13C2]glucose reveals a heterogeneous metabolism in human leukemia T cells. Biochimie, 2006. 88(5): p. 437-48. Berridge, M.V., P.M. Herst, and A.S. Tan, Metabolic flexibility and cell hierarchy in metastatic cancer. Mitochondrion, 2010. 10(6): p. 584-8. Marusyk, A. and K. Polyak, Tumor heterogeneity: causes and consequences. Biochim Biophys Acta, 2010. 1805(1): p. 105-17. Koppenol, W.H., P.L. Bounds, and C.V. Dang, Otto Warburg's contributions to current concepts of cancer metabolism. Nat Rev Cancer, 2011. 11(5): p. 325-37. Fantin, V.R., J. St-Pierre, and P. Leder, Attenuation of LDH-A expression uncovers a link between glycolysis, mitochondrial physiology, and tumor maintenance. Cancer Cell, 2006. 9(6): p. 425-34. Bonuccelli, G., et al., Ketones and lactate "fuel" tumor growth and metastasis: Evidence that epithelial cancer cells use oxidative mitochondrial metabolism. Cell Cycle, 2010. 9(17): p. 3506-14. Pavlides, S., et al., The reverse Warburg effect: aerobic glycolysis in cancer associated fibroblasts and the tumor stroma. Cell Cycle, 2009. 8(23): p. 3984-4001. 118 330. 331. 332. 333. 334. 335. 336. 337. 338. 339. 340. 341. 342. 343. 344. 345. 346. 347. 348. 349. 350. Koukourakis, M.I., et al., Comparison of metabolic pathways between cancer cells and stromal cells in colorectal carcinomas: a metabolic survival role for tumor-associated stroma. Cancer Res, 2006. 66(2): p. 632-7. Feron, O., Pyruvate into lactate and back: from the Warburg effect to symbiotic energy fuel exchange in cancer cells. Radiother Oncol, 2009. 92(3): p. 329-33. Belanger, M., I. Allaman, and P.J. Magistretti, Brain energy metabolism: focus on astrocyteneuron metabolic cooperation. Cell Metab, 2011. 14(6): p. 724-38. Martinez-Outschoorn, U.E., et al., Tumor cells induce the cancer associated fibroblast phenotype via caveolin-1 degradation: implications for breast cancer and DCIS therapy with autophagy inhibitors. Cell Cycle, 2010. 9(12): p. 2423-33. Martinez-Outschoorn, U.E., et al., Oxidative stress in cancer associated fibroblasts drives tumor-stroma co-evolution: A new paradigm for understanding tumor metabolism, the field effect and genomic instability in cancer cells. Cell Cycle, 2010. 9(16): p. 3256-76. Nakajima, E.C. and B. Van Houten, Metabolic symbiosis in cancer: refocusing the Warburg lens. Mol Carcinog, 2013. 52(5): p. 329-37. Kurlemann, G., et al., Therapy of complex I deficiency: peripheral neuropathy during dichloroacetate therapy. Eur J Pediatr, 1995. 154(11): p. 928-32. Bonnet, S., et al., A mitochondria-K+ channel axis is suppressed in cancer and its normalization promotes apoptosis and inhibits cancer growth. Cancer Cell, 2007. 11(1): p. 37-51. Dutta-Roy, A.K., Cellular uptake of long-chain fatty acids: role of membrane-associated fatty-acid-binding/transport proteins. Cell Mol Life Sci, 2000. 57(10): p. 1360-72. Gazi, E., et al., Direct evidence of lipid translocation between adipocytes and prostate cancer cells with imaging FTIR microspectroscopy. J Lipid Res, 2007. 48(8): p. 1846-56. Paton, C.M. and J.M. Ntambi, Biochemical and physiological function of stearoyl-CoA desaturase. Am J Physiol Endocrinol Metab, 2009. 297(1): p. E28-37. Scaglia, N. and R.A. Igal, Stearoyl-CoA desaturase is involved in the control of proliferation, anchorage-independent growth, and survival in human transformed cells. J Biol Chem, 2005. 280(27): p. 25339-49. Scaglia, N., J.W. Chisholm, and R.A. Igal, Inhibition of stearoylCoA desaturase-1 inactivates acetyl-CoA carboxylase and impairs proliferation in cancer cells: role of AMPK. PLoS One, 2009. 4(8): p. e6812. Koltun, D.O., et al., Novel, potent, selective, and metabolically stable stearoyl-CoA desaturase (SCD) inhibitors. Bioorg Med Chem Lett, 2009. 19(7): p. 2048-52. Hatzivassiliou, G., et al., ATP citrate lyase inhibition can suppress tumor cell growth. Cancer Cell, 2005. 8(4): p. 311-21. Bauer, D.E., et al., ATP citrate lyase is an important component of cell growth and transformation. Oncogene, 2005. 24(41): p. 6314-22. Milgraum, L.Z., et al., Enzymes of the fatty acid synthesis pathway are highly expressed in in situ breast carcinoma. Clin Cancer Res, 1997. 3(11): p. 2115-20. Kuhajda, F.P., Fatty-acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition, 2000. 16(3): p. 202-8. Kuhajda, F.P., Fatty acid synthase and cancer: new application of an old pathway. Cancer Res, 2006. 66(12): p. 5977-80. Lupu, R. and J.A. Menendez, Targeting fatty acid synthase in breast and endometrial cancer: An alternative to selective estrogen receptor modulators? Endocrinology, 2006. 147(9): p. 4056-66. Martel, P.M., et al., S14 protein in breast cancer cells: direct evidence of regulation by SREBP-1c, superinduction with progestin, and effects on cell growth. Exp Cell Res, 2006. 312(3): p. 278-88. 119 351. 352. 353. 354. 355. 356. 357. 358. 359. 360. 361. 362. 363. 364. 365. 366. 367. 368. 369. 370. 371. 372. 373. Menendez, J.A., J.P. Decker, and R. Lupu, In support of fatty acid synthase (FAS) as a metabolic oncogene: extracellular acidosis acts in an epigenetic fashion activating FAS gene expression in cancer cells. J Cell Biochem, 2005. 94(1): p. 1-4. Furuta, E., et al., Fatty acid synthase gene is up-regulated by hypoxia via activation of Akt and sterol regulatory element binding protein-1. Cancer Res, 2008. 68(4): p. 1003-11. Graner, E., et al., The isopeptidase USP2a regulates the stability of fatty acid synthase in prostate cancer. Cancer Cell, 2004. 5(3): p. 253-61. Mashima, T., H. Seimiya, and T. Tsuruo, De novo fatty-acid synthesis and related pathways as molecular targets for cancer therapy. Br J Cancer, 2009. 100(9): p. 1369-72. Berk, P.D. and D.D. Stump, Mechanisms of cellular uptake of long chain free fatty acids. Mol Cell Biochem, 1999. 192(1-2): p. 17-31. Hertzel, A.V. and D.A. Bernlohr, The mammalian fatty acid-binding protein multigene family: molecular and genetic insights into function. Trends Endocrinol Metab, 2000. 11(5): p. 175-80. Storch, J. and A.E. Thumser, Tissue-specific functions in the fatty acid-binding protein family. J Biol Chem, 2010. 285(43): p. 32679-83. Furuhashi, M. and G.S. Hotamisligil, Fatty acid-binding proteins: role in metabolic diseases and potential as drug targets. Nat Rev Drug Discov, 2008. 7(6): p. 489-503. Tan, N.S., et al., Selective cooperation between fatty acid binding proteins and peroxisome proliferator-activated receptors in regulating transcription. Mol Cell Biol, 2002. 22(14): p. 5114-27. Hancke, K., et al., Adipocyte fatty acid-binding protein as a novel prognostic factor in obese breast cancer patients. Breast Cancer Res Treat, 2010. 119(2): p. 367-7. Furuhashi, M., et al., Treatment of diabetes and atherosclerosis by inhibiting fatty-acidbinding protein aP2. Nature, 2007. 447(7147): p. 959-65. Lan, H., et al., Small-molecule inhibitors of FABP4/5 ameliorate dyslipidemia but not insulin resistance in mice with diet-induced obesity. J Lipid Res, 2011. 52(4): p. 646-56. Kunau, W.H., V. Dommes, and H. Schulz, beta-oxidation of fatty acids in mitochondria, peroxisomes, and bacteria: a century of continued progress. Prog Lipid Res, 1995. 34(4): p. 267-342. Felber, J.P. and A. Golay, Regulation of nutrient metabolism and energy expenditure. Metabolism, 1995. 44(2 Suppl 2): p. 4-9. Eaton, S., K. Bartlett, and M. Pourfarzam, Mammalian mitochondrial beta-oxidation. Biochem J, 1996. 320 ( Pt 2): p. 345-57. Engels, W., et al., Cytochrome P450, peroxisome proliferation, and cytoplasmic fatty acidbinding protein content in liver, heart and kidney of the diabetic rat. Mol Cell Biochem, 1999. 192(1-2): p. 53-61. Capdevila, J.H., J.R. Falck, and R.C. Harris, Cytochrome P450 and arachidonic acid bioactivation. Molecular and functional properties of the arachidonate monooxygenase. J Lipid Res, 2000. 41(2): p. 163-81. Gibbons, G.F., K. Islam, and R.J. Pease, Mobilisation of triacylglycerol stores. Biochim Biophys Acta, 2000. 