La structure des acides nucléiques
Biologie 11ième Chapitre 6.1 p.186
Biologie 12ième Chapitre 7.1 et 7.2 p.216 (revue de la 11ième)
1
La structure de l’ADN
2
Les chromosomes, les gènes et le code
génétique


Les chromosomes sont faits d’ADN, Acide Désoxyribonucléique et de
protéines
Dans les 46 chromosomes d’une cellule il y a deux mètres d’ADN
 0.34 nm entre les bases azotées
 3.4 nm pour dix bases azotées, un tour complet qui forme un
grand sillon et un petit sillon.
Combien y a-t-il de cellules dans ton corps?
Quel est la longueur total de l’ADN dans ton corps?

L’ADN (l’ordre des bases azotées) contient le code de fabrication des
protéines. Voir le tableau des codons.

Les gènes sur les chromosomes transmettent les caractéristiques d’une
génération à la suivante. (ex yeux bleus)

Il existe toujours deux versions de gènes, un sur chacun des
chromosomes homologues. Ex : les ailes apterous chez la drosophile se
retrouve chez le chromosome #__ version A et Version B.
3
Tableau des codons
Est un tableau pour la conversion du code de l’ARN en acide aminé lors
de la Synthèse des Protéine
4
Tableau des codons : Travail pratique.
Problème
Un brin d’ARNm contient la séquence de nucléotides suivante : Quel est la
séquence des acides aminés ?
GCUACGGAGCUUCGGAGCUAG
Problème
Un brin d’ARNm contient la séquence de nucléotides suivante :
AUGCCCACUACAUAG. Pour quelle séquence d’acides aminés cet ARNm
code-t-il ?
Problème
Un brin d’ARNm contient la séquence de nucléotides suivante. Pour quelle
séquence d’acides aminés cet ARNm code-t-il ?
Séquence d’ARNm : AUA AAG AGG UAC GGC GAG UAA GCG CGU GCU
Problème
Un brin d’ADN contient la séquence de nucléotides suivante :
TACTGCCTCCCCATAAGAATT.
5
6
Historique de l’ADN

1865, le moine autrichien Grégoir Mendel publie ses résultats de
génétique sur l’hérédité des pois dans la revue célèbre « Natural Science
Society » . Ses découverte sur la transmission de l’information héréditaire
n’ont pas obtenu une grande reconnaissance à cette époque.

1869, Friedrich Miescher isole des acides nucléiques (ADN) de
leucocytes (globules blancs)

En 1929, Phoebus Levene à l'Institut Rockefeller a identifié les éléments
qui composent une molécule d'ADN. Ces composants sont :
Les quatre bases
o
o
o
o
Adénine (A)
Cytosine (C)
Guanine (G)
Thymine (T)
Sucre et Phosphate Voir la figure 6.5 Biologie 11 p.188 (il définit
aussi l’ARN)

1944, l’équipe d’Oswald Avery, Colin MacLoed et Maclyn McCarty ont
publié des résultats d’expériences effectuées sur des bactéries qui
prouvaient que l’ADN était le matériel génétique.

1948 Erwin Chargaff a découvert que dans une molécule d’ADN donnée,
les quantités d’adénine et de thymine étaient égales. Il a définit la loi de
Chargaff : Adénine se lie toujours avec la Thymine ainsi que la guanine
avec la Cytosine.

1952 les américains Alfred Hershey et Martha Chase ont réalisé une
expérience sur des bactériophages qui a permis de confirmer que c’était
l’ADN et non les protéines dans les chromosomes, qui transportait
l’information génétique.

1950 Rosalind Franklin (Britannique) et Maurice Wilkins ont essayé de
faire un cristal de la molécule d'ADN. Ils voulaient prendre des photos de
cristallographie par rayons X de l'ADN pour comprendre le fonctionne de
l'ADN. Ces deux scientifiques ont réussi et obtenu un modèle de rayons x.
Le patron semblait contenir des barreaux, comme ceux sur une échelle
entre les brins qui sont côte à côte. Ils ont constaté que l'ADN avait une
forme d'hélice. (Voir figure 6.8, Biologie
11, p.189)

En 1953, à l’Université de Cambridge
en Angleterre, James Watson et
Francis Crick ont publié dans la revue « Nature » un article de deux
pages qui démontre la structure de la double hélice
d’ADN que l’on connait aujourd’hui. Ils ont également
trouvé que pourraient se former dans une liaison
hydrogène entre les deux paires de bases. En outre,
chaque côté est un complément complet de l'autre. (voir
figure 6.9, Biologie 11. P.189) Ils reçoivent le prix nobel
en 1962