1483(1): p. 37-57. van den Bosch, H., et al., Biochemistry of peroxisomes. Annu Rev Biochem, 1992. 61: p. 157-97. Hashimoto, T., Peroxisomal beta-oxidation enzymes. Neurochem Res, 1999. 24(4): p. 55163. Reddy, J.K. and G.P. Mannaerts, Peroxisomal lipid metabolism. Annu Rev Nutr, 1994. 14: p. 343-70. Mannaerts, G.P., P.P. Van Veldhoven, and M. Casteels, Peroxisomal lipid degradation via beta- and alpha-oxidation in mammals. Cell Biochem Biophys, 2000. 32 Spring: p. 73-87. Fan, C.Y., et al., Steatohepatitis, spontaneous peroxisome proliferation and liver tumors in mice lacking peroxisomal fatty acyl-CoA oxidase. Implications for peroxisome proliferator120 374. 375. 376. 377. 378. 379. 380. 381. 382. 383. 384. 385. 386. 387. 388. 389. 390. 391. activated receptor alpha natural ligand metabolism. J Biol Chem, 1998. 273(25): p. 1563945. Schepers, L., et al., Presence of three acyl-CoA oxidases in rat liver peroxisomes. An inducible fatty acyl-CoA oxidase, a noninducible fatty acyl-CoA oxidase, and a noninducible trihydroxycoprostanoyl-CoA oxidase. J Biol Chem, 1990. 265(9): p. 5242-6. Gottlieb, E. and I.P. Tomlinson, Mitochondrial tumour suppressors: a genetic and biochemical update. Nat Rev Cancer, 2005. 5(11): p. 857-66. Rinaldo, P., D. Matern, and M.J. Bennett, Fatty acid oxidation disorders. Annu Rev Physiol, 2002. 64: p. 477-502. Bartlett, K. and S. Eaton, Mitochondrial beta-oxidation. Eur J Biochem, 2004. 271(3): p. 462-9. Bonnefont, J.P., et al., Carnitine palmitoyltransferases 1 and 2: biochemical, molecular and medical aspects. Mol Aspects Med, 2004. 25(5-6): p. 495-520. Izai, K., et al., Novel fatty acid beta-oxidation enzymes in rat liver mitochondria. I. Purification and properties of very-long-chain acyl-coenzyme A dehydrogenase. J Biol Chem, 1992. 267(2): p. 1027-33. Ikeda, Y., K. Okamura-Ikeda, and K. Tanaka, Purification and characterization of shortchain, medium-chain, and long-chain acyl-CoA dehydrogenases from rat liver mitochondria. Isolation of the holo- and apoenzymes and conversion of the apoenzyme to the holoenzyme. J Biol Chem, 1985. 260(2): p. 1311-25. Kurtz, D.M., et al., Targeted disruption of mouse long-chain acyl-CoA dehydrogenase gene reveals crucial roles for fatty acid oxidation. Proc Natl Acad Sci U S A, 1998. 95(26): p. 15592-7. Uchida, Y., et al., Novel fatty acid beta-oxidation enzymes in rat liver mitochondria. II. Purification and properties of enoyl-coenzyme A (CoA) hydratase/3-hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase trifunctional protein. J Biol Chem, 1992. 267(2): p. 1034-41. Carpenter, K., R.J. Pollitt, and B. Middleton, Human liver long-chain 3-hydroxyacylcoenzyme A dehydrogenase is a multifunctional membrane-bound beta-oxidation enzyme of mitochondria. Biochem Biophys Res Commun, 1992. 183(2): p. 443-8. Ushikubo, S., et al., Molecular characterization of mitochondrial trifunctional protein deficiency: formation of the enzyme complex is important for stabilization of both alphaand beta-subunits. Am J Hum Genet, 1996. 58(5): p. 979-88. Weinberger, M.J., et al., Intact alpha-subunit is required for membrane-binding of human mitochondrial trifunctional beta-oxidation protein, but is not necessary for conferring 3ketoacyl-CoA thiolase activity to the beta-subunit. Biochem Biophys Res Commun, 1995. 209(1): p. 47-52. Kobayashi, A., L.L. Jiang, and T. Hashimoto, Two mitochondrial 3-hydroxyacyl-CoA dehydrogenases in bovine liver. J Biochem, 1996. 119(4): p. 775-82. Consitt, L.A., et al., Peroxisome proliferator-activated receptor-gamma coactivator-1alpha overexpression increases lipid oxidation in myocytes from extremely obese individuals. Diabetes, 2010. 59(6): p. 1407-15. Rector, R.S., et al., Daily exercise increases hepatic fatty acid oxidation and prevents steatosis in Otsuka Long-Evans Tokushima Fatty rats. Am J Physiol Gastrointest Liver Physiol, 2008. 294(3): p. G619-26. Thyfault, J.P., et al., Rats selectively bred for low aerobic capacity have reduced hepatic mitochondrial oxidative capacity and susceptibility to hepatic steatosis and injury. J Physiol, 2009. 587(Pt 8): p. 1805-16. Morris, E.M., et al., Mitochondria and redox signaling in steatohepatitis. Antioxid Redox Signal, 2011. 15(2): p. 485-504. Holloszy, J.O., Regulation by exercise of skeletal muscle content of mitochondria and GLUT4. J Physiol Pharmacol, 2008. 59 Suppl 7: p. 5-18. 121 392. 393. 394. 395. 396. 397. 398. 399. 400. 401. 402. 403. 404. 405. 406. 407. 408. 409. 410. 411. 412. 413. 414. 415. Morris, E.M., et al., PGC-1alpha overexpression results in increased hepatic fatty acid oxidation with reduced triacylglycerol accumulation and secretion. Am J Physiol Gastrointest Liver Physiol, 2012. 303(8): p. G979-92. Koves, T.R., et al., Peroxisome proliferator-activated receptor-gamma co-activator 1alphamediated metabolic remodeling of skeletal myocytes mimics exercise training and reverses lipid-induced mitochondrial inefficiency. J Biol Chem, 2005. 280(39): p. 33588-98. Liu, Y., Fatty acid oxidation is a dominant bioenergetic pathway in prostate cancer. Prostate Cancer Prostatic Dis, 2006. 9(3): p. 230-4. Khasawneh, J., et al., Inflammation and mitochondrial fatty acid beta-oxidation link obesity to early tumor promotion. Proc Natl Acad Sci U S A, 2009. 106(9): p. 3354-9. Monti, S., et al., Molecular profiling of diffuse large B-cell lymphoma identifies robust subtypes including one characterized by host inflammatory response. Blood, 2005. 105(5): p. 1851-61. Caro, P., et al., Metabolic signatures uncover distinct targets in molecular subsets of diffuse large B cell lymphoma. Cancer Cell, 2012. 22(4): p. 547-60. Linher-Melville, K., et al., Establishing a relationship between prolactin and altered fatty acid beta-oxidation via carnitine palmitoyl transferase 1 in breast cancer cells. BMC Cancer, 2011. 11: p. 56. Buzzai, M., et al., The glucose dependence of Akt-transformed cells can be reversed by pharmacologic activation of fatty acid beta-oxidation. Oncogene, 2005. 24(26): p. 4165-73. Taegtmeyer, H., Cardiac metabolism as a target for the treatment of heart failure. Circulation, 2004. 110(8): p. 894-6. Samudio, I., et al., Pharmacologic inhibition of fatty acid oxidation sensitizes human leukemia cells to apoptosis induction. J Clin Invest, 2010. 120(1): p. 142-56. Zaugg, K., et al., Carnitine palmitoyltransferase 1C promotes cell survival and tumor growth under conditions of metabolic stress. Genes Dev, 2011. 25(10): p. 1041-51. Schafer, Z.T., et al., Antioxidant and oncogene rescue of metabolic defects caused by loss of matrix attachment. Nature, 2009. 461(7260): p. 109-13. Carracedo, A., et al., A metabolic prosurvival role for PML in breast cancer. J Clin Invest, 2012. 122(9): p. 3088-100. Martinez-Outschoorn, U.E., et al., Energy transfer in "parasitic" cancer metabolism: mitochondria are the powerhouse and Achilles' heel of tumor cells. Cell Cycle, 2011. 10(24): p. 4208-16. Tisdale, M.J., Cachexia in cancer patients. Nat Rev Cancer, 2002. 2(11): p. 862-71. Dewys, W.D., et al., Prognostic effect of weight loss prior to chemotherapy in cancer patients. Eastern Cooperative Oncology Group. Am J Med, 1980. 69(4): p. 491-7. Blum, D. and F. Strasser, Cachexia assessment tools. Curr Opin Support Palliat Care, 2011. 5(4): p. 350-5. Fearon, K.C., The Sir David Cuthbertson Medal Lecture 1991. The mechanisms and treatment of weight loss in cancer. Proc Nutr Soc, 1992. 51(2): p. 251-65. Lainscak, M., et al., Cachexia: common, deadly, with an urgent need for precise definition and new therapies. Am J Cardiol, 2008. 101(11A): p. 8E-10E. Chung, T.H., et al., YC-1 rescues cancer cachexia by affecting lipolysis and adipogenesis. Int J Cancer, 2011. 129(9): p. 2274-83. Das, S.K., et al., Adipose triglyceride lipase contributes to cancer-associated cachexia. Science, 2011. 333(6039): p. 233-8. Fearon, K.C., Cancer cachexia and fat-muscle physiology. N Engl J Med, 2011. 365(6): p. 565-7. Notarnicola, M., et al., Low levels of lipogenic enzymes in peritumoral adipose tissue of colorectal cancer patients. Lipids, 2012. 47(1): p. 59-63. Lanza-Jacoby, S., et al., Sequential changes in the activities of lipoprotein lipase and lipogenic enzymes during tumor growth in rats. Cancer Res, 1984. 44(11): p. 5062-7. 122 416. 417. 418. 419. 420. 421. 422. 423. 424. 425. 426. 427. 428. 429. 430. 431. 432. 433. 434. 435. 436. 437. 438. 439. Tisdale, M.J., Mechanisms of cancer cachexia. Physiol Rev, 2009. 89(2): p. 381-410. Thompson, M.P., et al., Increased expression of the mRNA for hormone-sensitive lipase in adipose tissue of cancer patients. Biochim Biophys Acta, 1993. 1180(3): p. 236-42. Cao, D.X., et al., Role of beta1-adrenoceptor in increased lipolysis in cancer cachexia. Cancer Sci, 2010. 101(7): p. 1639-45. Agustsson, T., et al., Mechanism of increased lipolysis in cancer cachexia. Cancer Res, 2007. 67(11): p. 5531-7. Das, S.K. and G. Hoefler, The role of triglyceride lipases in cancer associated cachexia. Trends Mol Med, 2013. 19(5): p. 292-301. Nomura, D.K., et al., Monoacylglycerol lipase regulates a fatty acid network that promotes cancer pathogenesis. Cell, 2010. 140(1): p. 49-61. Nomura, D.K., et al., Monoacylglycerol lipase exerts dual control over endocannabinoid and fatty acid pathways to support prostate cancer. Chem Biol, 2011. 18(7): p. 846-56. Ye, L., et al., Monoacylglycerol lipase (MAGL) knockdown inhibits tumor cells growth in colorectal cancer. Cancer Lett, 2011. 307(1): p. 6-17. Parekh, N., U. Chandran, and E.V. Bandera, Obesity in cancer survival. Annu Rev Nutr, 2012. 32: p. 311-42. Dirat, B., et al., Unraveling the obesity and breast cancer links: a role for cancer-associated adipocytes? Endocr Dev, 2010. 19: p. 45-52. Nieman, K.M., et al., Adipose tissue and adipocytes support tumorigenesis and metastasis. Biochim Biophys Acta, 2013. Grum-Schwensen, B., et al., Suppression of tumor development and metastasis formation in mice lacking the S100A4(mts1) gene. Cancer Res, 2005. 65(9): p. 3772-80. Cederberg, A., et al., FOXC2 is a winged helix gene that counteracts obesity, hypertriglyceridemia, and diet-induced insulin resistance. Cell, 2001. 106(5): p. 563-73. Tsoli, M., et al., Activation of thermogenesis in brown adipose tissue and dysregulated lipid metabolism associated with cancer cachexia in mice. Cancer Res, 2012. 72(17): p. 4372-82. Guerra, C., et al., Emergence of brown adipocytes in white fat in mice is under genetic control. Effects on body weight and adiposity. J Clin Invest, 1998. 102(2): p. 412-20. Gaidhu, M.P., et al., Prolonged AICAR-induced AMP-kinase activation promotes energy dissipation in white adipocytes: novel mechanisms integrating HSL and ATGL. J Lipid Res, 2009. 50(4): p. 704-15. Daval, M., et al., Anti-lipolytic action of AMP-activated protein kinase in rodent adipocytes. J Biol Chem, 2005. 280(26): p. 25250-7. Lin, Z.Y., Y.H. Chuang, and W.L. Chuang, Cancer-associated fibroblasts up-regulate CCL2, CCL26, IL6 and LOXL2 genes related to promotion of cancer progression in hepatocellular carcinoma cells. Biomed Pharmacother, 2012. 66(7): p. 525-9. Dominguez-Soto, A., et al., Dendritic cell-specific ICAM-3-grabbing nonintegrin expression on M2-polarized and tumor-associated macrophages is macrophage-CSF dependent and enhanced by tumor-derived IL-6 and IL-10. J Immunol, 2011. 186(4): p. 2192-200. Kishimoto, T., IL-6: from its discovery to clinical applications. Int Immunol, 2010. 22(5): p. 347-52. Rio, M.C., From a unique cell to metastasis is a long way to go: clues to stromelysin-3 participation. Biochimie, 2005. 87(3-4): p. 299-306. Heizmann, C.W., G. Fritz, and B.W. Schafer, S100 proteins: structure, functions and pathology. Front Biosci, 2002. 7: p. d1356-68. Mishra, S.K., H.R. Siddique, and M. Saleem, S100A4 calcium-binding protein is key player in tumor progression and metastasis: preclinical and clinical evidence. Cancer Metastasis Rev, 2012. 31(1-2): p. 163-72. Flatmark, K., et al., Nuclear localization of the metastasis-related protein S100A4 correlates with tumour stage in colorectal cancer. J Pathol, 2003. 200(5): p. 589-95. 123 440. Pedersen, K.B., et al., Expression of S100A4, E-cadherin, alpha- and beta-catenin in breast cancer biopsies. Br J Cancer, 2002. 87(11): p. 1281-6. 441. Rudland, P.S., et al., Prognostic significance of the metastasis-inducing protein S100A4 (p9Ka) in human breast cancer. Cancer Res, 2000. 60(6): p. 1595-603. 442. Takenaga, K., et al., Increased expression of S100A4, a metastasis-associated gene, in human colorectal adenocarcinomas. Clin Cancer Res, 1997. 3(12 Pt 1): p. 2309-16. 443. Ryan, D.G., et al., Involvement of S100A4 in stromal fibroblasts of the regenerating cornea. Invest Ophthalmol Vis Sci, 2003. 44(10): p. 4255-62. 444. Ambartsumian, N.S., et al., Metastasis of mammary carcinomas in GRS/A hybrid mice transgenic for the mts1 gene. Oncogene, 1996. 13(8): p. 1621-30. 445. O'Connell, J.T., et al., VEGF-A and Tenascin-C produced by S100A4+ stromal cells are important for metastatic colonization. Proc Natl Acad Sci U S A, 2011. 108(38): p. 16002-7. 446. Jia, W., et al., S100A4 silencing suppresses proliferation, angiogenesis and invasion of thyroid cancer cells through downregulation of MMP-9 and VEGF. Eur Rev Med Pharmacol Sci, 2013. 17(11): p. 1495-508. 447. Boye, K. and G.M. Maelandsmo, S100A4 and metastasis: a small actor playing many roles. Am J Pathol, 2010. 176(2): p. 528-35. 448. O'Neill, H.M., G.P. Holloway, and G.R. Steinberg, AMPK regulation of fatty acid metabolism and mitochondrial biogenesis: implications for obesity. Mol Cell Endocrinol, 2013. 366(2): p. 135-51. 449. Wang, W. and K.L. Guan, AMP-activated protein kinase and cancer. Acta Physiol (Oxf), 2009. 196(1): p. 55-63. 450. Wang, X., X. Pan, and J. Song, AMP-activated protein kinase is required for induction of apoptosis and epithelial-to-mesenchymal transition. Cell Signal, 2010. 22(11): p. 1790-7. 451. Ahmadian, M., et al., Desnutrin/ATGL is regulated by AMPK and is required for a brown adipose phenotype. Cell Metab, 2011. 13(6): p. 739-48. 452. Haemmerle, G., et al., ATGL-mediated fat catabolism regulates cardiac mitochondrial function via PPAR-alpha and PGC-1. Nat Med, 2011. 17(9): p. 1076-85. 453. Tang, X.Y., et al., Overexpression of fatty acid binding protein-7 correlates with basal-like subtype of breast cancer. Pathol Res Pract, 2010. 206(2): p. 98-101. 454. Holubarsch, C.J., et al., A double-blind randomized multicentre clinical trial to evaluate the efficacy and safety of two doses of etomoxir in comparison with placebo in patients with moderate congestive heart failure: the ERGO (etomoxir for the recovery of glucose oxidation) study. Clin Sci (Lond), 2007. 113(4): p. 205-12. 455. Carracedo, A., L.C. Cantley, and P.P. Pandolfi, Cancer metabolism: fatty acid oxidation in the limelight. Nat Rev Cancer, 2013. 13(4): p. 227-32. 456. Kantor, P.F., et al., The antianginal drug trimetazidine shifts cardiac energy metabolism from fatty acid oxidation to glucose oxidation by inhibiting mitochondrial long-chain 3ketoacyl coenzyme A thiolase. Circ Res, 2000. 86(5): p. 580-8. 457. Nash, D.T. and S.D. Nash, Ranolazine for chronic stable angina. Lancet, 2008. 372(9646): p. 1335-41. 458. Carmichael AR, Obesity as a risk factor for development and poor prognosis of breast cancer BJOG. 2006 Oct;113(10):1160-6 459. Villena JA., et al., Desnutrin, an adipocyte gene encoding a novel patatin domain-containing protein, is induced by fasting and glucocorticoids: ectopic expression of desnutrin increases triglyceride hydrolysis. J Biol Chem. 2004 Nov 5;279(45):47066-75. 460. Jenkins CM., et al., Identification, cloning, expression, and purification of three novel human calcium-independent phospholipase A2 family members possessing triacylglycerol lipase and acylglycerol transacylase activities. J Biol Chem. 2004 Nov 19;279(47):48968-75. 