Profilage de l'ADN a été développé quelques années plus tard en 1984
par le généticien anglais Alec Jeffreys de l'Université de Leicester et fut
d'abord utilisé pour condamner Colin Pitchfork en 1988 dans le cas de
meurtres d'Enderby à Leicestershire, en Angleterre. Ainsi commença le
voyage de recherche de l'ADN.
le profil génétique obtenu à partir de la molécule d'ADN. Le premier profil génétique est
observée en 1985 par un généticien Britannique, professeur à l'université de Leicester,
Alec Jeffreys. Celui-ci observe, un peu par hasard, que des séquences répétitives sont
présentes dans la molécule d'ADN dans les zones non codantes. Il découvre aussi que
le nombre de ces répétitions varie en fonction des individus. Le professeur comprend
rapidement les possibilités offertes en criminalistique. Il développe alors une technique
permettant de déterminer le nombre de séquences répétitives et apporte ainsi la
possibilité de réaliser des tests d'identification. La méthode utilisée est la RFLP
(Restriction Fragment Length Polymorphism). Cette méthode permet de découper des
fragments d'ADN qui ont des séquences répétitives. La taille des fragments découpés est
variable en fonction du nombre de répétitions et donc des individus.
L'observation de ces fragments à l'aide d'une sonde donne un aspect de code barre (voir ci
dessus). Cette méthode est utilisée entre 1986 et 1990, puis abandonnée et remplacée par
d'autres méthodes plus efficaces.
7

Une technique d'amplification de l'ADN est découverte par Kary Mullis en 1985
(technique PCR) ce qui rend possible, en théorie, de travailler sur une seule cellule. La
découverte et la compréhension de l'ADN mitochondrial vont rendre possible des
analyses sur des échantillons vieux et très dégradés. En pratique judiciaire, l'ADN
mitochondrial est régulièrement utilisé à partir des années 1995-1996.

1986 Projet du génome humain
Depuis 1986, un nouveau projet a été lancé, celui d'identifier le génome
humain, c'est-à-dire d'identifier le rôle de tous les gènes qui composent
l'ADN de l'être humain.