124 ANNEX: Tissu adipeux et cancer: une proximite dangereuse (Lehuede et al, 2013, cancers aux feminins, in press) 125 Tissu adipeux et cancer : une proximité dangereuse Camille Lehuédé1,2#, Ikrame Lazar1,2#, Laurence Nieto1,2, Yuan Yuan Wang1,2, Ghislaine Escourrou3, Philippe Valet1,4, Catherine Muller1,2* # Contribution équivalente Affiliations 1 Université de Toulouse, UPS, F-31077 Toulouse, France 2 Institut de Pharmacologie et de Biologie Structurale, CNRS UMR 5089, 205 route de Narbonne, BP 64182, F-31077 Toulouse, France 3 Service d'Anatomie pathologique et Histologie-Cytologie, CHU, Hôpital Rangueil, 1, avenue Jean- Poulhes, TSA 50032, 31403 Toulouse, France. 4 Institut National de la Santé et de la Recherche Médicale, INSERM U1048, F-31432 Toulouse, France * Auteur correspondant : Pr Catherine MULLER – Institut de Pharmacologie et de Biologie Structurale, CNRS UMR 5089, 205 route de Narbonne, BP 64182, F-31077 Toulouse, France Tel : 0561175932/ Fax : 0561175994/ mail : [email protected] Mots clés : Obésité – Tissu adipeux – Cancer du sein – Microenvironnement – Adipocytes péritumoraux Explication du titre : Un dialogue bidirectionnel s’établit entre les tumeurs et les cellules graisseuses à proximité ce qui favorise la progression tumorale. Ce dialogue pourrait être amplifié chez les sujets obèses et expliquer ainsi l’agressivité des tumeurs dans ce sous-groupe de patients. 1 Résumé Il est maintenant clairement établi que l’obésité favorise la survenue et affecte le pronostic de nombreux cancers dont le cancer du sein. En utilisant le cancer su sein comme modèle, nous montrons ici qu’un dialogue bidirectionnel s’établit entre les cellules tumorales et le tissu adipeux à proximité. Les adipocytes péritumoraux présentent une délipidation et une diminution des marqueurs adipocytaires, cellules que nous avons appelé CAAs pour « Cancer-Associated Adipocytes ». Via leur capacité à sécréter des molécules pro-inflammatoires, des protéines de la matrice extra-cellulaire ou à libérer des acides gras, les CAAs stimulent la prolifération, la survie, les capacités invasives des tumeurs et favorisent la résistance aux traitements. Le propos de cette revue est de décrire comment les adipocytes affectent le comportement des tumeurs et de présenter les conséquences cliniques de ce dialogue délétère. Deux situations seront abordées. Tout d’abord, l’obésité où le tissu adipeux présente des modifications morphologiques et fonctionnelles qui le rendent plus enclin à favoriser localement la progression tumorale, pouvant expliquer le pronostic défavorable observé chez ces patientes. D’autre part, le risque carcinologique du transfert de graisse utilisé en chirurgie reconstructrice dans le cancer du sein sera décrit au regard de ces nouveaux éléments de connaissance sur le dialogue entre tissu graisseux et cancer. Summary Several epidemiological studies demonstrate positive associations between the prevalence of obesity, as judged by increased body mass index (BMI), cancer incidence, and cancer-related mortality. We have recently demonstrated that a bidirectional crosstalk is established between breast cancer cells and tumour-surrounding adipocytes. Tumour cell secretions are able to modify tumour-surrounding adipocytes to an activated state that we have named Cancer-Associated Adipocytes (CAAs). CAAs, by their ability to secrete proinflammatory molecules, extracellular matrix proteins and to liberate free fatty acids, stimulate tumor growth, survival, invasive capacities as well as resistance to treatment. The purpose of this review is to emphasize the role that adipose tissue might play by locally affecting breast cancer cell behaviour and subsequent clinical consequences arising from this dialog. Two particular clinical aspects are addressed: obesity that was identified as an independent negative prognosis factor in breast cancer and the oncological safety of autologous fat transfer used in reconstructive surgery for breast cancer patients. 2 L’obésité influence la survenue mais aussi le pronostic de certains cancers Au cours des dernières décennies, l’obésité est devenue un problème de santé publique majeur. L’organisation mondiale de la santé prévoit qu’en 2015, 3 milliards d’adultes dans le monde seront en surpoids tandis que 700 millions seront obèses. Chaque année, environ 3 millions de personnes meurent du fait des complications de l’obésité et ces chiffres sont en constante progression. Si les complications métaboliques et cardiovasculaires de l’obésité sont maintenant connues du grand public, le lien entre obésité et cancer reste lui largement ignoré. En 2003, une large étude épidémiologique publiée par le New England Journal of Medecine établit pour la première fois qu’aux Etats-Unis, environ 14% des décès par cancer chez l’homme et 20% chez la femme seraient dus à l’obésité [1]. Parmi les cancers les plus fréquemment concernés, on trouve des cancers digestifs (adénocarcinomes œsophagiens, cancers colorectaux et pancréatiques), des cancers gynécologiques (endomètre, sein après la ménopause) ainsi que les cancers du rein [1]. Outre l’augmentation du nombre de cancers, un des aspects du lien entre cancers et obésité qui a retenu notre attention est l’impact de cette dernière sur le pronostic, en particulier dans le cancer du sein. En effet, dans les carcinomes mammaires, l’obésité est un facteur indépendant de mauvais pronostic [2], les femmes obèses présentant une diminution de la survie globale, une diminution de la survie sans maladie ainsi qu’une augmentation des métastases. Ce caractère péjoratif semble indépendant de la ménopause, du stade de la tumeur et de son statut hormonal [pour revue [2]; [3]; [4]]. Il existe incontestablement des facteurs non biologiques qui pourraient expliquer ce résultat, en particulier des retards de diagnostic et des difficultés à utiliser une approche thérapeutique adaptée tel que le sous-dosage de la chimiothérapie [5, 6]. Cependant, des arguments convaincants montrent à l’heure actuelle que l’hôte, c’est à dire le sujet obèse, pourrait conduire à des modifications des propriétés de la tumeur à la faveur d’une augmentation de son agressivité [7] et [5]. Une des particularités du cancer du sein est sa proximité avec le tissu adipeux (TA), un contact physique s’établissant entre TA et cancer dès que ce dernier devient invasif (figure 1). Ces vingt dernières années, il a clairement été montré que la progression tumorale dépend d’une interaction dynamique avec les cellules « normales » entourant la tumeur [8]; [9]. Ces cellules normales, encore appelées cellules du microenvironnement ou stroma, sont activées localement ou recrutées par la 3 tumeur. L’importance dans la progression tumorale de certaines de ces cellules telles que les fibroblastes associés au cancer (CAF pour Cancer Associated Fibroblast) ou encore des macrophages (TAM pour Tumor Associated Macrophage) a été clairement décrite [10]; [11]. Ainsi, dans ce contexte, parmi les cellules qui constituent le stroma tumoral, les cellules adipeuses sont probablement celles dont le rôle a été le moins bien caractérisé alors qu’ils représentent le type cellulaire prédominant du microenvironnement des carcinomes mammaires. Les adipocytes matures représentent les cellules majoritaires du TA qui contient aussi, dans une fraction dite « stroma vasculaire », d’autres cellules telles que des progéniteurs (Adipose Derived Stem Cells ou ADSCs et préadipocytes), des fibroblastes, des macrophages, des lymphocytes, des péricytes ainsi que des cellules endothéliales [12]. L’adipocyte gère les fluctuations énergétiques induites par l'apport alimentaire ou les états de jeûne en stockant l'énergie sous forme de triglycérides ou en la libérant sous forme d'acides gras (AG) [13]. Toutefois, à côté de sa fonction de réservoir d’énergie, l’adipocyte est également une cellule endocrine active qui sécrète une grande variété de molécules (appelées adipokines), incluant des hormones, des facteurs de croissance, des chimiokines ou des molécules pro-inflammatoires [12], clairement susceptible d’influencer le comportement des tumeurs. Ainsi, l’hypothèse principale de nos travaux est que le dialogue local entre adipocytes et cellules tumorales pourrait influencer la survie, la prolifération et le potentiel métastatique de ces dernières, cet effet pouvant être exacerbé au cours de l'obésité où les sécrétions adipocytaires sont altérées [12]. Rôle des adipocytes péri-tumoraux dans la progression tumorale : le concept de CancerAssociated Adipocytes (CAAs) Afin d’étudier l’influence des adipocytes péritumoraux, nous avons mis en place au laboratoire un système de coculture entre cellules cancéreuses et adipocytes, les deux populations étant séparées par un insert autorisant le passage de facteurs solubles (figure 2). Après trois à cinq jours de coculture, nous avons étudié le comportement de ces cellules tumorales « éduquées » par les adipocytes. Parmi les différentes caractéristiques des tumeurs ainsi modifiées, nous avons retrouvé une augmentation de leurs propriétés invasives à la fois in vitro et in vivo, qu’il s’agisse de cellules exprimant ou non le récepteur aux œstrogènes (RE). Ainsi, des cellules tumorales mammaires « éduquées » par des 4 adipocytes et injectées dans la queue d’une souris présentent une capacité à former des métastases pulmonaires très fortement augmentée [14]. Comment les adipocytes peuvent-ils influencer le comportement des tumeurs ? Quelle que soit la lignée de cancer du sein utilisée, ces adipocytes subissent d’importantes modifications. En effet, ils présentent une délipidation partielle et une diminution de l’expression des marqueurs adipocytaires. Cette « dédifférenciation » s’accompagne d’un état d’activation marqué par la surexpression de cytokines pro-inflammatoires (interleukine 6 ou IL6, interleukine 1β ou IL1β, Tumor Necrosis Factor α ou TNFα) ainsi que de protéines de la matrice extra-cellulaire (MEC) et de son remodelage. Fait majeur, nous avons montré que ces adipocytes modifiés sont retrouvées au front invasif des tumeurs humaines (figure 2), soulignant ainsi la relevance clinique des résultats obtenus dans le système de coculture [14]. Quels sont les médiateurs les plus importants expliquant l’influence des CAAs sur la tumeur ? Tout d’abord l’inflammation et en particulier l’IL6. En effet, dans une série de 32 échantillons comparant les caractéristiques des adipocytes péritumoraux à des adipocytes normaux issus de mammoplastie de réduction, nous avons retrouvé une augmentation très importante de l’IL6 (7.5 fois) dans les CAAs. De façon très intéressante, le niveau d’expression de l’IL6 dans les CAAs est corrélé à la taille des tumeurs et à l’envahissement ganglionnaire mais non à l’expression du RE, du type ou du grade de ces dernières [14]. Dans notre modèle de coculture, le blocage par des anticorps spécifiques de l’IL6 adipocytaire diminue l’effet pro-invasif des adipocytes, confirmant l’importance de l’inflammation dans le dialogue TA/cancer. Outre l’inflammation, l’importance des protéines de la MEC ou de son remodelage a été soulignée par différentes équipes. Une des protéines de la matrice qui est fortement exprimée par les adipocytes péritumoraux et qui favorise la croissance des tumeurs mammaires in vivo est le collagène VI (COL6) [15]. De plus, il a été récemment montré qu’un des fragments de clivage du collagène, l’endotrophine, agissait comme une molécule de signalisation et augmentait la fibrose, l’angiogenèse et l’inflammation dans le microenvironnement des tumeurs mammaires favorisant ainsi l’agressivité tumorale et en particulier l’apparition de métastases [16]. Les CAAs expriment aussi la MMP11 (ou Stromelysine 3) qui appartient à la famille des métalloprotéases [17]. L’expression de cette protéine de remodelage de la MEC par les CAAs favorise la progression tumorale via sa capacité à cliver la MEC (étape importante pour l’invasion), mais aussi certains de ces substrats, les rendant 5 ainsi plus actifs [18]. C’est le cas du COL6 puisqu’il a été montré que le COL6 est un substrat de la MMP11 [18]. La dernière caractéristique des CAAs, et qui pourrait être la plus originale, est la perte des AG contenus dans les gouttelettes lipidiques, perte que nous avons observé in vitro et in vivo (Dirat et al, 2011 ; voir figure 2). Nous avons récemment montré au laboratoire que ces AGs libérés par les adipocytes sont transférés dans les cellules tumorales (Wang et al, résultats non publiés). Ce même dialogue métabolique a été montré dans le cancer de la prostate [19] et dans le cancer de l’ovaire disséminé [20]. Les cellules de cancer de l’ovaire disséminent fréquemment au niveau de l’omentum, région péritonéale riche en adipocytes. Sous l’effet d’un processus de lipolyse, les adipocytes se délipident, et les tumeurs ovariennes se chargent ainsi en lipides relargués qu’elles accumulent sous forme de gouttelettes [20]. Ce transfert de lipides est important pour la croissance de la tumeur dans l’omentum [2]. Ces AGs pourraient être utilisés comme constituants des membranes plasmiques, comme molécules de signalisation mais aussi comme source d’énergie pour les tumeurs. En effet, un ensemble de travaux récents montrent que les tumeurs, outre le glucose, pourraient utiliser les AGs comme substrat énergétique au travers de la β−oxydation des lipides qui a lieu dans la mitochondrie [21]. Ces résultats suggèrent qu’il pourrait exister une véritable symbiose métabolique entre les adipocytes (« donneurs d’énergie ») et les cellules tumorales (« receveuses »). S’ils étaient confirmés, l’interaction délétère entre adipocytes et cancer pourrait être efficacement interrompue via l’inhibition du transfert de lipides mais surtout via l’inhibition de la β-oxydation des lipides, des molécules comme l’etomoxir étant déjà connues pour exercer cet effet [21]. Le dialogue paracrine entre adipocytes et cancer fait aussi intervenir d’autres adipokines importantes telles que la leptine et l’adiponectine qui n’ont pas été abordées dans cette revue mais que le lecteur pourra retrouver dans les revues suivantes [22] ; [23] ; [24]. L’ensemble de ces résultats montre donc qu’il existe un dialogue permanent entre adipocytes et cancer du sein favorisant la prolifération tumorale, la survie et surtout l’invasion locale et à distance [3] ; [4]. L’interaction entre cellules tumorales mammaires et TA ne se limite pas aux adipocytes matures puisque des travaux récents montrent que les précurseurs adipocytaires sont eux aussi capables de participer activement à l’environnement de la tumeur, soit en générant des cellules proches des CAFs qui vont faire partie de la réaction desmoplasique, soit en 6 favorisant l’angiogenèse tumorale (pour une revue détaillée, le lecteur est invité à se référer à [4]). Finalement, les CAAs sont également impliqués dans des processus de radio- et chimiorésistance. En effet, nous avons montré grâce au système de coculture précédemment décrit que les cellules tumorales mammaires cocultivées avec des adipocytes présentaient une radiorésistance associée à une diminution de la mort post-mitotique [25]. Cet effet semble dépendant de l’IL6 sécrétée par les cellules tumorales, sécrétion autocrine qui est stimulée par la présence d’adipocytes. De la même façon, il a été montré que des facteurs solubles d’origine adipocytaire protègent des cellules de leucémie aiguë lymphoblastique (LAL) de l’effet cytotoxique de la vincristine [26]. Cette protection vis-à-vis des médicaments antitumoraux a été retrouvée pour d’autres types de molécules (dexamethasone, daunorubicine et nilotinib), ce qui suggère l’émergence d’un phénotype de résistance pléiotropique (ou « multidrug résistance ») qui pourrait dépendre, dans le cadre des LAL, d’une diminution de la mort par apoptose [26]. Enfin, l’inhibition de l’endotrophine, le produit de clivage du COL6 sensibilise les tumeurs au cisplatine [27]. L’ensemble des modifications résultant de l’interaction entre cellules tumorales