En France, le Fichier National Automatisé des Empreintes Génétiques
(FNAEG) est créé par la loi du 17 juin 1998. Les évolutions législatives
vont permettre d'étendre considérablement le champ d'application de ce
fichier et d'enregistrer les profils génétiques des personnes condamnées
mais aussi des personnes mises en cause pour quasiment tous les
crimes et délits d'atteintes aux biens et aux personnes. Une Unité
Automatisé de Génotypage (UAG) des
plus performantes voit le jour à Ecully en
2006. Ces nombreuses avancées
scientifiques, techniques et législatives
donnent la possibilité à cette unité
d'enregistrer 125000 profils génétiques par
an.
Source :
Biologie 11, Biologie 12,
http://www.news-medical.net/health/History-of-DNA-Research-(French).aspx
http://www.cvm.qc.ca/encephi/Syllabus/Histoire/Passecompose/DecouverteADN.htm
http://www.police-scientifique.com/historique/naissance-de-la-genetique
http://tpe-police-scientifique-mdc.e-monsite.com/pages/i-l-adn/histoire-de-l-adn.html
8
Choisissez la bonne réponse pour chaque question suivante liée à l'histoire de l'ADN.
1. La structure Double Hélice de l'ADN a été décrite pour la première fois par:
• Watson et King
• Oswald Avery
• Peter Mitchell
• James Watson, Francis Crick et Maurice Wilkins
Réponse:
2. Le scientifique qui a démontré pour la première fois que le matériel génétique est un
produit chimique stable à la chaleur est :
• Erwin Chargaff
• Franklin Griffith
• Friedrich Miescher
• Oswald Avery
Réponse:
3. Le scientifique qui a identifié l'agent transformant comme l'ADN dans la célèbre
expérience de Griffith (1928) est :
• Erwin Chargaff
• Friedrich Miescher
• Oswald Avery
• Peter Mitchell
Réponse:
4. Le scientifique qui a rapporté que la composition de l'ADN et espèce spécifique est :
• Sidney Brenner
• Erwin Chargaff
• Herbert Boyer
• Hamilton Smith
Réponse:
5. Le preuve du modèle de réplication de l'ADN proposé par Watson et Crick venaient
des expériences de:
• Stanley Cohen et Herbert Boyer
• Sidney Brenner et Francis Crick
• M. S. Meselson et F. W. Stahl
• George Beadle et Edward Tatum
Réponse:
9
6. Les scientifiques qui ont développé une technique de séquencer l'ADN et, plus tard, a
gagné un Prix Nobel pour leur réussité en 1980, sont :
• Arnold Levine et Gerald Edelman
• Harold Varmus et Rodney Porter
• Watson et King
• Walter Gilbert et Frederick Sanger
Réponse:
7. Le scientifique qui a créé les premières molécules d'ADN recombinants est:
• Howard Temin
• James Shapiero
• Paul Berg
• Ian Wilmut
Réponse:
8. Le premier organisme d'avoir été cloné à partir de cellules adultes est:
• Une Vache
• Grenouilles léopards de nord
• Dolly, la brebis
• Têtards
Réponse:
9. L'une des surprises découvertes par le projet Génome humain a été d'un petit nombre
étonnamment de gènes que les humains possèdent. Ce nombre est d'environ:
• 35000
• 10000
• 80000
• 60000
Réponse:
10. Robert Holley, Har Gobind Khorana et Marshall Nirenberg ont partagé le Prix Nobel
de médecine en 1968 pour leur contribution à la recherche sur l'ADN , qui était :
• l'élucidation de la synthèse des protéines.
• la découverte de la structure de l'ADN.
• la découverte d'opéron lactose.
• la découverte de la présence de l'ADN qui ne pouvait pas être exprimée.
Réponse:
http://fr.syvum.com/cgi/online/serve.cgi/quizz/biologie/a
dn/BioOne.html?question_hide pour les réponses
10
1. Le scientifique qui a rapporté que la composition de l'ADN et espèce spécifique
est :
3
Herbert Boyer
Sidney Brenner
Erwin Chargaff
Hamilton Smith
2,1,4,3
2. Le preuve du modèle de réplication de l'ADN proposé par Watson et Crick
venaient des expériences de:
4
M. S. Meselson et F. W. Stahl
Sidney Brenner et Francis Crick
Stanley Cohen et Herbert Boyer
George Beadle et Edward Tatum
0
3. Le scientifique qui a identifié l'agent transformant comme l'ADN dans la célèbre
expérience de Griffith (1928) est :
2
Peter Mitchell
Friedrich Miescher
Oswald Avery
Erwin Chargaff
0
http://fr.syvum.com/cgi/online/mult.cgi/quizz/biologie/adn/BioOne.tdf?0
11
4. La structure Double Hélice de l'ADN a été décrite pour la première fois par:
0
Peter Mitchell
Watson et King
James Watson, Francis Crick et Maurice Wilkins
Oswald Avery
0
5. Robert Holley, Har Gobind Khorana et Marshall Nirenberg ont partagé le Prix
Nobel de médecine en 1968 pour leur contribution à la recherche sur l'ADN ,
qui était :
9
la découverte d'opéron lactose.
l'élucidation de la synthèse des protéines.
la découverte de la présence de l'ADN qui ne pouvait pas être exprimée.
la découverte de la structure de l'ADN.
6. Les scientifiques qui ont développé une technique de séquencer l'ADN et, plus
tard, a gagné un Prix Nobel pour leur réussité en 1980, sont :
5
Arnold Levine et Gerald Edelman
Harold Varmus et Rodney Porter
Walter Gilbert et Frederick Sanger
Watson et King
7. Le premier organisme d'avoir été cloné à partir de cellules adultes est:
7
Dolly, la brebis
Têtards
12
Grenouilles léopards de nord
Une Vache
Biologie 12 p. 226
Propriétés de l’ADN
1) Directionnalité : chaque brin d’ADN possède une orientation
spécifique basé sur la position du lien entre le sucre et le
phosphate. L’ADN possède une extrémité 5’ et une extrémité
(bas) 3’.
2) Complémentaire : Suivre la loi de Chargaff . A avec T et C
avec G.
3) Antiparallèles : L’extrémité 5’ d’un brin est attaché à
l’extrémité 3’ de l’autre brin.
13
Vidéo Youtube
L'ADN : la science en bandes dessinées
Origine du code génétique - La fin des croyances créationnistes (soustitré)
14
Téléchargement

7.1 L`isolement du matériel héréditaire