et adipocytes est résumé dans la figure 2. Du fait de la composition de la glande mammaire, la plupart des travaux concernant l’interaction entre TA et cancer ont été consacrés aux cancers du sein. Il n’en demeure pas moins que la plupart des cancers invasifs va se retrouver à un moment donné de l’histoire de la maladie à proximité du TA. C’est le cas du cancer de la prostate invasif qui va envahir la graisse périprostatique, du cancer du côlon qui va se retrouver au contact de la graisse périviscérale, du cancer de l’ovaire qui dissémine au niveau de l’omentum ou du mélanome qui va rejoindre les couches profondes du derme. Dans toutes ces situations, une délipidation et une dédifférentiation partielle des adipocytes est observée ([28] et résultats de notre équipe non publiés). Certaines modifications plus spécifiques identifiées dans le cancer du sein sont retrouvées dans d’autres types de cancer comme par exemple l’augmentation de l’IL6 dans la graisse périprostatique [29]. Le dialogue métabolique apparaît quant à lui assez ubiquitaire [28]. Cette « proximité dangereuse » débouchant sur un dialogue délétère pourrait donc permettre d’aboutir à des concepts plus généraux en cancérologie et surtout au développement de stratégies thérapeutiques d’application élargie. 7 Le dialogue local entre adipocytes et cancer explique-t-il les liens délétères entre obésité et cancer ? Il existe donc un lien maintenant établi entre l’obésité et le pronostic du cancer du sein, ce lien semblant aussi exister pour d’autres cancers tels que le cancer de la prostate ou du colon [2]. Comme montré précédemment, l’ensemble de nos résultats ainsi que ceux de nos collègues supportent le concept innovant selon lequel les adipocytes participent à un cercle vicieux, initié par les cellules cancéreuses et favorable à la progression tumorale [3] ; [4] ; [24]. Notre hypothèse est que les adipocytes présents à proximité des tumeurs seraient, chez l’obèse, encore plus enclins à stimuler la dissémination locale et à distance ce qui pourrait expliquer le pronostic défavorable observé chez ces patients [7]. Chez le sujet obèse, le nombre (hyperplasie), la taille (hypertrophie) ainsi que le profil de sécrétion des adipocytes est altéré [24]. Il est maintenant clairement établi que le TA viscéral (TAV), c’est à dire présent dans les couches profondes de l’abdomen, des sujets obèses présente un état d’inflammation dit de « bas bruit » participant aux nombreux effets délétères métaboliques et cardiovasculaires de l’obésité [30] ; [31]. Cet état inflammatoire est marqué par une augmentation de la sécrétion de cytokines pro-inflammatoires (dont l’IL6), et par une infiltration de macrophages entourant le plus souvent des adipocytes nécrotiques, structure en couronne encore appelée « Crownlike structures » ou CLS [12]. Enfin, dans le TAV de sujets obèses, l’expression des composants de la MEC est modulée (afin de s’adapter à l’expansion hypertrophique des adipocytes) pouvant créer un état local profibrotique. Si l’on résume, on trouve donc dans le TAV d’un individu obèse, indépendamment de tout cancer, des modifications qui sont présentes dans les CAAs telles que l’inflammation, la fibrose et une augmentation de la libération d’AGs (figure 3). Ainsi ce terrain pourrait être tout à fait favorable à un dialogue amplifié avec la cellule tumorale. Il est important ici de souligner que l’ensemble de ces modifications a été décrit pour le TAV. De façon très intéressante deux études récentes montrent que le tissu adipeux mammaire chez l’obèse présente des similitudes par rapport au TAV. Une hypertrophie adipocytaire, proportionnelle à l’IMC, est également observée dans le TA mammaire, ainsi qu’un état inflammatoire, caractérisé par la présence de CLS et l’augmentation de l’expression des cytokines proinflammatoires [32] [33]. Ces résultats sont donc tout à fait en faveur de l’hypothèse proposée dans le cancer du sein qui reste notre modèle de 8 prédilection. Les modèles animaux offrent une opportunité intéressante de valider cette hypothèse. Ainsi, l’équipe de Stephen Hursting a récemment montré que l’implantation orthotopique dans la glande mammaire de lignées triple négatives (M-Wnt) dans des souris rendues obèses par un régime hyperlipidique, entraine une augmentation de la croissance tumorale, par comparaison à un groupe témoin. A l’inverse, des souris soumises à une restriction calorique présentent une diminution significative de la taille tumorale, comparée au même groupe témoin [34]. De la même manière, l’équipe de L. Miele a montré que la progression tumorale mammaire était également augmentée dans des souris obèses transplantées avec une lignée ER+, E0071, ce qui était associé à une augmentation de l’angiogenèse tumorale consécutive à une sécrétion accrue de VEGF [35]. Les mécanismes moléculaires impliqués dans ces effets restent encore à caractériser de façon fine à la fois dans des tumeurs humaines, dans des modèles murins et dans des modèles de coculture utilisant du TA isolé à partir de sujets obèses et normopondéraux. Enfin, si dans la progression tumorale nous pensons que la tumeur est probablement plus encline à utiliser le TA à proximité (effet paracrine), l’importance des mécanismes endocrines ne doit pas être négligée en particulier dans les étapes initiales de la carcinogenèse. L’obésité et les modifications métaboliques qui y sont associées pourraient favoriser la carcinogenèse via l’insulino-résistance, les modifications des taux d’adipokines circulantes (excès de sécrétion de leptine et de cytokines pro-inflammatoires, défaut de sécrétion d’adiponectine). L’augmentation de la production d’œstrogènes pour les cancers gynécologiques est aussi à prendre en compte, le TA étant pourvu d’une activité d’aromatisation des androgènes en œstrogènes, aspect important surtout en période post-ménopausique. Le lecteur intéressé par les facteurs endocrines pouvant contribuer à la carcinogenèse pourra lire les revues suivantes [24] ; [23] ; [36]. Risque oncologique de l’utilisation de tissu adipeux en chirurgie reconstructrice ? Le rôle des adipocytes dans la progression tumorale, notamment dans le cancer du sein peut également avoir un impact dans l’utilisation de l’injection de TA autologue dans des processus de chirurgie réparatrice après une mastectomie partielle ou totale. Cette technique, appelée lipotransfert ou lipofilling permet de « combler » les défauts, notamment d’irrégularité et le manque de volume ou, plus rarement, de reconstruire entièrement un sein. La simplicité, les résultats esthétiques et plastiques 9 de cette méthode suscitent un intérêt croissant [37]. Cette technique, développée par Sydney R. Coleman et connue sous le nom de « technique de Coleman » consiste à prélever du TA sous-cutané, classiquement au niveau de l’abdomen ou des cuisses et à le réinjecter dans le parenchyme mammaire, de la même patiente après une courte centrifugation, afin d’éventuellement éliminer l’huile, l’excès de fluides et les contaminants [37] [38]. Ainsi, la préparation administrée contient de nombreux types cellulaires présents dans le tissu adipeux comme des adipocytes et des précurseurs adipocytaires susceptibles de favoriser la progression tumorale [39]. En outre, on sait que la chirurgie, la chimiothérapie et la radiothérapie ne sont pas toujours suffisantes pour éradiquer toutes les cellules tumorales lors du traitement et de nombreuses études ont montré la présence de cellules quiescentes, « en dormance », cellules potentiellement très sensibles aux changements de leur microenvironnement [40]. Ainsi le risque carcinologique de cette technique doit être évalué, d’autant plus qu’un article récent montre chez la souris que le matériel utilisé pour le lipofilling pouvait, après tumorectomie, favoriser l’apparition de métastases secondaires [41]. Dans cette étude, les auteurs attribuent le risque carcinologique à une sous-population de cellules souches capables de favoriser la vascularisation tumorale. Une étude clinique rétrospective avec un groupe témoin a été publiée récemment par l’Institut Européen du Cancer de Milan. Cette étude ne montre pas de différence significative du taux de rechutes entre les deux groupes, toutefois une augmentation des rechutes chez les patientes ayant un cancer in situ a été noté dans le groupe ayant reçu un lipofilling [42]. Une autre étude rétrospective avec groupe témoin a été réalisée très récemment par la même équipe, centrée uniquement sur les patientes présentant des lésions intra-épithéliales, étude qui confirme les résultats précédents [43]. Si aucune conclusion définitive ne peut être tirée de ces premiers travaux (car elles concernent un faible nombre de patientes), des études supplémentaires sur des échantillons plus importants doivent être impérativement réalisées afin de confirmer ou d’infirmer les risques de cette technique sur les possibilités de récidives locales des cancers du sein in situ traités par tumorectomie. Enfin, les améliorations constantes de cette technique avec notamment l’apport de cellules souches adipocytaires nécessitent aussi des investigations cliniques spécifiques si l’on s’en réfère à la potentielle dangerosité des cellules souches révélée par les études effectuées chez la souris [41] [39] [44]. 10 Conclusion De nombreux arguments soulignent maintenant le rôle du tissu adipeux dans le cancer, notamment le cancer du sein. Ce tissu complexe, majoritairement composé d’adipocytes, peut être modifié dans des contextes pathologiques en particulier l’obésité. L’ensemble de nos résultats montre le dialogue bidirectionnel néfaste qui s’instaure entre les cellules tumorales mammaires et les adipocytes présents à proximité des tumeurs, influençant notamment leur capacité métastatique [14]. Ces adipocytes « activés » par les cellules tumorales ou CAAs présentent des modifications importantes, comme une délipidation, l’acquisition d’un phénotype inflammatoire et profibrotique [14] [20]. Comprendre et cibler les acteurs impliqués dans le dialogue entre cellules tumorales et adipocytes permettraient d’apporter un bénéfice thérapeutique important pour les patients atteints de cancer en particulier dans un contexte d’obésité. Remerciements Les travaux effectués dans nos équipes sont soutenues par l’Institut National du Cancer (INCA PL 2006–035 et INCA PL 2010-214 GE, PV et CM), La Ligue contre le Cancer Midi-Pyrénées (Comité du Lot, de la HauteGaronne et du Gers, CM), la Fondation de France (PV et CM), l’Association pour la Recherche sur les Tumeurs Prostatiques ARTP (CM) and l’Université de Toulouse (Appel d’offre du conseil scientifique 2009, CM). Références 1. 2. 3. 4. 5. 6. 7. 8. Calle, E.E. and R. Kaaks, Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms. Nat Rev Cancer, 2004. 4(8): p. 579-91. Parekh, N., U. Chandran, and E.V. Bandera, Obesity in cancer survival. Annu Rev Nutr, 2012. 32: p. 311-42. Dirat, B., et al., Unraveling the obesity and breast cancer links: a role for cancer-associated adipocytes? Endocr Dev, 2010. 19: p. 45-52. Wang, Y.Y., et al., Adipose tissue and breast epithelial cells: a dangerous dynamic duo in breast cancer. Cancer Lett, 2012. 324(2): p. 142-51. Griggs, J.J. and M.S. Sabel, Obesity and cancer treatment: weighing the evidence. J Clin Oncol, 2008. 26(25): p. 4060-2. Ewertz, M., et al., Effect of obesity on prognosis after early-stage breast cancer. J Clin Oncol, 2011. 29(1): p. 25-31. Sinicrope, F.A. and A.J. Dannenberg, Obesity and breast cancer prognosis: weight of the evidence. J Clin Oncol, 2011. 29(1): p. 4-7. Hanahan, D. and R.A. Weinberg, Hallmarks of cancer: the next generation. Cell, 2011. 144(5): p. 646-74. 11 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. Allen, M. and J. Louise Jones, Jekyll and Hyde: the role of the microenvironment on the progression of cancer. J Pathol, 2011. 223(2): p. 162-76. Polanska, U.M. and A. Orimo, Carcinoma-associated fibroblasts: Non-neoplastic tumourpromoting mesenchymal cells. J Cell Physiol, 2013. Ruffell, B., N.I. Affara, and L.M. Coussens, Differential macrophage programming in the tumor microenvironment. Trends Immunol, 2012. 33(3): p. 119-26. Ouchi, N., et al., Adipokines in inflammation and metabolic disease. Nat Rev Immunol, 2011. 11(2): p. 85-97. Lafontan, M. and D. Langin, Lipolysis and lipid mobilization in human adipose tissue. Prog Lipid Res, 2009. 48(5): p. 275-97. Dirat, B., et al., Cancer-associated adipocytes exhibit an activated phenotype and contribute to breast cancer invasion. Cancer Res, 2011. 71(7): p. 2455-65. Iyengar, P., et al., Adipocyte-derived collagen VI affects early mammary tumor progression in vivo, demonstrating a critical interaction in the tumor/stroma microenvironment. J Clin Invest, 2005. 115(5): p. 1163-76. Park, J. and P.E. Scherer, Adipocyte-derived endotrophin promotes malignant tumor progression. J Clin Invest, 2012. 122(11): p. 4243-56. Andarawewa, K.L., et al., Stromelysin-3 is a potent negative regulator of adipogenesis participating to cancer cell-adipocyte interaction/crosstalk at the tumor invasive front. Cancer Res, 2005. 65(23): p. 10862-71. Motrescu, E.R., et al., Matrix metalloproteinase-11/stromelysin-3 exhibits collagenolytic function against collagen VI under normal and malignant conditions. Oncogene, 2008. 27(49): p. 6347-55. Gazi, E., et al., Direct evidence of lipid translocation between adipocytes and prostate cancer cells with imaging FTIR microspectroscopy. J Lipid Res, 2007. 48(8): p. 1846-56. Nieman, K.M., et al., Adipocytes promote ovarian cancer metastasis and provide energy for rapid tumor growth. Nat Med, 2011. 17(11): p. 1498-503. Carracedo, A., L.C. Cantley, and P.P. Pandolfi, Cancer metabolism: fatty acid oxidation in the limelight. Nat Rev Cancer, 2013. 13(4): p. 227-32. Vansaun, M.N., Molecular pathways: adiponectin and leptin signaling in cancer. Clin Cancer Res, 2013. 19(8): p. 1926-32. Grossmann, M.E. and M.P. Cleary, The balance between leptin and adiponectin in the control of carcinogenesis - focus on mammary tumorigenesis. Biochimie, 2012. 94(10): p. 2164-71. Park, J., D.M. Euhus, and P.E. Scherer, Paracrine and endocrine effects of adipose tissue on cancer development and progression. Endocr Rev, 2011. 32(4): p. 550-70. Bochet, L., et al., Cancer-associated adipocytes promotes breast tumor radioresistance. Biochem Biophys Res Commun, 2011. 411(1): p. 102-6. Behan, J.W., et al., Adipocytes impair leukemia treatment in mice. Cancer Res, 2009. 69(19): p. 7867-74. Park, J., T.S. Morley, and P.E. Scherer, Inhibition of endotrophin, a cleavage product of collagen VI, confers cisplatin sensitivity to tumours. EMBO Mol Med, 2013. Nieman, K.M., et al., Adipose tissue and adipocytes support tumorigenesis and metastasis. Biochim Biophys Acta, 2013. Finley, D.S., et al., Periprostatic adipose tissue as a modulator of prostate cancer aggressiveness. J Urol, 2009. 182(4): p. 1621-7. Despres, J.P. and I. Lemieux, Abdominal obesity and metabolic syndrome. Nature, 2006. 444(7121): p. 881-7. Hotamisligil, G.S., Inflammation and metabolic disorders. Nature, 2006. 444(7121): p. 860-7. Morris, P.G., et al., Inflammation and increased aromatase expression occur in the breast tissue of obese women with breast cancer. Cancer Prev Res (Phila), 2011. 4(7): p. 1021-9. Sun, X., et al., Normal breast tissue of obese women is enriched for macrophage markers and macrophage-associated gene expression. Breast Cancer Res Treat, 2012. 131(3): p. 1003-12. Dunlap, S.M., et al., Dietary energy balance modulates epithelial-to-mesenchymal transition and tumor progression in murine claudin-low and basal-like mammary tumor models. Cancer Prev Res (Phila), 2012. 5(7): p. 930-42. 12 35. Gu, J.W., et al., Postmenopausal obesity promotes tumor angiogenesis and breast cancer progression in mice. Cancer Biol Ther, 2011. 11(10): p. 910-7. 36. Brown, K.A. and E.R. Simpson, Obesity and breast cancer: mechanisms and therapeutic implications. Front Biosci (Elite Ed), 2012. 4: p. 2515-24. 37. Bertolini, F., et al., Adipose tissue cells, lipotransfer and cancer: a challenge for scientists, oncologists and surgeons. Biochim Biophys Acta, 2012. 1826(1): p. 209-14. 38. Coleman, S.R., Structural fat grafts: the ideal filler? Clin Plast Surg, 2001. 28(1): p. 111-9. 39. Wang, Y.Y., et al., Oncological risk after autologous lipoaspirate grafting in breast cancer patients: from the bench to the clinic and back. J Craniofac Surg, 2013. 24(3): p. 700-2. 40. Houvenaeghel, G., et al., [Micrometastasis: biological entity and clinical impact?]. Bull Cancer, 2013. 100(4): p. 351-6. 41. Martin-Padura, I., et al., The white adipose tissue used in lipotransfer procedures is a rich reservoir of CD34+ progenitors able to promote cancer progression. Cancer Res, 2012. 72(1): p. 325-34. 42. Petit, J.Y., et al., Locoregional recurrence risk after lipofilling in breast cancer patients. Ann Oncol, 2012. 23(3): p. 582-8. 43. Petit, J.Y., et al., Evaluation of fat grafting safety in patients with intra epithelial neoplasia: a matched-cohort study. Ann Oncol, 2013. 24(6): p. 1479-84. 44. Bertolini, F., Contribution of endothelial precursors of adipose tissue to breast cancer: Progression-link with fat graft for reconstructive surgery. Ann Endocrinol (Paris), 2013. 74(2): p. 106-7. Légendes des figures Figure 1. La proximité entre tissu adipeux et cellules tumorales est retrouvée dans les cancers du sein invasif. Coupe histologique de cancer mammaire après coloration à l’Hématoxyline-Eosine. Le tissu adipeux est noté TA, la tumeur T. Les flèches indiquent des zones représentatives ou les cellules tumorales sont au contact du tissu adipeux. 13 Figure 2. Le dialogue entre les adipocytes et les cellules tumorales induisent des modifications phénotypiques caractéristiques dans les deux populations. A, Le dialogue entre adipocytes et cellules cancéreuses est étudié à l’aide d’un système de coculture en 2D ou les deux populations sont séparées par un insert permettant le passage des facteurs solubles entre les deux compartiments. Le phénotype des cellules tumorales et des adipocytes cocultivés est comparé respectivement à des cellules tumorales ou à des adipocytes cultivés seuls. B, Après coculture, les cellules tumorales présentent des caractéristiques différentes dont une augmentation de l’invasion. Cette augmentation de l’invasion est illustrée in vitro par un marquage de l’actine par une sonde fluorescente en rouge (panneau du haut). Les cellules cancéreuses non cocultivées (NC) montrent une organisation en îlot qui rappelle l’acinus mammaire alors que les cellules cocultivées (C) se séparent, s’étalent sur le support et montrent des extensions membranaires, modifications caractéristiques d’un phénotype invasif. In vivo (panneau du bas), les poumons des souris injectées par voie veineuse avec des cellules cancéreuses cocultivées (C) présentent des métastases (flèches blanches) dont le nombre et la taille sont fortement augmentés comparées aux cellules contrôles non cocultivées (NC). C, Les adipocytes cultivés in vitro (panneau du haut) sont marqués à l’huile rouge (marquage des lipides neutres) et observés au microscope. Les adipocytes cocultivés (C) présentent une diminution franche du nombre et de la taille des goutelettes lipidiques par rapport au contrôle non cocultivé (NC).Coupes histologiques de tissu adipeux à distance (TAD) ou péritumoral (TAP) de carcinome mammaire. Le phénotype « CAA »observé in vitro est retrouvé au front invasif dans ces tumeurs humaines. NC : non cocultivés, C : cocultivés, TAD : tissu adipeux à distance de la tumeur, TAP: tissu adipeux péritumoral. 14 Figure 3 : Dialogue adipocyte/cancer dans un contexte d’obésité. L’hyperplasie et l’hypertrophie des adipocytes rencontrées dans le tissu adipeux (TA) des sujets obèses ont pour conséquences la modification des sécrétions adipocytaires, l’apparition d’une fibrose et un état sub-inflammatoire. Ces modifications pourraient exacerber le dialogue entre ces deux composants, expliquant le pronostic défavorable observé pour les patients obèses. L’intensité de la coloration rouge représente le degré d’agressivité des tumeurs 15 AUTEUR: Yuan-Yuan WANG TITRE: Deciphering the crosstalk between breast cancer cells and tumour-surrounding adipocytes: contribution of cell metabolic symbiosis DIRECTEURS DE THESE: Pr Catherine MULLER et Pr Philippe VALET LIEU ET DATE DE SOUTENANCE: Amphithéâtre Fernand Gallais, Laboratoire de Chimie et de Coordination (LCC), 205 route de Narbonne, 31077 TOULOUSE RESUME: Relativement peu d'attention a été accordée aux adipocytes matures qui représentent le type cellulaire majoritaire entourant le cancer du sein. Le rôle des adipocytes dans la progression tumorale est devenu d’une importance clinique majeure depuis qu’il a été montré que l’obésité est un facteur indépendant de mauvais pronostic dans le cancer du sein. Au cours de ma thèse, j'ai participé aux efforts de mon équipe visant à caractériser les changements phénotypiques induits par les cellules tumorales dans les adipocytes environnants la tumeur. Nous avons ainsi défini deux nouvelles populations de cellules stromales dérivées des adipocytes, les Cancer-Associated Adipocytes (CAAs) (présents au front invasif de la tumeur) et les Adipose-Derived Fibroblasts (ADFs) (retrouvés au centre de la tumeur) qui stimulent l'invasion tumorale localement et à distance de la tumeur. Durant ma thèse, j'ai montré qu’une symbiose métabolique s`établit entre les cellules cancéreuses et les CAAs. Les acides gras libres dérivés des adipocytes (AGLs), captés et stockés par les cellules cancéreuses mammaires, sont utilisés pour la β-oxydation de lipids. Les cellules tumorales doivent posséder une voie lipolytique couplée pour utiliser les stockés à la fois in vitro et dans des tumeurs humaines. Nos résultats mettent en évidence le rôle important et plutôt inattendu de la β-oxydation dans l'invasion des cellules tumorales in vitro et in vivo. Dans l'ensemble, mon travail montre le rôle clé des adipocytes environnants dans l’augmentation de l'agressivité du cancer du sein et les mécanismes moléculaires impliqués. ABSTRACT: Relatively little attention has been given to mature adipocytes which are the most abundant cell type surrounding breast cancer. Role of adipocytes in tumor progression might be of major clinical importance since obesity has been shown to be a poor independent prognosis factor for breast cancer. During my Ph.D., I participated to the efforts of my team to characterize the phenotypical changes induced by tumor cells in surrounding adipocytes. We defined two new stromal cell population derived from adipocytes, Cancer-Associated Adipocytes (CAAs) (present at tumor invasive front) and Adipose-Derived Fibroblast (ADFs) (found in the tumor centre) that stimulate tumor local and distant invasion. During my thesis, I have shown that a metabolic symbiosis is established between cancer cells and CAAs. The adipocytes-derived free fatty acids (FFAs) are uptaken and stored by breast cancer cells to be used for fatty acid β-oxidation (FAO). Tumor cells need to possess a coupled lipolytic pathway to use the stored FFAs as depicted herein both in vitro and in human tumors. Our results highlight the important and rather unexpected role of FAO in tumor cell invasion in vitro and in vivo. Taken together, my work show the key role of surrounding adipocytes in increasing the aggressiveness of breast cancer and the molecular mechanisms involved. MOTS-CLES: Obesite, Adipocytes, Cancer du sein, Microenvironment, β-oxydation, invasion DISCIPLINES: Cancérologie LABORATOIRE: Institut de Pharmacologie et de Biologie Structurale (IPBS)-CNRS-UMR 5089 205 route de Narbonne, 20177 TOULOUSE Cedex 126
![Poster LIBER san antonio 2011 [Mode de compatibilité]](http://s1.studylibfr.com/store/data/000441925_1-0f624c1012097e18f69fca01a2951eb6-300x300.png)
